|
Originally published In Press as doi:10.1074/jbc.M210292200 on December 23, 2002
J. Biol. Chem., Vol. 278, Issue 10, 8786-8794, March 7, 2003
The -Helical D1 Domain of the Tobacco bZIP
Transcription Factor BZI-1 Interacts with the Ankyrin-repeat Protein
ANK1 and Is Important for BZI-1 Function, Both in Auxin Signaling and
Pathogen Response*
Markus
Kuhlmann,
Katja
Horvay,
Anne
Strathmann,
Thorsten
Heinekamp,
Ute
Fischer,
Stefan
Böttner, and
Wolfgang
Dröge-Laser
From the Albrecht-von-Haller Institut, Universität
Göttingen, Untere Karspüle 2, D-37073 Göttingen, Germany
Received for publication, October 8, 2002, and in revised form, December 20, 2002
 |
ABSTRACT |
The tobacco (Nicotiana tabacum) bZIP
transcription factor BZI-1 is involved in auxin-mediated growth
responses and in establishing pathogen defenses. Transgenic plants
expressing a dominant-negative BZI-1- N derivative, which lacks the
N-terminal activation domain, showed altered vegetative growth. In
particular auxin-induced rooting and formation of tobacco mosaic
virus-induced hypersensitive response lesions are affected.
BZI-1-related proteins described in various plant species share the
conserved domains D1, D2, BD, and D4. To define those BZI-1 domains
involved in transcription factor function, BZI-1 deletion derivatives
were expressed in transgenic plants. The domains D1 or BD are crucial
for BZI-1- N function in planta. The basic BD domain is
mediating DNA binding of BZI-1. Yeast two-hybrid and in
vitro binding studies reveal the ankyrin-repeat protein ANK1,
which specifically interacts with a part of the BZI-1 protein (amino
acids 73-222) encoding the D1 domain. ANK1 does not bind DNA or
act as a co-activator of BZI-1-mediated transcription. Moreover, green
fluorescence protein localization studies propose that ANK1 is acting
mainly inside the cytosol. Transcription analysis reveals that
ANK1 is ubiquitously expressed, but after pathogen attack
transcription is transiently down-regulated. Along these lines,
ANK1 homologous proteins in Arabidopsis thaliana have been
reported to function in pathogen defense. We therefore propose that the
D1 domain serves as an interaction surface for ANK1, which appears to
regulate BZI-1 function in auxin signaling as well as pathogen response.
 |
INTRODUCTION |
The tobacco bZIP protein BZI-1 displays all the characteristic
features of a transcription factor. It binds DNA, in particular ACGT containing cis-elements
(ACEs),1 it is localized
inside the nucleus, and its N-terminal domain acts as a
trans-activation domain in plant cells (1). Like CPRF2, a highly
homologous bZIP protein from parsley, BZI-1 has been isolated by virtue
of its in vitro binding to chalcone synthase promoter
cis-elements (1-4). However, using various transgenic approaches that modulate the amount or the activation potential of
BZI-1, we were not able to show any influence on transcription of
phenylpropanoid pathway genes, such as chalcone synthase or phenylalanine ammonia lyase in vivo (1).
Functional analysis has been performed in transgenic plants expressing
a dominant-negative BZI-1 derivative lacking the N-terminal activation
domain (BZI-1- N). These plants display reduced internodes, small
curly leaves, enhanced lateral shoot formation, and flowers that are
reduced in size. In particular auxin responses appeared to be reduced
with respect to auxin-induced rooting and regulation of a
GH3 target gene. Moreover, BZI-1
transcription is up-regulated in response to pathogen attack and
pathogen-induced phosphorylation of BZI-1-related proteins has been
described (1, 3, 4).
BZI-1-related transcription factors have been isolated from various
plant species, e.g. CPRF2, (2), OHP1/2 (5), BLZ1 (6), or
bZIP63 (7). Apart from the N-terminal activation domain, BZI-1-related
transcription factors share several highly conserved domains (1). Since
transcription factors show a modular architecture, it seems likely that
these conserved domains mediate specific functions. The D1 domain
displays a -helical structure, frequently localized in
protein-protein interaction surfaces. The D2 domain harbors many acidic
residues, as it has been described for activation domains (8).
Analyzing the parsley bZIP factor CPRF2, a phytochrome-mediated nuclear
import was described. Making use of a CPRF2-GFP fusion, sequences
related to the D1 and D2 domains have been postulated to act as
cytosolic retention domains (9). The basic domain (BD) of other bZIP
factors was shown to mediate DNA binding and nuclear localization (10).
The ZIP domain of BZI-1 facilitates specific homo- or
heterodimerization (3). Finally, a phosphorylation site has been mapped
in the C terminus of the BZI-1-related transcription factor CPRF2
(11).
In this work, transgenic plants expressing deletion derivatives of
BZI-1 have been used to define protein domains essential for BZI-1
function in planta. The basic BD domain establishes DNA
binding and is involved in nuclear translocation of BZI-1. The D1
domain appears to be crucial for BZI-1 function in the context of auxin
signaling or pathogen defense response. Frequently, protein-protein
interactions play an important role in signaling processes (12). To
isolate proteins specifically interacting with the -helical D1
domain, a yeast two-hybrid screen has been performed. The interaction
partner, an ankyrin-repeat protein referred to as ANK1, is unable to
bind DNA or to modulate transcription as a co-factor. Moreover, the
GFP-ANK1 fusion protein is localized inside the cytosol.
ANK1 transcription is transiently down-regulated after
pathogen attack, and TMV-induced HR formation is affected in BZI-1- N
plants. We therefore propose that protein interaction between ANK1 and
BZI-1, mediated by the D1 domain, is involved in auxin and/or pathogen
defense signaling.
 |
EXPERIMENTAL PROCEDURES |
Plant Cultivation and Pathogen Infection--
Tobacco plants
(Nicotiana tabacum cv. Xanthi NN) were
grown in a growth chamber under a 16-h light/8-h dark cycle at 22 °C and 85% humidity. For TMV infection, fully expanded leaves of 6- to
8-week-old tobacco plants, which were grown in soil, were inoculated
with TMV strain U1 (1 µg per leaf) in 50 mM potassium phosphate buffer, pH 7.0, or "mock" inoculated with buffer by gently rubbing the leaves with carborundum using a method which has
been described previously (15, 16). Organogenesis was carried out by
cultivating tobacco explants on solid Murashige and Skoog medium
(17) supplemented with 0.2 mg liter 1 naphthalene acetic
acid and 1 mg liter 1 6-BAP.
Standard Molecular Biological Techniques--
Standard DNA
techniques have been described in Ref. 18. DNA sequence analysis was
performed using an ABI310 sequencer, utilizing an ABI PRISM BigDye
Terminator Cycle Sequencing Reaction Kit.
Vector Construction--
A HA-tagged BZI-1 fusion gene
(HA-BZI-1- N) was obtained by inserting
synthetic oligonucleotides (pHA1,
CCGGGTACAATGACGTACCCTTACGACGTACCTGACTACGCGACG; pHA2,
CCGTCGCGTAGTCAGGTACGTCGTAAGGGACCGTCATTGTCCCCGGGTAC) into the
KpnI and AspI restriction sites at the 5' end of
the BZI-1- N coding sequence. The plasmid
obtained was named pUCA7Tx-HA-BZI-1- N. The deletion BZI-1- N D2
was generated by digesting pUCA7Tx-HA-BZI-1- N with XbaI
and BamHI. Insertion of the oligonucleotides Ol35
(CTAGCAAGCTTCAAGGCATG) and Ol36 (GATCCATGCCTTGAAGCTTG)
rebuilt the BZI-1 reading frame (BZI-1- N D2). The BZI-1- N D1
derivative was obtained from the plasmid pET28-BZI-1- N (3). Deletion
of an internal DraI fragment followed by religation resulted
in pET28-BZI-1- N D1. The
BZI-1- N D1 and
BZI-1- N D2 fusion genes have been
used to construct yeast and plant transformation vectors.
To obtain a plasmid for in vitro transcription/translation,
pGEM-ANK1 was constructed. The ANK1 gene was PCR-amplified
using the primer mk2 (CCATGGACCTGCAGAACAACACATCTTTCTC) and mk3
(AGATCTGAATTCATGTCTGAGGGAGAGAAA). The PCR fragment was inserted into
the vector pGEM-T (Promega, Madison, WI)
Plant Transformation--
The plant transformation vectors
pBIN-BZI-1-Oex and pBIN-BZI-1- N have been described previously (1).
Binary vectors encoding the HA-tagged BZI-1 derivatives have been
constructed. pBIN-HA-BZI-1- N, pBIN-HA-BZI-1- N D1, and
pBIN-HA-BZI-1- N D2 were obtained by inserting the
KpnI/SalI fragment from
pET28a-HA-BZI-1- N D1, pUCA7Tx-HA-BZI-1- N, or
pUCA7Tx-HA-BZI-1- N D2 into the plant transformation vector pBINHygTx (19). Tobacco transformation was described in Ref. 1.
Yeast Two-hybrid Techniques--
The commercial "MATCHMAKER"
yeast two-hybrid system (Clontech, Palo Alto, CA)
was used. Handling of yeast cultures and library screening,
construction of a tobacco SR1 cDNA library and quantitative -galactosidase assays were performed in accordance to Ref.3. -Galactosidase units were given as a mean value of three independent measurements. As a positive control, the interaction between BD-p53 and
AD-SV40 large T-antigen was used (Clontech
MATCHMAKER system). Yeast two-hybrid vectors are based on pGBT9
and pGAD424 coding for GAL4 DNA BD or activation domain (AD),
respectively. The construction of the plasmid pGBT-HA-BZI-1- N,
encoding a BD-HA-BZI-1- N fusion protein, has been described recently
(3). To obtain pGBT-HA-BZI-1- N D1 and pGBT-HA-BZI-1- N D2, an
AspI/SalI fragment from pE28-BZI-1- N D1 or a
SmaI/SalI fragment from
pUCA7Tx-HA-BZI-1- N D2 was inserted into the vector pGBT9. The
plasmid pGBT-ANK1 was obtained by insertion of an
EcoRI/PstI ANK1 fragment from
pGBT-ANK1 into GBT9.
Transient Expression in Tobacco Protoplasts--
After
HindIII/PstI digestion of pGBT-BZI-1 and
pGBT-BZI-1- N, the GALBD-BZI-1 and the
GALBD-BZI-1- N fusion genes were inserted into
pKS-Bluescript. To obtain pGALBD-BZI-1 and pGALBD-BZI-1- N, Acc65I fragments encoding GALBD-BZI-1 or GALBD-BZI-1- N
were inserted in the Acc65I-digested pHBT-BZI-1 or
pHBT-BZI-1- N (1), respectively. As controls the vectors
pHBTL,2 coding for a GFP, and
pRanBP1a-GFP, encoding a RanBP1a-GFP fusion protein, (20) have been
used. The ANK1 gene was obtained as a NcoI
fragment and inserted into pHBTL to result in an pHBTL-ANK1-GFP, encoding an ANK1-GFP fusion gene driven by a modified
35S promoter. To obtain the BZI-1 deletion derivatives,
pHBTL-BZI-1- N D1-GFP, pHBTL-BZI-1- N D2-GFP, and
pHBTL-BZI-1- N BD-GFP the KpnI-NheI fragments
encoding the corresponding deletion derivatives were introduced into
pHBTL-BZI-1- N-GFP. Tobacco leaf mesophyll protoplasts were isolated
and transformed by electroporation (21). After 20 h of incubation
in the dark, GUS assays were carried out according to Ref. 1).
GFP localization studies have been performed using a confocal
microscope (LSM-510, Zeiss).
Electrophoretic Mobility Shift Assay (EMSA)--
Preparation of
recombinant HIS-BZI-1- N protein has been previously described (3)
using pET28-BZI-1- N. The pET28-BZI-1- N D1 derivative was
obtained from the plasmid pET28-BZI-1- N by deleting an internal
DraI fragment, followed by religation. pET28-BZI-1- N BD was obtained by insertion of a KpnI-SalI fragment
encoding BZI-1- N BD into pET28-BZI-1- N. ANK1 protein was
obtained by in vitro transcription/translation applying
pGEM-ANK1 in a reticulocyte system (Promega). EMSA has been performed
as described previously (1). The following oligonucleotides were used
for the binding reactions:
AATTCGA- GAACTTTTGCTGACGTGGCCACACATCTGGACCCA.
Western and Northern Blot--
Yeast protein was isolated (3),
run on an SDS-PAGE (18), and transferred to a polyvinylidene difluoride
membrane (Millipore, Braunschweig, Germany) following the procedure
described previously (22). For immunodetection, a HA-specific antibody
(Santa Cruz Biotechnology, Santa Cruz, CA) and the ECL system (Amersham
Biosciences) were applied. Preparation of plant protein extracts
used for Western analysis and isolation of BZI-1-specific antibodies
( -BZI-1) were performed according to Ref. 1. Northern blot method
was performed using a BZI-1-specific
XhoI/PstI restriction fragment (1).
 |
RESULTS |
The Protein Domains N, BD, and D1 Are Important for BZI-1
Transcription Factor Function in Planta--
Conserved protein domains
have been defined in BZI-1-related proteins by means of amino acid (aa)
homology (1). To analyze a putative role of these domains in BZI-1
function, BZI-1 deletion derivates were expressed in transgenic plants
(Fig. 1, A and B). Whereas BZI-1-overexpressing tobacco plants (BZI-1-Oex) do not display
any visible alterations, expression of a dominant-negative BZI-1- N
derivative, which lacks the N-terminal activation domain, resulted in
plants showing a complex phenotype characterized by reduced internodes,
increased development of lateral shoots, and size-reduced curly leaves
(Fig. 1B). Therefore, the N-terminal domain is crucial for
BZI-1 function in planta (1).

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of BZI-1 derivatives in
transgenic tobacco plants. A, schematic drawing showing the
BZI-1 derivatives expressed in transgenic plants (for details see Fig.
4). After deletion of the domains N, D1, D2, or BD, the open reading
frame has been rebuilt by use of synthetic oligonucleotides.
B, phenotype of wild type (WT) in comparison to
the transgenic plants BZI-1-Oex, BZI-1- N, BZI-1- N D1,
BZI-1- N D2, and BZI-1- N BD. C, Northern expression
analysis of the plants depicted in B. Transcripts of the
endogenous BZI-1 and its derivatives are shown.
EtBr, ethidium bromide staining. D, Western
analysis of the transgenic plants expressing the constructs described
in A. E, phenotypic analysis of auxin-induced
rooting. Leaf explants of the plants depicted in B were
cultured on root induction medium supplemented with 0.2 mg
liter 1 naphthalene acetic acid and 1 mg
liter 1 6-BAP. Organogenesis was shown after 3 weeks of
culture. F, TMV infection of wild type tobacco
(Xanthi NN) and transgenic plants, expressing BZI-1
derivatives. Depicted is a phenotypic analysis of the plants described
in Fig. B 2 days after infection with TMV. Formation of HR
lesions is presented at a larger magnification (inset
figures). BZI-1- N and BZI-1- N D2 plants show
expanding lesions that are not limited in size. All experiments have
been performed at least in triplicate.
|
|
Phenotypic alterations imply that these plants might be affected in
hormone signaling. Using leaf explants derived from BZI-1- N plant in
an organogenesis assay, cytokinin-induced shooting was unchanged (data
not shown), but auxin-induced rooting appeared to be significantly
reduced (Fig. 1E). Furthermore, BZI-1 has been implicated to
function in the context of pathogen defense (1, 4). Hence, the
transgenic plants were infected with TMV (Fig. 1F). Whereas
viral spread was limited in wild type plants as monitored by reference
to localized HR lesion formation, BZI-1- N plants showed a spreading
of the HR lesions, which resulted in a breakdown of the whole leaf tissue.
These phenotypic alterations have been used to map BZI-1 protein
domains. BZI-1- N derivatives were expressed in transgenic tobacco,
displaying additional deletions of the conserved domains. In all assay
systems described above, deletion of the D2 domain did not alter the
BZI-1- N phenotype, implying that this domain might be not important
for BZI-1- N function. In contrast, deletion of D1 resulted in wild
type plants, abolishing the function of the overexpressed BZI-1- N protein.
Deletion of protein domains might alter expression, protein stability,
nuclear localization, or DNA binding properties of BZI-1. We therefore
performed a number of controls to molecularly characterize the
transgenic plants. Expression of the constructs was examined by
Northern (Fig. 1C) and Western analysis (Fig. 1D). All transgenic plants used for further studies showed
significant protein levels of the BZI-1 derivatives. Using recombinant
proteins, BZI-1- N and BZI-1- N D1 were found to bind ACEs in
EMSA (Fig. 2). Hence, these factors still
can function as DNA-binding proteins. In contrast, the deletion of the
DNA binding domain in BZI-1- N BD abolishes DNA binding (Fig. 2),
implying that this protein is inactive in controlling specific promoter
targets. Using transiently transformed protoplasts, BZI-1-GFP fusion
protein was detected predominantly in the nucleus (1). Like BZI-1-GFP,
the BZI-1- N-GFP, BZI-1- N D1-GFP, or BZI-1- N D2-GFP fusion
proteins were found in the nucleus. Compared with BZI-1-GFP, the
nuclear localization of these proteins appeared to be slightly enhanced
(Fig. 3, d-f), whereas
BZI-1- N BD-GFP was enriched in the cytosol (Fig. 3g) Nevertheless, complete nuclear exclusion, as it was found for a
cytosolic protein (RanBP1a-GFP) (19), could not be observed for
BZI-1- N BD-GFP.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
In vitro DNA binding of BZI-1
derivatives. A, recombinant His-tagged protein
preparations were confirmed by Western analysis using -BZI-1
antibodies. B, using radiolabeled ACE-cis
elements, recombinant His-tagged HIS-BZI-1- N, HIS-BZI-1- N D1,
and HIS-BZI-1- N BD protein were analyzed by EMSA. No DNA binding
was observed for HIS-BZI-1- N BD. , no protein added.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Cytosolic localization
studies of BZI-1-GFP fusion proteins. C-terminal GFP fusions of
the BZI-1 derivatives described in Fig. 1A were transiently
expressed tobacco leaf protoplasts. White field images
(left) and detection of GFP fluorescence (505-550 nm)
(right) are shown 20 h after transfection. As a
control, GFP localized in the cytosol and the nucleus (a)
and cytosolic RanBP1a-GFP (19) (b) are shown. The
BZI-derivatives are: BZI-1-GFP (c), BZI-1- N-GFP
(d), BZI-1- N D1-GFP (e), BZI-1- N D2-GFP
(f), and BZI-1- N BD-GFP (g). The nucleus is
marked by an arrow.
|
|
Like BZI-1- N, BZI-1- N D1 protein is stable in
planta, binds DNA, and is localized in the nucleus. However, since
BZI-1- N D1 plants appeared like wild type, the presence of the D1
domain seems important for establishing the BZI-1- N phenotype.
The BD domain is important for DNA-binding and is involved in nuclear
localization. However, its deletion does not completely abolish
function of the overexpressed BZI-1 derivative. Although the vegetative
part of BZI-1- N BD transgenic plants appears like wild type (Fig.
1B), it has to be noted that slight alterations, e.g. in flower size (data not shown), occur. Auxin-induced
rooting shows an intermediate phenotype that varies during repetitions of assay. However, TMV infection results in wild type lesion formation (data not shown). In conclusion, the influence of BZI-1 N BD on BZI-1 related transcription appears to be complex.
Isolation of the Ankyrin-repeat Protein ANK1 That Interacts with
the D1 Domain of BZI-1--
Since the D1 domain shows an -helical
structure frequently found in protein interaction domains, a yeast
two-hybrid screen was performed to identify BZI-1 interaction partners.
As a bait, an internal fragment encoding the domains D1 and D2 (aa
73-244) was fused with the GAL4 DNA binding domain (GALBD) (3) (Fig. 4A). Expression of the bait
construct in yeast was monitored by means of Western analysis (Fig.
4B). Screening of 107 clones resulted in the
isolation of a cDNA encoding a 37-kDa protein, referred to
as N. tabacum ANK1 (Fig.
5A). In silico
analysis revealed that the C-terminal part of ANK1 harbors four ankyrin repeats, protein domains typically involved in protein-protein interaction (for a review see Ref. 25). Compared with the ankyrin repeat consensus sequence, the repeats 2 and 3 were well conserved, whereas repeats 1 and 4 displayed some alterations. An almost identical
gene sequence has been isolated from N. tabacum
cv. SNN (HBP1, GenBankTM accession
number AAL25088), but functional data have not yet been
published. The homologous proteins AKR2 (MIPS At4g35450) (13) and
AtPhos43 (MIPS At2g17390) (14) have been described in Arabidopsis
thaliana (Fig. 5A). Apart from the N-terminal 50 aa,
which are less conserved, these proteins share a high aa identity of
66%. The N-terminal 50 aa are rich in proline, aspartic acid, serine,
and threonine, as has been described for the PEST domains (23).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
Isolation of N.
tabacum ANK1 by means of a yeast two-hybrid
screen. A, schematic drawing of the BZI-1-derived bait
(HA-BZI-1-(73-244)) used in a yeast two-hybrid screen. The
corresponding part of the BZI-1 aa sequence (1) showing the conserved
domains D1 and D2 (boxed sequence) is illustrated. The aa
deleted in the bait proteins BD-HA-BZI-1- N D1 or
BD-HA-BZI-1- N D2 are indicated. To verify expression in yeast, a
HA epitope tag (black bar) was included in the bait
construct located in between BD and BZI-1. BD,
GAL4 DNA binding domain. B, Western blot showing the
BD-HA-BZI-1-(73-244) bait protein detected by means of a HA
epitope-specific antibody. Yeast cells harboring the plasmids pGBT9 and
pGBT-BZI-1-(73-244) are analyzed, respectively. C, oNPG
assay measuring BZI-1 ANK1 interaction by means of a lacZ
reporter. Co-transformants carrying BZI-1-derived bait vectors and a
pGAD-ANK1 prey vector were analyzed. As controls, autoactivation of
pGBT-derivatives was measured. The mean values of three independent
measurements are given, and the experiment was repeated three times. As
a positive control, the interaction between BD-p53 and AD-SV40 large
T-antigen was used (Clontech MATCHMAKER
system).
|
|

View larger version (105K):
[in this window]
[in a new window]
|
Fig. 5.
The ANK1 protein from N. tabacum. A, alignment of N. tabacum ANK1 with A. thaliana AKR2 (13) and A. thaliana Phos43, (14) homologous proteins identified in A. thaliana. 100% identity is shown by a black background
label; identities higher than 50% are printed in gray.
The ankyrin repeats (R1-R4) are underlined.
B, alignment of the 33-aa ANK1 ankyrin repeats in comparison
with the ankyrin consensus (25).
|
|
ANK1 has been found reproducibly in the yeast two-hybrid
screen (19 independent clones). The interactions have been monitored by
adenine prototrophic growth of the yeast strains (data not shown) and
quantitative -galactosidase enzyme activity assay (oNPG-Assay) (Fig.
4C). To map the ANK1 interaction domain, BZI derivatives
were constructed, deleting parts of the domains D1 or D2, respectively
(for details see Fig. 4A). Since the N-terminal 73 aa lead
to auto-activation, the deletions were constructed based on the
BZI-1- N bait. However, the deletion in D1 only results in a 50%
decrease in ANK1-BZI-1 interaction. Hence, D1 is involved in the
interaction with BZI-1, but the deleted aa 101-152 are not sufficient.
Therefore, we assume that the neighboring aa participate in ANK1
binding. In contrast, deleting the central part of D2 shows that this
domain is not participating in ANK1-BZI-1 interactions. Furthermore,
the C-terminal part of the BZI-1 protein did not show any interaction
with ANK1. In summary, we conclude that the region between aa 73 and
222 acts as an interaction surface, which is sufficient for
BZI-1-ANK1 interaction.
ANK1 Does Not Bind DNA, but Depending on the D1 Domain, ANK1
Inhibits DNA Binding of BZI-1 in Vitro--
In EMSA, BZI-1- N
homodimers were found to bind ACEs, but ANK1 does not bind ACE-related
DNA sequences (Fig. 6). Interaction between BZI-1 and ANK1 in yeast was confirmed in the in
vitro assay. ANK1 inhibits binding of recombinant BZI-1- N
protein, whereas BZI-1- N D1 protein co-incubated with ANK1 binds
DNA. As has been found in yeast, deletion of the D1 domain does not completely abolish BZI-1-ANK1 interaction. In agreement with the in vivo data obtained for yeast and in planta,
in vitro protein interaction shows that the -helical
surface (aa 101-152) deleted in BZI-1- N D1 participates in ANK1
interaction but is itself not sufficient.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 6.
In vitro interaction of ANK1 and
BZI-1- N. ANK1 obtained by in vitro
transcription/translation (lane 3) does not bind ACEs
in vitro, whereas recombinant HIS-BZI-1- N protein binds
DNA (lane 4). Increasing the amount of ANK1 inhibits DNA
binding of BZI-1- N protein (lanes 5 and 6).
Recombinant BZI-1- N D1, which lacks a part of the D1 domain (see
Fig. 4A) binds DNA (lane 7). This binding is
poorly inhibited by the addition of ANK1 protein (lanes 8 and 9). The overall amount of reticulocyte lysate
(RL) is identical in all lanes. In comparison to lanes
5 and 8, the binding reactions in lanes 6 and 9 contain twice the amount of ANK1 protein.
|
|
ANK1 Does Not Act as a Co-factor of BZI-1-mediated
Transcription--
Since ANK1 interacts with a transcription factor it
might regulate transcription indirectly by acting as a co-factor. In
yeast, expression of a GALBD fusion with ANK1 leads to significant
activation of the GAL-UAS-lacZ
reporter (Fig. 7A). Hence, by
interacting with BZI-1, ANK1 might function as a co-factor modulating
BZI-1-mediated transcriptional control. Expression of a GALBD-BZI-1
protein in tobacco protoplasts resulted in a significant activation of
a 4xGAL-UAS-GUS reporter (Fig. 7B). The
level of activation was comparable to that of the strong activator
GALBD-VP16. However, co-expression of GALBD-BZI-1 and ANK1 did not
enhance transcription of the reporter, as it can be assumed from a
co-activator. In contrast, a slight reduction of transcription has been
observed, which is not significant. To verify that ANK1 expression has
no indirect effects on cell viability, co-transfection with a
functional unrelated GALBD-VP16 protein has been performed. In this
control, ANK expression did not interfere with normal cell
activities.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Transcriptional activation properties of ANK1
analyzed in yeast and in planta. A, a GALBD-ANK1
fusion protein was expressed in yeast, and activation of a
GAL-UAS-lacZ reporter gene was analyzed by
quantitative -galactosidase measurements. +, positive control of the
yeast two-hybrid system (Clontech). B,
GALBD-BZI-1 fusion protein activates expression of a
4xGAL-UAS-GUS reporter in transiently
transformed tobacco protoplasts. The effect of ANK1 on reporter gene
activity was analyzed by co-expression of ANK1. Specificity
of the influence of ANK1 was analyzed by using an artificial GALBD-VP16
activator, which does not harbor a D1 interaction domain. Given are
mean values of six independent transfections.
|
|
The ANK1 Protein Is Mainly Localized in the Cytosol--
In silico
analysis of BZI-1 did not show any well defined nuclear localization
sequences. An ANK1-GFP fusion gene was transiently expressed
in tobacco protoplasts, and cellular localization was analyzed by
confocal microscopy. Whereas non-fused GFP was found in the nucleus and
in the cytosol (Fig. 3a), ANK1-GFP was mainly localized in
the cytosolic compartment (Fig. 8). As a
control, exclusion outside the nucleus can be seen for RanBP1a-GFP
fusion protein as has been described previously (19) (Fig.
3b). However, this clear exclusion of the nucleus cannot be
seen with ANK1-GFP protein. Hence, ANK1 is mainly localized in the
cytosol, but we cannot rule out that small amounts might be present in
the nucleus.

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 8.
Cellular localization of ANK1-GFP
fusion protein analyzed by confocal microscopy. ANK1-GFP was
transiently expressed in tobacco leaf mesophyll protoplasts. Images
with detection wavelengths at 505-550 nm (a), 560 nm
(b), the white field (c), and merged
images (d) are shown.
|
|
According to the model proposed in Ref. 9, nuclear translocation of the
BZI-1-related transcription factor CPRF2 is regulated by a cytosolic
retention protein. If ANK1 were to act as a cytosolic-retention factor,
co-expression should result in alterations in BZI-1 localization. However, after co-expression of ANK1, we could not detect
any significant changes in cellular localization of the BZI-1- N-GFP fusion protein (data not shown).
ANK1 Transcription Is Transiently Repressed after Pathogen
Attack--
ANK1 has been found to be constitutively expressed in all
plant tissues tested (Fig.
9A). Since BZI-1 is involved
in mediating auxin and pathogen defense responses, we tested whether
ANK1 expression is regulated by these stimuli. Infection
with Pseudomonas syringae (Fig. 9B) results in a
transient decrease in the ANK1 transcript level. Comparable
results were obtained with other elicitors, e.g. cryptogein
(data not shown). The efficiency of infection was controlled by
activation EAS4, a pathogen-inducible gene (24). No effect
on ANK1 transcription was observed after treatment with auxin in response to light/dark rhythms or wounding (data not shown).
Hence, ANK1 transcription specifically responds to the pathogen stimulus.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 9.
Northern blot expression analysis of
ANK1. A, tissue-specific expression of
ANK1 (analyzed tissues are indicated). B,
P. syringae-induced transient decrease in
ANK1 transcription after 9 h. Infection is controlled
by expression of the pathogen-induced EAS4 gene (24). Mock
plants were treated with water. Time points are indicated. The ethidium
bromide stain (EtBr) is given as a loading control. The
experiments have been performed in triplicate.
|
|
 |
DISCUSSION |
In this work we have mapped protein domains conserved among
BZI-1-related bZIP transcription factors with respect to their function
in auxin and pathogen signaling. The BD domain has been shown to be
involved in DNA binding. The -helical D1 domain was found to be
important for BZI-1 function in planta. Most likely D1 acts
as a protein interaction surface for ANK1, a protein characterized by
ankyrin repeats.
The -Helical Domain D1 Is Crucial for BZI-1 Transcription Factor
Function--
In general, transcription factors are characterized by a
modular structure. Functions such as DNA binding, transactivation, nuclear localization, multimerization, or interaction with regulatory partners are mediated by distinct protein domains. Ongoing exchange and
combination of these modules provides a mechanism to establish new
functions within transcription factor families. Several conserved protein domains have been described in BZI-1-related proteins (1, 4),
implying they might be essential for transcription factor function.
Overexpression of BZI-1- N, which lacks the N-terminal activation
domain affect auxin and pathogen signaling. The BZI-1- N protein has
been shown to bind DNA and to be localized to the nucleus as it has
been described for the full-size BZI-1 protein. The bZIP domain of
BZI-1 has been shown to be a specific heterodimerization domain,
interacting with the tobacco bZIP factors BZI-2, BZI-3, and BZI-4,
respectively (3). We therefore propose that BZI-1- N acts as a
dominant-negative factor, binding promoter target sites as
non-activating homo- or heterodimers. Furthermore, by means of binding
with the ankyrin repeat protein ANK1, overexpressed BZI-1- N protein
might titrate ANK1 protein, which in term cannot function in
interaction with endogenous BZI-1 transcription factor. BZI-1- N BD
also should titrate the ANK1-interacting factor; nevertheless the
phenotype is more related to wild type. These data argue against the
titration hypothesis. However, we cannot rule out that the deletion of
the BD domain affects interaction with ANK1 in planta. In
summary, BZI-1- N appears to affect cellular functions by various mechanisms.
Expression of deletion derivatives of the BZI-1- N protein in
transgenic plants provides a valuable tool to identify those domains
essential for BZI-1- N function. Although BZI-1- N BD protein has
been shown to be stable in transgenic plants, the protein is impaired
in DNA binding as confirmed by EMSA analysis. As it has been
demonstrated for other bZIP transcription factors, such as OPAQUE2
(10), the basic domain contains a bipartite nuclear localization
signal. However, in the protoplast system used, BZI-1- N BD
concentration appears to be slightly increased in the cytosol; however,
it is not excluded from the nucleus. The residual nuclear import of
BZI-1- N BD may result from an additional nuclear localization
sequences, miss-localization of overexpressed GFP fusion proteins, or
co-transport with other heterodimerizing bZIPs. In some aspects, the
BZI-1- N BD plants showed an altered phenotype. Since DNA binding,
interaction with ANK1, nuclear import, and most likely
heterodimerization is affected, the BZI-1- N BD protein might
interfere with endogenous BZI-1 function in a more complex manner.
Because of the high amount of acidic aa, the D2 domain has been
suggested to act in transcriptional activation. However, D2 was not
involved in transcriptional activation in yeast. Furthermore, BZI-1- N D2 plants showed the BZI-1- N phenotype, implying that the D2 domain is not important for establishing the BZI-1- N
phenotype in planta. However, we cannot completely rule out
a function of D2 involved in wild type BZI-1 function.
Although the BZI-1- N D1 protein was stable in transgenic plants,
can bind DNA, and is localized in the nucleus, its expression does not
result in the BZI-1- N phenotype. Hence, the D1 domain appears to
play a crucial role in BZI-1 signaling. In consequence, BZI-1- N does
not act by simply blocking promoter target sites; in addition to DNA
binding properties, the D1 domain is necessary for transcription factor function.
In Arabidopsis a genome-wide classification of bZIP
transcription factors led to the identification of the subgroup C,
which harbors BZI-1-related proteins (7). Group C transcription
factors, as well as BZI-1-related bZIPs from other mono- and dicot
plants, harbor D1-related sequences. In contrast, D1 domains are not
encoded in other bZIP subgroups such as group S, which includes
specific BZI-1 interaction partners. We therefore propose that the
domain is important for the function of group C-related bZIP
transcription factors.
ANK1 Defines a Specific Interaction Partner of the BZI-1 Domain
D1--
Using a yeast two-hybrid screen, ANK1 has been isolated as a
BZI-1 interaction partner. This interaction is of functional relevance
because (i) ANK1 has been isolated repeatedly in the screen and (ii) the interaction is specific to a defined part of the
BZI-1 protein. Since no interaction with the closely situated D2 domain
was observed, we can define the ANK1 interaction domain as being from
aa 73 to 222. (iii) The BZI-1 D1 domain shows an -helical
structure, which has been described as mediating protein-protein interactions. (iv) The interaction was verified in an in
vitro system, and (v) the D1 interaction domain was found to be of
functional relevance in planta when deleted in a
BZI-1 derivative.
The ANK1 protein contains four ankyrin repeats of 33 conserved aa. The
ankyrin motif consists of two -helices, surrounded by two -sheets
on both sides. Consequently, the ankyrin repeat forms a surface for
protein-protein interaction (25). The number of ankyrin-repeats varies
between different proteins. Ankyrin-repeat proteins are involved in
various functional aspects; for example, mammalian I B is involved in
nuclear retention of the NF B transcription factor (26) or NPR1 in
Arabidopsis interacts with members of the TGA class of bZIP
transcription factors and in turn regulates the transcription of
PR1 (27, 28). No functional conclusion can be drawn for
proteins harboring this domain. Nevertheless, ankyrin-repeat containing
proteins share typical features of signaling components that have the
potential to form specific protein interactions (12).
ANK1-BZI-1 Protein-Protein Interaction, Implications for Auxin and
Pathogen Signaling--
After TMV infection, initiation of HR lesions
is unchanged in BZI-1- N plants, but a restriction of the lesion size
is impaired. This kind of cell death shows a marked resemblance to the
propagation-class mutant phenotype described, for example, in
Arabidopsis lsd1 mutants (29). LSD1 was found to be a zinc
finger protein, which acts as a negative regulator of cell death (29,
30). Accordingly, after triggering cell death, BZI-1- N plants
probably lack this negative feedback regulation, limiting execution of
the cell death program (31, 32).
The ANK1 homologous genes from Arabidopsis thaliana are
involved in plant pathogen defense reactions. In particular Yan
et al. (13) have isolated AKR2 by using a yeast two-hybrid
screen. AKR2 interacts with a 14-3-3 protein (GF14 ) and ascorbate
peroxidase, which scavenges reactive oxygen species (ROS) as an
antioxidant. AKR2 antisense plants result in the induced formation of
ROS and form spontaneous lesions. ROS are known to be essential
signaling molecules involved in initiation and propagation of HR
lesions (31), and they are postulated to participate in auxin-regulated developmental processes (33, 34). In Arabidopsis, the
dth9 mutant shows increased susceptibility to P. syringae infection as well as auxin insensitivity (35, 36). It is
tempting to speculate, that ROS are involved in cross-talk between
auxin and pathogen defense signaling pathways and that protein
interactions between BZI-1 and ANK1-like proteins are essential in this context.
As it has been described for the NF B/I B system in mammals (26),
Yan et al. (13) suggested that AKR2 might act as a cytosolic retention protein that regulates nuclear trans-location of a presently unidentified transcription factor (13). Like I B, ANK1 or AKR2 harbor
ankyrin repeats and a PEST domain. PEST domains are involved in protein
degradation. After stimulation, rapid phosphorylation of the PEST
domain results in I B ubiquitinilation and thereby targets this
protein for degradation at the proteasome (37). Consequently, the
NFêB transcription factor is no longer retarded in the cytosol
and can regulate its target genes inside the nucleus. The ANK1
homologue AtPhos43 has been isolated by using a proteomic approach, as
a protein which is rapidly phosphorylated in response to flagellin
elicitor treatment (14). The question whether this phosphorylation
triggers degradation of the protein has not yet been studied. We were
able to show that tobacco ANK1 is transcriptionally down-regulated after elicitation. Protein degradation, as well as
transcriptional repression, would result in a transient decrease in
ANK1 protein and might complement each other. Using ANK1-GFP fusion
proteins, we were able to show that ANK1 is mainly localized in the
cytosol. Hence, ANK1 would fulfil the requirements necessary for being
a retention factor regulating nuclear translocation of BZI-1. However,
NF B homologous proteins have not been detected in
Arabidopsis genome projects (38). In this study, we were able to demonstrate that ANK1 specifically interacts with BZI-1, a bZIP
transcription factor involved in auxin signaling and pathogen defense.
Moreover, nuclear uptake of CPRF2, the putative BZI-1 orthologue
isolated from parsley has been found to be regulated depending on
sequences corresponding to the D1 and D2 domains (9). A putative
cytosolic retention factor has been postulated, which regulates this
nuclear import. These data would fit in nicely with the proposed model.
However, using BZI-1-GFP fusion proteins we were not able to confirm
that ANK1 prevents nuclear translocation of BZI-1-GFP or that elicitors
enhances nuclear uptake of BZI-1-GFP. Nevertheless, since highly
overexpressed GFP fusion proteins were used in transfected protoplasts,
this experimental set-up might not be close to the natural situation.
In planta immunolocalization studies might be more suited to
reveal ANK1 function. According to this model, ANK1 is supposed to be a
negative regulator of BZI-1 transcription factor function. After
pathogen attack, ANK1 is inactivated and BZI-1 moves into the nucleus
to regulate yet undescribed genes involved in cell death.
In an alternative model, ANK1 is proposed to be a positive regulator of
BZI-1 function. Hence, BZI-1 target genes are involved in an unknown
mechanism that prevents cell death. After pathogen attack ANK1 function
is transiently reduced, inactivating the negative control of cell
death. Along these lines, BZI-1- N is proposed to titrate ANK1 from
interaction with BZI-1 and thereby enhances spreading of HR lesions.
Identification of BZI-1 target genes, as well as analysis of BZI-1 and
ANK1 RNAi in plants will be valuable tools to further reveal the
mechanism of ANK1 function.
No evidence was found indicating that ANK1 is directly involved in
transcriptional control but most likely functions by forming protein
complexes outside the nucleus, e.g. by regulating storage, nuclear translocation, or modification of BZI-1 transcription factors.
Moreover, pathogen-induced transient decrease of the ANK1 protein level
provides a stimulus-induced mechanism that regulates the BZI-1
transcription factor.
 |
ACKNOWLEDGEMENTS |
We are grateful to C. Thurow and R. Weigel for critically reading the manuscript and to C. Gatz for constant support. Tobacco cDNA libraries and plasmids
have been kindly provided by M. Rieping (University of Bielefeld,
Bielefeld, Germany), J. Chappell (University of Kentucky,
Lexington, KY), I. Lenk (University of Göttingen, Göttingen, Germany), J. Sheen (Harvard Medical School, Boston, MA), and B. Weisshaar (Max-Plank Institute, Köln, Germany).
 |
FOOTNOTES |
*
This research was supported, in part, by a grant of the Fond
der Chemischen Industrie (to A. S.) and Deutsche
Forschungsgemeinschaft Grant DR273/4.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF510035.
To whom correspondence should be addressed. Tel.:
49-0-551-39-19816; Fax: 49-0-551-39-7820; E-mail:
wdroege@gwdg.de.
Published, JBC Papers in Press, December 23, 2002, DOI 10.1074/jbc.M210292200
2
I. Lenk, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
ACEs, ACGT containing cis-elements;
BD, basic domain;
TMV, tobacco mosaic virus;
HR, hypersensitive response;
HA, hemagglutinin;
AD, activation domain;
GFP, green fluorescence
protein;
EMSA, electrophoretic mobility shift assay;
aa, amino acid(s);
ROS, reactive oxygen species.
 |
REFERENCES |
| 1.
|
Heinekamp, T.,
Kuhlmann, M.,
Lenk, A.,
Strathmann, A.,
and Dröge-Laser, W.
(2002)
Mol. Gen. Genom.
267,
16-26[CrossRef]
|
| 2.
|
Weisshaar, B.,
Armstrong, G. A.,
Block, A.,
da Costa e Silva, O.,
and Hahlbrock, K.
(1991)
EMBO J.
10,
1777-1786[Medline]
[Order article via Infotrieve]
|
| 3.
|
Strathmann, A.,
Kuhlmann, M.,
Heinekamp, T.,
and Droge-Laser, W.
(2001)
Plant J.
28,
397-408[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Dröge-Laser, W.,
Kaiser, A.,
Lindsay, W. P.,
Halkier, B. A.,
Loake, G. J.,
Doerner, P.,
Dixon, R. A.,
and Lamb, C.
(1997)
The EMBO J. l
16,
726-738
|
| 5.
|
Pysh, L. D.,
Aukerman, M. J.,
and Schmidt, R. J.
(1993)
Plant Cell
5,
227-236[Abstract]
|
| 6.
|
Vicente-Carbajosa, J.,
Onate, L.,
Lara, P.,
Diaz, I.,
and Carbonero, P.
(1998)
Plant J.
13,
629-640[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Jakoby, M.,
Weisshaar, B.,
Dröge-Laser, W.,
Tiedemann, J.,
Kroij, T.,
and Parcy, F.
(2002)
Trends in Plant Science
7,
106-111[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Theill, L. E.,
Castrillo, J. L.,
Wu, D.,
and Karin, M.
(1989)
Nature
342,
945-948[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Kircher, S.,
Wellmer, F.,
Nick, P.,
Rügner, A.,
Schafer, E.,
and Harter, K.
(1999)
J. Ccell Biol.
144,
201-211
|
| 10.
|
Varagona, M. J.,
and Raikhel, N. V.
(1994)
Plant J.
5,
207-214[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Wellmer, F.,
Kircher, S.,
Rugner, A.,
Frohnmeyer, H.,
Schafer, E.,
and Harter, K.
(1999)
J. Biol. Chem.
274,
29476-29482[Abstract/Free Full Text]
|
| 12.
|
Pawson, T.,
and Scott, J. D.
(1997)
Science
278,
2075-2080[Abstract/Free Full Text]
|
| 13.
|
Yan, J.,
Wang, J.,
and Zhang, H.
(2002)
Plant J.
29,
193-202[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Peck, S. C.,
Nuhse, T. S.,
Hess, D.,
Iglesias, A.,
Meins, F.,
and Boller, T.
(2001)
Plant Cell
13,
1467-1475[Abstract/Free Full Text]
|
| 15.
|
Yalpani, N.,
Altier, D. J.,
Barbour, E.,
Cigan, A. L.,
and Scelonge, C. J.
(2001)
Plant Cell
13,
1401-1410[Abstract/Free Full Text]
|
| 16.
| Malamy, J., Hennig, J., and Klessig, D. F. (1992) Plant
Cell 359-365
|
| 17.
|
Murashige, T.,
and Skoog, F.
(1962)
Physiol. Plant.
15,
473-497[CrossRef]
|
| 18.
| Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989)
Molecular cloning: A Labatory Manual 2nd. Cold Spring
Harbour, NY
|
| 19.
|
Rieping, M.,
Fritz, M.,
Prat, S.,
and Gatz, C.
(1994)
Plant Cell
6,
1087-1098[Abstract]
|
| 20.
|
Haasen, D.,
Kohler, C.,
Neuhaus, G.,
and Merkle, T.
(1999)
Plant J.
20,
695-705[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Crofts, A. J.,
Leborgne-Castel, N.,
Hillmer, S.,
Robinson, D. G.,
Phillipson, B.,
Carlsson, L. E.,
Ashford, D. A.,
and Denecke, J.
(1999)
Plant Cell
11,
2233-2248[Abstract/Free Full Text]
|
| 22.
|
Kyhse-Anderson, J.
(1984)
J. Biochem. Biophys. Meth.
10,
203-209[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Rechsteiner, M.,
and Rogers, S. W.
(1996)
Trends Biochem. Sci.
21,
267-271[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Facchini, P. J.,
and Chappell, J.
(1992)
Proc. Nal. Acad. Sci.
89,
11088-11092[Abstract/Free Full Text]
|
| 25.
|
Sedgwick, S. G.,
and Smerdon, S. J.
(1999)
Trends Biochem. Sci.
24,
311-316[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Baeuerle, P. A.,
and Baltimore, D.
(1996)
Cell
87,
13-20[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Cao, H.,
Glazebrook, J.,
Clarke, J. D.,
Volko, S.,
and Dong, X.
(1997)
Cell
88,
57-63[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Despres, C.,
DeLong, C.,
Glaze, S.,
Liu, E.,
and Fobert, P. R.
(2000)
Plant Cell
12,
279-290[Abstract/Free Full Text]
|
| 29.
|
Dietrich, R. A.,
Richberg, M. H.,
Schmidt, R.,
Dean, C.,
and Dangl, J. L.
(1997)
Cell
88,
685-694[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Kliebenstein, D. J.,
Dietrich, R. A.,
Martin, A. C.,
Last, R. L.,
and Dangl, J. L.
(1999)
Mol. Plant Microbe Int.
12,
1022-1026
|
| 31.
|
Jabs, T.,
Dietrich, R. A.,
and Dangl, J. L.
(1996)
Science
273,
1853-1856[Abstract/Free Full Text]
|
| 32.
|
Richberg, M. H.,
Aviv, D. H.,
and Dangl, J. L.
(1998)
Cur. Opin. Plant Biol.
1,
480-485[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Guan, I. M.,
and Scandalios, J. G.
(2002)
Physiol. Plant.
114,
288-295[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Schopfer, P.,
Liszkay, A.,
Bechtold, M.,
Frahry, G.,
and Wagner, A.
(2002)
Planta
214,
821-828[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Mayda, E.,
Mauch Mani, B.,
and Vera, P.
(2000)
Plant Cell
12,
2119-2128[Abstract/Free Full Text]
|
| 36.
|
Mayda, E.,
Marques, C.,
Conejero, V.,
and Vera, P.
(2000)
Mol. Plant Microbe Int.
13,
23-31
|
| 37.
|
Verma, I. M.,
and Stevenson, J.
(1997)
Proc. Natl. Acad. Sci.
94,
11758-11760[Free Full Text]
|
| 38.
|
Riechmann, J. L.,
Heard, J.,
Martin, G.,
Reuber, L.,
Jiang, C.,
Keddie, J.,
Adam, L.,
Pineda, O.,
Ratcliffe, O. J.,
Samaha, R. R.,
Creelman, R.,
Pilgrim, M.,
Broun, P.,
Zhang, J. Z.,
Ghandehari, D.,
Sherman, B. K.,
and Yu, G.
(2000)
Science
290,
2105-2110[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. S. Gesteira, F. Micheli, N. Carels, A. C. Da Silva, K. P. Gramacho, I. Schuster, J. N. Macedo, G. A. G. Pereira, and J. C. M. Cascardo
Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa
Ann. Bot.,
July 1, 2007;
100(1):
129 - 140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Chen, Q. Li, L. Sun, and Z. He
The Rice 14-3-3 Gene Family and its Involvement in Responses to Biotic and Abiotic Stress
DNA Res,
January 1, 2006;
13(2):
53 - 63.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Despres, C. Chubak, A. Rochon, R. Clark, T. Bethune, D. Desveaux, and P. R. Fobert
The Arabidopsis NPR1 Disease Resistance Protein Is a Novel Cofactor That Confers Redox Regulation of DNA Binding Activity to the Basic Domain/Leucine Zipper Transcription Factor TGA1
PLANT CELL,
September 1, 2003;
15(9):
2181 - 2191.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|