JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M211829200 on January 2, 2003

J. Biol. Chem., Vol. 278, Issue 11, 9167-9175, March 14, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/11/9167    most recent
M211829200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Musikacharoen, T.
Right arrow Articles by Matsuguchi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Musikacharoen, T.
Right arrow Articles by Matsuguchi, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Histone Acetylation and Activation of cAMP-response Element-binding Protein Regulate Transcriptional Activation of MKP-M in Lipopolysaccharide-stimulated Macrophages*

Tipayaratn MusikacharoenDagger , Yasunobu Yoshikai§, and Tetsuya MatsuguchiDagger

From the Dagger  Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University Graduate School of Medicine, Nagoya 466-8550 and § Division of Host Defense, Research Center of Prevention of Infectious Diseases, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582, Japan

Received for publication, November 20, 2002, and in revised form, December 19, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

MKP-M is a dual specificity phosphatase that preferentially inactivates JNK. mkp-M gene expression is rapidly induced by lipopolysaccharide (LPS) stimulation in macrophages and is involved in the negative regulation of LPS-mediated JNK activation and tumor necrosis factor-alpha secretion. To reveal the transcriptional regulation of the mkp-M gene, we isolated the mouse mkp-M gene and mapped its transcriptional start site. Luciferase reporter plasmids containing 5'-upstream regions of the mkp-M gene were stably transfected into RAW264.7 cells. The assays using these cells revealed that the promoter region between -252 and -135 is required for mkp-M promoter activation. Sequencing analysis revealed E box and CREB-responsive elements in this region, and electromobility shift assays and mutagenesis confirmed that both of these elements are essential for LPS responsiveness of the mkp-M gene. We also utilized chromatin immunoprecipitation assay and found that LPS stimulation caused acetylation of histone H3 and H4 at mkp-M promoter in RAW264.7 cells. Consistent with this, a histone deacetylase inhibitor, trichostatin A, increased endogenous mkp-M gene transcription. Finally, DNase I hypersensitivity site mapping revealed the inducible hypersensitivity site after LPS stimulation around the location of the E box and CREB-responsive elements. Altogether, our data indicated that the activation of mkp-M gene transcription in macrophages by LPS is associated with histone acetylation and chromatin remodeling.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The dual specificity protein phosphatases (DSPs)1 are an emerging subclass of the protein-tyrosine phosphatase gene superfamily which have been shown to inactivate mitogen-activated protein kinases (MAPKs) through dephosphorylation of both threonine and tyrosine residues within a signature sequence of TXY that are essential for the enzymatic activity (1). The members of DSPs share two common features as follows: a catalytic domain with significant amino acid sequence homology to a vaccinia virus dual specificity phosphatase, VH-1; and an N-terminal region homologous to the catalytic domain of the cdc25 phosphatase (rhodanese homology domain). Among its family members, some show highly selective substrate specificity, whereas others efficiently inactivate all three classes of MAPKs: extracellular signal-regulated kinase, c-Jun N-terminal kinase/stress-activated protein kinase, and p38/RK/CSBP (p38). Three distinct classes of MAPKs play important roles in various cellular events. Because the activation of MAPKs is a reversible process and gene expression of many DSPs is significantly induced following stimulation with growth factors, cytokines, or cell stresses, the induction of MKPs is likely to provide the important mechanism for control of MAPK activity.

To date, 10 members of the mammalian DSPs gene family have been isolated and characterized. These members of DSPs have been defined recently into three subgroups by their basic structural prediction from genomic sequence (2): subgroup I, DUSPI (hVHI/CL100/MKP-1/3CH134), DUSP2 (hPAC-1), DUSP4 (hVH2/TYP1), and DUSP5 (hVH3/B23/MKP-2); subgroup II, DUSP6 (PYSTI/MK-3/rVH6), DUSP7 (PYST2/B59/MKP-X), DUSP9 (MKP-4), and DUSP10 (MKP-5); and subgroup III, DUSP 8 (hVH5/M3/6) and DUSP16 (MKP-7/ MKP-M).

MKP-M, a dual specificity isolated from macrophage, also referred to as MKP-7 (3, 4) is a member of DSPs family which is homologous to the human protein MKP-7 (2). MKP-M preferentially inactivates JNK (3, 5) when it is overexpressed in COS7 cells, and it also efficiently inactivates p38alpha and p38beta in NIH3T3 cells (4). In any cell system, it does not show any significant phosphatase activity toward extracellular signal-regulated kinase. We have shown previously (5) that mkp-M gene expression is rapidly induced by LPS stimulation in mouse macrophage cell lines. Notably, it is not significantly increased by proinflammatory cytokines such as tumor necrosis factor-alpha (TNF-alpha ), interferon-gamma , interleukin-2 (IL-2), and IL-15. Expression of a phosphatase-inactive version of MKP-M enhanced and elongated both JNK activation and TNF-alpha production in LPS-treated macrophages. Thus induction of MKP-M expression is at least partially responsible for the down-regulation of LPS-mediated JNK activation and TNF-alpha secretion in macrophages, indicating that MKP-M may have a role in preventing excessive inflammatory responses mediated by activated macrophages.

To understand the transcriptional regulation of mkp-M gene in macrophages, we isolated mkp-M genomic DNA clones, identified the transcriptional initiation sites, and analyzed its 5'-upstream region. We show here that mkp-M gene expression is regulated by acetylation of histones H3 and H4 on the mkp-M promoter region containing the functional E box and CRE consensus motifs.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Antibodies and Reagents-- Anti-acetylhistone H3 and anti-acetylhistone H4 antibodies were purchased from Upstate Biotechnology Inc. (Lake Placid, NY). LPS from Escherichia coli serotype B5:055, trichostatin A, RPMI 1640 medium, and Dulbecco's modified Eagle's medium were obtained from Sigma. SB208530, a specific inhibitor of p38 kinase, was purchased from Calbiochem.

Isolation and Characterization of the Mouse mkp-M Genomic Clones-- The mouse MKP-M cDNA containing the whole coding region was labeled with 32P by random priming and used for screening the mouse genomic phage library in Lambda Fix II (Stratagene, La Jolla, CA). Plaque hybridization was carried out as described previously (6). Positive plaques were isolated and screened until pure clones were obtained. Phage DNAs were isolated from positive clones and characterized by enzyme restriction mapping and Southern blot analyses. Subfragments that hybridized to 5'-cDNA probe were cloned into pBlueScript II KS+ (Stratagene, La Jolla, CA) and were randomly sequenced by the DNA sequencer (model 373A sequencer) using EN::TN <KAN-2> insertion (Epicentre, Madison, WI) and DYEnamicTM ET terminator cycle sequencing kit (Amersham Biosciences). The nucleotide sequences upstream to the transcriptional start site were searched for the potential binding sites for transcription factors (7).

Mapping the Transcriptional Start Site of mMKP-M-- Primer extension analysis was applied to map the initiation start site of the mkp-M gene. Total RNA was prepared from LPS-stimulated RAW264.7 cells. Contaminating DNA was removed from RNA by treatment with 10 µg/ml DNase I (Sigma) for 2 h at 16 °C. Remaining RNA was extracted twice with phenol/chloroform and subjected to poly (A)+ RNA purification using mRNA purification kit (Amersham Biosciences). An oligonucleotide, TCTCTTCCACCGCCCCCC, complementary to the 5'-untranslated region of the MKP-M cDNA (5), was end-labeled with 32P. The annealing of the labeled primer to poly(A)+ RNA was performed in 11 µl of 2× first strand buffer (Invitrogen) by heating the mixture of 2 pmol of labeled primer and 10 µg of poly(A)+ RNA at 58 °C for 40 min and cooling to room temperature for 20 min. The reverse transcription was done by adding 9 µl of RT mix (40 mM dithiothreitol, 4 mM each of dNTP, 2 mM spermidine, 150 ng of actinomycin D, 5 µl of 2× first strand buffer, 1.5 µl of 40 mM sodium pyrophosphate) and 100 units of SuperscriptTM II (Invitrogen) into annealed primer/RNA and incubated at 42 °C for 2 h. The same primer was used in DNA sequencing on a plasmid containing 5'-flanking region of the mkp-M gene with fmol® DNA sequencing systems (Promega) as the marker. The extended primer was run along with the sequencing product on a 6% denaturing polyacrylamide urea gel.

Generation of mkp-M Promoter Constructs, Site-directed Mutagenesis, and DNA Purification-- A series of synthesis oligonucleotide senses: CGACGCGTCTGGCTAGACCAGAACATTT (pGL3-1958), CGACGCGTGTGGGAGAGGACTAACAGAA (pGL3-1488), CGACGCGTCCTGGAACTGGAGTTACAGA (pGL3-875), CGACGCGTGCAGCTGACTAGCAGAGAGC (pGL3-252), CGACGCGTGGCTCGCGGGGACGAGCGCC (PGL3-135), and an antisense CCCTCGAGAAACGGTGATGCCCGCAGGA, derived from the respective part of the 5'-upstream region of mkp-M gene, were used to generate a series of 5'-deletion DNA fragments by Advantage®-GC2 PCR (Clontech) according to the manufacturer's instructions. All PCR products were then cloned into pGEMT-easy vector (Promega) and digested with XhoI and MluI, and the inserts were subcloned into pGL3-basic vector (Promega).

To generate site-directed mutagenesis, the following mutated oligonucleotides, CRE-mut 5' CGCGGCGCTGcaCTtTTgtTCCCCGCGG, E box-mut 5' CGGCCAGCGCtCaGCGCTGGGC, or CRE/E box-mut 5' CGGCCAGCGCtCaGCGCTGcaCTtTTgtTCCCCGCGG, and an enzyme restriction-mutated primer SalI-mut GATAAGGATCCcTCGACCGATGCC (5' end position is given before sequence, the binding site is underlined and altered bases are given in lowercase letters) were used to introduce specific mutations into pGL3-252 construct by TransformerTM site-directed mutagenesis kit (Clontech) according to the manufacturer's instructions. Plasmid DNAs were purified from bacterial cultures using Endofree plasmid maxi kit (Qiagen). Finally, restriction enzyme mapping and sequencing confirmed all constructs.

Cell Culture, Transfection, and Luciferase Assays-- A mouse macrophage cell line, RAW264.7, was obtained from RIKEN cell bank (Tsukuba, Japan) and maintained in Dulbecco's modified Eagle's medium with 10% newborn calf serum (Sigma). For stable transfection, RAW264.7 cells were plated onto 60-mm plates at 1 × 106 cells/plate on the day before transfection. The combination of 2 µg of mkp-M luciferase plasmid and 0.5 µg of the neomycin resistance plasmid, pcDNA3.1(+), were transfected using LipofectAMINETM (Invitrogen) according to the manufacturer's instructions. After 36 h, cells were selected with 2 mg/ml geneticin (Sigma). The independent neomycin-resistant clones were isolated and maintained in the medium containing 1 mg/ml geneticin. For luciferase assays, stable RAW264.7 transfectants were trypsinized and washed twice with the cultured medium without geneticin and were plated onto 35-mm plates at 1 × 105 cells/plate. Twenty four hours after plating, cells were either left untreated or treated with 1 µg/ml LPS or 100 nM/ml TSA or the combination of LPS and TSA for 8 h. Cells were then lysed, and the lysates were used for luciferase activity measurements using luciferase assay system (Promega) according to the manufacturer's instructions.

Electrophoretic Mobility Shift Assay (EMSA)-- Nuclear extracts were prepared from RAW264.7 cells stimulated with 1 µg/ml LPS as described previously (8). A double strand DNA-comprising nucleotide -252 to -135 of mkp-M promoter amplified by PCR was radiolabeled by [gamma -32P]ATP with T4 polynucleotide kinase and used as a probe. For EMSA, 5 µg of nuclear extracts were incubated with 1 µg of poly(dI·dC) in a total volume of 19 µl of binding buffer (10 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 4% glycerol) for 15 min at 4 °C before ~1 × 105 cpm of radiolabeled probe was added for another 30 min. For competition assays, nuclear extracts were incubated with a 50-fold excess of cold-targeted oligonucleotide prior to the addition of 32P-labeled probe. The cold-targeted primers for the EMSA were 5' AGCGCGCGGC for E box, 5' TGGGCTCTTCGTCCC for CRE, or 5' CTCCCGGAGGC for AP-2. For supershift assays, anti-CREB was incubated with nuclear extracts for 2 h before the binding reactions. The reaction mixtures were run through a 6% non-denaturing polyacrylamide gel at 4 °C in TBE buffer.

Northern Blot Analysis-- Total cellular RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instruction. 15-µg aliquots of the total RNA were fractionated on a 1% agarose gel containing 20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA (pH 7.0), and 6% (v/v) formaldehyde and transferred to a nylon membrane. The membrane hybridization was performed as described previously (5). A 220-bp MKP-M cDNA fragment encoding amino acids 297-373 was prepared as described previously (5) and used as a probe.

Chromatin Immunoprecipitation (ChIP) Assay-- Acetylhistone ChIP assay was performed according to the manufacturer's instruction (Upstate Biotechnology Inc.). Following LPS stimulation, cells were cross-linked with 1% formaldehyde for 10 min at room temperature, washed twice with ice-cold PBS, and lysed for 10 min at 1 × 106 cells/200 µl of SDS lysis buffer. The chromatin was sheared by sonication 4 times for 10 s at one-third of the maximum power with 20 s cooling on ice between each pulse. Cross-link released chromatin fractions were pre-cleared with salmon sperm DNA/protein A-agarose for 3 h followed by immunoprecipitation with either anti-acetylhistone H3 or anti-acetylhistone H4 overnight at 4 °C. Immune complexes were collected with salmon sperm DNA/protein A-agarose for 1 h and extracted with 1% SDS, 0.1 M NaHCO3. Histone-DNA cross-linking was reversed at 65 °C overnight and digested with 100 µg of proteinase K at 45 °C for 1 h. DNA was recovered by phenol/chloroform, chloroform extraction, and precipitation in the presence of 20 µg of glycerol. Finally, DNA was dissolved in 20 µl of TE buffer and subjected to PCR. PCR amplifications were carried out in a 50-µl volume containing 1.0 M GC-melt, 50 pmol of each primer, 0.2 mM of each dNTP, 10 µl of 5× GC2 PCR buffer, and 1 µl of 50× (Titanium Taq DNA polymerase, Clontech, Palo Alto, CA). The mkp-M promoter-specific primers are as follows: sense, GAAAAGCCCCGGATTTGGGA; antisense, CTCTCTGCTAGTCAGCTGCT. PCR conditions are as follows: 94 °C for 3 min; 94 °C for 30 s; 66 °C for 2 min; and 72 °C for 7 min. PCR was done for 20-25 cycles with mkp-M promoter-specific primers followed by 3 cycles with a [gamma -32P]ATP-labeled antisense primer. The PCR products were analyzed by electrophoresis on a 6% denaturing polyacrylamide gel. For each reaction, 1% of cross-link released chromatin was saved and reversed at 65 °C for 6 h followed by proteinase K digestion and DNA extraction, and recovered DNA was used as input control.

Nuclei Preparation-- Nuclei preparation from RAW264.7 cells proceeded as described previously (9). Briefly, cells were rinsed twice with ice-cold PBS, harvested by scraping into PBS, and pelleted at 1500 rpm. The pellet was lysed in 5 volumes of ice-cold Nonidet P-40 lysis buffer (10 mM Tris (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40, 0.15 mM spermine, and 0.5 mM spermidine) for 10 min. Nuclei were pelleted for 5 min at 3000 rpm and washed twice with washing buffer (100 mM NaCl, 50 mM Tris (pH 8.0), 3 mM MgCl2, 0.15 mM spermine, and 0.5 mM spermidine) and then nuclei were collected at 3000 rpm for 5 min.

Nuclease Digestion, Restriction Enzyme Digestion, and Southern Blot Analysis-- For DNase I digestion, nuclei were resuspended in DNase I digestion buffer (100 mM NaCl, 50 mM Tris (pH 8.0), 3 mM MgCl2, 0.15 mM spermine, 0.5 mM spermidine, 1 mM CaCl2) at 2 × 108 nuclei/ml. 100-µl aliquots of nuclei were digested with increasing concentrations of DNase I, typically 0, 0.04, 0.06, and 0.08 µg at 25 °C for 10 min. The reactions were stopped by addition of 10 mM EDTA, 100 µl of DNase I digestion buffer, 100 µg of proteinase K, and 0.2% SDS and incubated at 37 °C overnight. For DNA purification, the samples were extracted once with phenol/chloroform and once with chloroform. The aqueous phase was digested with 20 µg of RNase A for 2 h at 37 °C, extracted with phenol/chloroform and chloroform, and then precipitated with ethanol, and DNA was redissolved in water. The 25-µg aliquots of genomic DNA from DNase I-treated nuclei were digested overnight with 50 units of EcoRI and SalI. Digested DNA was loaded onto 0.8% agarose gel. Gel was then soaked in denaturing buffer (0.6 M NaCl, 0.4 M NaOH) for 45 min and in neutralizing buffer (1.5 M NaCl, 0.1 M Tris base, 0.04 M Tris-HCl) for another 45 min and transferred to a nylon membrane. As the probe for DNase I hypersensitivity, PCR product was amplified with primers sense, GGTTTCAAGTGACGCCATCT, and antisense, GTCGACAGGGATGAAGAAGTT, using de-proteinized DNA from RAW264.7 as template and labeled with 32P by random priming. The membrane was prehybridized and hybridized with the 32P-labeled probe.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation and Characterization of mkp-M Gene-- In order to analyze the mouse mkp-M gene, a mouse genomic library was screened with MKP-M cDNA as the probe. We isolated 14 positive clones and characterized them by Southern blot analysis, restriction enzyme mapping, and nucleotide sequencing. The structure of the mkp-M gene including the intron/exon junctions is schematically shown in Fig. 1A. The mkp-M gene contained 7 exons; the consensus ATG that corresponded to the translational start codon was located at the distal part of exon 2 (Fig. 1A).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   Characterization of mkp-M gene. A, the mkp-M gene was characterized by restriction enzyme mapping and Southern blot analyses. Solid boxes represent exons, and the horizontal lines indicate introns. The position of the first methionine is also shown. B, primer extension analysis for mapping of the transcriptional start sites of the mkp-M gene. The transcribed product (P) was run along with sequencing ladder from the same primer on a 6% polyacrylamide/urea gel. The asterisks indicate the two transcribed products. C, the nucleotide sequence of the 5'-flanking region of the mouse mkp-M gene, two transcriptional start sites (TSS), are shown and the proximal transcriptional start site was assigned as +1. Potential binding sites for transcription factors are indicated by boldface capital letters. Arrows identify the 5' end of deletion promoter constructs.

Primer extension analysis was applied to map the transcriptional start site of the mkp-M gene. A synthesis oligonucleotide complementary to 5' end of the previously reported MKP-M cDNA was hybridized to poly(A)+ RNA from LPS stimulated RAW264.7 cells and extended by reverse transcription. Two transcriptional start sites were identified by comparing the transcribed products with the sequence ladder from the same primer (Fig. 1B). The first proximal transcriptional start site was located 229 bp upstream of the 5' end of the cDNA described previously (5). The second transcriptional start site was 115 bp upstream to the first site. To confirm these sites, several other oligonucleotides designed from different parts of MKP-M cDNA and mkp-M genomic DNA were also used for primer extension producing compatible results (data not shown). The nucleotide of the proximal transcriptional start site was designed as +1 throughout this paper (Fig. 1C).

The Structural and Functional Analysis of the 5'-Upstream Region of the Mouse mkp-M Gene-- The nucleotide sequence upstream of the transcriptional start sites was searched for the potential binding sites of transcriptional factors using Genome Exploring and Modeling software (7). As shown in Fig. 1C, neither TATA nor CAAT boxes were identified in the 5'-upstream region for each transcriptional initiation site. However, the region between the two initiation sites is very rich in GCs (GC content, 78%).

Because applying conventional PCR methods to this region was difficult most likely because of the high GC content, the Advantage®-GC 2 PCR kit (Clontech) was used to generate a series of 5'-deletion constructs to identify the region required for mkp-M gene activation. These 5'-deletion constructs were cloned into a promoter-less luciferase reporter vector. The activities of the mkp-M promoter constructs were first determined by transient transfection into RAW264.7 cells. Each of the reporter plasmids showed the proper basal promoter function, but none showed the inducible activity by LPS (data not shown). These plasmid constructs were then stably integrated into RAW264.7 cells by co-transfecting a G418-resistant plasmid for drug selection. Several independent stable clones for each construct were isolated. In stably integrated RAW264.7 cells, some constructs showed LPS-driven induction of luciferase activities (Fig. 2A). The highest inducible promoter activity was obtained from the longest pGL3-1958 construct. Subsequent deletion of pGL3-1958 resulted in moderately reduced promoter activity, but no significant differences were detected among those four deletion constructs (pGL3-1958, -1488, -875, and -252). In contrast, the responsiveness to LPS treatment was completely abrogated when the construct was deleted to -135 (pGL3-135).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Induction of mkp-M promoter activity by LPS in a mouse macrophage cell line. A, RAW264.7 cells stably integrated with MKP-M deletion constructs were cultured at 1 × 105 cells/plate for 24 h. Cells were either left untreated or treated for 8 h with 1 µg/ml LPS before lysate preparation for luciferase assays. Luciferase activity from two independent clones of each deletion construct was examined. Results are expressed as fold induction over the untreated controls. The assay of each clone was done in triplicate, and the average of three independent experiments is shown. B, CRE or E box mutation construct of the wild type pGL3-252 mkp-M promoter was stably integrated into RAW264.7 cells. Two independent neomycin-resistant clones of each construct were plated and treated as described in A. The fold inductions by LPS are shown. The assay of each clone was done in triplicate and the average of three independent experiments is shown.

Roles of E Box and CRE Consensus Elements in LPS-induced MKP-M Transcription-- As shown in Fig. 2A, the region between -252 and -135 seemed critical for the activation of mkp-M promoter by LPS. The sequence analysis within this region demonstrated the presence of consensus elements for E box, CRE, and AP-2.

In order to examine the involvement of these elements in LPS responsiveness, each site was mutated by site-directed mutagenesis on the pGL3-252 wild type mkp-M promoter construct, and the mutated constructs were stably integrated into RAW264.7 cells. In stably integrated RAW264.7 cells, mutation of either E box or CRE consensus element significantly reduced fold induction by LPS. The responsiveness to LPS was completely abrogated by E box/CRE double mutation (Fig. 2B).

We next examined if DNA-protein binding within this region is involved in the activation of mkp-M promoter by EMSA. Nuclear extracts prepared from untreated and LPS-treated RAW264.7 cells were incubated with a 32P-labeled probe spanning the mkp-M promoter region between -252 and -135. EMSAs revealed the presence of two protein complexes binding to the probe in an LPS-dependent manner, and the formation of the protein-DNA complexes was practically absent in unstimulated cells (Fig. 3A). To determine the DNA sequences responsible for these complexes, cold-target competition was carried out with 50-fold excesses of E box, CRE, or AP-2 consensus nucleotide sequences. As shown in Fig. 3A, both complexes were abrogated by the addition of 50-molar excesses of either unlabeled CRE or E box-specific oligonucleotides, whereas the other cold target consensus element tested, AP-2, was incapable of inhibiting either complex.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Specific protein complexes bind -252 to -135 region of mkp-M promoter. A, RAW264.7 cells were left untreated or treated with LPS for 30 or 60 min, and the nuclear extracts were prepared. Five micrograms of nuclear extracts were incubated with 32P-labeled probe spanning the region between -252 and -135 of the mkp-M promoter. Specific complexes (C) are indicated. Comp refers to EMSA binding reaction that contained cold target oligonucleotide corresponding to the indicated consensus element as the competitor. B, the supershift assay using anti-CREB antibody (alpha CREB). The EMSA was carried out as in A. For supershift experiments, nuclear extracts were preincubated with 2 µl of alpha CREB before adding the mkp-M promoter probe. Super-shifted protein-DNA complexes are indicated. C, oligonucleotides specific to CRE, E box, or their mutated oligonucleotides were used as a probe for EMSA using the same nuclear extracts as in A.

We next addressed whether an antibody against CREB could modify the protein-DNA complexes. As shown in Fig. 3B, the inducible protein complexes were efficiently shifted with the anti-CREB antibody, indicating that both DNA-protein complexes contain CREB as a component. Furthermore, synthetic oligonucleotides specific to CRE and E box also formed protein-DNA complexes when they were incubated with nuclear extracts from LPS-treated RAW264.7 (Fig. 3C). In contrast their mutated versions did not. These results strongly indicated that both CRE and E box consensus sequences are functional as binding sites for transcriptional factors.

DNase I Hypersensitivity Sites in the 5'-Upstream Region of the Mouse mkp-M Gene-- Transcriptional activation of a gene is often accompanied by chromatin remodeling leading to the appearance of DNase I hypersensitivity (HS) sites (10-12). Thus we searched for the HS site in the MKP-M 5'-regulatory region before and after LPS stimulation. The increasing amounts of DNase I was used to cleave the nuclei from RAW264.7 cells, and then the genomic DNA was completely digested with EcoRI and SalI and subjected to Southern blot analysis. The probe used for the assay was derived from the 3' end of the 5-kb genomic EcoRI/SalI fragment containing the mkp-M promoter region. As shown in Fig. 4, two smaller DNA fragments were observed by Southern probe only in the LPS-treated cells. By determining the size of these DNA fragments, the regions of HS were around -1500 and -220 from the proximal transcriptional start site. Although the contribution of the -1500 HS in the MKP-M transcription is not clear, the site around -220 coincides with the locations of E box and CREB-binding sites.


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 4.   Inducible DNase I hypersensitivity sites on mkp-M promoter. Nuclei from untreated (lanes 1-4) or LPS-treated (lanes 5-8) RAW264.7 cells were digested with 0 (lanes 1 and 5), 0.04 (lanes 2 and 6), 0.06 (lanes 3 and 7), or 0.08 µg (lanes 4 and 8) of DNase I. Purified genomic DNA was digested with EcoRI and SalI and subjected to Southern blot analysis. The full-length genomic EcoRI/SalI fragment containing the mkp-M promoter region in purified genomic DNA and DNA fragments relative position of DNase I hypersensitivity sites on MKP-M are shown. A scheme representation 5' of mkp-M gene, the restriction enzyme map, and the location of Southern probe are also shown.

Trichostatin A, a Histone Deacetylase Inhibitor, Induced mkp-M Gene Activation-- Restructuring of the chromatin is often associated with histone acetylation. In order to determine a possible role of histone modification in the regulation of mkp-M gene activation, we treated RAW264.7 cells with a histone deacetylase inhibitor, trichostatin A (TSA), and we investigated its effects on mkp-M gene expression. In the Northern blot analysis, MKP-M mRNA level was potently increased by TSA treatment (Fig. 5A). This result prompted us to investigate the effect of TSA on mkp-M promoter activity by treating RAW264.7 stable clones with TSA. Consistent with Northern blot analysis, TSA treatment of RAW264.7 cells with MKP-M luciferase reporters (pGL3-1958, -1488, -875, and -252) stably integrated resulted in the induction of luciferase activity 5-6-fold over untreated cells. The induction was completely lost for the shortest promoter construct, pGL3-135 (Fig. 5B). As in LPS stimulation, the responsiveness to TSA treatment was also significantly reduced by the mutation of either E box or CRE-binding element (Fig. 5C). Moreover, combined treatment of these cells with TSA and LPS increased the fold induction of the luciferase activity in an additional manner (Fig. 5, B and C). Taken together, theses results strongly implied that histone acetylation may be involved in the regulation of mkp-M gene activation.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   TSA-mediated mkp-M gene transcription in RAW264.7 cells. A, RAW264.7 cells were left untreated or treated with one of the following: 1 µg/ml LPS for 2 h, 100 nM/ml TSA for 16 h or pretreated with 100 nM/ml TSA for 14 h, and 1 µg/ml LPS for an additional 2 h. Total RNA was extracted for the Northern blot analysis using a 32P-labeled MKP-M cDNA probe. Gene expression of MKP-M and a picture of the ethidium bromide-stained gel are shown. B and C, RAW264.7 cells stably integrated MKP-M deletion or mutation constructs were plated and cultured as described in Fig. 2A. Cells were either left untreated or treated for 8 h with one of the following: LPS (1 µg/ml), TSA (100 nM/ml), or the combination of LPS and TSA before lysate preparation for luciferase assays. The results are expressed as described in Fig. 2A.

LPS Treatment Caused Acetylation of Histone H3 and H4 at the mkp-M Promoter-- As mentioned above, both LPS and TSA could induce the mkp-M promoter-mediated luciferase activation when reporter plasmids were stably integrated but not when they were transiently transfected in RAW264.7 cells. It may be because transiently transfected necked DNA was not efficiently packed into chromatin, as it is well established that modifying chromatin structure through acetylation of histone needs proper chromatin structure. In order to determine whether histone acetylation actually occurs at the endogenous mkp-M gene, we utilized ChIP assay using antibodies specific to acetylhistone H3 or acetylhistone H4. The presence of the mkp-M gene in the immunoprecipitated chromatin was analyzed by PCR using a pair of radiolabeled primers specific to the CREB/E box-binding region (Fig. 6A). The ChIP assay results showed that LPS stimulation potently induced the acetylation of both histone H3 and H4 at the mkp-M promoter, whereas neither acetylated histone H3 nor H4 was detected in non-stimulated cells (Fig. 6B). These results suggest that the regulation of the endogenous mkp-M gene activation is associated with the acetylation of histone H3 and H4 at the mkp-M promoter.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   LPS-induced acetylation of histone H3 and H4 at mkp-M promoter. A, schematic represent mkp-M promoter region. The areas of DNase I hypersensitivity sites (HS) and the positions of the primers for ChIP assay are shown. B, RAW264.7 cells were untreated or treated with LPS (1 µg/ml) for the indicated times. After treatment, chromatin was extracted and immunoprecipitated with either anti-acetylhistone H3 or anti-acetylhistone H4. PCR analyses of DNA products from immunoprecipitation reactions were carried out as described under "Experimental Procedures."

To confirm the specificity of our ChIP assay results, we determined the acetylation level of histone H3 and H4 on the mkp-M gene more 5'-upstream of the E box/CREB-binding region (Fig. 6A). A pair of primers specific to the -1970 to -1755 of the mkp-M gene were used to analyze the acetylation status of histone H3 and H4 using the same DNA templates. Although the basal acetylation of histone H3 and H4 was detected, LPS stimulation did not increase their acetylation at this region (Fig. 6B). These results, along with the HS data (Fig. 4), indicate that acetylation of histones and chromatin remodeling occurs at a short stretch of DNA around the E box/CRE site.

p38 MAPK Is Involved in the Transcriptional Induction of MKP-M-- We reported previously that p38 MAPK is necessary for LPS-mediated mkp-M gene expression in RAW264.7 cells using a specific inhibitor of p38 MAPK, SB208530 (5). To determine whether the inhibition of p38 MAPK pathway had any effect on LPS-induced mkp-M promoter, we pretreated RAW264.7 stable clones of reporter construct with SB208530. As expected, the inhibition of p38 MAPK pathway by pretreatment of the stable clones with SB208530 completely abrogated mkp-M promoter-driven luciferase activity by LPS (Fig. 7A). Thus the activation of p38 pathway is essential for mkp-M promoter activation by LPS.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   p38 MAPK is involved in the transcriptional regulation of MKP-M. A, RAW264.7 stable clones were cultured as described in Fig. 3A. Cells were pretreated with 50 µM SB208530, a specific inhibitor of p38 MAPK for 30 min before stimulation with 1 µg/ml LPS for an additional 8 h. The lysates were prepared for luciferase assay. The assay of each clone was done in triplicate, and the fold induction averages of three independent experiments are shown. B, a summary model for the transcriptional regulation of MKP-M in LPS-treated macrophages. A promoter region required for full mkp-M gene activation by LPS in macrophages, the HS region, and the location of E box and CRE consensus elements are shown. See "Discussion" for detailed explanation.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In our previous report (5) we demonstrated that gene expression of a dual specificity phosphatase, MKP-M, is rapidly induced by LPS or synthetic lipid A stimulation in mouse macrophage cell lines. MKP-M has strong substrate specificity toward JNK, and the increased level of MKP-M is at least partially responsible for the down-regulation of LPS-mediated JNK activation and TNF-alpha secretion. Thus MKP-M seems important in regulating the excessive inflammatory response in Gram-negative bacterial infection. Interestingly, unlike other MAP kinase phosphatases, MKP-M mRNA in macrophages is not significantly induced by treatment with pro-inflammatory cytokines such as TNF-alpha , interferon-gamma , IL-2, or IL-15, suggesting a unique regulatory mechanism of the mkp-M gene expression (5).

In this report, we describe the isolation of the mkp-M genomic clone and characterized its transcriptional initiation sites and the 5'-regulatory region. The mkp-M gene covers ~55 kb and consists of 7 exons (Fig. 1A). It utilizes two transcriptional start sites (Fig. 1, B and C). The 5'-flanking region of the mkp-M promoter lacks either TATA or CAAT box but is rich in GC content. The GC-rich/TATA less promoters have been found among the inducible and tissue-specific genes, such as the urokinase-type plasminogen activator receptor (13), CD7 (14), Pim-1 (15), T cell-specific mal genes (16), and pac-1 (17), and some of these genes contain multiple start sites like mkp-M. Interestingly, both of the two transcriptional start sites are indispensable for mkp-M gene transcription, as the deletion of either site caused the loss of the basal promoter activity (data not shown).

Our promoter functional analyses showed that the upstream region reaching up to -252 from the proximal start site is sufficient for the fully inducible expression of the mkp-M gene by LPS (Fig. 2A). Further deletion to -135 abrogated the induction, indicating the region between -252 and -135 confers LPS responsiveness to the mkp-M promoter. Nucleotide sequencing analysis of this region identified consensus binding sequences for three transcription factors that may be involve in the induction of mkp-M gene expression: E box, CRE, and AP-2 (Fig. 1C). Mutation of the E box and/or CREB-binding motif by site-directed mutagenesis significantly reduced fold inductions by LPS in the promoter functional assay (Fig. 2B). EMSAs using -252 to -135 DNA fragment as a probe revealed two DNA-protein complexes in the LPS-treated macrophage cell line. Addition of either E box or CRE consensus oligonucleotide as a non-radioactive competitor effectively inhibited the formation of the two complexes, whereas the AP-2 consensus oligonucleotide showed no inhibitory effect (Fig. 3A). Furthermore, an oligonucleotide specific to either E box or CRE consensus element was capable of forming protein-DNA complexes (Fig. 3C). These lines of evidence strongly indicate that both E box and CRE contribute to mkp-M gene activation by LPS.

The E box element has the consensus sequence that is recognized by the members of the bHLH-ZIP transcription factor that include Myc (18), Max (19), upstream stimulatory factors 1 and 2 (20, 21), as well as ZEB (22). The protein-protein interaction within the bHLH-ZIP results in the formation of a dimer at the E box that leads to either the activation or repression of gene transcription (18).

The CRE consensus element is recognized by various transcription factors including CREB (23), ATF (24), c-Jun (25), and c-Fos (26). Notably, the combination of E box and CRE sites is not unique to the mkp-M gene. As a matter of fact, many mammalian genes contain both of these sequences in their proximal promoters, and the synergy between these two elements has been reported in transcriptional activation of several genes such as rat vgf (27), murine and human transferrin (28), and transforming growth factor-beta 2 (29).

The competition assays of EMSA showed that the oligonucleotide corresponding to either E box or CRE consensus element abrogated the formation of the two protein-binding complexes, whereas the mutated versions of those lost the inhibitory affect (Fig. 3, A and C). Although we have not identified the protein binding to E box motif, the supershift assay using a specific antibody showed that CREB is in both of the DNA-protein complexes (Fig. 3B). Thus, it is reasonable to assume that CREB forms a complex with another regulatory protein binding to E box motif, and these two proteins synergistically activate transcription of mkp-M gene. In contrast, AP-2 does not seem to share any regulatory function. This is rather different from another DSP, PAC-1 (30). Regulation of PAC-1 expression in T cells in response to v-ras- and v-raf-induced signals is mediated by AP-2 and E box. Deletion of AP-2-binding site dramatically decreased pac-1 gene transcription, whereas mutation of E box had no effect in some cell lines.

Notably, in transient transfection assays, DNA fragments containing the 5'-upstream region of mkp-M gene showed proper basal promoter function but did not respond to LPS stimulation in RAW264.7 cells. The same constructs revealed significant inducibility by LPS when they were stably integrated in the genome, implying that LPS responsiveness of mkp-M promoter requires the proper chromatin structure. When DNA is packaged into nucleosome, it often fails to provide a recognition code for the transcription factors (31-34), and many transcription factors recognize chromatin templates with lower affinity or do not bind them at all (35). Also nucleosomal biochemistry can influence transcription factor accessibility to DNA (36). The structural changes in chromatin may accompany the acetylation of histone H3 and H4 by histone acetyltransferases and is associated with transcriptional activation, whereas deacetylation by histone deacetylases is associated with gene repression. Inducing the global hyperacetylation of cellular histones with TSA, a specific inhibitor for histone deacetylases, resulted in the up-regulation of endogenous MKP-M and mkp-M promoter reporter gene in RAW264.7 cell line (Fig. 5A). ChIP assays showed that LPS potentially induced acetylation of both histone H3 and H4 at the mkp-M promoter (Fig. 6B). These observations further support the crucial roles of chromatin modifications played by histone acetylation for mkp-M gene activation. Interestingly, the promoter activation of MKP-1, another DSP, has been shown to associate with histone H3 acetylation after arsenite treatment, and its gene expression is also induced by TSA (37). Thus MKP-M is a second DSP member whose gene expression has been shown to be positively regulated by histone acetylation. It is of note that the acetylation of histone and the inhibition of histone deacetylases by TSA are also associated with gene repression for some genes such as ETS transcription factor PU.1 (38).

The acetylation of the histone tails disrupts and interferes with the higher order chromatin folding, promotes the solubility of chromatin at physiological ionic strength, and maintains the unfolded structure of the transcribed nucleosome allowing transcription factor binding (39, 40). The presence of HS sites commonly corresponds to regions in which the chromatin is open and accessible (31). Our HS mapping revealed at least two HS sites at the promoter region of mkp-M gene after LPS stimulation, one of which correspond to the location of the consensus sequences for E box/CRE.

Based on these data, we would like to propose a model in which the structural changes in chromatin allow CREB and other regulatory proteins to bind the mkp-M promoter (Fig. 7B). LPS-mediated gene remodeling has also been reported for several other genes. For example, LPS induction of IL-12 p40 gene expression has been reported to require remodeling of a promoter-encompassing nucleosome, and this process is dependent on Toll-like receptor 4 (41). The activation of c-Rel or other transcriptional factors is neither required nor sufficient for this remodeling, indicating there is a preceding mechanism for nucleosome remodeling. Importantly, a recent report (42) indicated that p38 MAPK, which is strongly activated by LPS, is responsible for the phosphoacetylation of histone H3 on promoters of a subset of stimulus-induced cytokine and chemokine genes. It is of note that MKP-M mRNA induction was effectively inhibited by a specific p38 kinase inhibitor in LPS-stimulated macrophages, whereas a specific inhibitor of MEK had no inhibitory effect, indicating that p38 kinase but not extracellular signal-regulated kinase is required for mkp-M gene activation by LPS (5). We showed consistently in this report that pretreatment of RAW264.7 stable clones with SB208530 abrogated mkp-M promoter-driven luciferase activity by LPS (Fig. 7A). Thus it seems reasonable to presume that p38 kinase activated by LPS induces phosphorylation of histones leading to their subsequent acetylation and nucleosome remodeling at the mkp-M promoter.

In conclusion, acetylation of histone H3 and H4 is induced at the mkp-M promoter in LPS-stimulated macrophages. This leads to nucleosome remodeling and subsequent recruitment of transcriptional factors including CREB to the E box/CRE elements of mkp-M promoter. Induced MKP-M plays an important role in down-regulating JNK activity and cytokine secretion (5). Thus LPS utilizes nucleosome remodeling as a transcriptional activation mechanism not only for cytokine and chemokine genes such as IL-12 p40 but also for genes of signal regulators such as mkp-M.

    ACKNOWLEDGEMENTS

We thank Keiko Itano and Ayumi Nishikawa for technical assistance.

    FOOTNOTES

* This work was supported in part by grants from Ono Pharmaceutical Company, Ministry of Education, Science and Culture of the Japanese Government, and the Yakult Bioscience Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY150700.

To whom correspondence and reprint requests should be addressed: Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 Japan. Tel.: 52-744-2447; Fax: 52-744-2449; E-mail: tmatsugu@med.nagoya-u.ac.jp.

Published, JBC Papers in Press, January 2, 2003, DOI 10.1074/jbc.M211829200

    ABBREVIATIONS

The abbreviations used are: DSP, dual-specificity protein phosphatase; MAPK, mitogen-activated protein kinase; JNK, c-Jun N-terminal kinase; ChIP, chromatin immunoprecipitation; TSA, trichostatin A; CREB, cAMP-response element-binding protein; CRE, CREB-responsive element; EMSA, electromobility shift assay; LPS, lipopolysaccharide; TNF-alpha , tumor necrosis factor-alpha ; MOPS, morpholinepropanesulfonic acid; IL, interleukin; HS, hypersensitivity.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Camps, M., Nichols, A., and Arkinstall, S. (2000) FASEB J. 14, 6-16[Abstract/Free Full Text]
2. Theodosiou, A., and Ashworth, A. (2002) Genome Biol. 3, 3009.1-3009.10
3. Masuda, K., Shima, H., Watanabe, M., and Kikuchi, K. (2001) J. Biol. Chem. 276, 39002-39011[Abstract/Free Full Text]
4. Tanoue, T., Yamamoto, T., Maeda, R., and Nishida, E. (2001) J. Biol. Chem. 276, 26629-26639[Abstract/Free Full Text]
5. Matsuguchi, T., Musikacharoen, T., Johnson, T. R., Kraft, A. S., and Yoshikai, Y. (2001) Mol. Cell. Biol. 21, 6999-7009[Abstract/Free Full Text]
6. Musikacharoen, T., Matsuguchi, T., Kikuchi, T., and Yoshikai, Y. (2001) J. Immunol. 166, 4516-4524[Abstract/Free Full Text]
7. Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995) Nucleic Acids Res. 23, 4878-4884[Abstract/Free Full Text]
8. Schwenzer, R., Siemienski, K., Liptay, S., Schubert, G., Peters, N., Scheurich, P., Schmid, R. M., and Wajant, H. (1999) J. Biol. Chem. 274, 19368-19374[Abstract/Free Full Text]
9. Weinmann, A. S., Plevy, S. E., and Smale, S. T. (1999) Immunity 11, 665-675[CrossRef][Medline] [Order article via Infotrieve]
10. Hebbes, T. R., Thorne, A. W., and Crane-Robinson, C. (1988) EMBO J. 7, 1395-1402[Medline] [Order article via Infotrieve]
11. Hebbes, T. R., Clayton, A. L., Thorne, A. W., and Crane-Robinson, C. (1994) EMBO J. 13, 1823-1830[Medline] [Order article via Infotrieve]
12. Urnov, F. D., and Wolffe, A. P. (2001) Mol. Endocrinol. 15, 1-16[Free Full Text]
13. Soravia, E., Grebe, A., De Luca, P., Helin, K., Suh, T. T., Degen, J. L., and Blasi, F. (1995) Blood 86, 624-635[Abstract/Free Full Text]
14. Schanberg, L. E., Fleenor, D. E., Kurtzberg, J., Haynes, B. F., and Kaufman, R. E. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 603-607[Abstract/Free Full Text]
15. Meeker, T. C., Loeb, J., Ayres, M., and Sellers, W. (1990) Mol. Cell. Biol. 10, 1680-1688[Abstract/Free Full Text]
16. Tugores, A., Rubio, T., Rancano, C., and Alonso, M. A. (1997) DNA Cell Biol. 16, 245-255[Medline] [Order article via Infotrieve]
17. Gerondakis, S., Economou, C., and Grumont, R. J. (1994) Genomics 24, 182-184[CrossRef][Medline] [Order article via Infotrieve]
18. Ryan, K. M., and Birnie, G. D. (1996) Biochem. J. 314, 713-721[Medline] [Order article via Infotrieve]
19. Blackwood, E. M., and Eisenman, R. N. (1991) Science 251, 1211-1217[Abstract/Free Full Text]
20. Sawadogo, M., and Roeder, R. G. (1985) Cell 43, 165-175[CrossRef][Medline] [Order article via Infotrieve]
21. Sirito, M., Lin, Q., Maity, T., and Sawadogo, M. (1994) Nucleic Acids Res. 22, 427-433[Abstract/Free Full Text]
22. Postigo, A. A., Ward, E., Skeath, J. B., and Dean, D. C. (1999) Mol. Cell. Biol. 19, 7255-7263[Abstract/Free Full Text]
23. Montminy, M. R., and Bilezikjian, L. M. (1987) Nature 328, 175-178[CrossRef][Medline] [Order article via Infotrieve]
24. Lee, K. A., Hai, T. Y., SivaRaman, L., Thimmappaya, B., Hurst, H. C., Jones, N. C., and Green, M. R. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8355-8359[Abstract/Free Full Text]
25. Bohmann, D., Bos, T. J., Admon, A., Nishimura, T., Vogt, P. K., and Tjian, R. (1987) Science 238, 1386-1392[Abstract/Free Full Text]
26. Chiu, R., Boyle, W. J., Meek, J., Smeal, T., Hunter, T., and Karin, M. (1988) Cell 54, 541-552[CrossRef][Medline] [Order article via Infotrieve]
27. Di Rocco, G., Pennuto, M., Illi, B., Canu, N., Filocamo, G., Trani, E., Rinaldi, A. M., Possenti, R., Mandolesi, G., Sirinian, M. I., Jucker, R., Levi, A., and Nasi, S. (1997) Mol. Cell. Biol. 17, 1244-1253[Abstract]
28. Chaudhary, J., and Skinner, M. K. (1999) Endocrinology 140, 1262-1271[Abstract/Free Full Text]
29. Scholtz, B., Kingsley-Kallesen, M., and Rizzino, A. (1996) J. Biol. Chem. 271, 32375-32380[Abstract/Free Full Text]
30. Grumont, R. J., Rasko, J. E., Strasser, A., and Gerondakis, S. (1996) Mol. Cell. Biol. 16, 2913-2921[Abstract]
31. Forsberg, E. C., and Bresnick, E. H. (2001) Bioessays 23, 820-830[CrossRef][Medline] [Order article via Infotrieve]
32. Grunstein, M. (1997) Nature 389, 349-352[CrossRef][Medline] [Order article via Infotrieve]
33. Strahl, B. D., and Allis, C. D. (2000) Nature 403, 41-45[CrossRef][Medline] [Order article via Infotrieve]
34. Kadam, S., and Emerson, B. M. (2002) Curr. Opin. Cell Biol. 14, 262-268[CrossRef][Medline] [Order article via Infotrieve]
35. Taylor, I. C., Workman, J. L., Schuetz, T. J., and Kingston, R. E. (1991) Genes Dev. 5, 1285-1298[Abstract/Free Full Text]
36. Han, M., and Grunstein, M. (1988) Cell 55, 1137-1145[CrossRef][Medline] [Order article via Infotrieve]
37. Li, J., Read, L. R., and Baker, M. D. (2001) Mol. Cell. Biol. 21, 501-510[Abstract/Free Full Text]
38. Laribee, R. N., and Klemsz, M. J. (2001) J. Immunol. 167, 5160-5166[Abstract/Free Full Text]
39. Spencer, V. A., and Davie, J. R. (1999) Gene (Amst.) 240, 1-12[CrossRef][Medline] [Order article via Infotrieve]
40. Tse, C., Sera, T., Wolffe, A. P., and Hansen, J. C. (1998) Mol. Cell. Biol. 18, 4629-4638[Abstract/Free Full Text]
41. Weinmann, A. S., Mitchell, D. M., Sanjabi, S., Bradley, M. N., Hoffmann, A., Liou, H. C., and Smale, S. T. (2001) Nat. Immunol. 2, 51-57[CrossRef][Medline] [Order article via Infotrieve]
42. Saccani, S., Pantano, S., and Natoli, G. (2002) Nat. Immunol. 3, 69-75[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Nakamura, T. Kukita, T. Shobuike, K. Nagata, Z. Wu, K. Ogawa, T. Hotokebuchi, O. Kohashi, and A. Kukita
Inhibition of Histone Deacetylase Suppresses Osteoclastogenesis and Bone Destruction by Inducing IFN-{beta} Production
J. Immunol., November 1, 2005; 175(9): 5809 - 5816.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Musikacharoen, A. Oguma, Y. Yoshikai, N. Chiba, A. Masuda, and T. Matsuguchi
Interleukin-15 induces IL-12 receptor {beta}1 gene expression through PU.1 and IRF 3 by targeting chromatin remodeling
Blood, January 15, 2005; 105(2): 711 - 720.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Masuda, Y. Yoshikai, H. Kume, and T. Matsuguchi
The Interaction between GATA Proteins and Activator Protein-1 Promotes the Transcription of IL-13 in Mast Cells
J. Immunol., November 1, 2004; 173(9): 5564 - 5573.
[Abstract] [Full Text] [PDF]