Originally published In Press as doi:10.1074/jbc.M212995200 on January 9, 2003
J. Biol. Chem., Vol. 278, Issue 11, 9407-9411, March 14, 2003
Thr-431 and Arg-433 Are Part of a Conserved Sequence Motif of the
Glutamine Amidotransferase Domain of CTP Synthases and Are Involved in
GTP Activation of the Lactococcus lactis Enzyme*
Martin
Willemoës
From the Center for Crystallographic Studies, Department of
Chemistry, University of Copenhagen, Universitetsparken 5, DK-2100 Copenhagen Ø, Denmark
Received for publication, December 20, 2002, and in revised form, January 9, 2003
 |
ABSTRACT |
A conserved sequence motif within the class 1 glutamine amidotransferase (GATase) domain of CTP synthases was
identified. The sequence motif in the Lactococcus lactis
enzyme is 429GGTLRLG435. This motif was present
only in CTP synthases and not in other enzymes that harbor the GATase
domain. Therefore, it was speculated that this sequence was involved in
GTP activation of CTP synthase. Other members of the GATase protein
family are not activated allosterically by GTP. Residues Thr-431 and
Arg-433 were changed by site directed mutagenesis to the sterically
similar residues valine and methionine, respectively. The resulting
enzymes, T431V and R433M, had both lost the ability for GTP to activate
the uncoupled glutaminase activity and showed reduced GTP activation of
the glutamine-dependent CTP synthesis reaction. The T431V
enzyme had a similar activation constant, KA,
for GTP, but the activation was only 2-3-fold compared with 35-fold
for the wild type enzyme. The R433M enzyme was found to have a
10-15-fold lower KA for GTP and a concomitant
decrease in Vapp. The activation by GTP of this
enzyme was about 7-fold. The kinetic parameters for saturation with
ATP, UTP, and NH4Cl were similar for wild type and mutant
enzymes, except that the R433M enzyme only had half the
Vapp of the wild type enzyme when NH4Cl was the amino donor. The mutant enzymes T431V and
R433M apparently had not lost the ability to bind GTP, but the signal transmitted through the enzyme to the active sites upon binding of the
allosteric effector was clearly disrupted in the mutant enzymes.
 |
INTRODUCTION |
CTP synthase (EC 6.4.3.2) catalyzes the synthesis of CTP from UTP
by amination of the pyrimidine ring at the 4-position. CTP synthase has
three functionally distinct sites, i.e. the glutaminase site
where glutamine hydrolysis occurs, the active site where CTP synthesis
takes place, and the allosteric site where GTP binds. The reaction
proceeds via phosphorylation of UTP by ATP to give an activated
intermediate 4-phosphoryl UTP and ADP (1, 2). Ammonia then reacts with
this intermediate, yielding CTP and Pi. Ammonia can either
be utilized from the surrounding solution or generated by the
hydrolysis of glutamine in a reaction activated by GTP (3, 4).
Sequence comparison and structure-function studies have suggested a
role for several regions within the primary structure of CTP synthase.
As such, the catalytic triad (5, 6) as well as the oxyanion hole (7) of
the GATase1 domain have been
identified (8). From mutations isolated from cells of various organisms
that showed decreased sensitivity to the cytotoxic effects of
cyclopentenylcytosine, the CTP/UTP site of CTP synthase has been
identified because the mutant enzymes were less sensitive to CTP
feedback inhibition (9-11). In addition, a region has been pointed out
to be important for the structural integrity of the enzyme (12).
Recently, analysis of a region of the Escherichia coli
enzyme where selected residues between 102 and 118 were changed to
alanine has been performed, and a possible role of aspartate 107 and
leucine 109 in the coupling of glutamine hydrolysis to CTP synthesis
has been identified (13).
We have characterized the CTP synthase from L. lactis as
described in previous reports (3, 14). After gaining knowledge of the
properties of the wild type enzyme with respect to enzyme kinetics and
quaternary structure, we initiated a structure function analysis of the
L. lactis enzyme to increase the knowledge of the CTP
synthases as a whole and also to be able to explain the quite different
properties of this enzyme with respect to quaternary structure (3) and
the mechanism of GTP activation (14) compared with those apparently
common to other well characterized CTP synthases (4, 15-23). The lack
of a three-dimensional structure of the enzyme complicates rational
structure-function analysis of individual residues in CTP synthase.
However, we set out to try and identify amino acid residues involved in
GTP activation of the glutamine-dependent CTP synthesis
reaction. A region between residues 403 and 480 in the primary sequence
of the GATase domain of CTP synthase, here represented by the L. lactis enzyme, shows three insertions compared with the consensus
GATase domain (Fig. 1A). This
region, which already shows weak overall sequence homology between the consensus and the CTP synthase domains together with the insertions in
CTP synthase, suggests a high flexibility in the structure of the
GATase domain. Except for a short stretch of conserved residues, the
primary sequence in this region varies considerably within CTP
synthases from various sources (Fig. 1, A and
B). In this work, we describe the effect on the
kinetics of L. lactis CTP synthase mutant enzymes T431V and
R433M, which were derived by changing the side chain of Thr-431 to
valine and Arg-433 to methionine. Both side chains are part of the
conserved sequence motif in the CTP synthase GATase domain shown in
Fig. 1B.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
A conserved motif unique to CTP synthase is
found within the GATase domain. A, comparison between
L. lactis CTP synthase amino acid residues 303-529 and the
consensus GATase domain (pfam00117, NCBI conserved domain data base).
Residues in boldface are the cysteine, histidine, and
glutamate residues of the catalytic triad. The GTP regulatory motif
identified in this paper is underlined. B,
consensus sequence for the GTP regulatory motif described in this paper
based on a survey of CTP synthase sequences from the protein data base
found in Entrez-PubMed.
|
|
 |
EXPERIMENTAL PROCEDURES |
Site-directed Mutagenesis and DNA Sequencing--
Site-directed
mutagenesis in the coding region of the L. lactis pyrG gene
was performed by the QuikChange method (Stratagene) using the
complementary deoxyoligonucleotides LL5-T431V
(CATGGGTGGAGTATTACGTCTTG) and LL3-T431V
(CAAGACGTAATACTCCACCCATG) for construction of the allele encoding the T431V enzyme, and the complementary
deoxyoligonucleotides LL5-R433Ma
(TGGAACATTAATGCTTGGACTTT) and LL3-R433Ma
(AAAGTCCAAGCATTAATGTTCCA) for construction of the
allele encoding the R433M enzyme. Letters in italics indicate the base
changes introduced by the oligonucleotides. The plasmid pMW602 (3) was
used as a template for mutagenesis. The mutations were verified by
sequencing of the entire coding region using an ABI PRISM 310 DNA
Sequencer as recommended by the supplier (PerkinElmer Life Sciences).
Protein Purification and Enzyme Assays--
All chemicals were
purchased from Sigma. L. lactis wild type and mutant CTP
synthases were produced and purified to homogeneity as judged by
SDS-PAGE (24) (Fig. 2) by methods
described previously for the wild type enzyme (3). Assays were
performed at 30 °C in 50 mM Hepes, pH 8.0, 2 mM dithiothreitol. For spectrophotometric measurement of
CTP synthesis, the conversion of UTP to CTP with 
291 = 1338 cm
1 M
1 was recorded as described
previously (3, 25). The isothermal titration calorimetry-based
assay for CTP synthesis or glutamine hydrolysis was performed as
described in detail elsewhere (14).

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 2.
SDS-PAGE of wild type and mutant L. lactis CTP synthases. ~3 µg of each enzyme was
loaded on the gel. Lanes 1 and 5, low molecular
weight marker. The molecular masses of the marker proteins are, from
top to bottom, 97.4, 66.2, 45, 31, 21.5, and 14.4 kDa, respectively. Lane 2, wild type enzyme. Lane
3, T431V enzyme. Lane 4, R433M enzyme.
|
|
Analysis of Enzyme Kinetic Data--
Calculation of kinetic
constants was performed by fitting the initial velocities to one of the
four equations below using the computer program UltraFit (BioSoft,
version 3.01). The reported standard errors are those calculated by the
computer program. Equations 1 and 2 apply to hyperbolic and sigmoid
substrate saturation kinetics, respectively. Equation 3 applies to
hyperbolic activation kinetics. Equation 4 applies to cooperative
substrate inhibition,
|
(Eq. 1)
|
|
(Eq. 2)
|
|
(Eq. 3)
|
|
(Eq. 4)
|
where v is the initial velocity;
Vapp is the apparent maximal velocity;
S0.5 and A0.5 represent
the concentration of a substrate S or activator A, respectively, at
apparent half-maximal velocity; Km and
KA are the apparent Michaelis-Menten constants for substrate S or activator A, respectively; n is the Hill
coefficient; V1 and (V1 + V2) are the apparent maximal velocities in the
absence and presence of saturating concentrations of activator,
respectively; and I0.5 is the substrate
concentration for half-maximal substrate inhibition. For equation 4, n was fixed at a value of 4 as determined from an analysis
of initial velocity data obtained by varying NH4Cl at
several equimolar concentrations of ATP and
UTP.2 Unless otherwise noted,
all reported kinetic velocities are µmol of CTP min
1
mg
1.
 |
RESULTS AND DISCUSSION |
The work by Levitzki and Koshland (4) demonstrated that the
glutaminase activity of the E. coli enzyme was activated by GTP in a manner that could account for the observed GTP activation of
the overall glutamine-dependent CTP synthesis reaction. In agreement with this role of GTP in CTP synthase activation, CTP synthesis that utilizes ammonia from the solution is not dependent on
activation by GTP. However, in a recent investigation of the glutaminase reaction of the CTP synthase from L. lactis, it
was found that 4-phosphoryl UTP was likely to be a coactivator with GTP
of the glutaminase reaction for this enzyme. GTP alone could not
activate the glutaminase reaction to the same extent as the overall
glutamine-dependent CTP synthesis reaction, not even in the
presence of UTP and an ATP substrate analog (14) as has been found for
the E. coli enzyme (4).
Based on the work described above, it became clear that a difference
existed between the E. coli and L. lactis CTP
synthases with respect to the GTP activation of the
glutamine-dependent CTP synthesis reaction. We have
initiated structure-function studies that aim at identifying residues
involved in the GTP activation of CTP synthase. Because no tertiary
structure model exists for CTP synthase, we started out by
investigating the role of amino acid residues that are part of
conserved sequence motifs in the primary structure of CTP synthase.
Such a motif is shown in Fig. 1B. This motif seems to be
absent in the primary structure of the GATase domains (Fig.
1A) of the other members of this enzyme family (8). This
would be expected for sequence motifs where the amino acid residues are
involved in GTP activation, because this activation is unique to CTP
synthase. Within the sequence motif we picked two residues, Thr-431 and
Arg-433, for mutational analysis because they were the only
polar/charged residues and, therefore, were candidates for interaction
with other residues or bound ligands.
The results shown in Table I, which
present specific activities determined under standard assay conditions,
immediately indicated that both the T431V and R433M enzymes were
affected in GTP activation of glutamine-dependent CTP
synthesis. The activity of the NH4Cl-dependent reaction was similar to that of wild type enzyme in comparison with the
effect of the mutations on the glutamine-dependent
reaction.
View this table:
[in this window]
[in a new window]
|
Table I
Specific activity of wildtype and mutant CTP synthases
Assays were performed as described under "Experimental Procedures."
|
|
For the L. lactis CTP synthase it is possible to control the
oligomerization of the enzyme by varying the ionic strength. Increasing
salt concentrations will dissociate the active tetramer into inactive
dimers, and the substrate inhibition by NH4Cl can be
explained by this property of the oligomer.2 The kinetics
of saturation and inhibition with NH4Cl was similar for the
wild type and mutant enzymes, except for the 2-fold reduced Vapp observed for the R433M enzyme (Fig.
3). Therefore we may also conclude that
the stability of the mutant tetramers was similar to that of the wild
type enzyme as indicated by I0.5 for
NH4Cl in Table II. Also, UTP
binding and ATP binding of the mutant enzymes were unchanged compared
with wild type enzyme as shown in Table II.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
Initial velocity dependence on the ammonium
concentration for the synthesis of CTP by the wild type, T431V, and
R433M enzymes. Experiments were performed as described under
"Experimental Procedures." The initial velocity data were fitted to
Equation 4, and the calculated kinetic constants are presented in Table
II. Circles, wild type enzyme; squares, T431V
enzyme; diamonds, R433M enzyme.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Steady state kinetic constants for the
NH4Cl-dependent CTP synthesis reaction of the
wildtype, T431V, and R433M enzymes
Assay conditions were as described under "Experimental Procedures."
|
|
The kinetics for the uncoupled glutaminase activity in the absence of
GTP was similar for mutant and wild type enzymes, but in the presence
of 1 mM GTP this half-reaction was only stimulated at best
to ~1.1-fold for the mutant enzymes compared with the 2.5-fold
observed for the wild type enzyme (Table
III). The difference in the kinetic
properties of mutant and wild type enzymes also became evident from the
results obtained for GTP activation of the
glutamine-dependent CTP synthesis (Table IV and Fig.
4). The T431V enzyme bound GTP with the
same affinity as the wild type enzyme,
but the activation by binding of GTP was only 2-3-fold compared with
35-fold for the wild type enzyme (Table IV). The GTP activation of the
R433M enzyme displayed ~10-20-fold lower KA
and about a 15-fold lower Vapp
(V1 + V2) than the wild
type enzyme, and the GTP activation was only ~7-fold (Table IV).
View this table:
[in this window]
[in a new window]
|
Table III
Steady state kinetic constants for the uncoupled glutaminase reaction
of the wildtype, T431V, and R433M enzymes
Assay conditions were as described under "Experimental Procedures."
Initial velocity data were generated using the isothermal titration
calorimetry-based assay. Initial velocity data were fitted to Equation 1.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4.
GTP activation of the
glutamine-dependent CTP synthesis reaction of the wild
type, T431V, and R433M enzymes. Experiments were performed with
the spectrophotometric assay for CTP synthesis as described under
"Experimental Procedures." The initial velocity data were fitted to
Equation 3, and the calculated kinetic constants are shown in Table IV.
A, comparison of initial velocity data obtained for wild
type CTP synthase (circles), T431V (triangles)
and R433M (diamonds). B, detailed view of T431V.
C, detailed view of R433M.
|
|
View this table:
[in this window]
[in a new window]
|
Table IV
Steady state kinetic constants for the GTP activation of the
glutamine-dependent CTP synthesis reaction of the
wildtype, T431V, and R433M enzymes
Assay conditions were as described in "Experimental Procedures."
|
|
For both mutant enzymes, GTP binding had not been abolished by the side
chain substitutions. In the case of the mutant enzyme T431V it seems
that GTP binding was normal in terms of KA, but the effect of binding the activator was greatly reduced. The fact that
the glutamine-dependent CTP synthesis reaction still
retained a small degree of GTP activation (Table IV) compared with the wild type enzyme may indicate that some of the activation mechanism involving coactivation by 4-phosphoryl UTP and GTP was retained in the
T431V mutant enzyme as discussed below. It is likely that the hydroxyl
group of Thr-431 plays a role in the expected structural rearrangements
in CTP synthase when GTP binding leads to activation of the enzyme,
because only the GTP activation of the T431V enzyme differed from the
kinetics of the wild type enzyme.
The interpretation of the altered kinetics resulting from the side
chain substitution in the R433M enzyme is less straight forward,
although in this case it is also evident that the GTP activation had
been affected (Table IV). The concomitant decrease in
V2 and KA for
glutamine-dependent CTP synthesis resembles the wild type
enzyme when GTP activation is studied at subsaturating concentrations
of ATP and UTP that result in CTP synthesis at a rate below that of
uncoupled glutamine hydrolysis. Under these conditions, a substantial
decrease in KA for GTP is observed (14). The GTP
activation proceeds up to a V2 in Equation 3
that depends on the concentration of ATP and UTP. In the range from
below and up to the level of uncoupled glutaminase activity, the GTP
activation observed cannot be explained by increasing the rate of
glutamine hydrolysis. The GTP activation from below and up to the level of uncoupled glutamine hydrolysis was interpreted in terms of combined
mechanisms for GTP activation of the L. lactis enzyme that
not only stimulate glutamine hydrolysis but also the CTP synthesis
reaction (14). In the case of the R433M enzyme, the kinetics of GTP
activation is not a consequence of subsaturation with ATP and UTP,
because the S0.5 for these nucleotides was
similar to that of the wild type enzyme (Table II). The part of the GTP activation mechanism of glutamine-dependent CTP synthesis
responsible for the observations with the wild type enzyme as outlined
above may be the same as that responsible for the GTP activation
remaining with the R433M enzyme.
Apart from GTP activation, the similar kinetic properties observed with
both NH4Cl and glutamine as a substrate, together with the
use of the same purification protocol, the similar stability during
handling, and storage of the mutant enzymes, suggest that no gross
structural changes have been introduced by the side chain substitutions
when compared with wild type enzyme.
In conclusion, the kinetic analysis of the T431V and R433M enzymes
presented here further supports our previously suggested model on GTP
activation of the L. lactis CTP synthase (14). This model
can be described by GTP activation of the glutaminase reaction itself,
as observed in the absence of ATP and UTP, but also by coordinating
glutaminase activity with the synthesis of the reaction intermediate,
4-phosphoryl UTP. In this case, 4-phosphoryl UTP is thought to also act
as a coactivator with GTP in further increasing the rate of glutamine hydrolysis.
The absent or greatly reduced GTP activation of the uncoupled
glutaminase reaction for the two mutant enzymes described here is in
agreement with a disruption in the enzyme of side chain interactions
that are involved with GTP activation of this activity. This is also in
accordance with the location of the investigated sequence motif in the
primary structure within the GATase domain of CTP synthase (Fig.
1A). However, the observation that the
glutamine-dependent CTP synthesis of the mutant enzymes was
still activated by GTP, although to a much lesser extent than that of
the wild type enzyme, is in agreement with a bifunctional role of GTP
both as an activator of the glutaminase half-reaction and also as a
coactivator with the 4-phosphoryl UTP intermediate in the overall
reaction of L. lactis CTP synthase (14).
 |
ACKNOWLEDGEMENTS |
The author expresses his appreciation for the
excellent technical assistance by Dorthe Boelskifte. Bent Sigurskold
and Sine Larsen are acknowledged for reading the manuscript.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a grant from the Danish National Research Foundation
(to Sine Larsen). To whom correspondence should be addressed. Tel.:
45-3532-0239; Fax: 45-3532-0299; E-mail: martin@ccs.ki.ku.dk.
Published, JBC Papers in Press, January 9, 2003, DOI 10.1074/jbc.M212995200
2
M. Willemoës, unpublished results.
 |
ABBREVIATIONS |
The abbreviation used is:
GATase, glutamine
amidotransferase class I.
 |
REFERENCES |
| 1.
|
von der Saal, W.,
Anderson, P. M.,
and Villafranca, J. J.
(1985)
J. Biol. Chem.
260,
14993-14997[Abstract/Free Full Text]
|
| 2.
|
Lewis, D. A.,
and Villafranca, J. J.
(1989)
Biochemistry
28,
8454-8459[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Wadskov-Hansen, S. L.,
Willemoes, M.,
Martinussen, J.,
Hammer, K.,
Neuhard, J.,
and Larsen, S.
(2001)
J. Biol. Chem.
276,
38002-38009[Abstract/Free Full Text]
|
| 4.
|
Levitzki, A.,
and Koshland, D. E., Jr.
(1972)
Biochemistry
11,
241-246[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Weng, M.,
Makaroff, C. A.,
and Zalkin, H.
(1986)
J. Biol. Chem.
261,
5568-5574[Abstract/Free Full Text]
|
| 6.
|
Bearne, S. L.,
Hekmat, O.,
and Macdonnell, J. E.
(2001)
Biochem. J.
356,
223-232[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Chittur, S. V.,
Klem, T. J.,
Shafer, C. M.,
and Davisson, V. J.
(2001)
Biochemistry
40,
876-887[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Zalkin, H.,
and Smith, J. L.
(1998)
Adv. Enzymol. Relat. Areas Mol. Biol.
72,
87-144[Medline]
[Order article via Infotrieve]
|
| 9.
|
Wylie, J. L.,
Wang, L. L.,
Tipples, G.,
and McClarty, G.
(1996)
J. Biol. Chem.
271,
15393-15400[Abstract/Free Full Text]
|
| 10.
|
Whelan, J.,
Phear, G.,
Yamauchi, M.,
and Meuth, M.
(1993)
Nat. Genet.
3,
317-322[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Ostrander, D. B.,
O'Brien, D. J.,
Gorman, J. A.,
and Carman, G. M.
(1998)
J. Biol. Chem.
273,
18992-19001[Abstract/Free Full Text]
|
| 12.
|
Weng, M. L.,
and Zalkin, H.
(1987)
J. Bacteriol.
169,
3023-3028[Abstract/Free Full Text]
|
| 13.
|
Iyengar, A.,
and Bearne, S. L.
(2003)
Biochem. J
369,
497-507[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Willemoes, M.,
and Sigurskjold, B. W.
(2002)
Eur. J. Biochem.
269,
4772-4779[Medline]
[Order article via Infotrieve]
|
| 15.
|
Levitzki, A.,
Stallcup, W. B.,
and Koshland, D. E., Jr.
(1971)
Biochemistry
10,
3371-3378[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Levitzki, A.,
and Koshland, D. E., Jr.
(1972)
Biochemistry
11,
247-253[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Long, C. W.,
Levitzki, A.,
and Koshland, D. E., Jr.
(1970)
J. Biol. Chem.
245,
80-87[Abstract/Free Full Text]
|
| 18.
|
Pappas, A.,
Yang, W. L.,
Park, T. S.,
and Carman, G. M.
(1998)
J. Biol. Chem.
273,
15954-15960[Abstract/Free Full Text]
|
| 19.
|
Yang, W. L.,
McDonough, V. M.,
Ozier-Kalogeropoulos, O.,
Adeline, M. T.,
Flocco, M. T.,
and Carman, G. M.
(1994)
Biochemistry
33,
10785-10793[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Thomas, P. E.,
Lamb, B. J.,
and Chu, E. H.
(1988)
Biochim. Biophys. Acta
953,
334-344[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
van Kuilenburg, A. B.,
Elzinga, L.,
van den Berg, A. A.,
Slingerland, R. J.,
and Van Gennip, A. H.
(1994)
Anticancer Res.
14,
411-415[Medline]
[Order article via Infotrieve]
|
| 22.
|
Anderson, P. M.
(1983)
Biochemistry
22,
3285-3292[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Robertson, J. G.
(1995)
Biochemistry
34,
7533-7541[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Long, C. W.,
and Pardee, A. B.
(1967)
J. Biol. Chem.
242,
4715-4721[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. A. Lunn, J. E. MacDonnell, and S. L. Bearne
Structural Requirements for the Activation of Escherichia coli CTP Synthase by the Allosteric Effector GTP Are Stringent, but Requirements for Inhibition Are Lax
J. Biol. Chem.,
January 25, 2008;
283(4):
2010 - 2020.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-G. Choi, T.-S. Park, and G. M. Carman
Phosphorylation of Saccharomyces cerevisiae CTP Synthetase at Ser424 by Protein Kinases A and C Regulates Phosphatidylcholine Synthesis by the CDP-choline Pathway
J. Biol. Chem.,
June 20, 2003;
278(26):
23610 - 23616.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.