Originally published In Press as doi:10.1074/jbc.M211829200 on January 2, 2003
J. Biol. Chem., Vol. 278, Issue 11, 9167-9175, March 14, 2003
Histone Acetylation and Activation of cAMP-response
Element-binding Protein Regulate Transcriptional Activation of
MKP-M in Lipopolysaccharide-stimulated Macrophages*
Tipayaratn
Musikacharoen
,
Yasunobu
Yoshikai§, and
Tetsuya
Matsuguchi
¶
From the
Laboratory of Host Defense and Germfree
Life, Research Institute for Disease Mechanism and Control, Nagoya
University Graduate School of Medicine, Nagoya 466-8550 and
§ Division of Host Defense, Research Center of Prevention of
Infectious Diseases, Medical Institute of Bioregulation, Kyushu
University, Fukuoka 812-8582, Japan
Received for publication, November 20, 2002, and in revised form, December 19, 2002
 |
ABSTRACT |
MKP-M is a dual specificity phosphatase that
preferentially inactivates JNK. mkp-M gene
expression is rapidly induced by lipopolysaccharide (LPS) stimulation
in macrophages and is involved in the negative regulation of
LPS-mediated JNK activation and tumor necrosis factor-
secretion. To
reveal the transcriptional regulation of the mkp-M gene, we
isolated the mouse mkp-M gene and mapped its
transcriptional start site. Luciferase reporter plasmids containing
5'-upstream regions of the mkp-M gene were stably
transfected into RAW264.7 cells. The assays using these cells revealed
that the promoter region between
252 and
135 is required for
mkp-M promoter activation. Sequencing analysis revealed E
box and CREB-responsive elements in this region, and electromobility
shift assays and mutagenesis confirmed that both of these elements are
essential for LPS responsiveness of the mkp-M gene. We also
utilized chromatin immunoprecipitation assay and found that LPS
stimulation caused acetylation of histone H3 and H4 at
mkp-M promoter in RAW264.7 cells. Consistent with this, a
histone deacetylase inhibitor, trichostatin A, increased endogenous
mkp-M gene transcription. Finally, DNase I hypersensitivity site mapping revealed the inducible hypersensitivity site after LPS
stimulation around the location of the E box and CREB-responsive elements. Altogether, our data indicated that the activation of mkp-M gene transcription in macrophages by LPS is
associated with histone acetylation and chromatin remodeling.
 |
INTRODUCTION |
The dual specificity protein phosphatases
(DSPs)1 are an emerging
subclass of the protein-tyrosine phosphatase gene superfamily which
have been shown to inactivate mitogen-activated protein kinases (MAPKs)
through dephosphorylation of both threonine and tyrosine residues
within a signature sequence of TXY that are essential for
the enzymatic activity (1). The members of DSPs share two common
features as follows: a catalytic domain with significant amino acid
sequence homology to a vaccinia virus dual specificity phosphatase,
VH-1; and an N-terminal region homologous to the catalytic domain of
the cdc25 phosphatase (rhodanese homology domain). Among its family
members, some show highly selective substrate specificity, whereas
others efficiently inactivate all three classes of MAPKs: extracellular
signal-regulated kinase, c-Jun N-terminal kinase/stress-activated
protein kinase, and p38/RK/CSBP (p38). Three distinct classes of
MAPKs play important roles in various cellular events. Because
the activation of MAPKs is a reversible process and gene expression of
many DSPs is significantly induced following stimulation with growth
factors, cytokines, or cell stresses, the induction of MKPs is likely
to provide the important mechanism for control of MAPK activity.
To date, 10 members of the mammalian DSPs gene family have been
isolated and characterized. These members of DSPs have been defined
recently into three subgroups by their basic structural prediction from
genomic sequence (2): subgroup I, DUSPI
(hVHI/CL100/MKP-1/3CH134), DUSP2 (hPAC-1), DUSP4 (hVH2/TYP1), and DUSP5
(hVH3/B23/MKP-2); subgroup II, DUSP6 (PYSTI/MK-3/rVH6), DUSP7
(PYST2/B59/MKP-X), DUSP9 (MKP-4), and DUSP10 (MKP-5); and
subgroup III, DUSP 8 (hVH5/M3/6) and DUSP16 (MKP-7/ MKP-M).
MKP-M, a dual specificity isolated from macrophage, also referred to as
MKP-7 (3, 4) is a member of DSPs family which is homologous to the
human protein MKP-7 (2). MKP-M preferentially inactivates JNK (3, 5)
when it is overexpressed in COS7 cells, and it also efficiently
inactivates p38
and p38
in NIH3T3 cells (4). In any cell system,
it does not show any significant phosphatase activity toward
extracellular signal-regulated kinase. We have shown previously (5)
that mkp-M gene expression is rapidly induced by LPS
stimulation in mouse macrophage cell lines. Notably, it is not
significantly increased by proinflammatory cytokines such as tumor
necrosis factor-
(TNF-
), interferon-
, interleukin-2 (IL-2),
and IL-15. Expression of a phosphatase-inactive version of MKP-M
enhanced and elongated both JNK activation and TNF-
production in
LPS-treated macrophages. Thus induction of MKP-M expression is at least
partially responsible for the down-regulation of LPS-mediated JNK
activation and TNF-
secretion in macrophages, indicating that MKP-M
may have a role in preventing excessive inflammatory responses mediated
by activated macrophages.
To understand the transcriptional regulation of mkp-M gene
in macrophages, we isolated mkp-M genomic DNA clones,
identified the transcriptional initiation sites, and analyzed its
5'-upstream region. We show here that mkp-M gene expression
is regulated by acetylation of histones H3 and H4 on the
mkp-M promoter region containing the functional E box and
CRE consensus motifs.
 |
EXPERIMENTAL PROCEDURES |
Antibodies and Reagents--
Anti-acetylhistone H3 and
anti-acetylhistone H4 antibodies were purchased from Upstate
Biotechnology Inc. (Lake Placid, NY). LPS from Escherichia
coli serotype B5:055, trichostatin A, RPMI 1640 medium, and
Dulbecco's modified Eagle's medium were obtained from Sigma.
SB208530, a specific inhibitor of p38 kinase, was purchased from
Calbiochem.
Isolation and Characterization of the Mouse mkp-M Genomic
Clones--
The mouse MKP-M cDNA containing the whole coding
region was labeled with 32P by random priming and used for
screening the mouse genomic phage library in Lambda Fix II (Stratagene,
La Jolla, CA). Plaque hybridization was carried out as described
previously (6). Positive plaques were isolated and screened until pure
clones were obtained. Phage DNAs were isolated from positive clones and
characterized by enzyme restriction mapping and Southern blot analyses.
Subfragments that hybridized to 5'-cDNA probe were cloned into
pBlueScript II KS+ (Stratagene, La Jolla, CA) and were randomly
sequenced by the DNA sequencer (model 373A sequencer) using
EN::TN <KAN-2> insertion (Epicentre, Madison, WI) and
DYEnamicTM ET terminator cycle sequencing kit (Amersham
Biosciences). The nucleotide sequences upstream to the transcriptional
start site were searched for the potential binding sites for
transcription factors (7).
Mapping the Transcriptional Start Site of mMKP-M--
Primer
extension analysis was applied to map the initiation start site of the
mkp-M gene. Total RNA was prepared from LPS-stimulated RAW264.7 cells. Contaminating DNA was removed from RNA by treatment with 10 µg/ml DNase I (Sigma) for 2 h at 16 °C. Remaining RNA was extracted twice with phenol/chloroform and subjected to poly (A)+ RNA purification using mRNA purification kit
(Amersham Biosciences). An oligonucleotide, TCTCTTCCACCGCCCCCC,
complementary to the 5'-untranslated region of the MKP-M cDNA (5),
was end-labeled with 32P. The annealing of the labeled
primer to poly(A)+ RNA was performed in 11 µl of 2×
first strand buffer (Invitrogen) by heating the mixture of 2 pmol of
labeled primer and 10 µg of poly(A)+ RNA at 58 °C for
40 min and cooling to room temperature for 20 min. The reverse
transcription was done by adding 9 µl of RT mix (40 mM
dithiothreitol, 4 mM each of dNTP, 2 mM
spermidine, 150 ng of actinomycin D, 5 µl of 2× first strand buffer,
1.5 µl of 40 mM sodium pyrophosphate) and 100 units of
SuperscriptTM II (Invitrogen) into annealed primer/RNA and
incubated at 42 °C for 2 h. The same primer was used in DNA
sequencing on a plasmid containing 5'-flanking region of the
mkp-M gene with fmol® DNA sequencing systems
(Promega) as the marker. The extended primer was run along with the
sequencing product on a 6% denaturing polyacrylamide urea gel.
Generation of mkp-M Promoter Constructs, Site-directed
Mutagenesis, and DNA Purification--
A series of synthesis
oligonucleotide senses: CGACGCGTCTGGCTAGACCAGAACATTT
(pGL3-1958), CGACGCGTGTGGGAGAGGACTAACAGAA (pGL3-1488), CGACGCGTCCTGGAACTGGAGTTACAGA (pGL3-875), CGACGCGTGCAGCTGACTAGCAGAGAGC (pGL3-252), CGACGCGTGGCTCGCGGGGACGAGCGCC (PGL3-135), and an antisense CCCTCGAGAAACGGTGATGCCCGCAGGA, derived from the respective part of
the 5'-upstream region of mkp-M gene, were used to generate a series of 5'-deletion DNA fragments by Advantage®-GC2 PCR
(Clontech) according to the manufacturer's
instructions. All PCR products were then cloned into pGEMT-easy vector
(Promega) and digested with XhoI and MluI, and
the inserts were subcloned into pGL3-basic vector (Promega).
To generate site-directed mutagenesis, the following mutated
oligonucleotides, CRE-mut 5' CGCGGCGCTGcaCTtTTgtTCCCCGCGG,
E box-mut 5' CGGCCAGCGCtCaGCGCTGGGC, or CRE/E box-mut 5'
CGGCCAGCGCtCaGCGCTGcaCTtTTgtTCCCCGCGG, and an
enzyme restriction-mutated primer SalI-mut
GATAAGGATCCcTCGACCGATGCC (5' end position is given
before sequence, the binding site is underlined and altered bases are
given in lowercase letters) were used to introduce specific mutations
into pGL3-252 construct by TransformerTM site-directed
mutagenesis kit (Clontech) according to the
manufacturer's instructions. Plasmid DNAs were purified from bacterial
cultures using Endofree plasmid maxi kit (Qiagen). Finally, restriction enzyme mapping and sequencing confirmed all constructs.
Cell Culture, Transfection, and Luciferase Assays--
A mouse
macrophage cell line, RAW264.7, was obtained from RIKEN cell bank
(Tsukuba, Japan) and maintained in Dulbecco's modified Eagle's medium
with 10% newborn calf serum (Sigma). For stable transfection, RAW264.7
cells were plated onto 60-mm plates at 1 × 106
cells/plate on the day before transfection. The combination of 2 µg
of mkp-M luciferase plasmid and 0.5 µg of the neomycin
resistance plasmid, pcDNA3.1(+), were transfected using
LipofectAMINETM (Invitrogen) according to the
manufacturer's instructions. After 36 h, cells were selected with
2 mg/ml geneticin (Sigma). The independent neomycin-resistant clones
were isolated and maintained in the medium containing 1 mg/ml
geneticin. For luciferase assays, stable RAW264.7 transfectants were
trypsinized and washed twice with the cultured medium without geneticin
and were plated onto 35-mm plates at 1 × 105
cells/plate. Twenty four hours after plating, cells were either left
untreated or treated with 1 µg/ml LPS or 100 nM/ml TSA or the combination of LPS and TSA for 8 h. Cells were then lysed, and
the lysates were used for luciferase activity measurements using
luciferase assay system (Promega) according to the manufacturer's instructions.
Electrophoretic Mobility Shift Assay (EMSA)--
Nuclear
extracts were prepared from RAW264.7 cells stimulated with 1 µg/ml
LPS as described previously (8). A double strand DNA-comprising
nucleotide
252 to
135 of mkp-M promoter amplified by PCR
was radiolabeled by [
-32P]ATP with T4 polynucleotide
kinase and used as a probe. For EMSA, 5 µg of nuclear extracts were
incubated with 1 µg of poly(dI·dC) in a total volume of 19 µl of
binding buffer (10 mM Tris-HCl (pH 7.5), 100 mM
NaCl, and 4% glycerol) for 15 min at 4 °C before ~1 × 105 cpm of radiolabeled probe was added for another 30 min.
For competition assays, nuclear extracts were incubated with a 50-fold
excess of cold-targeted oligonucleotide prior to the addition of
32P-labeled probe. The cold-targeted primers for the EMSA
were 5' AGCGCGCGGC for E box, 5' TGGGCTCTTCGTCCC for CRE, or 5'
CTCCCGGAGGC for AP-2. For supershift assays, anti-CREB was incubated
with nuclear extracts for 2 h before the binding reactions. The
reaction mixtures were run through a 6% non-denaturing polyacrylamide
gel at 4 °C in TBE buffer.
Northern Blot Analysis--
Total cellular RNA was extracted
using TRIzol reagent (Invitrogen) according to the manufacturer's
instruction. 15-µg aliquots of the total RNA were fractionated on a
1% agarose gel containing 20 mM MOPS, 5 mM
sodium acetate, 1 mM EDTA (pH 7.0), and 6% (v/v) formaldehyde and transferred to a nylon membrane. The membrane hybridization was performed as described previously (5). A 220-bp MKP-M
cDNA fragment encoding amino acids 297-373 was prepared as
described previously (5) and used as a probe.
Chromatin Immunoprecipitation (ChIP) Assay--
Acetylhistone
ChIP assay was performed according to the manufacturer's instruction
(Upstate Biotechnology Inc.). Following LPS stimulation, cells were
cross-linked with 1% formaldehyde for 10 min at room temperature,
washed twice with ice-cold PBS, and lysed for 10 min at 1 × 106 cells/200 µl of SDS lysis buffer. The chromatin was
sheared by sonication 4 times for 10 s at one-third of the maximum
power with 20 s cooling on ice between each pulse. Cross-link
released chromatin fractions were pre-cleared with salmon sperm
DNA/protein A-agarose for 3 h followed by immunoprecipitation with
either anti-acetylhistone H3 or anti-acetylhistone H4 overnight at
4 °C. Immune complexes were collected with salmon sperm DNA/protein A-agarose for 1 h and extracted with 1% SDS, 0.1 M
NaHCO3. Histone-DNA cross-linking was reversed at 65 °C
overnight and digested with 100 µg of proteinase K at 45 °C for
1 h. DNA was recovered by phenol/chloroform, chloroform
extraction, and precipitation in the presence of 20 µg of glycerol.
Finally, DNA was dissolved in 20 µl of TE buffer and subjected to
PCR. PCR amplifications were carried out in a 50-µl volume containing
1.0 M GC-melt, 50 pmol of each primer, 0.2 mM
of each dNTP, 10 µl of 5× GC2 PCR buffer, and 1 µl of 50×
(Titanium Taq DNA polymerase, Clontech, Palo Alto, CA). The mkp-M promoter-specific primers are as
follows: sense, GAAAAGCCCCGGATTTGGGA; antisense, CTCTCTGCTAGTCAGCTGCT. PCR conditions are as follows: 94 °C for 3 min; 94 °C for 30 s; 66 °C for 2 min; and 72 °C for 7 min. PCR was done for 20-25
cycles with mkp-M promoter-specific primers followed by 3 cycles with a [
-32P]ATP-labeled antisense primer. The
PCR products were analyzed by electrophoresis on a 6% denaturing
polyacrylamide gel. For each reaction, 1% of cross-link released
chromatin was saved and reversed at 65 °C for 6 h followed by
proteinase K digestion and DNA extraction, and recovered DNA was used
as input control.
Nuclei Preparation--
Nuclei preparation from RAW264.7 cells
proceeded as described previously (9). Briefly, cells were rinsed twice
with ice-cold PBS, harvested by scraping into PBS, and pelleted at 1500 rpm. The pellet was lysed in 5 volumes of ice-cold Nonidet P-40 lysis buffer (10 mM Tris (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40, 0.15 mM spermine, and 0.5 mM spermidine) for 10 min.
Nuclei were pelleted for 5 min at 3000 rpm and washed twice with
washing buffer (100 mM NaCl, 50 mM Tris (pH
8.0), 3 mM MgCl2, 0.15 mM spermine,
and 0.5 mM spermidine) and then nuclei were collected at
3000 rpm for 5 min.
Nuclease Digestion, Restriction Enzyme Digestion, and Southern
Blot Analysis--
For DNase I digestion, nuclei were resuspended in
DNase I digestion buffer (100 mM NaCl, 50 mM
Tris (pH 8.0), 3 mM MgCl2, 0.15 mM
spermine, 0.5 mM spermidine, 1 mM
CaCl2) at 2 × 108 nuclei/ml. 100-µl
aliquots of nuclei were digested with increasing concentrations of
DNase I, typically 0, 0.04, 0.06, and 0.08 µg at 25 °C for 10 min.
The reactions were stopped by addition of 10 mM EDTA, 100 µl of DNase I digestion buffer, 100 µg of proteinase K, and 0.2%
SDS and incubated at 37 °C overnight. For DNA purification, the
samples were extracted once with phenol/chloroform and once with
chloroform. The aqueous phase was digested with 20 µg of RNase A for
2 h at 37 °C, extracted with phenol/chloroform and chloroform,
and then precipitated with ethanol, and DNA was redissolved in water.
The 25-µg aliquots of genomic DNA from DNase I-treated nuclei were
digested overnight with 50 units of EcoRI and
SalI. Digested DNA was loaded onto 0.8% agarose gel. Gel
was then soaked in denaturing buffer (0.6 M NaCl, 0.4 M NaOH) for 45 min and in neutralizing buffer (1.5 M NaCl, 0.1 M Tris base, 0.04 M
Tris-HCl) for another 45 min and transferred to a nylon membrane. As
the probe for DNase I hypersensitivity, PCR product was amplified with
primers sense, GGTTTCAAGTGACGCCATCT, and antisense,
GTCGACAGGGATGAAGAAGTT, using de-proteinized DNA from RAW264.7 as
template and labeled with 32P by random priming. The
membrane was prehybridized and hybridized with the
32P-labeled probe.
 |
RESULTS |
Isolation and Characterization of mkp-M Gene--
In order to
analyze the mouse mkp-M gene, a mouse genomic library was
screened with MKP-M cDNA as the probe. We isolated 14 positive
clones and characterized them by Southern blot analysis, restriction
enzyme mapping, and nucleotide sequencing. The structure of the
mkp-M gene including the intron/exon junctions is
schematically shown in Fig.
1A. The mkp-M gene
contained 7 exons; the consensus ATG that corresponded to the
translational start codon was located at the distal part of exon 2 (Fig. 1A).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
Characterization of mkp-M
gene. A, the mkp-M gene was characterized
by restriction enzyme mapping and Southern blot analyses. Solid
boxes represent exons, and the horizontal lines
indicate introns. The position of the first methionine is also shown.
B, primer extension analysis for mapping of the
transcriptional start sites of the mkp-M gene. The
transcribed product (P) was run along with sequencing ladder
from the same primer on a 6% polyacrylamide/urea gel. The
asterisks indicate the two transcribed products.
C, the nucleotide sequence of the 5'-flanking region of the
mouse mkp-M gene, two transcriptional start sites
(TSS), are shown and the proximal transcriptional start site
was assigned as +1. Potential binding sites for transcription
factors are indicated by boldface capital letters.
Arrows identify the 5' end of deletion promoter
constructs.
|
|
Primer extension analysis was applied to map the transcriptional start
site of the mkp-M gene. A synthesis oligonucleotide complementary to 5' end of the previously reported MKP-M cDNA was
hybridized to poly(A)+ RNA from LPS stimulated RAW264.7
cells and extended by reverse transcription. Two transcriptional start
sites were identified by comparing the transcribed products with the
sequence ladder from the same primer (Fig. 1B). The first
proximal transcriptional start site was located 229 bp upstream of the
5' end of the cDNA described previously (5). The second
transcriptional start site was 115 bp upstream to the first site. To
confirm these sites, several other oligonucleotides designed from
different parts of MKP-M cDNA and mkp-M genomic DNA were
also used for primer extension producing compatible results (data not
shown). The nucleotide of the proximal transcriptional start site was
designed as +1 throughout this paper (Fig. 1C).
The Structural and Functional Analysis of the 5'-Upstream Region of
the Mouse mkp-M Gene--
The nucleotide sequence upstream of the
transcriptional start sites was searched for the potential binding
sites of transcriptional factors using Genome Exploring and Modeling
software (7). As shown in Fig. 1C, neither TATA nor CAAT
boxes were identified in the 5'-upstream region for each
transcriptional initiation site. However, the region between the two
initiation sites is very rich in GCs (GC content, 78%).
Because applying conventional PCR methods to this region was difficult
most likely because of the high GC content, the Advantage®-GC 2 PCR
kit (Clontech) was used to generate a series of
5'-deletion constructs to identify the region required for
mkp-M gene activation. These 5'-deletion constructs were
cloned into a promoter-less luciferase reporter vector. The activities
of the mkp-M promoter constructs were first determined by
transient transfection into RAW264.7 cells. Each of the reporter
plasmids showed the proper basal promoter function, but none showed the
inducible activity by LPS (data not shown). These plasmid constructs
were then stably integrated into RAW264.7 cells by co-transfecting a
G418-resistant plasmid for drug selection. Several independent stable
clones for each construct were isolated. In stably integrated RAW264.7 cells, some constructs showed LPS-driven induction of luciferase activities (Fig. 2A). The
highest inducible promoter activity was obtained from the longest
pGL3-1958 construct. Subsequent deletion of pGL3-1958 resulted in
moderately reduced promoter activity, but no significant differences
were detected among those four deletion constructs (pGL3-1958, -1488, -875, and -252). In contrast, the responsiveness to LPS treatment was
completely abrogated when the construct was deleted to -135 (pGL3-135).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
Induction of mkp-M promoter
activity by LPS in a mouse macrophage cell line. A, RAW264.7
cells stably integrated with MKP-M deletion constructs were cultured at
1 × 105 cells/plate for 24 h. Cells were either
left untreated or treated for 8 h with 1 µg/ml LPS before lysate
preparation for luciferase assays. Luciferase activity from two
independent clones of each deletion construct was examined. Results are
expressed as fold induction over the untreated controls. The assay of
each clone was done in triplicate, and the average of three independent
experiments is shown. B, CRE or E box mutation construct of
the wild type pGL3-252 mkp-M promoter was stably integrated
into RAW264.7 cells. Two independent neomycin-resistant clones of each
construct were plated and treated as described in A. The
fold inductions by LPS are shown. The assay of each clone was done in
triplicate and the average of three independent experiments is
shown.
|
|
Roles of E Box and CRE Consensus Elements in LPS-induced MKP-M
Transcription--
As shown in Fig. 2A, the region between
252 and
135 seemed critical for the activation of mkp-M
promoter by LPS. The sequence analysis within this region demonstrated
the presence of consensus elements for E box, CRE, and AP-2.
In order to examine the involvement of these elements in LPS
responsiveness, each site was mutated by site-directed mutagenesis on
the pGL3-252 wild type mkp-M promoter construct, and the
mutated constructs were stably integrated into RAW264.7 cells. In
stably integrated RAW264.7 cells, mutation of either E box or CRE
consensus element significantly reduced fold induction by LPS. The
responsiveness to LPS was completely abrogated by E box/CRE double
mutation (Fig. 2B).
We next examined if DNA-protein binding within this region is involved
in the activation of mkp-M promoter by EMSA. Nuclear extracts prepared from untreated and LPS-treated RAW264.7 cells were
incubated with a 32P-labeled probe spanning the
mkp-M promoter region between
252 and
135. EMSAs
revealed the presence of two protein complexes binding to the probe in
an LPS-dependent manner, and the formation of the
protein-DNA complexes was practically absent in unstimulated cells
(Fig. 3A). To determine the
DNA sequences responsible for these complexes, cold-target competition
was carried out with 50-fold excesses of E box, CRE, or AP-2 consensus
nucleotide sequences. As shown in Fig. 3A, both complexes
were abrogated by the addition of 50-molar excesses of either unlabeled
CRE or E box-specific oligonucleotides, whereas the other cold target
consensus element tested, AP-2, was incapable of inhibiting either
complex.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Specific protein complexes bind 252 to
135 region of mkp-M promoter. A, RAW264.7
cells were left untreated or treated with LPS for 30 or 60 min, and the
nuclear extracts were prepared. Five micrograms of nuclear extracts
were incubated with 32P-labeled probe spanning the region
between 252 and 135 of the mkp-M promoter. Specific
complexes (C) are indicated. Comp refers to EMSA
binding reaction that contained cold target oligonucleotide
corresponding to the indicated consensus element as the competitor.
B, the supershift assay using anti-CREB antibody
( CREB). The EMSA was carried out as in A. For
supershift experiments, nuclear extracts were preincubated with 2 µl
of CREB before adding the mkp-M promoter probe.
Super-shifted protein-DNA complexes are indicated. C,
oligonucleotides specific to CRE, E box, or their mutated
oligonucleotides were used as a probe for EMSA using the same nuclear
extracts as in A.
|
|
We next addressed whether an antibody against CREB could modify the
protein-DNA complexes. As shown in Fig. 3B, the inducible protein complexes were efficiently shifted with the anti-CREB antibody,
indicating that both DNA-protein complexes contain CREB as a component.
Furthermore, synthetic oligonucleotides specific to CRE and E box also
formed protein-DNA complexes when they were incubated with nuclear
extracts from LPS-treated RAW264.7 (Fig. 3C). In contrast
their mutated versions did not. These results strongly indicated that
both CRE and E box consensus sequences are functional as binding sites
for transcriptional factors.
DNase I Hypersensitivity Sites in the 5'-Upstream Region of the
Mouse mkp-M Gene--
Transcriptional activation of a gene is often
accompanied by chromatin remodeling leading to the appearance of DNase
I hypersensitivity (HS) sites (10-12). Thus we searched for the HS
site in the MKP-M 5'-regulatory region before and after LPS
stimulation. The increasing amounts of DNase I was used to cleave the
nuclei from RAW264.7 cells, and then the genomic DNA was completely
digested with EcoRI and SalI and subjected to
Southern blot analysis. The probe used for the assay was derived from
the 3' end of the 5-kb genomic EcoRI/SalI
fragment containing the mkp-M promoter region. As shown in
Fig. 4, two smaller DNA fragments were
observed by Southern probe only in the LPS-treated cells. By
determining the size of these DNA fragments, the regions of HS were
around
1500 and
220 from the proximal transcriptional start site.
Although the contribution of the
1500 HS in the MKP-M transcription
is not clear, the site around
220 coincides with the locations of E
box and CREB-binding sites.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 4.
Inducible DNase I hypersensitivity sites on
mkp-M promoter. Nuclei from untreated
(lanes 1-4) or LPS-treated (lanes 5-8) RAW264.7
cells were digested with 0 (lanes 1 and 5), 0.04 (lanes 2 and 6), 0.06 (lanes 3 and
7), or 0.08 µg (lanes 4 and 8) of
DNase I. Purified genomic DNA was digested with EcoRI and
SalI and subjected to Southern blot analysis. The
full-length genomic EcoRI/SalI fragment
containing the mkp-M promoter region in purified genomic DNA
and DNA fragments relative position of DNase I hypersensitivity sites
on MKP-M are shown. A scheme representation 5' of mkp-M
gene, the restriction enzyme map, and the location of Southern probe
are also shown.
|
|
Trichostatin A, a Histone Deacetylase Inhibitor, Induced mkp-M Gene
Activation--
Restructuring of the chromatin is often associated
with histone acetylation. In order to determine a possible role of
histone modification in the regulation of mkp-M gene
activation, we treated RAW264.7 cells with a histone deacetylase
inhibitor, trichostatin A (TSA), and we investigated its effects on
mkp-M gene expression. In the Northern blot analysis, MKP-M
mRNA level was potently increased by TSA treatment (Fig.
5A). This result prompted us
to investigate the effect of TSA on mkp-M promoter activity
by treating RAW264.7 stable clones with TSA. Consistent with Northern
blot analysis, TSA treatment of RAW264.7 cells with MKP-M luciferase
reporters (pGL3-1958, -1488, -875, and -252) stably integrated resulted in the induction of luciferase activity 5-6-fold over untreated cells.
The induction was completely lost for the shortest promoter construct,
pGL3-135 (Fig. 5B). As in LPS stimulation, the
responsiveness to TSA treatment was also significantly reduced by the
mutation of either E box or CRE-binding element (Fig. 5C).
Moreover, combined treatment of these cells with TSA and LPS increased
the fold induction of the luciferase activity in an additional manner
(Fig. 5, B and C). Taken together, theses results
strongly implied that histone acetylation may be involved in the
regulation of mkp-M gene activation.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
TSA-mediated mkp-M gene
transcription in RAW264.7 cells. A, RAW264.7 cells were left
untreated or treated with one of the following: 1 µg/ml LPS for
2 h, 100 nM/ml TSA for 16 h or pretreated with
100 nM/ml TSA for 14 h, and 1 µg/ml LPS for an
additional 2 h. Total RNA was extracted for the Northern blot
analysis using a 32P-labeled MKP-M cDNA probe. Gene
expression of MKP-M and a picture of the ethidium bromide-stained gel
are shown. B and C, RAW264.7 cells stably
integrated MKP-M deletion or mutation constructs were plated and
cultured as described in Fig. 2A. Cells were either left
untreated or treated for 8 h with one of the following: LPS (1 µg/ml), TSA (100 nM/ml), or the combination of LPS and
TSA before lysate preparation for luciferase assays. The results are
expressed as described in Fig. 2A.
|
|
LPS Treatment Caused Acetylation of Histone H3 and H4 at the mkp-M
Promoter--
As mentioned above, both LPS and TSA could induce the
mkp-M promoter-mediated luciferase activation when reporter
plasmids were stably integrated but not when they were transiently
transfected in RAW264.7 cells. It may be because transiently
transfected necked DNA was not efficiently packed into chromatin, as it
is well established that modifying chromatin structure through
acetylation of histone needs proper chromatin structure. In order to
determine whether histone acetylation actually occurs at the endogenous
mkp-M gene, we utilized ChIP assay using antibodies specific
to acetylhistone H3 or acetylhistone H4. The presence of the
mkp-M gene in the immunoprecipitated chromatin was analyzed
by PCR using a pair of radiolabeled primers specific to the CREB/E
box-binding region (Fig. 6A).
The ChIP assay results showed that LPS stimulation potently induced the
acetylation of both histone H3 and H4 at the mkp-M promoter,
whereas neither acetylated histone H3 nor H4 was detected in
non-stimulated cells (Fig. 6B). These results suggest that
the regulation of the endogenous mkp-M gene activation is
associated with the acetylation of histone H3 and H4 at the mkp-M promoter.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
LPS-induced acetylation of histone H3 and H4
at mkp-M promoter. A, schematic represent
mkp-M promoter region. The areas of DNase I hypersensitivity
sites (HS) and the positions of the primers for ChIP assay
are shown. B, RAW264.7 cells were untreated or treated with
LPS (1 µg/ml) for the indicated times. After treatment, chromatin was
extracted and immunoprecipitated with either anti-acetylhistone H3 or
anti-acetylhistone H4. PCR analyses of DNA products from
immunoprecipitation reactions were carried out as described under
"Experimental Procedures."
|
|
To confirm the specificity of our ChIP assay results, we determined the
acetylation level of histone H3 and H4 on the mkp-M gene
more 5'-upstream of the E box/CREB-binding region (Fig. 6A). A pair of primers specific to the
1970 to
1755 of the
mkp-M gene were used to analyze the acetylation status of
histone H3 and H4 using the same DNA templates. Although the
basal acetylation of histone H3 and H4 was detected, LPS stimulation
did not increase their acetylation at this region (Fig. 6B).
These results, along with the HS data (Fig. 4), indicate that
acetylation of histones and chromatin remodeling occurs at a
short stretch of DNA around the E box/CRE site.
p38 MAPK Is Involved in the Transcriptional Induction of
MKP-M--
We reported previously that p38 MAPK is necessary for
LPS-mediated mkp-M gene expression in RAW264.7 cells using a
specific inhibitor of p38 MAPK, SB208530 (5). To determine whether the inhibition of p38 MAPK pathway had any effect on LPS-induced
mkp-M promoter, we pretreated RAW264.7 stable clones of
reporter construct with SB208530. As expected, the inhibition of p38
MAPK pathway by pretreatment of the stable clones with SB208530
completely abrogated mkp-M promoter-driven luciferase
activity by LPS (Fig. 7A).
Thus the activation of p38 pathway is essential for mkp-M promoter activation by LPS.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
p38 MAPK is involved in the transcriptional
regulation of MKP-M. A, RAW264.7 stable clones were cultured
as described in Fig. 3A. Cells were pretreated with 50 µM SB208530, a specific inhibitor of p38 MAPK for 30 min
before stimulation with 1 µg/ml LPS for an additional 8 h. The
lysates were prepared for luciferase assay. The assay of each clone was
done in triplicate, and the fold induction averages of three
independent experiments are shown. B, a summary model for
the transcriptional regulation of MKP-M in LPS-treated macrophages. A
promoter region required for full mkp-M gene activation by
LPS in macrophages, the HS region, and the location of E box and CRE
consensus elements are shown. See "Discussion" for detailed
explanation.
|
|
 |
DISCUSSION |
In our previous report (5) we demonstrated that gene expression of
a dual specificity phosphatase, MKP-M, is rapidly induced by LPS or
synthetic lipid A stimulation in mouse macrophage cell lines. MKP-M has
strong substrate specificity toward JNK, and the increased level of
MKP-M is at least partially responsible for the down-regulation of
LPS-mediated JNK activation and TNF-
secretion. Thus MKP-M seems
important in regulating the excessive inflammatory response in
Gram-negative bacterial infection. Interestingly, unlike other MAP
kinase phosphatases, MKP-M mRNA in macrophages is not significantly
induced by treatment with pro-inflammatory cytokines such as TNF-
,
interferon-
, IL-2, or IL-15, suggesting a unique regulatory
mechanism of the mkp-M gene expression (5).
In this report, we describe the isolation of the mkp-M
genomic clone and characterized its transcriptional initiation sites and the 5'-regulatory region. The mkp-M gene covers ~55 kb
and consists of 7 exons (Fig. 1A). It utilizes two
transcriptional start sites (Fig. 1, B and C).
The 5'-flanking region of the mkp-M promoter lacks either
TATA or CAAT box but is rich in GC content. The GC-rich/TATA less
promoters have been found among the inducible and tissue-specific
genes, such as the urokinase-type plasminogen activator receptor (13),
CD7 (14), Pim-1 (15), T cell-specific mal genes
(16), and pac-1 (17), and some of these genes contain multiple start sites like mkp-M. Interestingly, both of the
two transcriptional start sites are indispensable for mkp-M
gene transcription, as the deletion of either site caused the loss of
the basal promoter activity (data not shown).
Our promoter functional analyses showed that the upstream region
reaching up to
252 from the proximal start site is sufficient for the
fully inducible expression of the mkp-M gene by LPS (Fig. 2A). Further deletion to
135 abrogated the induction,
indicating the region between
252 and
135 confers LPS
responsiveness to the mkp-M promoter. Nucleotide sequencing
analysis of this region identified consensus binding sequences for
three transcription factors that may be involve in the induction of
mkp-M gene expression: E box, CRE, and AP-2 (Fig.
1C). Mutation of the E box and/or CREB-binding motif by
site-directed mutagenesis significantly reduced fold inductions by LPS
in the promoter functional assay (Fig. 2B). EMSAs using
252 to
135 DNA fragment as a probe revealed two DNA-protein
complexes in the LPS-treated macrophage cell line. Addition of either E
box or CRE consensus oligonucleotide as a non-radioactive competitor
effectively inhibited the formation of the two complexes, whereas the
AP-2 consensus oligonucleotide showed no inhibitory effect (Fig.
3A). Furthermore, an oligonucleotide specific to either E
box or CRE consensus element was capable of forming protein-DNA
complexes (Fig. 3C). These lines of evidence strongly
indicate that both E box and CRE contribute to mkp-M gene
activation by LPS.
The E box element has the consensus sequence that is recognized by the
members of the bHLH-ZIP transcription factor that include Myc (18), Max
(19), upstream stimulatory factors 1 and 2 (20, 21), as well as ZEB
(22). The protein-protein interaction within the bHLH-ZIP results in
the formation of a dimer at the E box that leads to either the
activation or repression of gene transcription (18).
The CRE consensus element is recognized by various transcription
factors including CREB (23), ATF (24), c-Jun (25), and c-Fos (26).
Notably, the combination of E box and CRE sites is not unique to the
mkp-M gene. As a matter of fact, many mammalian genes
contain both of these sequences in their proximal promoters, and the
synergy between these two elements has been reported in transcriptional
activation of several genes such as rat vgf (27), murine and
human transferrin (28), and transforming growth factor-
2 (29).
The competition assays of EMSA showed that the oligonucleotide
corresponding to either E box or CRE consensus element abrogated the
formation of the two protein-binding complexes, whereas the mutated
versions of those lost the inhibitory affect (Fig. 3, A and
C). Although we have not identified the protein binding to E
box motif, the supershift assay using a specific antibody showed that
CREB is in both of the DNA-protein complexes (Fig. 3B).
Thus, it is reasonable to assume that CREB forms a complex with another
regulatory protein binding to E box motif, and these two proteins
synergistically activate transcription of mkp-M gene. In
contrast, AP-2 does not seem to share any regulatory function. This is
rather different from another DSP, PAC-1 (30). Regulation of PAC-1
expression in T cells in response to v-ras- and
v-raf-induced signals is mediated by AP-2 and E box.
Deletion of AP-2-binding site dramatically decreased pac-1
gene transcription, whereas mutation of E box had no effect in some
cell lines.
Notably, in transient transfection assays, DNA fragments containing the
5'-upstream region of mkp-M gene showed proper basal promoter function but did not respond to LPS stimulation in RAW264.7 cells. The same constructs revealed significant inducibility by LPS
when they were stably integrated in the genome, implying that LPS
responsiveness of mkp-M promoter requires the proper
chromatin structure. When DNA is packaged into nucleosome, it often
fails to provide a recognition code for the transcription factors
(31-34), and many transcription factors recognize chromatin templates
with lower affinity or do not bind them at all (35). Also nucleosomal biochemistry can influence transcription factor accessibility to DNA
(36). The structural changes in chromatin may accompany the acetylation
of histone H3 and H4 by histone acetyltransferases and is associated
with transcriptional activation, whereas deacetylation by histone
deacetylases is associated with gene repression. Inducing the global
hyperacetylation of cellular histones with TSA, a specific inhibitor
for histone deacetylases, resulted in the up-regulation of endogenous
MKP-M and mkp-M promoter reporter gene in RAW264.7 cell line
(Fig. 5A). ChIP assays showed that LPS potentially induced acetylation of both histone H3 and H4 at the mkp-M promoter
(Fig. 6B). These observations further support the crucial
roles of chromatin modifications played by histone acetylation for
mkp-M gene activation. Interestingly, the promoter
activation of MKP-1, another DSP, has been shown to associate with
histone H3 acetylation after arsenite treatment, and its gene
expression is also induced by TSA (37). Thus MKP-M is a second DSP
member whose gene expression has been shown to be positively regulated
by histone acetylation. It is of note that the acetylation of histone
and the inhibition of histone deacetylases by TSA are also associated
with gene repression for some genes such as ETS transcription factor
PU.1 (38).
The acetylation of the histone tails disrupts and interferes with the
higher order chromatin folding, promotes the solubility of chromatin at
physiological ionic strength, and maintains the unfolded structure of
the transcribed nucleosome allowing transcription factor binding (39,
40). The presence of HS sites commonly corresponds to regions in which
the chromatin is open and accessible (31). Our HS mapping revealed at
least two HS sites at the promoter region of mkp-M gene
after LPS stimulation, one of which correspond to the location of the
consensus sequences for E box/CRE.
Based on these data, we would like to propose a model in which the
structural changes in chromatin allow CREB and other regulatory proteins to bind the mkp-M promoter (Fig. 7B).
LPS-mediated gene remodeling has also been reported for several other
genes. For example, LPS induction of IL-12 p40 gene expression has been
reported to require remodeling of a promoter-encompassing nucleosome,
and this process is dependent on Toll-like receptor 4 (41). The activation of c-Rel or other transcriptional factors is neither required nor sufficient for this remodeling, indicating there is a
preceding mechanism for nucleosome remodeling. Importantly, a recent
report (42) indicated that p38 MAPK, which is strongly activated by
LPS, is responsible for the phosphoacetylation of histone H3 on
promoters of a subset of stimulus-induced cytokine and chemokine genes.
It is of note that MKP-M mRNA induction was effectively inhibited
by a specific p38 kinase inhibitor in LPS-stimulated macrophages,
whereas a specific inhibitor of MEK had no inhibitory effect,
indicating that p38 kinase but not extracellular signal-regulated kinase is required for mkp-M gene activation by LPS (5). We showed consistently in this report that pretreatment of RAW264.7 stable
clones with SB208530 abrogated mkp-M promoter-driven
luciferase activity by LPS (Fig. 7A). Thus it seems
reasonable to presume that p38 kinase activated by LPS induces
phosphorylation of histones leading to their subsequent acetylation and
nucleosome remodeling at the mkp-M promoter.
In conclusion, acetylation of histone H3 and H4 is induced at the
mkp-M promoter in LPS-stimulated macrophages. This leads to
nucleosome remodeling and subsequent recruitment of transcriptional factors including CREB to the E box/CRE elements of mkp-M
promoter. Induced MKP-M plays an important role in down-regulating JNK
activity and cytokine secretion (5). Thus LPS utilizes nucleosome
remodeling as a transcriptional activation mechanism not only for
cytokine and chemokine genes such as IL-12 p40 but also for genes of
signal regulators such as mkp-M.
 |
ACKNOWLEDGEMENTS |
We thank Keiko Itano and Ayumi
Nishikawa for technical assistance.
 |
FOOTNOTES |
*
This work was supported in part by grants from Ono
Pharmaceutical Company, Ministry of Education, Science and Culture of
the Japanese Government, and the Yakult Bioscience Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY150700.
¶
To whom correspondence and reprint requests should be
addressed: Laboratory of Host Defense and Germfree Life, Research
Institute for Disease Mechanism and Control, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 Japan.
Tel.: 52-744-2447; Fax: 52-744-2449; E-mail:
tmatsugu@med.nagoya-u.ac.jp.
Published, JBC Papers in Press, January 2, 2003, DOI 10.1074/jbc.M211829200
 |
ABBREVIATIONS |
The abbreviations used are:
DSP, dual-specificity protein phosphatase;
MAPK, mitogen-activated protein
kinase;
JNK, c-Jun N-terminal kinase;
ChIP, chromatin
immunoprecipitation;
TSA, trichostatin A;
CREB, cAMP-response
element-binding protein;
CRE, CREB-responsive element;
EMSA, electromobility shift assay;
LPS, lipopolysaccharide;
TNF-
, tumor
necrosis factor-
;
MOPS, morpholinepropanesulfonic acid;
IL, interleukin;
HS, hypersensitivity.
 |
REFERENCES |
| 1.
|
Camps, M.,
Nichols, A.,
and Arkinstall, S.
(2000)
FASEB J.
14,
6-16[Abstract/Free Full Text]
|
| 2.
|
Theodosiou, A.,
and Ashworth, A.
(2002)
Genome Biol.
3,
3009.1-3009.10
|
| 3.
|
Masuda, K.,
Shima, H.,
Watanabe, M.,
and Kikuchi, K.
(2001)
J. Biol. Chem.
276,
39002-39011[Abstract/Free Full Text]
|
| 4.
|
Tanoue, T.,
Yamamoto, T.,
Maeda, R.,
and Nishida, E.
(2001)
J. Biol. Chem.
276,
26629-26639[Abstract/Free Full Text]
|
| 5.
|
Matsuguchi, T.,
Musikacharoen, T.,
Johnson, T. R.,
Kraft, A. S.,
and Yoshikai, Y.
(2001)
Mol. Cell. Biol.
21,
6999-7009[Abstract/Free Full Text]
|
| 6.
|
Musikacharoen, T.,
Matsuguchi, T.,
Kikuchi, T.,
and Yoshikai, Y.
(2001)
J. Immunol.
166,
4516-4524[Abstract/Free Full Text]
|
| 7.
|
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884[Abstract/Free Full Text]
|
| 8.
|
Schwenzer, R.,
Siemienski, K.,
Liptay, S.,
Schubert, G.,
Peters, N.,
Scheurich, P.,
Schmid, R. M.,
and Wajant, H.
(1999)
J. Biol. Chem.
274,
19368-19374[Abstract/Free Full Text]
|
| 9.
|
Weinmann, A. S.,
Plevy, S. E.,
and Smale, S. T.
(1999)
Immunity
11,
665-675[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Hebbes, T. R.,
Thorne, A. W.,
and Crane-Robinson, C.
(1988)
EMBO J.
7,
1395-1402[Medline]
[Order article via Infotrieve]
|
| 11.
|
Hebbes, T. R.,
Clayton, A. L.,
Thorne, A. W.,
and Crane-Robinson, C.
(1994)
EMBO J.
13,
1823-1830[Medline]
[Order article via Infotrieve]
|
| 12.
|
Urnov, F. D.,
and Wolffe, A. P.
(2001)
Mol. Endocrinol.
15,
1-16[Free Full Text]
|
| 13.
|
Soravia, E.,
Grebe, A.,
De Luca, P.,
Helin, K.,
Suh, T. T.,
Degen, J. L.,
and Blasi, F.
(1995)
Blood
86,
624-635[Abstract/Free Full Text]
|
| 14.
|
Schanberg, L. E.,
Fleenor, D. E.,
Kurtzberg, J.,
Haynes, B. F.,
and Kaufman, R. E.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
603-607[Abstract/Free Full Text]
|
| 15.
|
Meeker, T. C.,
Loeb, J.,
Ayres, M.,
and Sellers, W.
(1990)
Mol. Cell. Biol.
10,
1680-1688[Abstract/Free Full Text]
|
| 16.
|
Tugores, A.,
Rubio, T.,
Rancano, C.,
and Alonso, M. A.
(1997)
DNA Cell Biol.
16,
245-255[Medline]
[Order article via Infotrieve]
|
| 17.
|
Gerondakis, S.,
Economou, C.,
and Grumont, R. J.
(1994)
Genomics
24,
182-184[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Ryan, K. M.,
and Birnie, G. D.
(1996)
Biochem. J.
314,
713-721[Medline]
[Order article via Infotrieve]
|
| 19.
|
Blackwood, E. M.,
and Eisenman, R. N.
(1991)
Science
251,
1211-1217[Abstract/Free Full Text]
|
| 20.
|
Sawadogo, M.,
and Roeder, R. G.
(1985)
Cell
43,
165-175[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Sirito, M.,
Lin, Q.,
Maity, T.,
and Sawadogo, M.
(1994)
Nucleic Acids Res.
22,
427-433[Abstract/Free Full Text]
|
| 22.
|
Postigo, A. A.,
Ward, E.,
Skeath, J. B.,
and Dean, D. C.
(1999)
Mol. Cell. Biol.
19,
7255-7263[Abstract/Free Full Text]
|
| 23.
|
Montminy, M. R.,
and Bilezikjian, L. M.
(1987)
Nature
328,
175-178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Lee, K. A.,
Hai, T. Y.,
SivaRaman, L.,
Thimmappaya, B.,
Hurst, H. C.,
Jones, N. C.,
and Green, M. R.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
8355-8359[Abstract/Free Full Text]
|
| 25.
|
Bohmann, D.,
Bos, T. J.,
Admon, A.,
Nishimura, T.,
Vogt, P. K.,
and Tjian, R.
(1987)
Science
238,
1386-1392[Abstract/Free Full Text]
|
| 26.
|
Chiu, R.,
Boyle, W. J.,
Meek, J.,
Smeal, T.,
Hunter, T.,
and Karin, M.
(1988)
Cell
54,
541-552[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Di Rocco, G.,
Pennuto, M.,
Illi, B.,
Canu, N.,
Filocamo, G.,
Trani, E.,
Rinaldi, A. M.,
Possenti, R.,
Mandolesi, G.,
Sirinian, M. I.,
Jucker, R.,
Levi, A.,
and Nasi, S.
(1997)
Mol. Cell. Biol.
17,
1244-1253[Abstract]
|
| 28.
|
Chaudhary, J.,
and Skinner, M. K.
(1999)
Endocrinology
140,
1262-1271[Abstract/Free Full Text]
|
| 29.
|
Scholtz, B.,
Kingsley-Kallesen, M.,
and Rizzino, A.
(1996)
J. Biol. Chem.
271,
32375-32380[Abstract/Free Full Text]
|
| 30.
|
Grumont, R. J.,
Rasko, J. E.,
Strasser, A.,
and Gerondakis, S.
(1996)
Mol. Cell. Biol.
16,
2913-2921[Abstract]
|
| 31.
|
Forsberg, E. C.,
and Bresnick, E. H.
(2001)
Bioessays
23,
820-830[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Grunstein, M.
(1997)
Nature
389,
349-352[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Strahl, B. D.,
and Allis, C. D.
(2000)
Nature
403,
41-45[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Kadam, S.,
and Emerson, B. M.
(2002)
Curr. Opin. Cell Biol.
14,
262-268[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Taylor, I. C.,
Workman, J. L.,
Schuetz, T. J.,
and Kingston, R. E.
(1991)
Genes Dev.
5,
1285-1298[Abstract/Free Full Text]
|
| 36.
|
Han, M.,
and Grunstein, M.
(1988)
Cell
55,
1137-1145[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Li, J.,
Read, L. R.,
and Baker, M. D.
(2001)
Mol. Cell. Biol.
21,
501-510[Abstract/Free Full Text]
|
| 38.
|
Laribee, R. N.,
and Klemsz, M. J.
(2001)
J. Immunol.
167,
5160-5166[Abstract/Free Full Text]
|
| 39.
|
Spencer, V. A.,
and Davie, J. R.
(1999)
Gene (Amst.)
240,
1-12[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Tse, C.,
Sera, T.,
Wolffe, A. P.,
and Hansen, J. C.
(1998)
Mol. Cell. Biol.
18,
4629-4638[Abstract/Free Full Text]
|
| 41.
|
Weinmann, A. S.,
Mitchell, D. M.,
Sanjabi, S.,
Bradley, M. N.,
Hoffmann, A.,
Liou, H. C.,
and Smale, S. T.
(2001)
Nat. Immunol.
2,
51-57[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Saccani, S.,
Pantano, S.,
and Natoli, G.
(2002)
Nat. Immunol.
3,
69-75[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Nakamura, T. Kukita, T. Shobuike, K. Nagata, Z. Wu, K. Ogawa, T. Hotokebuchi, O. Kohashi, and A. Kukita
Inhibition of Histone Deacetylase Suppresses Osteoclastogenesis and Bone Destruction by Inducing IFN-{beta} Production
J. Immunol.,
November 1, 2005;
175(9):
5809 - 5816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Musikacharoen, A. Oguma, Y. Yoshikai, N. Chiba, A. Masuda, and T. Matsuguchi
Interleukin-15 induces IL-12 receptor {beta}1 gene expression through PU.1 and IRF 3 by targeting chromatin remodeling
Blood,
January 15, 2005;
105(2):
711 - 720.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Masuda, Y. Yoshikai, H. Kume, and T. Matsuguchi
The Interaction between GATA Proteins and Activator Protein-1 Promotes the Transcription of IL-13 in Mast Cells
J. Immunol.,
November 1, 2004;
173(9):
5564 - 5573.
[Abstract]
[Full Text]
[PDF]
|
 |
|