Originally published In Press as doi:10.1074/jbc.M210440200 on January 2, 2003
J. Biol. Chem., Vol. 278, Issue 11, 9134-9141, March 14, 2003
A Synergy Control Motif within the Attenuator Domain of
CCAAT/Enhancer-binding Protein
Inhibits Transcriptional
Synergy through Its PIASy-enhanced Modification by SUMO-1 or
SUMO-3*
Lalitha
Subramanian
,
Mark D.
Benson§, and
Jorge A.
Iñiguez-Lluhí
¶
From the
Department of Pharmacology and
§ Medical Scientist Training Program, University of
Michigan Medical School, Ann Arbor, Michigan 48109-0632
Received for publication, October 11, 2002, and in revised form, December 30, 2002
 |
ABSTRACT |
One of the most common forms of functional
interaction among transcription factors is the more than additive
effect at promoters harboring multiple copies of a response element.
The mechanisms that enable or control synergy at such compound response
elements are poorly understood. We recently defined a common motif
within the negative regulatory regions of multiple factors that
operates by regulating their transcriptional synergy. We have
identified such a synergy control (SC) motif embedded within the
"attenuator domain" of CCAAT/enhancer-binding protein
(C/EBP
), a key regulator of energy homeostasis and cellular
differentiation. A Lys159
Arg substitution within
the SC motif does not alter C/EBP
activity from a single site but
leads to enhanced transactivation from synthetic or natural compound
response elements. The sequence of SC motifs overlaps with the recently
defined consensus SUMO modification site, and we find that the SC motif
is the major site of both SUMO-1 and SUMO-3 modification in C/EBP
.
Furthermore, the disruption of SC motif function is accompanied by loss
of SUMO but not ubiquitin modification. C/EBP
interacts directly with the E2 SUMO-conjugating enzyme Ubc9 and can be SUMOylated in
vitro using purified recombinant components. Notably, we find that PIASy has E3-like activity and enhances both SUMO-1 and SUMO-3 modification of C/EBP
in vivo and in vitro.
Our results indicate that SUMO modification of SC motifs provides a
means to rapidly control higher order interactions among transcription
factors and suggests that SUMOylation may be a general mechanism to
limit transcriptional synergy.
 |
INTRODUCTION |
One of the most pervasive forms of interaction between
transcription factors is the synergistic response resulting from the recruitment of an activator to multiple copies of a recognition site
(1, 2). Transcriptional synergy from such compound response elements
provides a means to control both the level and specificity of gene
expression (3), yet the mechanisms by which synergy is controlled are
still relatively poorly understood.
Through a genetic approach, our laboratory has elucidated the function
of a novel protein motif, which limits the transcriptional synergy of
DNA binding regulators, including multiple steroid hormone receptors
and ETS1 (4). Disruption of these conserved synergy control
(SC)1 motifs dramatically
enhances synergistic activation from compound response elements without
altering the intrinsic activity from an individual binding site. SC
motifs are devoid of activation or repression properties, yet they are
both necessary and sufficient to restrict the synergy mediated by a
heterologous activation domain (4). We have proposed that SC motifs
serve to recruit synergy control factor(s) that directly limit
transcriptional synergy (4).
Our functional characterization of eight examples of SC motifs in
different regulators revealed that the critical features for SC motif
function include a branched aliphatic residue at the first position
followed by invariant Lys and Glu residues at positions 2 and 4 (see
Fig. 1 and Ref. 4). The core of the motif is preceded and/or followed
by Pro residues in a region that often varies in size in different
species, suggesting that the motif may lie between secondary structure
elements or within a loop that can tolerate insertions (4).
In addition to the cases we have examined, matches to our definition of
SC motifs occur frequently within documented negative regulatory
regions of numerous unrelated transcription factors (4). These
seemingly disparate regions may therefore operate via a common
mechanism (i.e. synergy control). A striking example is in
the CCAAT/enhancer-binding proteins (C/EBPs), where C/EBP
and -
harbor highly conserved SC motifs in previously defined "attenuator" regions (5, 6). At least six members of the C/EBP
family have been isolated and characterized, C/EBP
to C/EBP
. They
all contain a highly conserved, basic leucine zipper dimerization and
DNA binding domain at the C terminus (7). Their divergent N-terminal
regions contain the transcriptional regulatory domains and specify
their diverse activities. Three conserved regions have been identified
in C/EBP
, -
, and -
that are involved in transcriptional
activation (8).
The
-isoform of C/EBP is a central regulator of energy homeostasis
(9) as it directly activates the transcription of many metabolically
important genes (10, 11) and also plays pivotal roles in growth and
differentiation (12-18). Genes regulated by C/EBP
usually harbor
multiple binding sites like in the case of the peroxisome
proliferator-activated receptor
promoter (19) or the
myeloperoxidase enhancer (20). C/EBP
often functions synergistically
with other transcription factors like peroxisome proliferator-activated
receptor
or PU.1 (21, 22). For example, cross-regulation between
peroxisome proliferator-activated receptor
and C/EBP
is a key
component of the transcriptional control during adipogenesis (23, 24).
Regulatory mechanisms that affect C/EBP
synergy are therefore likely
to have a profound impact on its function.
We have hypothesized that the function of SC motifs may be regulated
through post-translational modification of the critical Lys residue
(4), especially since Arg is not functional at this position.
Interestingly, soon after our description of SC motifs, the consensus
site for modification by the ubiquitin-like protein SUMO (Fig. 1) came
into sharper focus, and it became apparent that our current definition
of SC motifs could be viewed as a special case of the more general
SUMOylation consensus.
SUMOylation is a reversible process that regulates the function of
target proteins in a manner akin to phosphorylation. The functional
consequences of SUMOylation are poorly understood but do not directly
involve targeting for proteasomal degradation (25). Three different
isoforms of SUMO are present in mammals, but whether they subserve
different roles is unknown. As in the case of ubiquitination,
preparation of SUMO for modification of proteins involves two steps
carried by specific E1 activating (SAE1/SAE2) and E2 transfer (UBC9)
enzymes. During ubiquitination, a third Ub-ligase or E3 component
conveys substrate recognition, often in a signal-regulated manner (26,
27). Although SUMOylation can be achieved without an E3 activity
in vitro (28), recent studies indicate that proteins like
RanBP2 (29) and members of the PIAS family (30-32) can have E3-like
activity for SUMO conjugation.
In an effort to examine the generality of SC motif function and to
explore its mode of action, we have probed the functional significance of the SC motif in C/EBP
and the role of SUMO
modification in its function.
 |
EXPERIMENTAL PROCEDURES |
Mammalian Expression Plasmids--
The pCDNA3-based
expression plasmid for the p42 form of mouse C/EBP
was provided by
Dr. Ormond MacDougald and is described in Ref. 33. This
plasmid (pCDNA3 p42) contains engineered silent restriction sites
for ease of manipulation. The K159R substitution was generated by PCR
and then transferred to p42 as a 538-bp XhoI/KpnI fragment (pCDNA3 p42 K159R). The C-terminal region of p42 was amplified with primers 5'-CGCAACAGAAGGTGCTCGAGTTGACCAGTGACAAT-3' and 5'-CTAGAAGCTTCTAA TGATGATGGTGGTGATGGTCGACCGCGCAGTTGCCCATGGCCTTG ACC-3' to add a C-terminal hexahistidine tag and transferred into the
XhoI and Hind III sites of the WT and K159R p42
plasmids (pCDNA3 p42 His and pCDNA3 p42 K159R His). The
pCDNA3 HA SUMO-1, pCDNA3 HA SUMO-3, and pCDNA3 HA
ubiquitin were kind gifts of Dr. Kim Orth (University of
Texas Southwestern), and the pCMVFLAG PIASy plasmid was a kind gift of
Dr. Tae-Hwa Chun (University of Michigan).
Reporter Plasmids--
The p
ODLO 02 parental vector contains
a polylinker upstream of a minimal Drosophila alcohol
dehydrogenase promoter (adh
33 to +53) and the luciferase
gene. The oligonucleotides 5'-GATCCTGATTGCGCAATCGA-3' and
5'-GATCTCGATTGCGCAATCAG-3', containing a single consensus C/EBP site,
were annealed and ligated into the BamHI and
BglII sites of p
ODLO 02 to yield p
(CAAT)1-Luc.
Ligation of BseRI/BglII and
BamHI/BseRI fragments of the same vector yielded
p
(CAAT)2-Luc. The same procedure using p
(CAAT)2-Luc yielded
p
(CAAT)4-Luc. The p
TAT glucocorticoid response units
reporter consists of a fusion of 668- and 300-bp fragments
corresponding to the
5.5 and
2.5 kb glucocorticoid response units
of the rat tyrosine aminotransferase gene (34) inserted at the
BamHI and BglII sites of p
ODLO 02.
Bacterial Expression Plasmids--
The human Ubc9 coding
sequence was amplified with primers
5'-GCTACGGATCCATGAGTGAGATCGCCCTCAGCAGACTCGCCCAG-3' and
5'-GGAGTGCCTTGGCCCCAAG TCCGGTGGTGGTGGTGGAATTCAAAGATC-3', digested with
BamHI and EcoRI, and transferred to the same
sites of the pGEX-KG vector (35) to yield pGEX-hUbc9. The expression
vectors for His SUMO-1GG, in which the last 4 residues of
SUMO-1 have been deleted, and GST-Ulp1 were kind gifts of Dr. Kim Orth.
The expression vector for bicistronic expression of GST SAE2 and SAE1
(28) was a kind gift of Dr. R. T. Hay. The sequences of all of the
constructed plasmids were confirmed by sequencing.
Cell Culture, Transfections, and Immunoblotting--
Human
embryonic kidney 293T cells were maintained in Dulbecco's modified
Eagle's medium (Invitrogen) supplemented with 10% fetal bovine
serum. Cells were transfected by liposome-mediated transfection using
LipofectAMINE and Plus reagent (Invitrogen). In all cases, cells
received equimolar amounts of each type of expression plasmid to
control for promoter effects. For functional assays, 5 × 103 cells were seeded into 96-well plates and transfected
with the indicated amounts of expression plasmids, 30 ng of the
indicated reporter plasmid, and 10 ng of the control pRSV
gal plasmid
(36). The total amount of DNA was supplemented to 70 ng/well with pBSKS (
). Cells were lysed 36 h after transfection, and luciferase and
-galactosidase activities were determined as described previously (37). For SUMOylation/ubiquitination experiments, 2 × 106 cells were seeded in 10-cm plates and transfected with
the indicated amounts of expression plasmids. Cells were harvested
36 h post-transfection in 0.7 ml of urea lysis buffer (8 M urea, 0.5 M NaCl, 45 mM
Na2HPO4, 5 mM
NaH2PO4, 10 mM imidazole, Complete
miniprotease inhibitor mixture tablets (1 tablet/10 ml) (pH 8.0)) and
sonicated. For ubiquitination experiments, the cells were treated with
10 µM lactacystin for 1 h before harvest with urea
lysis buffer. Lysates were incubated with 0.1 ml of
Ni2+-NTA-agarose (Qiagen) for 1 h at room temperature
in a rotator. The resin was washed three times with 10 bed volumes of
wash buffer 1 (8 M urea, 0.4 M NaCl, 17.6 mM Na2HPO4, 32.4 mM
NaH2PO4, 10 mM imidazole (pH 6.75))
and three times with 10 bed volumes of wash buffer 2 (buffer 1 with 150 mM NaCl and no urea). Examination of the supernatants
revealed that the binding is quantitative under these conditions. For
Ulp1 treatment, beads were incubated with 3.5 µg of purified GST or
GST-Ulp1 for 60 min at 30 °C. Proteins were eluted by incubating at
90 °C in elution buffer (100 mM Tris-HCl, pH 6.8, 2%
SDS, 10% glycerol, 500 mM imidazole, 0.015% bromphenol blue, 10 mM dithiothreitol), resolved by SDS-PAGE, and
processed for immunoblotting. Membranes (Immobilon) were incubated with goat polyclonal anti-C/EBP
IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or monoclonal HA 11 anti IgG (Covance) or monoclonal anti-FLAG IgG (Sigma). Anti-goat IgG peroxidase conjugate (Santa Cruz
Biotechnology) or anti-mouse IgG peroxidase conjugate (Bio-Rad) were
used as secondary antibodies, and visualization was with Super Signal
West Femto substrates (Pierce). Images were captured with an Eastman
Kodak Co. Image Station 440 CF. All of the experiments were performed
at least twice with similar results.
Protein Expression and Purification--
BL21 DE3-CodonPlus
cells harboring the pGEX-hUbc9 or pGEX-SAE2/SAE1 expression vector and
BLR (DE3) pLysS cells (Novagen) containing pGEX-Ulp1 or pT7His
SUMO-1GG were grown at 37 °C in LB medium containing
carbenicillin, chloramphenicol, and tetracycline (50 µg/ml, 25 µg/ml, and 12 µg/ml). Cultures (1 liter;
A600 = 0.8) were induced with 1 mM
isopropyl-1-thio-
-D-galactopyranoside for 2 h at
37 °C. Cells were centrifuged at 8,000 × g for 15 min at 4 °C. For GST fusion proteins, the pellet was resuspended in buffer A (10 mM Tris-HCl (pH 8.0), 150 mM NaCl,
1 mM EDTA, 5 mM dithiothreitol, 10% glycerol,
and Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml)).
After lysozyme treatment (40 µg/ml for 30 min) and sonication at
4 °C, the suspension was centrifuged at 35,000 rpm at 4 °C for 30 min. The supernatant was incubated with 2 ml of glutathione-agarose
(Sigma) for 60 min at 24 °C. The matrix was washed (4 °C) with 10 bed volumes of buffer A without protease inhibitors and with 10 bed
volumes of buffer B (buffer A with 400 mM NaCl). Proteins
were eluted in buffer B (24 °C) supplemented with 20 mM
reduced glutathione. For His SUMO-1GG, cells were
resuspended and lysed in buffer C (50 mM sodium phosphate buffer, pH 8.0, 300 mM NaCl, 10% glycerol 10 mM imidazole, 5 mM
-mercaptoethanol Complete
miniprotease inhibitor mixture tablets (1 tablet/10 ml)). Incubation of
the extract was with 2 ml of Ni2+-NTA resin (Qiagen) for
1 h at 4 °C. The resin was washed with 10 bed volumes of buffer
C, followed by 2 bed volumes of buffer C containing 20 mM
imidazole. Protein was eluted in buffer C containing 250 mM
imidazole. All proteins were exchanged into buffer D (10 mM
Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 5 mM dithiothreitol, 10% glycerol) via gel filtration and
stored at
80 °C. For immunopurification of PIASy, COS-7 cells were
maintained and transiently transfected in 10-cm plates as described
above for 293T cells with 10 µg of expression plasmid,
pCMVFLAG-PIASy, or the empty pCMV FLAG. Cells were harvested after
36 h in Buffer E (20 mM Hepes, pH 7.5, 5 mM EDTA, 1 mM EGTA, 5% glycerol, 400 mM NaCl, Complete miniprotease inhibitor mixture tablets (1 tablet/10 ml)). The extracts were incubated with 50 µg of anti-FLAG
antibody (Sigma) for 1 h at 4 °C. Complexes were recovered
using 50 µl of protein A-Sepharose (Sigma) and washed three times in
buffer E with 200 mM NaCl and twice in 50 mM
Tris (pH 7.5), 5 mM MgCl2.
In Vitro Protein-Protein Interaction and SUMOylation
Assays--
Proteins were translated in vitro using the
T7-TNT Quick Coupled Transcription-Translation system
(Promega) in the presence of [35S]methionine using the
pCDNA3 p42, pCDNA3 p42 K159R, or control T7 Luc (Promega)
plasmids as templates. Binding reactions (50 µl) were carried out at
4 °C for 1 h and contained 1.2 nmol of purified GST or
GST-hUBC9 fusion proteins bound to 20 µl of glutathione-Sepharose 4B
(Amersham Biosciences) and 10 µl of 35S-labeled proteins
in a binding buffer containing 50 mM NaCl and 1 mg/ml
bovine serum albumin. The resin was washed four times with 1 ml of
0.1% Nonidet P-40 in phosphate-buffered saline. The beads and 2 µl
of the corresponding load were boiled in a final volume of 40 µl of
SDS-PAGE sample buffer, and 25% of the samples were resolved by
SDS-PAGE. The gels were fixed in 45% methanol, 10% acetic acid and
dried, and radioactive proteins were visualized using a PhosphorImager
(Amersham Biosciences). In vitro SUMOylation reactions (20 µl) were assembled on ice in 50 mM Tris, 5 mM MgCl2 (pH 7.5) and contained 1 µg of GST
SAE2/SAE1, 5 or 0.5 µg of GST hUBC9, 5 µg of
His-SUMO-1GG, 5 µl of in vitro translated
[35S]methionine-labeled p42 C/EBP
WT or K159R, and 10 µl of control or PIASy-containing beads as indicated. Reactions were
initiated by the addition of an ATP regeneration system (10 units/ml
creatine kinase, 25 mM phosphocreatine, 5 mM
ATP final concentrations) and pyrophosphatase (0.6 units/ml final
concentration) and incubated at 30 °C for 2 h. Disruption
buffer (50 mM Tris-HCl, pH 6.8, 1.67% SDS, 10% glycerol,
0.24 M
-mercaptoethanol, 0.015% bromphenol blue) was
added to terminate the reaction. The samples were heated at 95 °C
for 5 min, resolved by SDS-PAGE, and dried, and the radioactive proteins were visualized in a PhosphorImager. All of the results were
confirmed in at least two independent experiments.
 |
RESULTS |
Identification of a Synergy Control Motif in C/EBP
--
Mining
of the Swiss-Prot protein data base for the occurrence of SC motifs
allowed us to identify a number of transcription factors that harbor
conserved SC motifs. For several of them, like the progesterone
receptor, Sp3, C/EBP
, C/EBP
and c-Myb, the motifs reside in
demonstrated negative regulatory regions (4). In the case of C/EBP
,
the SC motif lies within an "attenuator" domain (5). By comparing
multiple sequences from distantly related vertebrates, we find that the
SC motif in C/EBP
constitutes a highly conserved small stretch
surrounded by regions of lower conservation (see Fig.
1A). This suggests an
evolutionary pressure for the preservation of this sequence and the
function it subserves.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of a synergy control motif in
C/EBP . A, schematic representation of
C/EBP . TE I, II, and
III, activation domains; NR, negative regulatory
region; b-ZIP, DNA-binding leucine zipper region. A plot of
sequence specific similarity among different species is shown
below. The alignment region corresponding to the synergy
control motif is expanded, and the core motif residues and the flanking
Pro residues are boxed. The consensus definition of SC
motifs and of SUMOylation sites is shown below.
B, left panel, HEK 293T cells were transiently
transfected as indicated under "Experimental Procedures" with 5 ng
of pCDNA3 (Vector), pCDNA3 p42 (WT), or
pCDNA3 p42 K159R (MUT) together with reporter plasmids,
harboring zero, one, two, or four C/EBP binding sites. Data represent
the average ± S.E. from 6-8 independent transfections done in
quadruplicate. Right panel, 293T cells were transiently
transfected as above but using the p TAT glucocorticoid response
units reporter, which harbors two enhancer regions of the rat
tyrosine aminotransferase gene containing multiple C/EBP sites. Data
represent the average ± S.E. of two independent transfections
done in quadruplicate.
|
|
To assess whether the SC motif in C/EBP
functions by inhibiting
transcriptional synergy, we replaced the predicted critical lysine at
position 159 with arginine. This substitution inactivates SC motif
function in all of the cases we have examined (4). We then compared the
activity of the WT and mutant proteins at promoters harboring zero,
one, two, or four C/EBP
sites. We chose 293T cells, since they do
not contain endogenous C/EBP
(38). As can be seen in Fig.
1B, WT C/EBP
activates the reporter with a single binding
site by 10-fold. Adding a second site enhances the activity only
2.8-fold, and adding two more sites does not significantly increase
transcription. These results indicate that the ability of C/EBP
to
engage in synergistic interactions is limited. The K159R mutant is
indistinguishable from the WT at a single site. However, the activity
of the mutant at the reporters with two and four sites is ~6- and
14-fold higher than that at a single site. This translates to a 2.5- and 5-fold higher activity of the mutant versus the WT
protein at these reporters. Thus, disruption of the SC motif leads to
enhanced transcriptional synergy, indicating that its normal function
is to restrict the potential of C/EBP
to synergize but without
affecting its intrinsic transactivation potential. Similar results were
obtained in CV-1 cells (not shown). Importantly, we also observed a
5-fold higher activity of the mutant C/EBP
from a reporter driven by
the natural enhancer regions of the rat tyrosine aminotransferase gene,
which harbor multiple C/EBP
sites (see Fig. 1B,
right) (34). This indicates that the effect is not
restricted to synthetic promoters.
Consistent with their comparable activities at a single site, Western
blot analysis indicated that the WT and mutant proteins are expressed
at equivalent levels (not shown). Furthermore, similar results were
observed at both higher and lower amounts of plasmid, ruling out
preferential squelching effects (not shown). Taken together, these
results confirm our assignment of this region of C/EBP
as a
functional synergy control motif and argue that the SC motif is
responsible for the described "attenuator" property of this region
(5).
The SC Motif in C/EBP
Is Modified in Vivo by SUMO-1 and
SUMO-3--
Our sequence definition of SC motifs, which is based
purely on functional effects, can be viewed as a subset of the more
general SUMO modification consensus (Fig. 1A). Therefore, we
tested whether the SC motif in C/EBP
can be modified by SUMO
isoforms in vivo. To this end, we co-transfected 293T cells
with expression vectors for His-tagged WT and mutant C/EBP
forms
with vectors for HA-tagged SUMO-1 or SUMO-3. Cells were lysed under
denaturing conditions to protect SUMOylated proteins from
isopeptidases. His-tagged C/EBP
forms were purified via metal
chelate chromatography, resolved by SDS-PAGE, and immunoblotted. As can
be seen in Fig. 2, when WT C/EBP
is
coexpressed with HA-SUMO-1 or HA-SUMO-3, we can detect ~91-kDa HA
immunoreactive bands corresponding to HA SUMO-1- and HA SUMO-3-modified
C/EBP
. The SUMO-3-modified form migrates slightly faster than the
SUMO-1 counterpart, presumably due to the smaller size of SUMO-3
versus SUMO-1. As is the case for other SUMO-modified proteins, the migration of modified forms is slower than that expected
for their molecular sizes. The slower migrating species can also be
detected as a minor band in the anti C/EBP blot for both SUMO-1 and
SUMO-3. As in the case of other targets (25), relative quantitation
revealed that less than 5% of the total C/EBP
is modified by either
SUMO isoform. This may reflect the transient and reversible nature of
this modification. Notably, these slower migrating forms were
completely absent in the case of the K159R mutant, although its
expression is indistinguishable from that of the WT protein. Comparable
results were obtained in COS-7 cells. These results show that C/EBP
is modified in vivo by SUMO-1 or SUMO-3 and argue strongly
that the SC motif is the main target for SUMO modification in C/EBP
.
Moreover, the fact that the K159R mutation disrupts both SC motif
function and SUMOylation implies that this modification is key for SC
motif function.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 2.
The SC motif in C/EBP
is modified in vivo by SUMO-1 and SUMO-3.
HEK 293T cells were transfected as described under "Experimental
Procedures" with 5 µg of pCDNA3 (Vector), pCDNA3
p42 His (WT), or pCDNA3 p42 K159R His (Mut)
along with 5 µg of pCDNA3 HA-SUMO-1 (top
panels) or pCDNA3 HA-SUMO-3 (bottom
panels). Cells were harvested under denaturing conditions,
and the His-tagged proteins were purified using Ni2+-NTA
columns. 30% of the protein preparations from individual 10-cm plates
were immunoblotted with anti-C/EBP (right) and anti-HA
(left) antibodies. The arrows indicate the
position of SUMO-modified species.
|
|
Ulp1 Can Remove SUMO-1 and SUMO-3 from C/EBP
--
The yeast
ubiquitin-like protein specific protease 1 (Ulp1) deconjugates SUMO
from the lysine
-amino group of modified proteins (39). This
deconjugase activity is specific for SUMO versus ubiquitin.
To confirm that the higher order species of C/EBP
that we observe is
a SUMO-modified form, we treated the purified C/EBP
preparations
with GST alone or with GST-Ulp1 (Fig. 3). In contrast to the GST treatment, we did not observe HA immunoreactive bands at ~91 kDa in SUMO-1 or SUMO-3 samples treated with GST-Ulp1. Instead, we saw a species of ~24 kDa corresponding to free SUMO. Ulp1
did not display nonspecific protease activity, since the unmodified
C/EBP
protein was not affected by the treatment. These results
suggest that C/EBP
can be modified by SUMO-1 and SUMO-3 and that
Ulp1 can remove either SUMO isoform from C/EBP
. Although the
cleavage of SUMO-1 from substrates by Ulp1 is well established, to our
knowledge, this is the first demonstration that SUMO-3-modified proteins can also be deconjugated by this yeast enzyme.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
Ulp1 can remove SUMO-1 and SUMO-3 from
C/EBP . HEK 293T cells were transfected with 5 µg each of
pCDNA3 p42 His and pCDNA3 HA SUMO-1 (left) or
pCDNA3 HA SUMO-3 (right) and treated as in Fig. 2.
Ni2+-NTA columns were washed in urea-free buffer, and
resin-bound proteins were treated with purified GST or GST-Ulp1 (3.5 µg) at 30 °C for 60 min. 30% of the protein preparations from
individual 10-cm plates were immunoblotted with anti-HA
(top) or anti-C/EBP (bottom) antibodies.
|
|
Disruption of the SC Motif Does Not Prevent
Ubiquitination--
Both ubiquitin and SUMO are linked to proteins
through Lys residues, and in the case of I
B, both modifications
appear to occur at the same site (40). Desterro et al. (40)
proposed that SUMO modification of I
B prevents its ubiquitination
and therefore contributes to the stabilization of this protein. We therefore explored whether C/EBP
is ubiquitinated and, if so, whether disruption of the SC motif alters this modification. We used
the same experimental paradigm as for SUMO modification and treated the
cells with the proteasome inhibitor lactacystin to allow the
accumulation of ubiquitinated proteins. As can be seen in the HA
immunoblot in Fig. 4, we can detect mono-
and polyubiquitinated forms of C/EBP
. To our knowledge, this is the
first demonstration that C/EBP
is ubiquitinated. Notably, we
observed an identical pattern using the K159R mutant. These results
clearly indicate that although ubiquitination is likely to be important
for the degradation of C/EBP
, the mechanism of action of the SC
motif does not involve preventing ubiquitination.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 4.
Disruption of the SUMOylation site does not
prevent ubiquitination. HEK 293T cells were transfected as
described under "Experimental Procedures" with 5 µg of pCDNA3
(Vector), pCDNA3 p42 His (WT), or pCDNA3
p42 K159R His (Mut) along with 5 µg of pCDNA3
HA-ubiquitin. Cells were harvested under denaturing conditions, and the
His-tagged proteins were purified using Ni2+-NTA columns.
30% of the protein preparations from individual 10-cm plates were
immunoblotted with anti-C/EBP (right) and anti-HA
(left) antibodies.
|
|
Ubc9 Interacts with C/EBP
Independently of SC Motif
Function--
Ubc9 (E2 SUMO-conjugating enzyme) is an essential
component of the SUMOylation pathway and can directly mediate the
conjugation of SUMO to target proteins. We therefore performed an
in vitro binding assay to determine whether C/EBP
can
interact with Ubc9. Full-length human Ubc9 was expressed in bacteria as
a GST fusion protein, coupled to glutathione-Sepharose beads, and
incubated with in vitro translated 35S-labeled
C/EBP
in its WT and K159R mutant forms as well as with luciferase as
a control. As shown in Fig. 5, both the
WT and mutant forms of C/EBP
interacted with GST-Ubc9 but not with
GST alone. The control protein luciferase did not bind to either
matrix. These results show that C/EBP
interacts with Ubc9 and that
the K159R mutation does not affect the interaction although it disrupts both SC motif function and SUMOylation.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5.
C/EBP interacts with
UBC9 independently of SUMOylation. Preparations of GST-hUbc9
fusion protein or GST were bound to glutathione-Sepharose beads and
incubated with 35S-labeled p42 C/EBP (p42
WT), p42 C/EBP K159R (p42 Mut), or luciferase
(Luc) prepared by in vitro transcription and
translation. Bound proteins as well as 20% of the initial material
(Load) were separated on a 10% SDS-PAGE gel and analyzed by
PhosphorImager.
|
|
PIASy Enhances SUMO-1 and SUMO-3 Modification of C/EBP
in Vivo
and in Vitro--
Recent reports suggest that members of the PIAS
family of proteins can enhance SUMO conjugation in vivo and
in vitro (31, 32). In order to initiate our analysis of the
role of PIAS proteins in C/EBP
SUMOylation and SC motif function, we
examined the effect of expressing PIASy on the extent of C/EBP
modification by either SUMO-1 or SUMO-3 in vivo. The results
in Fig. 6 show that expression of PIASy
enhances the extent of SUMOylation of p42C/EBP
WT, both with SUMO-1
and SUMO-3 (Fig. 6, A and B, respectively)
without altering the expression or recovery of C/EBP
. The slower
migrating band in the anti-C/EBP
blot was also enhanced to the same
extent, consistent with our assignment of this band as SUMO-modified
C/EBP
. Notably, we did not detect significant SUMO-1 or SUMO-3
modification of the K159R mutant either in the absence or presence of
PIASy. The enhancement of SUMO modification by PIASy was not limited to
C/EBP
, however, because immunoblot analysis of cell extracts with
anti-HA antibodies revealed that PIASy substantially enhanced general
SUMO-1 and SUMO-3 modification of cellular proteins (data not shown).
Unfortunately, the broad changes in SUMO modification levels upon PIASy
expression lead to global effects on transcription, presumably because
multiple transcription factors and coregulators (41, 42) are subject to
SUMO modification. This has prevented us from specifically assessing
the functional consequences of enhancing C/EBP
SUMOylation on its
activity (see "Discussion"). Taken together, our results indicate
that PIASy enhances the in vivo SUMO-1 and SUMO-3
modification of Lys159 in C/EBP
and reveal the novel
finding that the ability of PIASy to enhance SUMO modification is not
limited to SUMO-1 but also extends to the conjugation of SUMO-3.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
PIASy enhances SUMO-1 and SUMO-3 modification
of C/EBP in vivo and in
vitro. A, HEK 293T cells were transfected as
described under "Experimental Procedures" with 4 µg of pCDNA3
(Vector), pCDNA3 p42 His (WT), or pCDNA3
p42 K159R His (Mut); 4 µg of pCMV FLAG or pCMVFlag PIASy;
and 4 µg of pCDNA3 HA-SUMO-1. Cells were harvested under
denaturing conditions, and the His-tagged proteins were purified using
Ni2+-NTA columns. 20% of the protein preparations from
individual 10-cm plates were immunoblotted with anti-C/EBP
(left), anti-HA (center), or anti-FLAG
(left) antibodies. The arrows indicate the
positions of SUMO-modified species. B, experiment as in
A but using pCDNA3 HA-SUMO-3 instead of pCDNA3 HA
SUMO-1.
|
|
To investigate the mechanism of C/EBP
SUMOylation, we established an
in vitro SUMOylation system using purified recombinant SUMO-1, SUMO-activating (SAE1/SAE2) and -conjugating (Ubc9) proteins, and in vitro transcribed, 35S-labeled p42
C/EBP
WT and K159R proteins as substrates. In the case of the WT
form, a 2-h incubation at 37 °C produced a well defined higher
molecular mass C/EBP
band (~91 kDa) and a faint higher order slow
migrating species at ~101 kDa corresponding to mono- and probably
di-SUMOylated C/EBP
(Fig.
7A). Under these conditions,
more than 55% of the C/EBP
was in the mono-SUMOylated form. We did
not detect these species in the case of the K159R mutant. The formation
of these bands was dependent on the presence of SUMO-1 and the E1
(SAE2/SAE1) and E2 (Ubc9) activities. To examine the effect of PIASy,
we immunopurified the protein and carried out 30-min reactions in the
presence of either control beads derived from vector-transfected cells
or PIASy-loaded beads (Fig. 7B). At 30 min, the extent of
SUMO modification was only 30% in the control reaction, whereas in the
presence of PIASy, ~70% of the protein was modified. As in the
in vivo experiments, the K159R mutant was not modified. The
presence of PIASy in the beads was confirmed by immunoblotting (Fig.
7B, lower panel). This indicates that
PIASy accelerates the rate of SUMO modification even in the presence of
excess Ubc9. When similar reactions were carried out for 1 h but
with an amount of Ubc9 (0.5 µg) that supports modification of only a
small fraction of C/EBP
, PIASy enhanced the stochiometry of
SUMOylation to ~35% (Fig. 7C). Thus, our results indicate
that PIASy enhances the rate of SUMO modification of the SC motif in
C/EBP
both in vivo and in vitro and therefore has the properties of an E3 for conjugation of both SUMO-1 and SUMO-3.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7.
PIASy enhances the in vitro
SUMOylation of C/EBP . A, in vitro
translated 35S-labeled p42 C/EBP (WT) or p42
C/EBP K159R (MUT) were incubated as described under
"Experimental Procedures" alone or with the indicated purified
proteins: GST-SAE1/SAE2 (1 µg), GST-Ubc9 (5 µg),
His-SUMO-1GG (5 µg). Reactions (2 h, 30 °C) were
terminated by adding SDS-PAGE sample buffer. The samples were resolved
by SDS-PAGE and visualized using a PhosphorImager. B,
top panel, in vitro translated
35S-labeled p42 C/EBP wild type and mutant were
incubated alone or with purified proteins GST-SAE1/SAE2 (1 µg),
GST-Ubc9 (5 µg), and His-SUMOGG-1 (5 µg)
(Mix) and with 10 µl of immunopurified control or PIASy
beads (see "Experimental Procedures") as indicated. The samples
were incubated for 30 min and processed as in A. Bottom panel, anti-FLAG immunoblot of the samples.
C, samples were treated as in B except that the
reactions contained only 0.5 µg of GST-Ubc9 and were incubated for
1 h.
|
|
Taken as a whole, the data presented indicate that the synergy control
motif we have identified in C/EBP
is functional and is responsible
for the negative or attenuator functions attributed to this region.
Moreover, the SC motif constitutes a post-translational modification
site for SUMO-1 and -3. Since mutation of the critical lysine within
the SC motif disrupts both SUMO modification and function, our data
provide a direct link between SUMOylation and synergy control.
 |
DISCUSSION |
A Synergy Control Motif in C/EBP
Inhibits Its Transcriptional
Synergy--
We recently characterized the properties of a novel
functional region defined by one or more copies of a short amino acid motif that operates by restraining the ability of regulators to engage
in synergy (4). In the case of C/EBP
, an SC motif is present within
a region (amino acids 107-170) that Pei and Shih (5) identified as an
"attenuator" domain. As we anticipated (4), this study shows that
the ability of C/EBP
to engage in synergy is indeed regulated
through this SC motif. Disruption of the SC motif does not affect the
activity of C/EBP
at a single site, but it leads to a substantial
enhancement of activity at natural or synthetic compound response
elements. This brings the number of functionally confirmed examples of
SC motifs to nine, spanning three very different classes of
transcriptional regulators (nuclear receptors, ETS, and C/EBP) (4).
Thus, a common synergy control mechanism may be responsible for the
function of negative regulatory regions that harbor SC motifs.
Gene activation by C/EBP
relies on cooperation between three
separate trans-activation elements (TE-I through TE-III) that operate
by distinct mechanisms (43). It will be interesting to examine whether
one or more of these functions is affected by the SC motif. Notably,
the p30 isoform of C/EBP
, which antagonizes the effects of the
full-length p42 form, retains the SC motif as well as TE-III (44). We
are currently characterizing the effects of the SC motif in the context
of p30 and examining whether the activity of the SC motif extends to
synergy with other transcription factors. The recent characterization
of a region with SC motif properties in the Drosophila
activator Dorsal suggests that heterotypic effects are possible
(45).
SC Motifs as SUMO Acceptor Sites--
The convergence between the
SUMO modification and SC motif consensus sequences led us to test the
role of this modification in SC motif function. Our results, using a
transfection paradigm indicate that C/EBP
is modified by SUMO and
that the critical lysine within the SC motif is the major site for this
modification. Mutation of this site to Arg leads to concomitant loss of
SC motif function and SUMO modification, arguing for a critical role of SUMO in synergy control. This post-translational modification therefore
provides a means to rapidly regulate SC motif function. Although SUMO
modification of endogenously expressed C/EBP
remains to be
demonstrated, a key role for SUMO in the function of SC motifs is
supported by the fact that the site of SUMO modification in other
transcription factors maps to functional SC motifs like in the case of
the androgen and glucocorticoid receptors (46). In the case of
c-Myb, we proposed that the SC motif embedded in its C-terminal
negative region was involved in its function (4). Recent evidence by
Bies et al. supports this idea (47). Other factors such as
p53 and c-Jun are SUMO-modified (48), and disruption of the main
SUMOylation sites leads to an enhancement of activity. Interestingly,
in both cases, the modification site matches our definition of SC
motifs except for the first position, which is occupied by Phe and Leu
in p53 and c-Jun, respectively. If these regions do function as synergy
control motifs, our SC motif definition will have to relax the identity
at the first position to accommodate these hydrophobic residues.
Interestingly, although SUMO-1 and SUMO-3 are substantially divergent
in sequence, both isoforms can modify the SC motif of C/EBP
. Except
for the preferential SUMO-1 modification of Ran GAP1 (49), little is
known regarding the subtype specificity for modification of proteins.
In contrast to SUMO-1, the closely related SUMO-2 and -3 each harbor a
SUMO modification site, and SUMO-2 chains have been observed in
vivo (50). Whether these or other differences result in distinct
regulatory outcomes remains to be explored.
Many SUMO-1 modified proteins interact directly with Ubc9, and
mutagenesis studies of Ran GAP1 indicate that the residues surrounding
the modification site are both necessary and sufficient for Ubc9
binding (51). This correlates with our observations that SC motifs are
self-contained modules (4). Interestingly, although the K159R mutation
abolishes SUMOylation, it does not perturb Ubc9 binding, presumably due
to the structurally conservative nature of this substitution. A similar
result was observed for Ran Gap1 (51).
Regulation of SUMO Modification--
SUMO modification is a
dynamic and reversible process regulated by both positive (E3-like) and
negative (Ulp-like) activities. Our results show that PIASy can act as
an E3 to enhance the SUMO modification of C/EBP
. Notably, the effect
applies to both SUMO-1 and SUMO-3 conjugation. This novel finding
implies that caution should be taken in assigning the effects of PIASy
proteins to SUMO-1 modification exclusively. PIASy expression enhances
the modification of many proteins in addition to C/EBP
(not shown). This has prevented us from assessing the effects of selectively enhancing C/EBP
SUMOylation on its function. In our hands, PIASy expression leads to a strong dose-dependent inhibition of
certain constitutive promoters as well as
C/EBP
-dependent transcription. However, both the WT and
mutant forms of C/EBP
are affected (not shown). Similarly, PIASy
inhibits both WT and non-SUMOylatable forms of Lef-1 (31), and PIAS1
and PIASx
inhibit p53 even when the major SUMO modification site is
mutated (30). In other cases, expression of PIAS family members alters
transactivation by a given activator in complex ways (32). Given that
multiple transcriptional regulators including co-activators (41) and
co-repressors (42) are also regulated by SUMO modification, the net
effect of broad spectrum E3-like activities such as PIASy probably
reflects the balance between positive and negative effects on both the
activator and its cofactors. A similar argument can be made for the
variable and noncongruent effects of overexpressing SUMO-1 on
transcriptional activation by several SUMO-modified factors (30, 52).
To circumvent these problems, we are developing novel approaches to
selectively affect the SUMOylation status of C/EBP
.
A Model for the Function of SC Motifs in C/EBP
and Other
Activators--
On the basis of the properties of SC motifs, we
proposed that synergy control is unlikely to be due to a direct
intramolecular interaction and suggested that a synergy control factor
(SCF) is recruited to an assemblage of activators by multivalent
recognition of SC motifs (4). Our observations lead us to propose that SC motifs need to be SUMOylated to be functional. In this modified model (Fig. 8), recruitment of the
machinery responsible for synergy control is likely to depend on its
interaction with SUMO itself. The selective effect of SC motifs at
compound response elements could then be the result of SUMO
modification only when the transcription factor is bound at a compound
response element. Conversely, SC motifs could be modified
irrespective of the DNA binding status, but recruitment of SCF may
depend on multivalent contacts and therefore only occur at compound
response elements. We are currently examining these nonexclusive
possibilities experimentally.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 8.
Model for the action of SC motifs in
C/EBP . Ubc9-dependent and
PIASy-stimulated SUMO modification of the SC motif in C/EBP allows
the recruitment of SCF to the promoter. See "Discussion" for
details.
|
|
Although the nature of SCF remains to be determined, our observations
suggest that the factor(s) responsible for synergy control may comprise
a SUMO-binding protein. In this regard, the ability of Ubc9 to interact
with the K159R mutant makes it unlikely that Ubc9 is involved in this
capacity. The mechanisms involved in synergy, especially those
involving steps subsequent to DNA binding, are not well understood, but
effects beyond DNA binding imply the alteration of the transcription
complex. An SCF could thus interfere with or favor the disassembly of
an active transcription complex. This may be similar to the role of
SUMO modification in septin disassembly in yeast. Conversely, SCF
function could lead to the sequestration of factors in specific
subnuclear domains. Sachdev et al. (31) proposed that
PIASy inhibits Lef-1 by altering its subnuclear localization. Our
preliminary experiments, however, suggest that at concentrations that
fully affect function, PIASy does not significantly alter the
distribution of C/EBP
(not shown).
Role of SC Motif and SUMO Modification in C/EBP
-regulated
Processes--
C/EBP
plays key roles in adipocyte and myeloid
differentiation by regulating the expression of differentiation
regulators and markers. Through its SUMO modification, the SC motif in
C/EBP
may permit the selective deployment or utilization of
functional synergy surfaces at the appropriate promoter context or
developmental stage. For example, selective loss of SUMO modification
when preadipocytes approach a terminally differentiated state would
allow the characteristic high level expression of the appropriate set
of adipocyte-specific genes. We are currently examining the SUMO
modification of endogenous C/EBP
in an in vitro model of
adipocyte differentiation. This approach will also allow us to extend
our observations beyond the transfection paradigm we have used here.
Recently, Wang et al. have provided evidence that the
antimitotic activity of C/EBP
may be mediated by direct inhibition
of Cdk2 and Cdk4 (53). The critical region for this function
lies immediately downstream of the SC motif, which raises the
interesting possibility that SUMO modification of C/EBP
may modify
its antimitotic activity. Whether SUMO modification alters the pattern
or the effects of GSK-mediated phosphorylation of C/EBP
(33) remains
to be determined. Moreover, regulation by SUMO modification is likely
to extend to other members of the C/EBP family; in fact, during the
preparation of this manuscript, Kim et al. (54) showed that
in addition to C/EBP
, C/EBP
can also be modified by SUMO with
important regulatory consequences.
The finding that SC motifs function as SUMO modification sites provides
a versatile regulatory mechanism to control their function. Since the
extent of SUMO modification can be modulated via factors that enhance
conjugation, such as PIASy, or reduce it, such as Ulp-like activities,
SUMO modification of SC motifs has all of the hallmarks of a cellular
regulatory device designed to control higher order interactions among
transcription factors.
 |
ACKNOWLEDGEMENTS |
We thank Ormond MacDougald for providing
C/EBP expression plasmids and invaluable advice and encouragement; Kim
Orth, Ron Hay, and Tae-Hwa Chun for kind gifts of expression plasmids
and advice; Sam Holmstrom and the other members of the Iñiguez
laboratory for many useful discussions; and Mary E. Van-Antwerp for
expert technical assistance.
 |
FOOTNOTES |
*
This work was supported by United States Public Health
Service Grant DK61656-01, American Heart Association (AHA) Scientist Development Grant AHA0130559Z, AHA postdoctoral fellowship AHA 0225755Z
(to L. S.), and National Institutes of Health Grant MSTP TG GM
07863 (to M. D. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of
Pharmacology, University of Michigan Medical School, Ann Arbor, MI
48109-0632. Tel.: 734-615-6565; Fax: 734-763-4450; E-mail:
iniguez@umich.edu.
Published, JBC Papers in Press, January 2, 2003, DOI 10.1074/jbc.M210440200
 |
ABBREVIATIONS |
The abbreviations used are:
SC, synergy control;
SCF, synergy control factor(s);
C/EBP, CAAT/enhancer-binding protein;
E1, ubiquitin-activating enzyme;
E2, ubiquitin carrier protein;
E3, ubiquitin-protein isopeptide ligase;
Ub, ubiquitin;
WT, wild
type;
HA, hemagglutinin;
NTA, nitrilotriacetic acid;
GST, glutathione
S-transferase.
 |
REFERENCES |
| 1.
|
Yamamoto, K. R.,
Darimont, B. D.,
Wagner, R. L.,
and Iniguez-Lluhi, J. A.
(1998)
Cold Spring Harbor Symp. Quant. Biol.
63,
587-598[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Yanofsky, C.
(1992)
in
Transcriptional Regulation
(Mcknight, S. L.
, and Yamamoto, K. R., eds)
, pp. 3-26, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 3.
|
Emami, K. H.,
and Carey, M.
(1992)
EMBO J.
11,
5005-5012[Medline]
[Order article via Infotrieve]
|
| 4.
|
Iñiguez-Lluhí, J. A.,
and Pearce, D.
(2000)
Mol. Cell. Biol.
20,
6040-6050[Abstract/Free Full Text]
|
| 5.
|
Pei, D. Q.,
and Shih, C. H.
(1991)
Mol. Cell. Biol.
11,
1480-1487[Abstract/Free Full Text]
|
| 6.
|
Angerer, N. D.,
Du, Y.,
Nalbant, D.,
and Williams, S. C.
(1999)
J. Biol. Chem.
274,
4147-4154[Abstract/Free Full Text]
|
| 7.
|
Cao, Z.,
Umek, R. M.,
and McKnight, S. L.
(1991)
Genes Dev.
5,
1538-1552[Abstract/Free Full Text]
|
| 8.
|
Ramji, D. P.,
and Foka, P.
(2002)
Biochem. J.
365,
561-575[Medline]
[Order article via Infotrieve]
|
| 9.
|
McKnight, S. L.,
Lane, M. D.,
and Gluecksohn-Waelsch, S.
(1989)
Genes Dev.
3,
2021-2024[Free Full Text]
|
| 10.
|
Park, E. A.,
Gurney, A. L.,
Nizielski, S. E.,
Hakimi, P.,
Cao, Z.,
Moorman, A.,
and Hanson, R. W.
(1993)
J. Biol. Chem.
268,
613-619[Abstract/Free Full Text]
|
| 11.
|
Park, E. A.,
Roesler, W. J.,
Liu, J.,
Klemm, D. J.,
Gurney, A. L.,
Thatcher, J. D.,
Shuman, J.,
Friedman, A.,
and Hanson, R. W.
(1990)
Mol. Cell. Biol.
10,
6264-6272[Abstract/Free Full Text]
|
| 12.
|
Darlington, G. J.,
Ross, S. E.,
and MacDougald, O. A.
(1998)
J. Biol. Chem.
273,
30057-30060[Free Full Text]
|
| 13.
|
Lane, M. D.,
Tang, Q. Q.,
and Jiang, M. S.
(1999)
Biochem. Biophys. Res. Commun.
266,
677-683[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Cardinaux, J. R.,
Allaman, I.,
and Magistretti, P. J.
(2000)
Glia
29,
91-97[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Tengku-Muhammad, T. S.,
Hughes, T. R.,
Ranki, H.,
Cryer, A.,
and Ramji, D. P.
(2000)
Cytokine
12,
1430-1436[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Lekstrom-Himes, J.,
and Xanthopoulos, K. G.
(1998)
J. Biol. Chem.
273,
28545-28548[Abstract/Free Full Text]
|
| 17.
|
Hendricks-Taylor, L. R.,
and Darlington, G. J.
(1995)
Nucleic Acids Res.
23,
4726-4733[Abstract/Free Full Text]
|
| 18.
|
Wang, N. D.,
Finegold, M. J.,
Bradley, A.,
Ou, C. N.,
Abdelsayed, S. V.,
Wilde, M. D.,
Taylor, L. R.,
Wilson, D. R.,
and Darlington, G. J.
(1995)
Science
269,
1108-1112[Abstract/Free Full Text]
|
| 19.
|
Shi, X. M.,
Blair, H. C.,
Yang, X.,
McDonald, J. M.,
and Cao, X.
(2000)
J. Cell. Biochem.
76,
518-527[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Ford, A. M.,
Bennett, C. A.,
Healy, L. E.,
Towatari, M.,
Greaves, M. F.,
and Enver, T.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10838-10843[Abstract/Free Full Text]
|
| 21.
|
Rosen, E. D.,
Hsu, C. H.,
Wang, X.,
Sakai, S.,
Freeman, M. W.,
Gonzalez, F. J.,
and Spiegelman, B. M.
(2002)
Genes Dev.
16,
22-26[Abstract/Free Full Text]
|
| 22.
|
Zhang, D. E.,
Hohaus, S.,
Voso, M. T.,
Chen, H. M.,
Smith, L. T.,
Hetherington, C. J.,
and Tenen, D. G.
(1996)
Curr. Top. Microbiol. Immunol.
211,
137-147[Medline]
[Order article via Infotrieve]
|
| 23.
|
Wu, Z.,
Rosen, E. D.,
Brun, R.,
Hauser, S.,
Adelmant, G.,
Troy, A. E.,
McKeon, C.,
Darlington, G. J.,
and Spiegelman, B. M.
(1999)
Mol. Cell
3,
151-158[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Clarke, S. L.,
Robinson, C. E.,
and Gimble, J. M.
(1997)
Biochem. Biophys. Res. Commun.
240,
99-103[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Muller, S.,
Hoege, C.,
Pyrowolakis, G.,
and Jentsch, S.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
202-210[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Weissman, A. M.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
169-178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Jackson, P. K.,
Eldridge, A. G.,
Freed, E.,
Furstenthal, L.,
Hsu, J. Y.,
Kaiser, B. K.,
and Reimann, J. D.
(2000)
Trends Cell Biol.
10,
429-439[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Desterro, J. M.,
Rodriguez, M. S.,
Kemp, G. D.,
and Hay, R. T.
(1999)
J. Biol. Chem.
274,
10618-10624[Abstract/Free Full Text]
|
| 29.
|
Pichler, A.,
Gast, A.,
Seeler, J. S.,
Dejean, A.,
and Melchior, F.
(2002)
Cell
108,
109-120[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Schmidt, D.,
and Muller, S.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
2872-2877[Abstract/Free Full Text]
|
| 31.
|
Sachdev, S.,
Bruhn, L.,
Sieber, H.,
Pichler, A.,
Melchior, F.,
and Grosschedl, R.
(2001)
Genes Dev.
15,
3088-3103[Abstract/Free Full Text]
|
| 32.
|
Kotaja, N.,
Karvonen, U.,
Janne, O. A.,
and Palvimo, J. J.
(2002)
Mol. Cell. Biol.
22,
5222-5234[Abstract/Free Full Text]
|
| 33.
|
Ross, S. E.,
Erickson, R. L.,
Hemati, N.,
and MacDougald, O. A.
(1999)
Mol. Cell. Biol.
19,
8433-8441[Abstract/Free Full Text]
|
| 34.
|
Grange, T.,
Roux, J.,
Rigaud, G.,
and Pictet, R.
(1991)
Nucleic Acids Res.
19,
131-139[Abstract/Free Full Text]
|
| 35.
|
Guan, K. L.,
and Dixon, J. E.
(1991)
Anal. Biochem.
192,
262-267[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Pearce, D.,
and Yamamoto, K. R.
(1993)
Science
259,
1161-1165[Abstract/Free Full Text]
|
| 37.
|
Iñiguez-Lluhí, J. A.,
Lou, D. Y.,
and Yamamoto, K. R.
(1997)
J. Biol. Chem.
272,
4149-4156[Abstract/Free Full Text]
|
| 38.
|
Erickson, R. L.,
Hemati, N.,
Ross, S. E.,
and MacDougald, O. A.
(2001)
J. Biol. Chem.
276,
16348-16355[Abstract/Free Full Text]
|
| 39.
|
Li, S. J.,
and Hochstrasser, M.
(1999)
Nature
398,
246-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Desterro, J. M.,
Rodriguez, M. S.,
and Hay, R. T.
(1998)
Mol. Cell
|