![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 11, 9013-9018, March 14, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Division of Biochemistry, Biozentrum of the University of
Basel, Klingelbergstrasse 70, CH 4056 Basel, Switzerland
Received for publication, December 18, 2002
The estrogen-related receptor The nuclear receptor
ERR One way to control orphan receptor activity is to express the receptors
in a temporally and spatially restricted manner. ERR The activity of orphan nuclear receptors may also be regulated at the
protein level via interactions with specific cofactors. ERR PGC-1 is a transcriptional coactivator of many nuclear receptors, as
well as specific other transcription factors like the nuclear
respiratory factor 1 (NRF-1) and members of the MEF2
(myocyte enhancer factor 2) family
(22-28). PGC-1 is expressed in a tissue-selective manner, with the
highest mRNA levels found in heart, kidney, brown fat, and muscle
(22, 25, 29, 30). Moreover, PGC-1 expression is induced in a
tissue-specific manner by signals that relay metabolic needs. Exposure
to cold leads to the induction of PGC-1 in brown fat and muscle,
starvation induces PGC-1 expression in heart and liver, and physical
exercise increases its expression in muscle (22, 28, 31-33). PGC-1
function has been implicated in the control of energy metabolism, as
PGC-1 expression stimulates mitochondrial biogenesis and modulates
mitochondrial functions and utilization of energy (Refs. 23, 24, and 31
and reviewed in Ref. 34). The nuclear receptors PPAR In the study presented here, we show that PGC-1 regulates, first, the
expression of ERR Plasmids and Adenoviral Vectors--
Expression plasmids for
wild-type and mutant human PGC-1, and luciferase reporters pGK1,
p
Adenoviral vectors were generated by CRE-lox-mediated recombination in
CRE8 cells (38). Briefly, CRE8 cells were transfected with 3 µg of
purified Cell lines, Infections, and Transfections--
293, CRE8 (38),
HepG2, SAOS2-GR(+) (39), and HtTA-1 (derived from HeLa; Ref. 35) cells
were cultured in Dulbecco's modified Eagle's medium supplemented with
9% fetal calf serum. When measuring ERR RNA Analysis--
Total RNA was isolated using the TRIzol
reagent and checked for its integrity by agarose gel electrophoresis
and ethidium bromide staining. RNA was converted to cDNA and
specific transcripts were quantitated by real-time PCR using the Light
Cycler system (Roche Diagnostics) as described previously (36). A
melting curve from 65 to 95 °C (0.05 °C/s) at the end of the
reaction was used to check the purity and nature of the product. In all cases, a single PCR product was detected. The sequences of the primers
and the sizes of the PCR products were as follows: AAGACAGCAGCCCCAGTGAA (exon 4) and ACACCCAGCACCAGCACCT (exon 5) for human ERR Western Analysis--
Cells were lysed in 100 mM
Tris, pH 7.5, 1% Nonidet P-40, 250 mM NaCl, 1 mM EDTA buffer. Cell lysates were subjected to Western analysis using antibodies against the HA epitope (HA.11, Babco), ERR Yeast Two-hybrid Interaction Assays--
Yeast carrying
Gal4-responsive PGC-1 Induces ERR
ERR PGC-1 Strongly Induces ERR PGC-1 Activates ERR
To determine the effect of PGC-1 on the activity of ERR ERR
Next, we determined the requirement of the physical interaction between
PGC-1 and ERR PGC-1 Can Induce the Expression of the Endogenous Gene MCAD in an
ERR
The distinct utilization of the L3 site of PGC-1 for interaction with
ERR Many members of the nuclear receptor superfamily are still orphan
receptors, with no known physiological ligands. The mechanisms that
regulate the activity of these receptors are not fully understood. The
results presented here provide evidence that the transcriptional coactivator PGC-1 is a key regulator of the orphan nuclear receptor ERR The activity of several orphan nuclear receptors is restricted by
expression of the receptors in specific tissues or at particular times
(reviewed in Ref. 17). The mechanisms that control the selective
expression of these receptors are often not clear. The observation that
PGC-1 induces ERR Interestingly, we find that in the absence of PGC-1, ERR The activation of ERR The in vivo functions of ERR We thank M. Senften and U. Muller for *
This work was supported by the Swiss National Science
Foundation, the University of Basel, the Novartis Stiftung (to S. N. S.), Roche Research Foundation (to D. K.), and the
Max Cloëtta Foundation (to A. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 41-61-267-2162;
Fax: 41-61-267-2149; E-mail: anastasia.kralli@unibas.ch.
Published, JBC Papers in Press, January 8, 2003, DOI 10.1074/jbc.M212923200
The abbreviations used are:
ERR
The Transcriptional Coactivator PGC-1 Regulates the Expression
and Activity of the Orphan Nuclear Receptor Estrogen-Related
Receptor
(ERR
)*
,
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(ERR
) is one
of the first orphan nuclear receptors identified. Still, we know little
about the mechanisms that regulate its expression and its activity. In
this study, we show that the transcriptional coactivator PGC-1, which
is implicated in the control of energy metabolism, regulates ERR
at
two levels. First, PGC-1 induces the expression of ERR
. Consistent
with this induction, levels of ERR
mRNA in vivo are highest in PGC-1 expressing tissues, such as heart, kidney, and muscle,
and up-regulated in response to signals that induce PGC-1, such as
exposure to cold. Second, PGC-1 interacts physically with ERR
and
enables it to activate transcription. Strikingly, we find that PGC-1
converts ERR
from a factor with little or no transcriptional
activity to a potent regulator of gene expression, suggesting that
ERR
is not a constitutively active nuclear receptor but rather one
that is regulated by protein ligands, such as PGC-1. Our findings
suggest that the two proteins act in a common pathway to regulate
processes relating to energy metabolism. In support of this hypothesis,
adenovirus-mediated delivery of small interfering RNA for ERR
, or of
PGC-1 mutants that interact selectively with different types of nuclear
receptors, shows that PGC-1 can induce the fatty acid oxidation enzyme
MCAD (medium-chain acyl-coenzyme A dehydrogenase) in an
ERR
-dependent manner.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 was identified in
1988 as a protein that shares significant sequence similarity to known
steroid receptors, such as the estrogen receptor (1). ERR
and its relatives ERR
and ERR
form a small family of orphan nuclear receptors that are evolutionarily related to the estrogen receptors ER
and ER
, and whose in vivo function is still unclear
(Refs. 1 and 2 and reviewed in Ref. 3). The three ERRs recognize and
bind similar DNA sequences, which include estrogen response elements
(EREs) recognized by ERs, as well as extended ERE half-sites that have
been termed ERR response elements (4-7). Despite their high similarity
to ligand-dependent receptors, ERRs seem to regulate transcription in the absence of known natural lipophilic agonist ligands. Searches for ligands have so far identified only synthetic antagonists. 4-Hydroxytamoxifen, which binds ERR
and ERR
but not
ERR
, and diethylstilbestrol, which binds all three ERRs, inhibit the
ability of ERRs to activate transcription (8, 9). In support of the
pharmacological data, elucidation of the crystal structure of the
ERR
LBD suggests that the ERRs assume the conformation of
ligand-activated nuclear receptors in the absence of ligand (10)
and that agonist ligands may not be required. These findings raise the
question of how the activity of these nuclear receptors is regulated.
is expressed
widely; however, particularly high ERR
mRNA levels have been
noted at sites of ossification during development, and in heart,
kidney, brown fat, and muscle in adults (Refs. 5 and 11-16 and
reviewed in Ref. 17). Thus, differential expression of ERR
may
contribute to the regulation of ERR
-mediated transcription. The
mechanisms and signals that regulate ERR
expression are not clear.
has been
reported variably as an activator, a repressor, or a DNA-binding factor
with little activity, suggesting that cellular factors determine the
ability of the ERR
protein to activate transcription (4-6, 11, 16,
18-21). Possible candidates for exerting such control are coactivators
that interact with ERR
, such as members of the p160 family of
coactivators. Overexpression of p160 coactivators can indeed enhance
ERR
-mediated transcription at model reporters (18-20). However,
ERR
shows weak transcriptional activity in cells that express
endogenous p160 coactivators (5, 20), suggesting that additional
cofactors must be important.
, TR
,
PPAR
, HNF4, and GR, and the transcription factors NRF-1, MEF2C, and
MEF2D, interact with, and may recruit, PGC-1 to the promoters of target
genes that execute the metabolic effects of PGC-1. Additional
transcription factors are likely to contribute to PGC-1 function.
mRNA and, second, the transcriptional activity
of the ERR
protein. Our findings indicate that ERR
by itself is a
poor activator of transcription and that PGC-1 fulfills a specific role
as a cofactor required for ERR
function. The interactions of PGC-1
and ERR
suggest that the two proteins act in a common pathway.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
LUC, and p
(cERE)x2-Luc (referred in this study as pERE-Luc),
have been described previously (35, 36). pSG5-mERR
for the
expression of full-length mouse ERR
was a gift of J.-M. Vanacker
(11). The human ERR
ligand-binding domain (LBD) was amplified by
PCR, using HeLa cDNA and primers CGAATTCATATGGGGCCCCTGGCAGTCGCT and
GCTCTAGACTATCAGTCCATCATGGCCTC, and cloned as an
NdeI-XbaI fragment into pcDNA3/Gal4DBD (36). The plasmid pSiERR
was generated by cloning the annealed primers GAT
CCC CGA GCA TCC CAG GCT TCT CAT TCA AGA GAT GAG AAG CCT GGG ATG CTC TTT
TTG GAA A (ERR
907/927-s) and AGC TTT TCC AAA AAG AGC ATC CCA GGC TTC
TCA TCT CTT GAA TGA GAA GCC TGG GAT GCT CGG G (ERR
907/927-a) into
pSUPER (37). Yeast expression vectors for Gal4-PGC-1 (aa 91-408,
wild-type or mutants) were generated by subcloning the PGC-1 cDNA
fragments encoding aa 91-408 in the vector pGBKT7
(Clontech). Plasmid pAS2-ERR
LBD expresses the
ERR
LBD fused to the Gal4 DBD and was generated by subcloning the NdeI-XbaI fragment encoding the ERR
LBD into
pAS2-1 (Clontech). pGBKT7/hER
.280C expresses
the human ER
LBD (starting at aa 280) fused to the Gal4 DBD. Human
PPAR
(full-length), RXR
(starting at aa 10) and ERR
(starting
at aa 221) fused to the Gal4 activation domain (AD) were
isolated in a yeast two-hybrid screen and were expressed from the
vector pACT2 (Clontech).
5 adenovirus DNA and 10 µg of pAdlox DNA shuttle plasmid
(38) carrying the cDNA for human PGC-1 (wild-type or mutant)
downstream of the cytomegalovirus promoter. For the expression of siRNA
from adenoviruses, the cytomegalovirus promoter and SV40
polyadenylation sequences of pAdlox were replaced by a DNA fragment
harboring the expression cassette of pSUPER (37) to generate AdSUPER.
The viral vector AdSiERR
expresses the same siRNA as pSiERR
. All
viruses were plaque-isolated to obtain single clones, titered by serial
dilution in CRE8 cultures that were grown under 0.6% Noble agar
overlay, and used as freeze-thaw lysates.
- and GR-mediated
transcription, cells were grown in medium with charcoal-stripped serum.
SAOS2-GR(+) and CRE8 cultures were supplemented with G418 (400 µg/ml). For infection, cells were plated at 2 × 105
per well in a six-well dish. The next day, viruses were added at a
multiplicity of infection of 40 or 100, as indicated in the figure
legends to Figs. 1 and 5, for 2 h. Cells were then washed and replenished with fresh medium. For transfections, cells were incubated with a calcium phosphate/DNA precipitate. Transfections included 0.2 µg of p6RlacZ for normalization of transfection
efficiency, and 1 µg of the luciferase reporters p
Luc, pERE-Luc,
or pGK1. The amounts of expression plasmids per transfection were as
follows: 0.5-1 µg of pcDNA3 or pcDNA3/HA-PGC-1, 1 µg of
pSG5 or pSG5-mERR
, 1 µg of pcDNA3/Gal4 DBD or
pcDNA3/ Gal4-ERR
LBD, and 1 µg of pSUPER or pSiERR
for siRNA.
Cell lysates were prepared 40-48 h after transfection and assayed for
luciferase activity as described (25). Luciferase values normalized to
the
-galactosidase activity are referred to as luciferase units.
(product 254 bp), TGTGGAGGTCTTGGACTTGGA (exon 4/5) and TCCTCAGTCATTCTCCCCAAA (exon
6) for MCAD (product 173 bp), CTGTGCCAGCCCAGAACACT (exon 4) and
TGACCAGCCCAAAGGAGAAG (exon 5) for 36B4/ribosomal protein P0 large
(product 201 bp), CGGGATGAGTTGGGAGGAG (exon 1) and CGGCGTTTGGAGTGGTAGAA (exon 2) for p21 (product 212 bp), GGAGGACGGCAGAAGTACAAA (exon 4) and
GCGACACCAGAGCGTTCAC (exon 5) for mouse ERR
(product 130 bp); primers
for mouse PGC-1 and actin have been described previously (36).
(4), or PGC-1 (sera from rabbits immunized with a PGC-1 fragment
bearing aa 1-293).
-galactosidase reporters (CG1945xY187,
Clontech) were transformed by the lithium acetate
transformation method with expression plasmids for Gal4 DBD and Gal4 AD
fusion proteins. Single transformants were grown to stationary phase, diluted 1:20 in selective media, grown for an additional 14 h at
30 °C in 96-well plates, and assayed for
-galactosidase activity as described previously (36).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Expression--
To identify genes that are
induced by PGC-1 and that could execute the cellular processes
activated by PGC-1, we have compared the RNA profiles of SAOS2-GR(+)
cells infected with adenoviral vectors expressing PGC-1 with those of
cells infected with control vectors expressing
-galactosidase or
GFP. Analysis of the RNA profiles after hybridization to high density
oligonucleotide arrays (data not shown) identified the orphan nuclear
receptor ERR
as a gene that is induced strongly by PGC-1. Expression
of PGC-1 led to the induction of ERR
at the RNA and protein level in
SAOS2-GR(+) cells, as well as in HtTA-1, HepG2, and 293 cells (Fig.
1A and data not shown).
Evaluation of protein levels by immunoblotting showed that the increase
in the levels of ERR
protein followed closely the appearance of
PGC-1 protein at different times after infection, suggesting that
ERR
induction is an early event upon PGC-1 expression (Fig.
1B).

View larger version (28K):
[in a new window]
Fig. 1.
PGC-1 induces ERR
at
the mRNA and protein level. A and B,
cells were infected with either GFP (control) or PGC-1 expressing
adenoviruses at a multiplicity of infection of 40 (SAOS2-GR(+)) or 100 (HtTA-1). A, RNA was isolated 24 h (HtTA-1) or 48 h (SAOS2-GR(+)) after infection. Levels of ERR
mRNA were
determined by quantitative RT-PCR, normalized to 36B4 levels, and
expressed relative to levels in control cells. Data represent the
mean ± S.D. of four experiments performed in duplicates. Cell
extracts prepared 24 h after infection were analyzed by
immunoblotting with antibodies against PGC-1 (upper panel)
or ERR
(lower panel). B, cell extracts
prepared at the indicated times after infection of HtTA-1 cells with a
PGC-1 expressing adenovirus were analyzed by immunoblotting with
antibodies against PGC-1 (upper panel) or ERR
(lower panel).
, extracts from uninfected HtTA-1 cells.
C and D, levels of PGC-1 and ERR
mRNA in
the indicated mouse tissues were determined by quantitative RT-PCR and
normalized to
-actin levels. C, relative mRNA levels
in tissues of a ~6-week-old female mouse. Levels in heart were set
equal to 100 for each transcript. Data represent mRNA levels
relative to expression in heart and are the mean ± range of
duplicate PCR reactions. SKM, skeletal muscle;
ADG, adrenal gland. D, relative mRNA levels
in brown fat and soleus muscle of four ~8-week-old male siblings,
kept at 23 °C (M1, M2; control) or
exposed to 4 °C for 6 h (M3, M4;
cold). Data shown are the mean ± range of PGC-1 and
ERR
mRNA levels normalized to
-actin levels in each RNA
sample.
mRNA levels have been reported to be high in PGC-1
expressing tissues, such as kidney, heart, muscle, and brown adipose tissue (5, 13-16, 22, 25, 29, 30). Analysis of mRNA expression
levels in tissues of adult mice shows that indeed ERR
levels
correlate with PGC-1 mRNA levels (Fig. 1C). PGC-1
expression in some of these tissues is known to be induced in response
to physiological signals, such as exposure to cold (22). Thus, to test
the ability of PGC-1 to induce ERR
in vivo, we determined PGC-1 and ERR
mRNA levels in the brown fat and muscle of mice that were exposed to cold for 6 h. As seen in Fig. 1D,
the increase in PGC-1 expression was accompanied by an increase in
ERR
mRNA levels, suggesting that PGC-1 can also induce ERR
expression in vivo.
-mediated Transcription--
The
finding that PGC-1 induces the expression of ERR
suggests that PGC-1
enhances also the activity of ERR
-regulated promoters. To test this,
we transfected 293 cells with a PGC-1 expression vector and a reporter
that carries the luciferase gene under the control of the minimal ADH
promoter with or without binding sites for ERR
(pERE-Luc and
p
Luc, respectively). PGC-1 strongly enhanced expression from the
pERE-Luc reporter, in a manner dependent on the presence of the binding
sites for ERR
(Fig. 2A).
Estradiol, tamoxifen, or hydroxytamoxifen did not affect the
enhancement by PGC-1 (data not shown), suggesting that it was not
mediated by receptors that are regulated by these ligands and can
recognize the same DNA binding site (e.g. ER
, ER
,
ERR
, or ERR
). To confirm that endogenous, PGC-1-induced ERR
was mediating the effect of PGC-1 on the pERE-Luc reporter, we
determined the effect of inhibiting the expression of ERR
. For this,
cells were transfected with a vector expressing a small interfering
(si) RNA specific for ERR
(pSiERR
) (37). Expression of the
ERR
-specific siRNA led to a decrease in ERR
mRNA levels (Fig.
2B) and a decrease in the PGC-1-mediated induction of the
luciferase reporter, demonstrating that endogenous ERR
was required
for the PGC-1 effect (Fig. 2C). In the absence of PGC-1,
pSiERR
decreased ERR
expression (Fig. 2B) but had no
effect on the pERE-Luc reporter (Fig. 2C), suggesting that
in this context ERR
was not transcriptionally active.

View larger version (18K):
[in a new window]
Fig. 2.
PGC-1 induces
ERR
-mediated transcription. A,
293 cells were transfected with a luciferase reporter driven by either
just the minimal ADH promoter (p
Luc) or 2 EREs upstream
of the minimal ADH promoter (pERE-Luc) and either the
control vector pcDNA3 or a PGC-1 expression vector. Data are the
mean ± S.D. of luciferase activities from three experiments
performed in duplicates. B, 293 cells were transfected with
the empty vector pSUPER (37) or the vector expressing siRNA for ERR
(pSiERR
) and either pcDNA3 (+vector) or
the PGC-1 expression vector pcDNA3/HA-PGC-1 (+PGC-1).
Transfection efficiency was 40-50%. RNA was prepared 48 h later.
ERR
mRNA levels were determined by quantitative RT-PCR and
normalized to levels of 36B4. Data are the average of two experiments
performed in duplicates. C, 293 cells were transfected with
the pERE-Luc reporter, a control or PGC-1 expression vector as
indicated, and either the control pSUPER or the siRNA expressing
pSiERR
. Data represent the mean ± S.D. of luciferase
activities from two experiments performed in duplicates.
at the Protein Level--
PGC-1 interacts
physically with many nuclear receptors and enhances their
transcriptional activity (reviewed in Ref. 34). Thus, PGC-1 could also
interact with ERR
. In this case, the increased ERR
-mediated
transcription could be the combined result of PGC-1 inducing ERR
levels and enhancing ERR
activity. To address this, we first asked
whether overexpression of ERR
would lead to the same phenotype as
PGC-1 expression. If the only function of PGC-1 were to increase ERR
levels, we would expect that exogenous ERR
expression would mimic
the PGC-1 effect. Surprisingly, overexpression of ERR
had very
little effect on pERE-Luc (<2-fold), suggesting that ERR
alone was
not sufficient for the transcriptional activation of this reporter
(Fig. 3A). Coexpression of
PGC-1 with ERR
led to an increase in luciferase expression that was
stronger than that seen with just endogenous ERR
, indicating that
PGC-1 activated the exogenously introduced ERR
(Fig.
3A).

View larger version (17K):
[in a new window]
Fig. 3.
PGC-1 activates ERR
,
which by itself is a weak activator of transcription.
A, 293 cells were transfected with the pERE-Luc reporter, a
control or PGC-1 expression vector as indicated, and either the pSG5
vector (endogenous) or the pSG5-mERR
expression vector
(+ERR
) (6). Data are the mean ± S.D. of luciferase
activities from three experiments performed in duplicates.
B, 293 cells were transfected with the Gal4-responsive
luciferase reporter pGK1, an expression vector for either the Gal4 DBD
or a fusion of the ERR
LBD to the Gal4 DBD, and either vector alone
or PGC-1 expression vector. Data are from one representative experiment
performed in triplicates and are expressed relative to the activity of
Gal4-ERR
LBD in the absence of PGC-1.
directly, we
evaluated the consequence of PGC-1 expression on the activity of a Gal4
DBD-ERR
LBD chimera, using a Gal4-responsive luciferase reporter. In
this context, endogenous ERR
does not interfere with the luciferase
readout. As seen in Fig. 3B, Gal4-ERR
LBD by itself
activated transcription modestly, ~2-fold, suggesting that the LBD of
ERR
carries only a weak transcriptional activation function.
Addition of PGC-1 converted the Gal4-ERR
LBD fusion to a strong
activator of transcription, indicating that PGC-1 enables the
transcriptional function of ERR
(Fig. 3B).
Interacts with PGC-1 via an Atypical L-rich Box--
PGC-1
harbors three Leu-rich motifs (L1, L2, and L3), one of which
(L2) bears the consensus LXXLL sequence present in many proteins that interact with the LBD of nuclear receptors. The L2 motif
serves as the major binding site for many nuclear receptors, and
mutations in L2 disrupt the interactions of PGC-1 with nuclear receptors tested so far (24, 26, 35). Surprisingly, PGC-1 harboring a
mutant L2 (L2A) was still capable of interacting with ERR
in a yeast
two-hybrid assay; in the same context, the L2A mutant was severely
compromised for interaction with PPAR
, RXR
, and ER
(Fig.
4, A and B). In
previous studies, we had noted that the L3 site can mediate a weak
interaction with the glucocorticoid receptor (35). We thus tested the
contribution of the L3 site to the PGC-1/ERR
interaction. As seen in
Fig. 4, A and B, PGC-1 bearing a disruption of
just L3 (L3A) was also capable of interacting with ERR
, while the
double L2A/L3A mutation abolished the interaction. Mutations in motif
L1, alone or in combination with L2, had no effect on the physical
interaction of PGC-1 with ERR
(data not shown). Thus, we concluded
that motifs L2 and L3 can be used equivalently for physical
interactions between PGC-1 and ERR
, while L2 is the preferred site
for most other receptors (Fig. 4, A and B).

View larger version (23K):
[in a new window]
Fig. 4.
ERR
interacts with
the L3 as well as the L2 site of PGC-1. A and
B, yeast two-hybrid assay. A, interactions
between the L2/L3 containing PGC-1 fragment (aa 91-408) fused to the
Gal4 DBD, and the indicated receptors fused to the Gal4 AD. Data are
the mean ± S.D. of
-galactosidase activities from four
independent transformants. B, interactions between the LBD
of ERR
or ER
fused to the Gal4 DBD (Gal4-ERR
and Gal4-ER
,
respectively), and full-length PGC-1 (wild-type (wt) or
L2/L3 mutants) fused to the Gal4 AD. Interaction with ER
was assayed
in the presence of 10 µM 17
-estradiol. Data are the
mean ± S.D. of
-galactosidase activities from 12 yeast
transformants. C, activation of the ERR
LBD in mammalian
cells. 293 cells were transfected with the Gal4-responsive luciferase
reporter pGK1, the vector expressing the Gal4-ERR
LBD fusion, and
either vector alone (
), PGC-1 wild type (wt), or the
indicated PGC-1 mutants. Data are the mean ± S.D. of luciferase
activities from at least four experiments performed in
duplicates.
for the activation of the ERR
LBD in mammalian
cells, using the context of the Gal4-ERR
LBD chimera. Single
mutations in either L2 or L3 did not compromise the PGC-1 effect (Fig.
4C), suggesting that interaction via either site is
sufficient for activation of ERR
by PGC-1. The double L2A/L3A mutation abolished the activation, indicating that the physical interaction between the two proteins is necessary for the effect of
PGC-1 on the ERR
LBD (Fig. 4C).
-dependent Manner--
The ability of PGC-1 to
induce ERR
expression and activity predicts that PGC-1 should also
induce the expression of ERR
target genes. To test this, we
determined the effect of PGC-1 on the RNA levels of a proposed ERR
target, the MCAD, an enzyme in fatty acid oxidation (5, 13). As seen in
Fig. 5, PGC-1 expression led to the
induction of MCAD in HtTA-1 and SAOS2-GR(+) cells. To address whether
the induction was mediated by ERR
, we asked whether suppression of
ERR
expression affected the response of MCAD to PGC-1. Infection of
HtTA-1 cells with adenoviruses that express ERR
-specific siRNA led
to a decrease in ERR
mRNA levels (Fig. 5A), and a
reduced induction of MCAD (Fig. 5B), consistent with ERR
mediating the PGC-1 effect at the MCAD promoter.

View larger version (20K):
[in a new window]
Fig. 5.
PGC-1 induces the endogenous MCAD gene in an
ERR
-dependent manner.
A and B, HtTA-1 cells were infected with either
control (AdSUPER) or siERR
expressing
(AdSiERR
) adenoviruses on day 1 and either GFP- or
PGC-1-expressing adenoviruses on day 2. RNA was harvested on day 3, and
mRNA levels for ERR
and MCAD were analyzed by quantitative
RT-PCR, normalized to 36B4 levels, and expressed relative to levels in
cells infected with AdSUPER/GFP viruses. Data represent the mean ± S.D. of three experiments performed in duplicates. C and
D, SAOS2-GR(+) cells were infected with adenoviruses
expressing either GFP or PGC-1 (wild type (wt) or mutants
L2A, L3A, or double mutant L2A/L3A). C, 24 h after
infection cells were treated with either 50 nM
corticosterone (+H) or just vehicle ethanol
(
H). RNA was harvested 8 h after hormone addition,
and p21 mRNA levels were determined by quantitative RT-PCR,
normalized to 36B4 levels, and expressed relative to levels in cells
infected with GFP virus and treated with just ethanol. Data represent
the mean ± range of duplicates of one experiment. D,
RNA was harvested 48 h after infection, and MCAD mRNA levels
were determined by quantitative RT-PCR, normalized to 36B4 levels, and
expressed relative to levels in cells infected with GFP virus. Data
represent the mean ± S.D. of two experiments performed in
duplicates. Wild-type, L2A, L3A, and L2A/L3A mutants were expressed at
similar levels, as determined by Western blot analysis.
and not other receptors like GR suggests that mutations in the
L2 and L3 sites could be used to diagnose the type of nuclear receptors
that mediate specific functions of PGC-1. Functions that are mediated
by receptors utilizing the L2 site should be abrogated by the single
PGC-1 mutation L2A, while functions that rely on ERR
should be
disrupted only by the double L2A/L3A and not the single L2A mutation.
To test this, we infected SAOS2-GR(+) cells that express GR from a
stably integrated locus with adenoviruses expressing PGC-1, wild-type
or mutant variants. As predicted, the glucocorticoiddependent
induction of the endogenous GR target p21 (39) was enhanced by both
wild-type PGC-1 and the L3A mutant, but not by the L2A mutant (Fig.
5C). In contrast, induction of MCAD in the same cells was
not affected by the L2A mutation and was only abolished by the double
L2A/L3A mutation (Fig. 5D). These findings indicate that the
L2 and L3 sites of PGC-1 are indeed used selectively by different
nuclear receptors to recruit PGC-1 at their respective endogenous
target genes.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
. PGC-1 acts at two levels. First, it induces ERR
expression, and second, it associates with ERR
and enables the transcriptional activation of ERR
target genes. PGC-1 expression is known to be
regulated in a tissue-selective manner by physiological signals that
relay metabolic needs (22, 28, 31-33). Accordingly, PGC-1 function has
been implicated in the regulation of energy metabolism (Refs. 23, 24,
and 31 and reviewed in Ref. 34). Our findings suggest that ERR
functions in PGC-1-regulated pathways, where it may contribute to the
transcriptional activation of genes important for energy homeostasis.
mRNA levels provides a molecular explanation
for the high ERR
expression in heart, kidney, muscle, and brown fat,
i.e. tissues that express PGC-1. Moreover, it suggests physiological signals that are likely to control ERR
expression, as
shown here for exposure to cold in brown fat and muscle. In support of
these findings, Ichida et al. have recently shown that fasting, which is known to induce PGC-1 expression in the liver (28,
33), also increases ERR
mRNA levels (40). The spatial and
temporal correlation of PGC-1 and ERR
expression implies that ERR
induction is an early, and possibly direct, outcome of PGC-1 action.
Future studies must address whether PGC-1 acts directly at the ERR
promoter. Additional regulatory mechanisms may restrict or enhance
ERR
induction by PGC-1, in a tissue- or physiological
state-dependent manner.
is a very
weak activator of transcription. Coexpression of PGC-1 enables potent
transcriptional activation by ERR
. These findings suggest that
ERR
is not a constitutively active receptor and that transformation
into an active form is favored by binding to protein ligands, such as
PGC-1, rather than to small lipophilic ligands. Expression levels of
PGC-1 may explain why ERR
has been reported as an efficient
transcriptional activator in some cells (e.g. ROS 17.2/8)
and a poor activator in others (4-6, 11, 16, 18-21). Many established
cell lines express very low, if any, levels of PGC-1. Importantly, the
ability of PGC-1 to activate ERR
at the protein level predicts that
physiological signals that induce PGC-1 are likely to activate
ERR
-mediated transcription, even in the absence of increased ERR
expression.
at the protein level requires the physical
interaction of PGC-1 with ERR
. Surprisingly, this interaction differs from that of PGC-1 with other nuclear receptors. While PGC-1
recognizes most receptors tested until now (GR, ER
, TR
, RXR
,
RAR
, PPAR
, PPAR
, HNF4) via the canonical LXXLL
motif L2, it can interact with ERR
equally well via the L2 or the L3 site. Similar to our findings, Huss et al. have recently
shown that ERR
, as well as the related receptor ERR
, bind the L3
site of PGC-1 (41), suggesting that the L3-mediated interaction is characteristic of the ERR subfamily of receptors. Interestingly, the
differential utilization of the Leu-rich motifs can be used to dissect
the receptors that mediate specific PGC-1 functions, as shown by the
fact that L2A mutations disrupt GR-dependent, but not
ERR
-dependent, effects of PGC-1. Thus, the L2 and L3 mutants of PGC-1 may provide useful tools for elucidating the types of
receptors that recruit PGC-1 at distinct promoters.
are not yet defined. Based
on its ability to bind EREs and modulate some estrogen-responsive genes, ERR
has been proposed to modulate ER signaling and possibly play a role in ER-dependent tumors (6, 20, 21). A function of ERR
in bone development is supported by the high levels of ERR
at sites of ossification during embryogenesis, and the ability of
ERR
to promote osteoblast differentiation in vitro and to activate the promoter of the bone matrix protein osteopontin (11, 42).
Finally, the strong expression of ERR
in tissues with high capacity
for fatty acid oxidation, and its ability to bind the promoter of the
MCAD gene, suggest a role in the mitochondrial
-oxidation of fatty
acids (5, 13). Our findings support a function of ERR
in
PGC-1-stimulated cellular processes, such as fatty acid oxidation (24),
and possibly other aspects of energy homeostasis. Interestingly, the
close relationship of PGC-1 and ERR
activity may reflect not only an
involvement of ERR
in known PGC-1-regulated functions, but also of
PGC-1 in processes where ERR
roles have been suggested, such as bone
development and homeostasis or breast cancer.
![]()
ACKNOWLEDGEMENTS
5
adenoviral DNA; L. Dolfini and M. Meyer for technical help; J.-M.
Vanacker and R. Agami for plasmids; J. Mertz for the anti-ERR
serum;
I. Rogatsky and M. J. Garabedian for the SAOS-GR(+) cells; R. Emter, D. Kressler, and U. Muller for discussions and comments on the manuscript.
![]()
FOOTNOTES
These two authors contributed equally to this work.
![]()
ABBREVIATIONS
, estrogen-related receptor
;
ER, estrogen receptor;
ERE, estrogen
response element;
LBD, ligand-binding domain;
DBD, DNA-binding domain;
AD, activation domain;
PPAR, peroxisome proliferator-activated
receptor;
GFP, green fluorescent protein;
siRNA, small interfering RNA;
NRF, nuclear respiratory factor;
MEF, myocyte enhancer factor;
TR, thyroid hormone receptor;
HNF, hepatocyte nuclear factor;
GR, glucocorticoid receptor;
aa, amino acid(s);
MCAD, medium-chain acyl-coenzyme A dehydrogenase;
ADH, alcohol
dehydrogenase;
RXR, retinoid X receptor;
RT, reverse
transcriptase.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Giguere, V.,
Yang, N.,
Segui, P.,
and Evans, R. M.
(1988)
Nature
331,
91-94[CrossRef][Medline]
[Order article via Infotrieve]
2.
Hong, H.,
Yang, L.,
and Stallcup, M. R.
(1999)
J. Biol. Chem.
274,
22618-22626 3.
Giguere, V.
(2002)
Trends Endocrinol. Metab.
13,
220-225[CrossRef][Medline]
[Order article via Infotrieve]
4.
Johnston, S. D.,
Liu, X.,
Zuo, F.,
Eisenbraun, T. L.,
Wiley, S. R.,
Kraus, R. J.,
and Mertz, J. E.
(1997)
Mol. Endocrinol.
11,
342-352 5.
Sladek, R.,
Bader, J. A.,
and Giguere, V.
(1997)
Mol. Cell. Biol.
17,
5400-5409[Abstract]
6.
Vanacker, J. M.,
Pettersson, K.,
Gustafsson, J. A.,
and Laudet, V.
(1999)
EMBO J.
18,
4270-4279[CrossRef][Medline]
[Order article via Infotrieve]
7.
Vanacker, J. M.,
Bonnelye, E.,
Chopin-Delannoy, S.,
Delmarre, C.,
Cavailles, V.,
and Laudet, V.
(1999)
Mol. Endocrinol.
13,
764-773 8.
Tremblay, G. B.,
Kunath, T.,
Bergeron, D.,
Lapointe, L.,
Champigny, C.,
Bader, J. A.,
Rossant, J.,
and Giguere, V.
(2001)
Genes Dev.
15,
833-838 9.
Coward, P.,
Lee, D.,
Hull, M. V.,
and Lehmann, J. M.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
8880-8884 10.
Greschik, H.,
Wurtz, J. M.,
Sanglier, S.,
Bourguet, W.,
van Dorsselaer, A.,
Moras, D.,
and Renaud, J. P.
(2002)
Mol. Cell
9,
303-313[CrossRef][Medline]
[Order article via Infotrieve]
11.
Bonnelye, E.,
Vanacker, J. M.,
Dittmar, T.,
Begue, A.,
Desbiens, X.,
Denhardt, D. T.,
Aubin, J. E.,
Laudet, V.,
and Fournier, B.
(1997)
Mol. Endocrinol.
11,
905-916 12.
Bonnelye, E.,
Vanacker, J. M.,
Spruyt, N.,
Alric, S.,
Fournier, B.,
Desbiens, X.,
and Laudet, V.
(1997)
Mech. Dev.
65,
71-85[CrossRef][Medline]
[Order article via Infotrieve]
13.
Vega, R. B.,
and Kelly, D. P.
(1997)
J. Biol. Chem.
272,
31693-31699 14.
Shi, H.,
Shigeta, H.,
Yang, N.,
Fu, K.,
O'Brian, G.,
and Teng, C. T.
(1997)
Genomics
44,
52-60[CrossRef][Medline]
[Order article via Infotrieve]
15.
Shigeta, H.,
Zuo, W.,
Yang, N.,
DiAugustine, R.,
and Teng, C. T.
(1997)
J. Mol. Endocrinol.
19,
299-309[Abstract]
16.
Vanacker, J. M.,
Bonnelye, E.,
Delmarre, C.,
and Laudet, V.
(1998)
Oncogene
17,
2429-2435[CrossRef][Medline]
[Order article via Infotrieve]
17.
Giguere, V.
(1999)
Endocr. Rev.
20,
689-725 18.
Xie, W.,
Hong, H.,
Yang, N. N.,
Lin, R. J.,
Simon, C. M.,
Stallcup, M. R.,
and Evans, R. M.
(1999)
Mol. Endocrinol.
13,
2151-2162 19.
Zhang, Z.,
and Teng, C. T.
(2000)
J. Biol. Chem.
275,
20837-20846 20.
Lu, D.,
Kiriyama, Y.,
Lee, K. Y.,
and Giguere, V.
(2001)
Cancer Res.
61,
6755-6761 21.
Kraus, R. J.,
Ariazi, E. A.,
Farrell, M. L.,
and Mertz, J. E.
(2002)
J. Biol. Chem.
277,
24826-24834 22.
Puigserver, P.,
Wu, Z.,
Park, C. W.,
Graves, R.,
Wright, M.,
and Spiegelman, B. M.
(1998)
Cell
92,
829-839[CrossRef][Medline]
[Order article via Infotrieve]
23.
Wu, Z.,
Puigserver, P.,
Andersson, U.,
Zhang, C.,
Adelmant, G.,
Mootha, V.,
Troy, A.,
Cinti, S.,
Lowell, B.,
Scarpulla, R. C.,
and Spiegelman, B. M.
(1999)
Cell
98,
115-124[CrossRef][Medline]
[Order article via Infotrieve]
24.
Vega, R. B.,
Huss, J. M.,
and Kelly, D. P.
(2000)
Mol. Cell. Biol.
20,
1868-1876 25.
Knutti, D.,
Kaul, A.,
and Kralli, A.
(2000)
Mol. Cell. Biol.
20,
2411-2422 26.
Tcherepanova, I.,
Puigserver, P.,
Norris, J. D.,
Spiegelman, B. M.,
and McDonnell, D. P.
(2000)
J. Biol. Chem.
275,
16302-16308 27.
Michael, L. F.,
Wu, Z.,
Cheatham, R. B.,
Puigserver, P.,
Adelmant, G.,
Lehman, J. J.,
Kelly, D. P.,
and Spiegelman, B. M.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
3820-3825 28.
Yoon, J. C.,
Puigserver, P.,
Chen, G.,
Donovan, J.,
Wu, Z.,
Rhee, J.,
Adelmant, G.,
Stafford, J.,
Kahn, C. R.,
Granner, D. K.,
Newgard, C. B.,
and Spiegelman, B. M.
(2001)
Nature
413,
131-138[CrossRef][Medline]
[Order article via Infotrieve]
29.
Larrouy, D.,
Vidal, H.,
Andreelli, F.,
Laville, M.,
and Langin, D.
(1999)
Int. J. Obes. Relat. Metab. Disord.
23,
1327-1332[CrossRef][Medline]
[Order article via Infotrieve]
30.
Esterbauer, H.,
Oberkofler, H.,
Krempler, F.,
and Patsch, W.
(1999)
Genomics
62,
98-102[CrossRef][Medline]
[Order article via Infotrieve]
31.
Lehman, J. J.,
Barger, P. M.,
Kovacs, A.,
Saffitz, J. E.,
Medeiros, D. M.,
and Kelly, D. P.
(2000)
J. Clin. Invest.
106,
847-856[Medline]
[Order article via Infotrieve]
32.
Goto, M.,
Terada, S.,
Kato, M.,
Katoh, M.,
Yokozeki, T.,
Tabata, I.,
and Shimokawa, T.
(2000)
Biochem. Biophys. Res. Commun.
274,
350-354[CrossRef][Medline]
[Order article via Infotrieve]
33.
Herzig, S.,
Long, F.,
Jhala, U. S.,
Hedrick, S.,
Quinn, R.,
Bauer, A.,
Rudolph, D.,
Schutz, G.,
Yoon, C.,
Puigserver, P.,
Spiegelman, B.,
and Montminy, M.
(2001)
Nature
413,
179-183[CrossRef][Medline]
[Order article via Infotrieve]
34.
Knutti, D.,
and Kralli, A.
(2001)
Trends Endocrinol. Metab.
12,
360-365[CrossRef][Medline]
[Order article via Infotrieve]
35.
Knutti, D.,
Kressler, D.,
and Kralli, A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
9713-9718 36.
Kressler, D.,
Schreiber, S. N.,
Knutti, D.,
and Kralli, A.
(2002)
J. Biol. Chem.
277,
13918-13925 37.
Brummelkamp, T. R.,
Bernards, R.,
and Agami, R.
(2002)
Science
296,
550-553 38.
Hardy, S.,
Kitamura, M.,
Harris-Stansil, T.,
Dai, Y.,
and Phipps, M. L.
(1997)
J. Virol.
71,
1842-1849[Abstract]
39.
Rogatsky, I.,
Trowbridge, J. M.,
and Garabedian, M. J.
(1997)
Mol. Cell. Biol.
17,
3181-3193[Abstract]
40.
Ichida, M.,
Nemoto, S.,
and Finkel, T.
(2002)
J. Biol. Chem.
277,
50991-50995 41.
Huss, J. M.,
Kopp, R. P.,
and Kelly, D. P.
(2002)
J. Biol. Chem.
277,
40265-40274 42.
Bonnelye, E.,
Merdad, L.,
Kung, V.,
and Aubin, J. E.
(2001)
J. Cell Biol.
153,
971-984
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
V. Giguere Transcriptional Control of Energy Homeostasis by the Estrogen-Related Receptors Endocr. Rev., October 1, 2008; 29(6): 677 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bombail, S. MacPherson, H. O.D. Critchley, and P. T.K. Saunders Estrogen receptor related beta is expressed in human endometrium throughout the normal menstrual cycle Hum. Reprod., September 4, 2008; (2008) den298v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Wright, I. G. Maroulakou, J. Eldridge, T. L. Liby, V. Sridharan, P. N. Tsichlis, and R. C. Muise-Helmericks VEGF stimulation of mitochondrial biogenesis: requirement of AKT3 kinase FASEB J, September 1, 2008; 22(9): 3264 - 3275. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hummasti and P. Tontonoz Adopting New Orphans into the Family of Metabolic Regulators Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Greschik, M. Althage, R. Flaig, Y. Sato, V. Chavant, C. Peluso-Iltis, L. Choulier, P. Cronet, N. Rochel, R. Schule, et al. Communication between the ERR{alpha} Homodimer Interface and the PGC-1{alpha} Binding Surface via the Helix 8-9 Loop J. Biol. Chem., July 18, 2008; 283(29): 20220 - 20230. [Abstract] [Full Text] [PDF] |
||||
![]() |
|