JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M212923200 on January 8, 2003

J. Biol. Chem., Vol. 278, Issue 11, 9013-9018, March 14, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/11/9013    most recent
M212923200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schreiber, S. N.
Right arrow Articles by Kralli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schreiber, S. N.
Right arrow Articles by Kralli, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Transcriptional Coactivator PGC-1 Regulates the Expression and Activity of the Orphan Nuclear Receptor Estrogen-Related Receptor alpha  (ERRalpha )*

Sylvia N. SchreiberDagger, Darko KnuttiDagger, Kathrin Brogli, Thomas Uhlmann, and Anastasia Kralli§

From the Division of Biochemistry, Biozentrum of the University of Basel, Klingelbergstrasse 70, CH 4056 Basel, Switzerland

Received for publication, December 18, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The estrogen-related receptor alpha  (ERRalpha ) is one of the first orphan nuclear receptors identified. Still, we know little about the mechanisms that regulate its expression and its activity. In this study, we show that the transcriptional coactivator PGC-1, which is implicated in the control of energy metabolism, regulates ERRalpha at two levels. First, PGC-1 induces the expression of ERRalpha . Consistent with this induction, levels of ERRalpha mRNA in vivo are highest in PGC-1 expressing tissues, such as heart, kidney, and muscle, and up-regulated in response to signals that induce PGC-1, such as exposure to cold. Second, PGC-1 interacts physically with ERRalpha and enables it to activate transcription. Strikingly, we find that PGC-1 converts ERRalpha from a factor with little or no transcriptional activity to a potent regulator of gene expression, suggesting that ERRalpha is not a constitutively active nuclear receptor but rather one that is regulated by protein ligands, such as PGC-1. Our findings suggest that the two proteins act in a common pathway to regulate processes relating to energy metabolism. In support of this hypothesis, adenovirus-mediated delivery of small interfering RNA for ERRalpha , or of PGC-1 mutants that interact selectively with different types of nuclear receptors, shows that PGC-1 can induce the fatty acid oxidation enzyme MCAD (medium-chain acyl-coenzyme A dehydrogenase) in an ERRalpha -dependent manner.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The nuclear receptor ERRalpha 1 was identified in 1988 as a protein that shares significant sequence similarity to known steroid receptors, such as the estrogen receptor (1). ERRalpha and its relatives ERRbeta and ERRgamma form a small family of orphan nuclear receptors that are evolutionarily related to the estrogen receptors ERalpha and ERbeta , and whose in vivo function is still unclear (Refs. 1 and 2 and reviewed in Ref. 3). The three ERRs recognize and bind similar DNA sequences, which include estrogen response elements (EREs) recognized by ERs, as well as extended ERE half-sites that have been termed ERR response elements (4-7). Despite their high similarity to ligand-dependent receptors, ERRs seem to regulate transcription in the absence of known natural lipophilic agonist ligands. Searches for ligands have so far identified only synthetic antagonists. 4-Hydroxytamoxifen, which binds ERRbeta and ERRgamma but not ERRalpha , and diethylstilbestrol, which binds all three ERRs, inhibit the ability of ERRs to activate transcription (8, 9). In support of the pharmacological data, elucidation of the crystal structure of the ERRgamma LBD suggests that the ERRs assume the conformation of ligand-activated nuclear receptors in the absence of ligand (10) and that agonist ligands may not be required. These findings raise the question of how the activity of these nuclear receptors is regulated.

One way to control orphan receptor activity is to express the receptors in a temporally and spatially restricted manner. ERRalpha is expressed widely; however, particularly high ERRalpha mRNA levels have been noted at sites of ossification during development, and in heart, kidney, brown fat, and muscle in adults (Refs. 5 and 11-16 and reviewed in Ref. 17). Thus, differential expression of ERRalpha may contribute to the regulation of ERRalpha -mediated transcription. The mechanisms and signals that regulate ERRalpha expression are not clear.

The activity of orphan nuclear receptors may also be regulated at the protein level via interactions with specific cofactors. ERRalpha has been reported variably as an activator, a repressor, or a DNA-binding factor with little activity, suggesting that cellular factors determine the ability of the ERRalpha protein to activate transcription (4-6, 11, 16, 18-21). Possible candidates for exerting such control are coactivators that interact with ERRalpha , such as members of the p160 family of coactivators. Overexpression of p160 coactivators can indeed enhance ERRalpha -mediated transcription at model reporters (18-20). However, ERRalpha shows weak transcriptional activity in cells that express endogenous p160 coactivators (5, 20), suggesting that additional cofactors must be important.

PGC-1 is a transcriptional coactivator of many nuclear receptors, as well as specific other transcription factors like the nuclear respiratory factor 1 (NRF-1) and members of the MEF2 (myocyte enhancer factor 2) family (22-28). PGC-1 is expressed in a tissue-selective manner, with the highest mRNA levels found in heart, kidney, brown fat, and muscle (22, 25, 29, 30). Moreover, PGC-1 expression is induced in a tissue-specific manner by signals that relay metabolic needs. Exposure to cold leads to the induction of PGC-1 in brown fat and muscle, starvation induces PGC-1 expression in heart and liver, and physical exercise increases its expression in muscle (22, 28, 31-33). PGC-1 function has been implicated in the control of energy metabolism, as PGC-1 expression stimulates mitochondrial biogenesis and modulates mitochondrial functions and utilization of energy (Refs. 23, 24, and 31 and reviewed in Ref. 34). The nuclear receptors PPARgamma , TRalpha , PPARalpha , HNF4, and GR, and the transcription factors NRF-1, MEF2C, and MEF2D, interact with, and may recruit, PGC-1 to the promoters of target genes that execute the metabolic effects of PGC-1. Additional transcription factors are likely to contribute to PGC-1 function.

In the study presented here, we show that PGC-1 regulates, first, the expression of ERRalpha mRNA and, second, the transcriptional activity of the ERRalpha protein. Our findings indicate that ERRalpha by itself is a poor activator of transcription and that PGC-1 fulfills a specific role as a cofactor required for ERRalpha function. The interactions of PGC-1 and ERRalpha suggest that the two proteins act in a common pathway.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmids and Adenoviral Vectors-- Expression plasmids for wild-type and mutant human PGC-1, and luciferase reporters pGK1, pDelta LUC, and pDelta (cERE)x2-Luc (referred in this study as pERE-Luc), have been described previously (35, 36). pSG5-mERRalpha for the expression of full-length mouse ERRalpha was a gift of J.-M. Vanacker (11). The human ERRalpha ligand-binding domain (LBD) was amplified by PCR, using HeLa cDNA and primers CGAATTCATATGGGGCCCCTGGCAGTCGCT and GCTCTAGACTATCAGTCCATCATGGCCTC, and cloned as an NdeI-XbaI fragment into pcDNA3/Gal4DBD (36). The plasmid pSiERRalpha was generated by cloning the annealed primers GAT CCC CGA GCA TCC CAG GCT TCT CAT TCA AGA GAT GAG AAG CCT GGG ATG CTC TTT TTG GAA A (ERRalpha 907/927-s) and AGC TTT TCC AAA AAG AGC ATC CCA GGC TTC TCA TCT CTT GAA TGA GAA GCC TGG GAT GCT CGG G (ERRalpha 907/927-a) into pSUPER (37). Yeast expression vectors for Gal4-PGC-1 (aa 91-408, wild-type or mutants) were generated by subcloning the PGC-1 cDNA fragments encoding aa 91-408 in the vector pGBKT7 (Clontech). Plasmid pAS2-ERRalpha LBD expresses the ERRalpha LBD fused to the Gal4 DBD and was generated by subcloning the NdeI-XbaI fragment encoding the ERRalpha LBD into pAS2-1 (Clontech). pGBKT7/hERalpha .280C expresses the human ERalpha LBD (starting at aa 280) fused to the Gal4 DBD. Human PPARgamma (full-length), RXRalpha (starting at aa 10) and ERRalpha (starting at aa 221) fused to the Gal4 activation domain (AD) were isolated in a yeast two-hybrid screen and were expressed from the vector pACT2 (Clontech).

Adenoviral vectors were generated by CRE-lox-mediated recombination in CRE8 cells (38). Briefly, CRE8 cells were transfected with 3 µg of purified Psi 5 adenovirus DNA and 10 µg of pAdlox DNA shuttle plasmid (38) carrying the cDNA for human PGC-1 (wild-type or mutant) downstream of the cytomegalovirus promoter. For the expression of siRNA from adenoviruses, the cytomegalovirus promoter and SV40 polyadenylation sequences of pAdlox were replaced by a DNA fragment harboring the expression cassette of pSUPER (37) to generate AdSUPER. The viral vector AdSiERRalpha expresses the same siRNA as pSiERRalpha . All viruses were plaque-isolated to obtain single clones, titered by serial dilution in CRE8 cultures that were grown under 0.6% Noble agar overlay, and used as freeze-thaw lysates.

Cell lines, Infections, and Transfections-- 293, CRE8 (38), HepG2, SAOS2-GR(+) (39), and HtTA-1 (derived from HeLa; Ref. 35) cells were cultured in Dulbecco's modified Eagle's medium supplemented with 9% fetal calf serum. When measuring ERRalpha - and GR-mediated transcription, cells were grown in medium with charcoal-stripped serum. SAOS2-GR(+) and CRE8 cultures were supplemented with G418 (400 µg/ml). For infection, cells were plated at 2 × 105 per well in a six-well dish. The next day, viruses were added at a multiplicity of infection of 40 or 100, as indicated in the figure legends to Figs. 1 and 5, for 2 h. Cells were then washed and replenished with fresh medium. For transfections, cells were incubated with a calcium phosphate/DNA precipitate. Transfections included 0.2 µg of p6RlacZ for normalization of transfection efficiency, and 1 µg of the luciferase reporters pDelta Luc, pERE-Luc, or pGK1. The amounts of expression plasmids per transfection were as follows: 0.5-1 µg of pcDNA3 or pcDNA3/HA-PGC-1, 1 µg of pSG5 or pSG5-mERRalpha , 1 µg of pcDNA3/Gal4 DBD or pcDNA3/ Gal4-ERRalpha LBD, and 1 µg of pSUPER or pSiERRalpha for siRNA. Cell lysates were prepared 40-48 h after transfection and assayed for luciferase activity as described (25). Luciferase values normalized to the beta -galactosidase activity are referred to as luciferase units.

RNA Analysis-- Total RNA was isolated using the TRIzol reagent and checked for its integrity by agarose gel electrophoresis and ethidium bromide staining. RNA was converted to cDNA and specific transcripts were quantitated by real-time PCR using the Light Cycler system (Roche Diagnostics) as described previously (36). A melting curve from 65 to 95 °C (0.05 °C/s) at the end of the reaction was used to check the purity and nature of the product. In all cases, a single PCR product was detected. The sequences of the primers and the sizes of the PCR products were as follows: AAGACAGCAGCCCCAGTGAA (exon 4) and ACACCCAGCACCAGCACCT (exon 5) for human ERRalpha (product 254 bp), TGTGGAGGTCTTGGACTTGGA (exon 4/5) and TCCTCAGTCATTCTCCCCAAA (exon 6) for MCAD (product 173 bp), CTGTGCCAGCCCAGAACACT (exon 4) and TGACCAGCCCAAAGGAGAAG (exon 5) for 36B4/ribosomal protein P0 large (product 201 bp), CGGGATGAGTTGGGAGGAG (exon 1) and CGGCGTTTGGAGTGGTAGAA (exon 2) for p21 (product 212 bp), GGAGGACGGCAGAAGTACAAA (exon 4) and GCGACACCAGAGCGTTCAC (exon 5) for mouse ERRalpha (product 130 bp); primers for mouse PGC-1 and actin have been described previously (36).

Western Analysis-- Cells were lysed in 100 mM Tris, pH 7.5, 1% Nonidet P-40, 250 mM NaCl, 1 mM EDTA buffer. Cell lysates were subjected to Western analysis using antibodies against the HA epitope (HA.11, Babco), ERRalpha (4), or PGC-1 (sera from rabbits immunized with a PGC-1 fragment bearing aa 1-293).

Yeast Two-hybrid Interaction Assays-- Yeast carrying Gal4-responsive beta -galactosidase reporters (CG1945xY187, Clontech) were transformed by the lithium acetate transformation method with expression plasmids for Gal4 DBD and Gal4 AD fusion proteins. Single transformants were grown to stationary phase, diluted 1:20 in selective media, grown for an additional 14 h at 30 °C in 96-well plates, and assayed for beta -galactosidase activity as described previously (36).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

PGC-1 Induces ERRalpha Expression-- To identify genes that are induced by PGC-1 and that could execute the cellular processes activated by PGC-1, we have compared the RNA profiles of SAOS2-GR(+) cells infected with adenoviral vectors expressing PGC-1 with those of cells infected with control vectors expressing beta -galactosidase or GFP. Analysis of the RNA profiles after hybridization to high density oligonucleotide arrays (data not shown) identified the orphan nuclear receptor ERRalpha as a gene that is induced strongly by PGC-1. Expression of PGC-1 led to the induction of ERRalpha at the RNA and protein level in SAOS2-GR(+) cells, as well as in HtTA-1, HepG2, and 293 cells (Fig. 1A and data not shown). Evaluation of protein levels by immunoblotting showed that the increase in the levels of ERRalpha protein followed closely the appearance of PGC-1 protein at different times after infection, suggesting that ERRalpha induction is an early event upon PGC-1 expression (Fig. 1B).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1.   PGC-1 induces ERRalpha at the mRNA and protein level. A and B, cells were infected with either GFP (control) or PGC-1 expressing adenoviruses at a multiplicity of infection of 40 (SAOS2-GR(+)) or 100 (HtTA-1). A, RNA was isolated 24 h (HtTA-1) or 48 h (SAOS2-GR(+)) after infection. Levels of ERRalpha mRNA were determined by quantitative RT-PCR, normalized to 36B4 levels, and expressed relative to levels in control cells. Data represent the mean ± S.D. of four experiments performed in duplicates. Cell extracts prepared 24 h after infection were analyzed by immunoblotting with antibodies against PGC-1 (upper panel) or ERRalpha (lower panel). B, cell extracts prepared at the indicated times after infection of HtTA-1 cells with a PGC-1 expressing adenovirus were analyzed by immunoblotting with antibodies against PGC-1 (upper panel) or ERRalpha (lower panel). -, extracts from uninfected HtTA-1 cells. C and D, levels of PGC-1 and ERRalpha mRNA in the indicated mouse tissues were determined by quantitative RT-PCR and normalized to beta -actin levels. C, relative mRNA levels in tissues of a ~6-week-old female mouse. Levels in heart were set equal to 100 for each transcript. Data represent mRNA levels relative to expression in heart and are the mean ± range of duplicate PCR reactions. SKM, skeletal muscle; ADG, adrenal gland. D, relative mRNA levels in brown fat and soleus muscle of four ~8-week-old male siblings, kept at 23 °C (M1, M2; control) or exposed to 4 °C for 6 h (M3, M4; cold). Data shown are the mean ± range of PGC-1 and ERRalpha mRNA levels normalized to beta -actin levels in each RNA sample.

ERRalpha mRNA levels have been reported to be high in PGC-1 expressing tissues, such as kidney, heart, muscle, and brown adipose tissue (5, 13-16, 22, 25, 29, 30). Analysis of mRNA expression levels in tissues of adult mice shows that indeed ERRalpha levels correlate with PGC-1 mRNA levels (Fig. 1C). PGC-1 expression in some of these tissues is known to be induced in response to physiological signals, such as exposure to cold (22). Thus, to test the ability of PGC-1 to induce ERRalpha in vivo, we determined PGC-1 and ERRalpha mRNA levels in the brown fat and muscle of mice that were exposed to cold for 6 h. As seen in Fig. 1D, the increase in PGC-1 expression was accompanied by an increase in ERRalpha mRNA levels, suggesting that PGC-1 can also induce ERRalpha expression in vivo.

PGC-1 Strongly Induces ERRalpha -mediated Transcription-- The finding that PGC-1 induces the expression of ERRalpha suggests that PGC-1 enhances also the activity of ERRalpha -regulated promoters. To test this, we transfected 293 cells with a PGC-1 expression vector and a reporter that carries the luciferase gene under the control of the minimal ADH promoter with or without binding sites for ERRalpha (pERE-Luc and pDelta Luc, respectively). PGC-1 strongly enhanced expression from the pERE-Luc reporter, in a manner dependent on the presence of the binding sites for ERRalpha (Fig. 2A). Estradiol, tamoxifen, or hydroxytamoxifen did not affect the enhancement by PGC-1 (data not shown), suggesting that it was not mediated by receptors that are regulated by these ligands and can recognize the same DNA binding site (e.g. ERalpha , ERbeta , ERRbeta , or ERRgamma ). To confirm that endogenous, PGC-1-induced ERRalpha was mediating the effect of PGC-1 on the pERE-Luc reporter, we determined the effect of inhibiting the expression of ERRalpha . For this, cells were transfected with a vector expressing a small interfering (si) RNA specific for ERRalpha (pSiERRalpha ) (37). Expression of the ERRalpha -specific siRNA led to a decrease in ERRalpha mRNA levels (Fig. 2B) and a decrease in the PGC-1-mediated induction of the luciferase reporter, demonstrating that endogenous ERRalpha was required for the PGC-1 effect (Fig. 2C). In the absence of PGC-1, pSiERRalpha decreased ERRalpha expression (Fig. 2B) but had no effect on the pERE-Luc reporter (Fig. 2C), suggesting that in this context ERRalpha was not transcriptionally active.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   PGC-1 induces ERRalpha -mediated transcription. A, 293 cells were transfected with a luciferase reporter driven by either just the minimal ADH promoter (pDelta Luc) or 2 EREs upstream of the minimal ADH promoter (pERE-Luc) and either the control vector pcDNA3 or a PGC-1 expression vector. Data are the mean ± S.D. of luciferase activities from three experiments performed in duplicates. B, 293 cells were transfected with the empty vector pSUPER (37) or the vector expressing siRNA for ERRalpha (pSiERRalpha ) and either pcDNA3 (+vector) or the PGC-1 expression vector pcDNA3/HA-PGC-1 (+PGC-1). Transfection efficiency was 40-50%. RNA was prepared 48 h later. ERRalpha mRNA levels were determined by quantitative RT-PCR and normalized to levels of 36B4. Data are the average of two experiments performed in duplicates. C, 293 cells were transfected with the pERE-Luc reporter, a control or PGC-1 expression vector as indicated, and either the control pSUPER or the siRNA expressing pSiERRalpha . Data represent the mean ± S.D. of luciferase activities from two experiments performed in duplicates.

PGC-1 Activates ERRalpha at the Protein Level-- PGC-1 interacts physically with many nuclear receptors and enhances their transcriptional activity (reviewed in Ref. 34). Thus, PGC-1 could also interact with ERRalpha . In this case, the increased ERRalpha -mediated transcription could be the combined result of PGC-1 inducing ERRalpha levels and enhancing ERRalpha activity. To address this, we first asked whether overexpression of ERRalpha would lead to the same phenotype as PGC-1 expression. If the only function of PGC-1 were to increase ERRalpha levels, we would expect that exogenous ERRalpha expression would mimic the PGC-1 effect. Surprisingly, overexpression of ERRalpha had very little effect on pERE-Luc (<2-fold), suggesting that ERRalpha alone was not sufficient for the transcriptional activation of this reporter (Fig. 3A). Coexpression of PGC-1 with ERRalpha led to an increase in luciferase expression that was stronger than that seen with just endogenous ERRalpha , indicating that PGC-1 activated the exogenously introduced ERRalpha (Fig. 3A).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   PGC-1 activates ERRalpha , which by itself is a weak activator of transcription. A, 293 cells were transfected with the pERE-Luc reporter, a control or PGC-1 expression vector as indicated, and either the pSG5 vector (endogenous) or the pSG5-mERRalpha expression vector (+ERRalpha ) (6). Data are the mean ± S.D. of luciferase activities from three experiments performed in duplicates. B, 293 cells were transfected with the Gal4-responsive luciferase reporter pGK1, an expression vector for either the Gal4 DBD or a fusion of the ERRalpha LBD to the Gal4 DBD, and either vector alone or PGC-1 expression vector. Data are from one representative experiment performed in triplicates and are expressed relative to the activity of Gal4-ERRalpha LBD in the absence of PGC-1.

To determine the effect of PGC-1 on the activity of ERRalpha directly, we evaluated the consequence of PGC-1 expression on the activity of a Gal4 DBD-ERRalpha LBD chimera, using a Gal4-responsive luciferase reporter. In this context, endogenous ERRalpha does not interfere with the luciferase readout. As seen in Fig. 3B, Gal4-ERRalpha LBD by itself activated transcription modestly, ~2-fold, suggesting that the LBD of ERRalpha carries only a weak transcriptional activation function. Addition of PGC-1 converted the Gal4-ERRalpha LBD fusion to a strong activator of transcription, indicating that PGC-1 enables the transcriptional function of ERRalpha (Fig. 3B).

ERRalpha Interacts with PGC-1 via an Atypical L-rich Box-- PGC-1 harbors three Leu-rich motifs (L1, L2, and L3), one of which (L2) bears the consensus LXXLL sequence present in many proteins that interact with the LBD of nuclear receptors. The L2 motif serves as the major binding site for many nuclear receptors, and mutations in L2 disrupt the interactions of PGC-1 with nuclear receptors tested so far (24, 26, 35). Surprisingly, PGC-1 harboring a mutant L2 (L2A) was still capable of interacting with ERRalpha in a yeast two-hybrid assay; in the same context, the L2A mutant was severely compromised for interaction with PPARgamma , RXRalpha , and ERalpha (Fig. 4, A and B). In previous studies, we had noted that the L3 site can mediate a weak interaction with the glucocorticoid receptor (35). We thus tested the contribution of the L3 site to the PGC-1/ERRalpha interaction. As seen in Fig. 4, A and B, PGC-1 bearing a disruption of just L3 (L3A) was also capable of interacting with ERRalpha , while the double L2A/L3A mutation abolished the interaction. Mutations in motif L1, alone or in combination with L2, had no effect on the physical interaction of PGC-1 with ERRalpha (data not shown). Thus, we concluded that motifs L2 and L3 can be used equivalently for physical interactions between PGC-1 and ERRalpha , while L2 is the preferred site for most other receptors (Fig. 4, A and B).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   ERRalpha interacts with the L3 as well as the L2 site of PGC-1. A and B, yeast two-hybrid assay. A, interactions between the L2/L3 containing PGC-1 fragment (aa 91-408) fused to the Gal4 DBD, and the indicated receptors fused to the Gal4 AD. Data are the mean ± S.D. of beta -galactosidase activities from four independent transformants. B, interactions between the LBD of ERRalpha or ERalpha fused to the Gal4 DBD (Gal4-ERRalpha and Gal4-ERalpha , respectively), and full-length PGC-1 (wild-type (wt) or L2/L3 mutants) fused to the Gal4 AD. Interaction with ERalpha was assayed in the presence of 10 µM 17beta -estradiol. Data are the mean ± S.D. of beta -galactosidase activities from 12 yeast transformants. C, activation of the ERRalpha LBD in mammalian cells. 293 cells were transfected with the Gal4-responsive luciferase reporter pGK1, the vector expressing the Gal4-ERRalpha LBD fusion, and either vector alone (-), PGC-1 wild type (wt), or the indicated PGC-1 mutants. Data are the mean ± S.D. of luciferase activities from at least four experiments performed in duplicates.

Next, we determined the requirement of the physical interaction between PGC-1 and ERRalpha for the activation of the ERRalpha LBD in mammalian cells, using the context of the Gal4-ERRalpha LBD chimera. Single mutations in either L2 or L3 did not compromise the PGC-1 effect (Fig. 4C), suggesting that interaction via either site is sufficient for activation of ERRalpha by PGC-1. The double L2A/L3A mutation abolished the activation, indicating that the physical interaction between the two proteins is necessary for the effect of PGC-1 on the ERRalpha LBD (Fig. 4C).

PGC-1 Can Induce the Expression of the Endogenous Gene MCAD in an ERRalpha -dependent Manner-- The ability of PGC-1 to induce ERRalpha expression and activity predicts that PGC-1 should also induce the expression of ERRalpha target genes. To test this, we determined the effect of PGC-1 on the RNA levels of a proposed ERRalpha target, the MCAD, an enzyme in fatty acid oxidation (5, 13). As seen in Fig. 5, PGC-1 expression led to the induction of MCAD in HtTA-1 and SAOS2-GR(+) cells. To address whether the induction was mediated by ERRalpha , we asked whether suppression of ERRalpha expression affected the response of MCAD to PGC-1. Infection of HtTA-1 cells with adenoviruses that express ERRalpha -specific siRNA led to a decrease in ERRalpha mRNA levels (Fig. 5A), and a reduced induction of MCAD (Fig. 5B), consistent with ERRalpha mediating the PGC-1 effect at the MCAD promoter.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5.   PGC-1 induces the endogenous MCAD gene in an ERRalpha -dependent manner. A and B, HtTA-1 cells were infected with either control (AdSUPER) or siERRalpha expressing (AdSiERRalpha ) adenoviruses on day 1 and either GFP- or PGC-1-expressing adenoviruses on day 2. RNA was harvested on day 3, and mRNA levels for ERRalpha and MCAD were analyzed by quantitative RT-PCR, normalized to 36B4 levels, and expressed relative to levels in cells infected with AdSUPER/GFP viruses. Data represent the mean ± S.D. of three experiments performed in duplicates. C and D, SAOS2-GR(+) cells were infected with adenoviruses expressing either GFP or PGC-1 (wild type (wt) or mutants L2A, L3A, or double mutant L2A/L3A). C, 24 h after infection cells were treated with either 50 nM corticosterone (+H) or just vehicle ethanol (-H). RNA was harvested 8 h after hormone addition, and p21 mRNA levels were determined by quantitative RT-PCR, normalized to 36B4 levels, and expressed relative to levels in cells infected with GFP virus and treated with just ethanol. Data represent the mean ± range of duplicates of one experiment. D, RNA was harvested 48 h after infection, and MCAD mRNA levels were determined by quantitative RT-PCR, normalized to 36B4 levels, and expressed relative to levels in cells infected with GFP virus. Data represent the mean ± S.D. of two experiments performed in duplicates. Wild-type, L2A, L3A, and L2A/L3A mutants were expressed at similar levels, as determined by Western blot analysis.

The distinct utilization of the L3 site of PGC-1 for interaction with ERRalpha and not other receptors like GR suggests that mutations in the L2 and L3 sites could be used to diagnose the type of nuclear receptors that mediate specific functions of PGC-1. Functions that are mediated by receptors utilizing the L2 site should be abrogated by the single PGC-1 mutation L2A, while functions that rely on ERRalpha should be disrupted only by the double L2A/L3A and not the single L2A mutation. To test this, we infected SAOS2-GR(+) cells that express GR from a stably integrated locus with adenoviruses expressing PGC-1, wild-type or mutant variants. As predicted, the glucocorticoiddependent induction of the endogenous GR target p21 (39) was enhanced by both wild-type PGC-1 and the L3A mutant, but not by the L2A mutant (Fig. 5C). In contrast, induction of MCAD in the same cells was not affected by the L2A mutation and was only abolished by the double L2A/L3A mutation (Fig. 5D). These findings indicate that the L2 and L3 sites of PGC-1 are indeed used selectively by different nuclear receptors to recruit PGC-1 at their respective endogenous target genes.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Many members of the nuclear receptor superfamily are still orphan receptors, with no known physiological ligands. The mechanisms that regulate the activity of these receptors are not fully understood. The results presented here provide evidence that the transcriptional coactivator PGC-1 is a key regulator of the orphan nuclear receptor ERRalpha . PGC-1 acts at two levels. First, it induces ERRalpha expression, and second, it associates with ERRalpha and enables the transcriptional activation of ERRalpha target genes. PGC-1 expression is known to be regulated in a tissue-selective manner by physiological signals that relay metabolic needs (22, 28, 31-33). Accordingly, PGC-1 function has been implicated in the regulation of energy metabolism (Refs. 23, 24, and 31 and reviewed in Ref. 34). Our findings suggest that ERRalpha functions in PGC-1-regulated pathways, where it may contribute to the transcriptional activation of genes important for energy homeostasis.

The activity of several orphan nuclear receptors is restricted by expression of the receptors in specific tissues or at particular times (reviewed in Ref. 17). The mechanisms that control the selective expression of these receptors are often not clear. The observation that PGC-1 induces ERRalpha mRNA levels provides a molecular explanation for the high ERRalpha expression in heart, kidney, muscle, and brown fat, i.e. tissues that express PGC-1. Moreover, it suggests physiological signals that are likely to control ERRalpha expression, as shown here for exposure to cold in brown fat and muscle. In support of these findings, Ichida et al. have recently shown that fasting, which is known to induce PGC-1 expression in the liver (28, 33), also increases ERRalpha mRNA levels (40). The spatial and temporal correlation of PGC-1 and ERRalpha expression implies that ERRalpha induction is an early, and possibly direct, outcome of PGC-1 action. Future studies must address whether PGC-1 acts directly at the ERRalpha promoter. Additional regulatory mechanisms may restrict or enhance ERRalpha induction by PGC-1, in a tissue- or physiological state-dependent manner.

Interestingly, we find that in the absence of PGC-1, ERRalpha is a very weak activator of transcription. Coexpression of PGC-1 enables potent transcriptional activation by ERRalpha . These findings suggest that ERRalpha is not a constitutively active receptor and that transformation into an active form is favored by binding to protein ligands, such as PGC-1, rather than to small lipophilic ligands. Expression levels of PGC-1 may explain why ERRalpha has been reported as an efficient transcriptional activator in some cells (e.g. ROS 17.2/8) and a poor activator in others (4-6, 11, 16, 18-21). Many established cell lines express very low, if any, levels of PGC-1. Importantly, the ability of PGC-1 to activate ERRalpha at the protein level predicts that physiological signals that induce PGC-1 are likely to activate ERRalpha -mediated transcription, even in the absence of increased ERRalpha expression.

The activation of ERRalpha at the protein level requires the physical interaction of PGC-1 with ERRalpha . Surprisingly, this interaction differs from that of PGC-1 with other nuclear receptors. While PGC-1 recognizes most receptors tested until now (GR, ERalpha , TRalpha , RXRalpha , RARalpha , PPARalpha , PPARgamma , HNF4) via the canonical LXXLL motif L2, it can interact with ERRalpha equally well via the L2 or the L3 site. Similar to our findings, Huss et al. have recently shown that ERRalpha , as well as the related receptor ERRgamma , bind the L3 site of PGC-1 (41), suggesting that the L3-mediated interaction is characteristic of the ERR subfamily of receptors. Interestingly, the differential utilization of the Leu-rich motifs can be used to dissect the receptors that mediate specific PGC-1 functions, as shown by the fact that L2A mutations disrupt GR-dependent, but not ERRalpha -dependent, effects of PGC-1. Thus, the L2 and L3 mutants of PGC-1 may provide useful tools for elucidating the types of receptors that recruit PGC-1 at distinct promoters.

The in vivo functions of ERRalpha are not yet defined. Based on its ability to bind EREs and modulate some estrogen-responsive genes, ERRalpha has been proposed to modulate ER signaling and possibly play a role in ER-dependent tumors (6, 20, 21). A function of ERRalpha in bone development is supported by the high levels of ERRalpha at sites of ossification during embryogenesis, and the ability of ERRalpha to promote osteoblast differentiation in vitro and to activate the promoter of the bone matrix protein osteopontin (11, 42). Finally, the strong expression of ERRalpha in tissues with high capacity for fatty acid oxidation, and its ability to bind the promoter of the MCAD gene, suggest a role in the mitochondrial beta -oxidation of fatty acids (5, 13). Our findings support a function of ERRalpha in PGC-1-stimulated cellular processes, such as fatty acid oxidation (24), and possibly other aspects of energy homeostasis. Interestingly, the close relationship of PGC-1 and ERRalpha activity may reflect not only an involvement of ERRalpha in known PGC-1-regulated functions, but also of PGC-1 in processes where ERRalpha roles have been suggested, such as bone development and homeostasis or breast cancer.

    ACKNOWLEDGEMENTS

We thank M. Senften and U. Muller for Psi 5 adenoviral DNA; L. Dolfini and M. Meyer for technical help; J.-M. Vanacker and R. Agami for plasmids; J. Mertz for the anti-ERRalpha serum; I. Rogatsky and M. J. Garabedian for the SAOS-GR(+) cells; R. Emter, D. Kressler, and U. Muller for discussions and comments on the manuscript.

    FOOTNOTES

* This work was supported by the Swiss National Science Foundation, the University of Basel, the Novartis Stiftung (to S. N. S.), Roche Research Foundation (to D. K.), and the Max Cloëtta Foundation (to A. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger These two authors contributed equally to this work.

§ To whom correspondence should be addressed. Tel.: 41-61-267-2162; Fax: 41-61-267-2149; E-mail: anastasia.kralli@unibas.ch.

Published, JBC Papers in Press, January 8, 2003, DOI 10.1074/jbc.M212923200

    ABBREVIATIONS

The abbreviations used are: ERRalpha , estrogen-related receptor alpha ; ER, estrogen receptor; ERE, estrogen response element; LBD, ligand-binding domain; DBD, DNA-binding domain; AD, activation domain; PPAR, peroxisome proliferator-activated receptor; GFP, green fluorescent protein; siRNA, small interfering RNA; NRF, nuclear respiratory factor; MEF, myocyte enhancer factor; TR, thyroid hormone receptor; HNF, hepatocyte nuclear factor; GR, glucocorticoid receptor; aa, amino acid(s); MCAD, medium-chain acyl-coenzyme A dehydrogenase; ADH, alcohol dehydrogenase; RXR, retinoid X receptor; RT, reverse transcriptase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Giguere, V., Yang, N., Segui, P., and Evans, R. M. (1988) Nature 331, 91-94[CrossRef][Medline] [Order article via Infotrieve]
2. Hong, H., Yang, L., and Stallcup, M. R. (1999) J. Biol. Chem. 274, 22618-22626[Abstract/Free Full Text]
3. Giguere, V. (2002) Trends Endocrinol. Metab. 13, 220-225[CrossRef][Medline] [Order article via Infotrieve]
4. Johnston, S. D., Liu, X., Zuo, F., Eisenbraun, T. L., Wiley, S. R., Kraus, R. J., and Mertz, J. E. (1997) Mol. Endocrinol. 11, 342-352[Abstract/Free Full Text]
5. Sladek, R., Bader, J. A., and Giguere, V. (1997) Mol. Cell. Biol. 17, 5400-5409[Abstract]
6. Vanacker, J. M., Pettersson, K., Gustafsson, J. A., and Laudet, V. (1999) EMBO J. 18, 4270-4279[CrossRef][Medline] [Order article via Infotrieve]
7. Vanacker, J. M., Bonnelye, E., Chopin-Delannoy, S., Delmarre, C., Cavailles, V., and Laudet, V. (1999) Mol. Endocrinol. 13, 764-773[Abstract/Free Full Text]
8. Tremblay, G. B., Kunath, T., Bergeron, D., Lapointe, L., Champigny, C., Bader, J. A., Rossant, J., and Giguere, V. (2001) Genes Dev. 15, 833-838[Abstract/Free Full Text]
9. Coward, P., Lee, D., Hull, M. V., and Lehmann, J. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8880-8884[Abstract/Free Full Text]
10. Greschik, H., Wurtz, J. M., Sanglier, S., Bourguet, W., van Dorsselaer, A., Moras, D., and Renaud, J. P. (2002) Mol. Cell 9, 303-313[CrossRef][Medline] [Order article via Infotrieve]
11. Bonnelye, E., Vanacker, J. M., Dittmar, T., Begue, A., Desbiens, X., Denhardt, D. T., Aubin, J. E., Laudet, V., and Fournier, B. (1997) Mol. Endocrinol. 11, 905-916[Abstract/Free Full Text]
12. Bonnelye, E., Vanacker, J. M., Spruyt, N., Alric, S., Fournier, B., Desbiens, X., and Laudet, V. (1997) Mech. Dev. 65, 71-85[CrossRef][Medline] [Order article via Infotrieve]
13. Vega, R. B., and Kelly, D. P. (1997) J. Biol. Chem. 272, 31693-31699[Abstract/Free Full Text]
14. Shi, H., Shigeta, H., Yang, N., Fu, K., O'Brian, G., and Teng, C. T. (1997) Genomics 44, 52-60[CrossRef][Medline] [Order article via Infotrieve]
15. Shigeta, H., Zuo, W., Yang, N., DiAugustine, R., and Teng, C. T. (1997) J. Mol. Endocrinol. 19, 299-309[Abstract]
16. Vanacker, J. M., Bonnelye, E., Delmarre, C., and Laudet, V. (1998) Oncogene 17, 2429-2435[CrossRef][Medline] [Order article via Infotrieve]
17. Giguere, V. (1999) Endocr. Rev. 20, 689-725[Abstract/Free Full Text]
18. Xie, W., Hong, H., Yang, N. N., Lin, R. J., Simon, C. M., Stallcup, M. R., and Evans, R. M. (1999) Mol. Endocrinol. 13, 2151-2162[Abstract/Free Full Text]
19. Zhang, Z., and Teng, C. T. (2000) J. Biol. Chem. 275, 20837-20846[Abstract/Free Full Text]
20. Lu, D., Kiriyama, Y., Lee, K. Y., and Giguere, V. (2001) Cancer Res. 61, 6755-6761[Abstract/Free Full Text]
21. Kraus, R. J., Ariazi, E. A., Farrell, M. L., and Mertz, J. E. (2002) J. Biol. Chem. 277, 24826-24834[Abstract/Free Full Text]
22. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 92, 829-839[CrossRef][Medline] [Order article via Infotrieve]
23. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C., and Spiegelman, B. M. (1999) Cell 98, 115-124[CrossRef][Medline] [Order article via Infotrieve]
24. Vega, R. B., Huss, J. M., and Kelly, D. P. (2000) Mol. Cell. Biol. 20, 1868-1876[Abstract/Free Full Text]
25. Knutti, D., Kaul, A., and Kralli, A. (2000) Mol. Cell. Biol. 20, 2411-2422[Abstract/Free Full Text]
26. Tcherepanova, I., Puigserver, P., Norris, J. D., Spiegelman, B. M., and McDonnell, D. P. (2000) J. Biol. Chem. 275, 16302-16308[Abstract/Free Full Text]
27. Michael, L. F., Wu, Z., Cheatham, R. B., Puigserver, P., Adelmant, G., Lehman, J. J., Kelly, D. P., and Spiegelman, B. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3820-3825[Abstract/Free Full Text]
28. Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., Newgard, C. B., and Spiegelman, B. M. (2001) Nature 413, 131-138[CrossRef][Medline] [Order article via Infotrieve]
29. Larrouy, D., Vidal, H., Andreelli, F., Laville, M., and Langin, D. (1999) Int. J. Obes. Relat. Metab. Disord. 23, 1327-1332[CrossRef][Medline] [Order article via Infotrieve]
30. Esterbauer, H., Oberkofler, H., Krempler, F., and Patsch, W. (1999) Genomics 62, 98-102[CrossRef][Medline] [Order article via Infotrieve]
31. Lehman, J. J., Barger, P. M., Kovacs, A., Saffitz, J. E., Medeiros, D. M., and Kelly, D. P. (2000) J. Clin. Invest. 106, 847-856[Medline] [Order article via Infotrieve]
32. Goto, M., Terada, S., Kato, M., Katoh, M., Yokozeki, T., Tabata, I., and Shimokawa, T. (2000) Biochem. Biophys. Res. Commun. 274, 350-354[CrossRef][Medline] [Order article via Infotrieve]
33. Herzig, S., Long, F., Jhala, U. S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., Spiegelman, B., and Montminy, M. (2001) Nature 413, 179-183[CrossRef][Medline] [Order article via Infotrieve]
34. Knutti, D., and Kralli, A. (2001) Trends Endocrinol. Metab. 12, 360-365[CrossRef][Medline] [Order article via Infotrieve]
35. Knutti, D., Kressler, D., and Kralli, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9713-9718[Abstract/Free Full Text]
36. Kressler, D., Schreiber, S. N., Knutti, D., and Kralli, A. (2002) J. Biol. Chem. 277, 13918-13925[Abstract/Free Full Text]
37. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296, 550-553[Abstract/Free Full Text]
38. Hardy, S., Kitamura, M., Harris-Stansil, T., Dai, Y., and Phipps, M. L. (1997) J. Virol. 71, 1842-1849[Abstract]
39. Rogatsky, I., Trowbridge, J. M., and Garabedian, M. J. (1997) Mol. Cell. Biol. 17, 3181-3193[Abstract]
40. Ichida, M., Nemoto, S., and Finkel, T. (2002) J. Biol. Chem. 277, 50991-50995[Abstract/Free Full Text]
41. Huss, J. M., Kopp, R. P., and Kelly, D. P. (2002) J. Biol. Chem. 277, 40265-40274[Abstract/Free Full Text]
42. Bonnelye, E., Merdad, L., Kung, V., and Aubin, J. E. (2001) J. Cell Biol. 153, 971-984[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Endocr. Rev.Home page
V. Giguere
Transcriptional Control of Energy Homeostasis by the Estrogen-Related Receptors
Endocr. Rev., October 1, 2008; 29(6): 677 - 696.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
V. Bombail, S. MacPherson, H. O.D. Critchley, and P. T.K. Saunders
Estrogen receptor related beta is expressed in human endometrium throughout the normal menstrual cycle
Hum. Reprod., September 4, 2008; (2008) den298v1.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
G. L. Wright, I. G. Maroulakou, J. Eldridge, T. L. Liby, V. Sridharan, P. N. Tsichlis, and R. C. Muise-Helmericks
VEGF stimulation of mitochondrial biogenesis: requirement of AKT3 kinase
FASEB J, September 1, 2008; 22(9): 3264 - 3275.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Hummasti and P. Tontonoz
Adopting New Orphans into the Family of Metabolic Regulators
Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Greschik, M. Althage, R. Flaig, Y. Sato, V. Chavant, C. Peluso-Iltis, L. Choulier, P. Cronet, N. Rochel, R. Schule, et al.
Communication between the ERR{alpha} Homodimer Interface and the PGC-1{alpha} Binding Surface via the Helix 8-9 Loop
J. Biol. Chem., July 18, 2008; 283(29): 20220 - 20230.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page