JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M209323200 on January 13, 2003

J. Biol. Chem., Vol. 278, Issue 12, 10214-10220, March 21, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/12/10214    most recent
M209323200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cui, J.
Right arrow Articles by Wright, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cui, J.
Right arrow Articles by Wright, S. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Guggulsterone Is a Farnesoid X Receptor Antagonist in Coactivator Association Assays but Acts to Enhance Transcription of Bile Salt Export Pump*

Jisong CuiDagger, Li Huang, Annie Zhao, Jane-L. Lew, Jinghua Yu, Soumya Sahoo§, Peter T. Meinke§, Inmaculada Royo, Fernando Peláez, and Samuel D. Wright

From the Department of Atherosclerosis and Endocrinology, § Department of Medicinal Chemistry, Merck Research Laboratories, Rahway, New Jersey 07065 and the  Centro de Investigacion Basica, Merck Sharp and Dohme de Espana, S.A., Josefa Valcarcel 38, 28027 Madrid, Spain

Received for publication, September 11, 2002, and in revised form, January 10, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Guggulipid is an extract of the guggul tree Commiphora mukul and has been widely used to treat hyperlipidemia in humans. The plant sterol guggulsterone (GS) is the active agent in this extract. Recent studies have shown that GS can act as an antagonist ligand for farnesoid X receptor (FXR) and decrease expression of bile acid-activated genes. Here we show that GS, although an FXR antagonist in coactivator association assays, enhances FXR agonist-induced transcription of bile salt export pump (BSEP), a major hepatic bile acid transporter. In HepG2 cells, in the presence of an FXR agonist such as chenodeoxycholate or GW4064, GS enhanced endogenous BSEP expression with a maximum induction of 400-500% that induced by an FXR agonist alone. This enhancement was also readily observed in FXR-dependent BSEP promoter activation using a luciferase reporter construct. In addition, GS alone slightly increased BSEP promoter activation in the absence of an FXR agonist. Consistent with the results in HepG2, guggulipid treatment in Fisher rats increased BSEP mRNA. Interestingly, in these animals expression of the orphan nuclear receptor SHP (small heterodimer partner), a known FXR target, was also significantly increased, whereas expression of other FXR targets including cholesterol 7alpha -hydroxylase (Cyp 7a1), sterol 12alpha -hydroxylase (Cyp 8b1), and the intestinal bile acid-binding protein (I-BABP), remained unchanged. Thus, we propose that GS is a selective bile acid receptor modulator that regulates expression of a subset of FXR targets. Guggulipid treatment in rats lowered serum triglyceride and raised serum high density lipoprotein levels. Taken together, these data suggest that guggulsterone defines a novel class of FXR ligands characterized by antagonist activities in coactivator association assays but with the ability to enhance the action of agonists on BSEP expression in vivo.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Guggulipid is an extract of the guggul tree Commiphora mukul and has been widely used to treat hyperlipidemia in humans (1, 2). Numerous clinical trials demonstrate that guggulipid effectively lowers serum low density lipoprotein cholesterol and triglyceride levels and increases high density lipoprotein cholesterol levels (3, 4). The plant guggulsterones E and Z (stereoisomers) in guggulipid were identified as active ingredients for lipid-lowering (5).

Recent studies have shown that guggulsterone (GS)1 is an antagonist ligand for the farnesoid X receptor (FXR) and inhibited expression of FXR agonist-induced genes (6, 7). It has also been demonstrated that the hepatic lipid-lowering effect of GS was mediated through FXR using FXR knockout mice (6).

FXR is a nuclear receptor for bile acids and controls expression of critical genes in bile acid and cholesterol homeostasis (8-11). It has been shown that FXR inhibits expression of cholesterol 7alpha -hydroxylase (Cyp 7a1) (12-15), sterol 12alpha -hydroxylase (16), the Na+/taurocholate co-transporting polypeptide (17) and apolipoprotein A-I (18), and activates expression of intestinal bile acid-binding protein (I-BABP) (19), phospholipid transfer protein (20), bile salt export pump (BSEP) (21, 22), dehydroepiandrosterone sulfotransferase (23), and apolipoprotein C-II (24).

BSEP is the major hepatic bile acid transporter that mediates the transport of bile acids across the canalicular membrane (25-27), the rate-limiting step in overall hepatocellular bile salt excretion. BSEP deficiencies in humans result in progressive familial intrahepatic cholestasis type 2 (28). Recent studies have shown that BSEP transcription is robustly activated by FXR via an FXR response element in the BSEP promoter (21).

To examine the role of GS in regulation of BSEP expression, we evaluated GS in HepG2 cells in combination with an FXR agonist to assess the FXR antagonist activity. To our surprise and in contrast to the FXR antagonist activity reported before, GS enhanced FXR agonist-induced BSEP expression by 400-500% that induced by an FXR agonist alone. A similar pattern of enhancement was also observed in FXR transactivation using a BSEP promoter-driven luciferase reporter construct, indicating that the enhancement of BSEP expression was mediated by FXR-dependent promoter activation. Consistent with the results in HepG2 cells, guggulipid treatment in rats increased BSEP expression in a dose-dependent manner. In addition, expression of the orphan nuclear receptor SHP (small heterodimer partner), another direct target of FXR (14, 15), was also increased in guggulipid-treated animals, whereas expression of the other FXR targets including Cyp 7a1, Cyp 8b1, and I-BABP was unchanged. These results suggest that GS is a selective bile acid receptor modulator (SBARM) that regulates expression of a subset of FXR targets.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents-- The following reagents were obtained from Invitrogen: tissue culture media of DME and Opti-MEM I, regular fetal bovine serum (FBS) and charcoal striped-FBS (CS-FBS), TRIZOL reagents, PCR Supermix, and oligonucleotide primers for gene cloning. FuGENE 6 transfection reagent was obtained from Roche Molecular Diagnostics. Reagents for beta -galactosidase and luciferase assays were purchased from Promega (Madison, WI). CDCA and guggulsterones Z and E were obtained from Steraloids, Inc. (Newport, RI). GW4064 was synthesized at Merck. The guggulipid GUGGUL with a brand name of SOLARAY was purchased from a health food store in Cranford, NJ. TaqMan reagents for cDNA synthesis and real-time PCR, and TaqMan oligonucleotide primers and probes for human BSEP, rat BSEP, rat SHP-1, and rat I-BABP were purchased from Applied Biosystems (Foster City, CA). SA/XL665 and (Eu)K were from CIS Biointernational (Bagnols-sur-Ceze, France) and Packard Instrument Co. The goat anti-GST antibody and glutathione-Sepharose were from Amersham Biosciences. Dry milk was from Bio-Rad. The Fisher rats were purchased from Taconic (Germantown, NY). Assay kits for determination of total plasma cholesterol and triglycerides were from WAKO Diagnostics (Richmond, VA).

Plasmid Constructs-- pGL3-enhancer-hBSEP-Promoter-Luc was constructed by inserting the DNA fragment of the human BSEP promoter from -1440 to +77 (GenBankTM accession number AF190696) into the plasmid vector pGL3-enhancer (Promega) at NheI/HindIII. The expression vector pcDNA3.1-hFXR was constructed by inserting the cDNA fragment encoding the full-length human FXR (GenBankTM accession number NP_005114) into pcDNA3.1 at NheI/BamHI. The integrity of sequence for both constructs was confirmed by DNA sequencing. pGST-hFXR-LBD, pcDNA3.1-hRXRalpha , and pCMV-lacZ were described previously (29).

FXR Coactivator Association Assays-- Preparation of GST-FXR-LBD fusion protein from Escherichia coli strain BL21 and protocols for a homogeneous time-resolved fluorescence-based interaction of GST-FXR-LBD with the coactivator SRC-1 were described previously (29). The expression and purification of peroxisome proliferator-activated receptor-binding protein (PBP) and p120 peptides are essentially the same as described for SRC-1. Reactions for compound antagonist activities included 9 µM CDCA (an FXR agonist) in the assay buffer.

Nuclear Extraction and Western Blot Analysis for Expression of FXR-- HepG2 cells, a human hepatoma cell line obtained from ATCC, were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, and 1 mM sodium pyruvate. Cells were seeded in 6-well plates at a density of 1.2 × 106 cells/well in DMEM 24 h prior to treatment. Cells were treated with Me2SO, 10 µM Z-GS, 0.1 µM GW4064 or 10 µM Z-GS plus 0.1 µM GW4064 for ~24 h in fresh DMEM containing 0.5% CS-FBS. At the end of the incubation, nuclear extraction was prepared using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Pierce) according to the manufacturer's instructions. Typically, 20 µg of total nuclear proteins were separated by electrophoresis on a 4-20% SDS-PAGE (Invitrogen). Western blotting was carried out following the manufacturer's instructions (Amersham Biosciences) using the polyclonal rabbit anti-human FXR antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Donkey anti-rabbit IgG conjugated to horseradish peroxidase and the ECL chemiluminescence kit were purchased from Amersham Biosciences.

FXR Transactivation-- HepG2 cells were transfected in 96-well plates using the FuGENE 6 transfection reagent as previously described (29). Transfection mixtures for each well contained 0.405 µl of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXRalpha , 10.4 ng of pGL3-enhancer-hBSEP-Promoter-Luc, and 103.8 ng of pCMV-lacZ. The treatment of transfected cells with various FXR ligands, assays for luciferase, and beta -galactosidase activities were also following the same protocols as previously described (29). This assay was performed at Merck Sharp and Dohme de España, Spain.

Treatment of HepG2 Cells for Gene Expression-- HepG2 cells were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For determination of gene-specific expression by TaqMan analysis, cells were seeded in 6-well plates at a density of 1 million cells/well in DMEM containing 10% FBS, 1% penicillin/streptomycin, and 25 mM HEPES. Twenty-four hours after seeding, cells were treated with various concentrations of compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin, and 25 mM HEPES. Unless specified, cells were treated for 24 h.

RNA Isolation and Real-time Quantitative PCR-- Total RNA was extracted from the cultured cells or rat tissues using the TRIZOL reagent according the manufacturer's instructions. Reverse transcription reactions and TaqMan PCRs were performed according to the manufacturer's instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of FAM (reporter dye) during the amplification cycles. Amplification of human 18 S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18 S RNA. Levels of human BSEP mRNA were expressed as -fold difference of compound-treated cells against Me2SO-treated cells. Levels of rat BSEP, SHP, and I-BABP were expressed as -fold difference of GUGGUL-treated animals against control animals.

TaqMan Primers and Probes-- Oligonucleotide primers and probes for human and murine BSEP were designed using the Primer Express program and were synthesized by Applied Biosystems. These sequences (5' to 3') are as follows: human BSEP, forward primer (GGGCCATTGTACGAGATCCTAA), probe (6FAM-TCTTGCTACTAGATGAAGCCACTTCTGCCTTAGA-TAMRA), and reverse primer (TGCACCGTCTTTTCACTTTCTG); rat BSEP, forward primer (GATGAAGCTACGTCTGCCCTAGAC), probe (6FAM-CATTGTCATTGCTCATCGTTTGTCCACC-TAMRA), and reverse primer (GACACGACAGCAATGATATCTGAGTT); rat SHP (AGCTTGGATTTCCTCGGTTTG), probe (6FAM-ATACAGTGTTTGACTAACTGTCCAGCAG-TAMRA), and reverse primer (GAGGTTTTGGGAGCCATCAA); rat I-BABP, forward primer (GGGCAACATCATGAGCAACA), probe (6FAM-ATTGGCAAAGAATGTGAAATGCAGACCATG-TAMRA), and reverse primer (TCACGGTTGCCTTGAACTTCT); rat Cyp 7a1, forward primer (CGCCCTAGCGACTGGATTAG), probe (6FAM-AAGAACTTTGTTCTCGCTGCCCACATTCC-TAMRA), and reverse primer (GGCCCCAGCTATGTGAACA); rat Cyp 8b1, forward primer (AGCTCCCATGAGTCAAACAGTATCT), probe (6FAM-TGCCTCAGCCCATCCTACCTGCCTTA-TAMRA), and reverse primer (AGGATTTGGAGTAAGGGCATCA); human ABCA1, forward primer (GAGGATGTCCAGTCCAGTAATGGT), probe (6FAM-ACACCTGGAGAGAAGCTTTCAACGAGACTAACC-TAMRA), and reverse primer (AGCGAGATATGGTCCGGATTG); human ABCG1, forward primer (TGCAATCTTGTGCCATATTTGA), probe (6FAM- TACCACAACCCAGCAGATTTTGTCATGGA-TAMRA), and reverse primer (CCAGCCGACTGTTCTGATCA). Primers and probe for human 18 S RNA were also purchased from Applied Biosystems.

Guggulipid Treatment in Fischer Rats-- Six-week-old male Fischer rats (Taconic) were randomly divided into three groups with 9 animals per group. Animals in the control group were fed a ground-chow diet, and the two treatment groups were fed a ground-chow diet containing 2.8 and 5.6% content of GUGGUL capsules, respectively. At the end of the 10-day treatment, rats were sacrificed and blood samples were collected by heart puncture. Liver and ileum tissues were collected for determination of gene expression by TaqMan.

Determination of Serum Total Cholesterol and Triglyceride Levels-- Serum total cholesterol and triglyceride levels were determined using the kits from WAKO Diagnostics following the manufacturer's instructions. The sample volume used for total cholesterol determination was 20 µl and for triglyceride determination was 60 µl. Lipid concentrations were calculated based on the standard provided with the kits. Both assays were individually performed for the sample from each animal.

Hepatic Cholesterol Determination-- 0.1-0.2 grams of liver were homogenized in 4 ml of chloroform/methanol (2:1, v/v), washed with 1 ml of 50 mM NaCl, and centrifuged at 1500 × g for 10 min. The organic phase was carefully transferred to a new glass tube, washed with 1 ml of 0.36 M CaCl2, methanol (1:1, v/v) twice, then centrifuged at 1500 × g for 10 min. The organic phase was carefully transferred to a new glass tube again, and the volume was brought up to 5 ml with chloroform. To a 1-ml aliquot, 100 µl of 50% Triton X-100 in chloroform was added and the mixture was dried under nitrogen, then dissolved in 200 µl of H2O. The cholesterol determination was performed using the kit from WAKO Diagnostics and expressed as micrograms of cholesterol per milligrams of liver tissue.

Hepatic Triglyceride Determination-- 80-100 mg of liver tissue was homogenized in 0.5 ml of phosphate-buffered saline, and 0.25 ml of homogenate was transferred to a glass tube containing 0.25 ml of phosphate-buffered saline and 2.3 ml of 0.85% NaCl. 7 milliliters of methanol were added and mixed, followed by adding 3.5 ml of chloroform. The mixture was cooled for 10 min on ice, followed by centrifugation at 2000 rpm for 20 min at 4 °C. The supernatant was transferred to a clean glass tube, and 3.5 ml of 0.85% NaCl and 3.5 ml of chloroform were added, followed by mixing and centrifugation as above. The lower phase was recovered and 2 ml of this solution was transferred to a new tube containing 1 ml of 1% Triton X-100 in chloroform (w/v). The samples were mixed gently, dried under nitrogen with low heat, and dissolved in 0.25 ml of H2O. The triglyceride determination was performed using the kit from Roche Molecular Diagnostics and expressed as micrograms of triglyceride per milligram of liver tissue.

FPLC Analysis for Serum Lipoprotein Profile-- To perform FPLC analysis, the serum sample from each animal in the same treatment group was pooled equally. To a volume of 350 µl of pooled sample, 3.5 µl of 200 mM lipase inhibitor (Sigma) and 8.75 µl of protease mixture inhibitors (Sigma) were added. The mixed sample was then filtered, and a volume of 250 µl was loaded to FPLC (Bio-Rad). Serum lipoproteins were fractionated by the size-exclusion column Superose 6 HR 10/30 (Amersham Biosciences) at a running speed of 0.2 ml/min. Eighty fractions were collected with 0.27 ml per fraction. The cholesterol concentration of each fraction was measured using the kit from WAKO Diagnostics.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

GS Effectively Enhances FXR Agonist-induced Endogenous Expression of BSEP-- It has been recently reported that GS (Z or E isomer) is an FXR antagonist that decreases FXR agonist-induced expression of several FXR targets (6, 7). BSEP, the major bile acid transporter in the liver, is transcriptionally activated by FXR through an FXR response element in the promoter (21). We asked whether GS would also decrease FXR agonist-induced BSEP expression. To answer this question, HepG2 cells were treated with Z-GS in the presence of the bile acid agonist ligand CDCA, and BSEP mRNA was quantified by real-time PCR (TaqMan). CDCA alone at 25 µM, a concentration sufficient for half-maximal induction of BSEP expression, induced BSEP expression by 60-80-fold (data not shown). To our surprise, treatment of HepG2 cells with Z-GS did not inhibit but enhanced the CDCA-induced BSEP expression (Fig. 1A). This enhancement was in a GS dose-dependent fashion with a maximum of 400-500% that induced by CDCA alone (Fig. 1A).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Enhancement of Z-guggulsterone on FXR agonist-induced BSEP expression. HepG2 cells at a density of 1 million cells/well in 6-well plates were treated with various concentrations of Z-guggulsterone (Z-GS) in the presence of 25 µM CDCA (A) or 100 nM GW4064 (B) for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was prepared and BSEP mRNA was analyzed by TaqMan-PCR as described under "Materials and Methods." Results are normalized as -fold of control (treated cells versus vehicle), and data are the mean ± S.D. of three determinations.

GW4064 is a potent and specific synthetic FXR agonist (30). Similar to CDCA, GW4064 robustly induced BSEP expression in HepG2 cells with an over 100-fold induction at a concentration of 100 nM (data not shown) (22). As with CDCA, in the presence of 100 nM GW4064, Z-GS also enhanced BSEP expression in a GS dose-dependent fashion with a maximum of 500% that induced by GW4064 alone (Fig. 1B). This result indicates that GS can enhance BSEP expression induced by different classes of FXR agonists.

In the absence of an FXR agonist ligand, GS treatment alone did not significantly increase BSEP mRNA in HepG2 cells (Fig. 1C). As previously reported, HepG2 cells expressed a low basal level of BSEP with a threshold cycle number ~40 in TaqMan (22). Thus, it is possible that GS alone did not significantly increase BSEP mRNA or this increase was too small to be detected in this assay. Essentially identical results were obtained with E-GS, but the Z isomer was used for the studies described here.

GS Enhances FXR-dependent BSEP Promoter Activation-- To determine whether the enhancement of endogenous BSEP mRNA by GS is a promoter-dependent event, GS was also evaluated in FXR transactivation using BSEP promoter-driven luciferase gene expression. In the presence of GW4064, Z-GS enhanced GW4064-induced luciferase activity in a dose-dependent manner with a maximal increase ~200% that by GW4064 alone (Fig. 2A).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of Z-guggulsterone on FXR-dependent BSEP promoter activation. HepG2 cells at a density of 3.2 × 104 cells/well in 96-well plates were transfected with 0.405 µl of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXRalpha , 10.4 ng of pGL3-enhancer-hBSEP-Promoter-Luc, and 103.8 ng of pCMV-lacZ in serum-free Opti-MEM I medium using the FuGENE 6 transfection reagent according to the manufacturer's instructions. The transfected cells were treated with various concentrations of Z-GS in the presence of 50 nM GW4064 (A), treated with various concentrations of GW4064 in the presence of 8 µM Z-guggulsterone (B), or treated with various concentrations of Z-guggulsterone alone (C). After 24 h treatment, cells were harvested and the cell lysate was used for determination of luciferase and beta -galactosidase activities as described under "Materials and Methods." Luciferase activities were normalized to beta -galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations.

The enhancement on BSEP promoter activity was also analyzed at various concentrations of GW4064 with a fixed concentration of Z-GS. As shown in Fig. 2B, Z-GS at 8 µM enhanced the GW4064-induced luciferase activity throughout the entire titration of GW4064. Taken together, these data indicate that GS enhances FXR-dependent BSEP promoter activation resulting in the enhancement of BSEP mRNA.

In FXR transactivation with the BSEP promoter, treatment of HepG2 cells with Z-GS alone (in the absence of an FXR agonist) slightly increased luciferase activities in a dose-dependent fashion with a maximum induction of 4-fold (Fig. 2C). In the same experiment, GW4064 treatment alone increased luciferase activities by a maximum of 23-fold (Fig. 2B). The low level of activation on BSEP promoter was mediated through FXR because in this system expression of the luciferase gene required co-transfection of an FXR expression vector. In the absence of exogenous FXR, GS did not increase the luciferase activities (data not shown).

GS Does Not Alter FXR Protein Levels or Isoforms-- GS up-regulation on FXR protein was one of the potential mechanisms to explain the enhanced BSEP expression. To test this hypothesis, HepG2 cells were treated with Z-GS, GW4064, or Z-GS plus GW4064, and FXR protein was detected by Western blot using the antibody against amino acid residues 1-130 of the N terminus of human FXR (31). This antibody should detect all four FXR isoforms reported by Zhang et al. (32). Fig. 3 shows that treatment with GW4064 significantly up-regulated FXR protein, consistent with the reported up-regulation of FXR activities by bile acids in vivo (33). However, treatment with GS alone did not significantly change FXR protein levels or the FXR molecular weight, suggesting that GS has no significant effects on FXR protein levels or isoforms. Treatment with GW4064 alone is indistinguishable from the treatment with GW4064 plus Z-GS, further supporting the notion that GS does not alter FXR proteins and isoforms.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 3.   Western blot analysis for FXR proteins and isoforms. HepG2 cells were treated with Me2SO, 10 µM Z-GS, 0.1 µM GW4064, or 10 µM Z-GS plus 0.1 µM GW4064 for ~24 h in fresh DMEM containing 0.5% CS-FBS. At the end of the incubation, nuclear extraction was prepared using a Nuclear and Cytoplasmic Extraction kit (Pierce) according to the manufacturer's instructions. 20 µg of total nuclear proteins were separated by 4-20% SDS-PAGE. Western blotting was carried out following the manufacturer's instructions (Amersham Biosciences) using the polyclonal rabbit anti-human FXR antibody (Santa Cruz Biotechnologies), donkey anti-rabbit IgG conjugated to horseradish peroxidase, and the ECL chemiluminescence kit.

GS Is an FXR Antagonist in a Coactivator Association Assay-- A homogeneous time-resolved fluorescence-based FXR coactivator association assay was used to assess FXR agonism/antagonism of GS in the cell-free system. This assay measures ligand-dependent association of FXR with the coactivator SRC-1 (29). Consistent with the previous report of GS as an FXR antagonist (6, 7), GS alone, either the Z or E isomer failed to activate FXR (Fig. 4A). In the presence of CDCA, GS decreased CDCA-induced FXR activation with an IC50 of 17 and 15 µM for Z- and E-GS, respectively (Fig. 4B). Consistent with the previous reports, these results confirm that GS is an FXR antagonist in the coactivator association assay.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of guggulsterones on interaction of FXR with coactivator SRC-1. 4 nM purified GST-FXR were incubated with 2 nM anti-GST-(Eu)K, 10 nM biotin-SRC-1-(568-780), 20 nM SA/XL665, and various concentrations of guggulsterones in the absence (A) or presence (B) of 9 µM CDCA. The mixture was incubated overnight at 4 °C. The fluorescent signal was measured, and results were calculated as described under "Materials and Methods." Each value represents the mean ± S.D. of three determinations.

To determine whether the antagonism behavior of GS was only limited to SRC-1, parallel analysis was also performed using coactivators p120 (34) and PBP (35). Similar to the results with SRC-1, GS alone failed to recruit either of the two coactivators (Fig. 5A). In the presence of CDCA, GS inhibited FXR activation with an IC50 value of 6.6 µM for p120 and 9.9 µM for PBP (Fig. 5B). These values are close to that from the assay with SRC-1 (Fig. 4B). As a control, CDCA activated FXR resulting in recruitment of p120 and PBP with an EC50 of 3.1 and 2.5 µM, respectively (Fig. 5A). Again, these values are similar to that using SRC-1 (22). These data indicate that GS acts as an FXR antagonist in the coactivator association assays with coactivators including SRC-1, PBP, and p120.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of Z-guggulsterones on interaction of FXR with coactivator p120 and PBP. 4 nM purified GST-FXR were incubated with 2 nM anti-GST-(Eu)K, 10 nM biotin-p120-(186-297), or PBP-(568-737), 20 nM SA/XL665, and various concentrations of Z-guggulsterone or CDCA alone (A) or Z-guggulsterone in the presence of 9 µM CDCA (B). The mixture was incubated overnight at 4 °C. The fluorescent signal was measured, and results were calculated as described under "Materials and Methods." Each value represents the mean ± S.D. of three determinations.

Guggulipid Selectively Regulates Expression of FXR Target Genes in Vivo-- To assess the FXR activity of GS in vivo, Fisher rats were treated with GUGGUL for 10 days by feeding animals with a chow diet containing 2.8 and 5.6% GUGGUL. These doses are equivalent to 25 and 50 mpk of guggulsterones (2.5% guggulsterones in GUGGUL). At the end of treatment, tissue samples were collected for determination of FXR target gene expression and blood samples for determination of serum lipids.

Guggulipid treatment resulted in a dose-dependent increase in BSEP expression in the liver. Compared with the control group, 2.8 and 5.6% guggulipid increased BSEP mRNA by 1.3- and 1.6-fold, respectively (Table I). This increase is consistent with the observation of GS enhancement of BSEP expression in HepG2 cells. Interestingly, in these animals expression of another FXR target, the orphan nuclear receptor SHP, was much more robustly induced by guggulipid. The induction of SHP mRNA also showed dose dependence with an increase of 1.5- and 2.8-fold at the two doses of guggulipid (Table I). The increase in SHP and BSEP mRNA (at 5.6%) was significant with p < 0.05 compared with the controls. It is known that transcription of Cyp 7a1 and Cyp 8b1 are regulated by FXR via an indirect mechanism involving SHP and LRH-1. Interestingly, expression of these two genes was not changed by guggulipid (Table I).


                              
View this table:
[in this window]
[in a new window]
 
Table I
Gene expression in rats treated with guggulipid

It has been shown that transcription of I-BABP in the ileum is robustly up-regulated by an agonist-activated FXR via an FXR response element in the promoter (19). However, guggulipid treatment did not significantly increase I-BABP mRNA (Table I).

To confirm the results of guggulipid feeding in Fisher rats, another set of experiments was also carried out under the same conditions as described above except that lower doses of guggulipid were used (1.5 and 3%). Basically, similar results were obtained for expression of the five FXR target genes as described above (Table I). Taken together, these data suggest that guggulipid/guggulsterone is an agent that regulates only a subset of FXR target gene expression.

Guggulipid Decreases Serum Triglyceride and Increases Serum High Density Lipoprotein Cholesterol Levels in Rats-- The serum lipid levels in guggulipid-treated rats were also determined. Guggulipid effectively decreased serum triglycerides (TG) in a dose-dependent manner with a reduction of 45 and 70% with doses of 2.8 and 5.6%, respectively, in the first experiment, and a reduction of 22 and 49% with doses of 1.5 and 3% in the second experiment (Table II). Total cholesterol (TC) increased 8, 10, 23, and 21% at the four doses, respectively (Table II).


                              
View this table:
[in this window]
[in a new window]
 
Table II
Serum and liver total cholesterol (TC) and triglyceride (TG) levels in rats treated with guggulipid

Hepatic TC and TG were also determined in sets of animal experiments. Compared with controls, guggulipid treatment did not significantly change hepatic TG levels, whereas the hepatic TC concentration seems to be significantly increased by 3 and 5.6% guggulipid (Table II).

FPLC analysis of serum lipoproteins indicated that the increase in total cholesterol was all in high density lipoprotein cholesterol. Fig. 6 presents the serum lipoprotein profile from the experiment with 2.8 and 5.6% guggulipid. The peak for high density lipoprotein (fractions 49-60) was significantly increased over that of the control, whereas peaks for low density lipoprotein and very low density lipoprotein were decreased by guggulipid (Fig. 6). These results are consistent with previous studies in the animal (36, 37) and also reflect the lipoprotein changes by guggulipid in humans (3, 4).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   Serum lipoprotein profile in Fisher rats treated with guggulipid in. Six-week-old male Fischer rats (n = 9) were fed a ground-chow diet alone (controls) or the same diet containing 2.8 and 5.6% content of GUGGUL capsules, respectively. At the end of the 10-day treatment, rats were sacrificed and blood samples were collected. The serum lipoprotein profile was determined by FPLC as described under "Materials and Methods."


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study we demonstrate that GS is an FXR antagonist in coactivator association assays but enhanced FXR agonist-induced BSEP expression in cells and in animals. It is particularly interesting that GS acts as an SBARM that selectively regulates expression of a subset of FXR targets in vivo.

We have explored several possibilities to explain the SBARM activities. The first one is coactivator usage. It is possible that GS binding to FXR results in dynamic changes within the transcription complex including recruitment of some coactivators and dissociation of others. To test this hypothesis, we have evaluated three different coactivators, SRC-1, p120, and PBP, in FXR coactivator association assay. Although GS showed antagonism with each of the three coactivators (Figs. 4B and 5B), it does not eliminate the possibility that GS-liganded FXR recruits a subset of coactivators to BSEP promoter that are not normally recruited by an agonist-bound FXR resulting in the enhanced transcription. A second possibility is FXR phosphorylation. It has been shown that ligand binding to GR or VDR causes receptor phosphorylation, which in turn activates target gene transcription (38-41). However, GS treatment in HepG2 did not change FXR phosphorylation in our preliminary metabolic labeling experiment (data not shown). We also explored the possibility whether GS treatment in HepG2 would change the expression of FXR protein levels and isoforms. Western blot analysis indicates that GS treatment did not significantly alter FXR protein levels or isoforms (Fig. 3).

It has been proposed that FXR down-regulates expression of Cyp 7a1 and this down-regulation is mediated by up-regulation of SHP expression that subsequently inhibits LRH-1 activity on activating Cyp 7a1 transcription. Guggulipid treatment in rats significantly increased expression of SHP. However, in these animals Cyp 7a1 mRNA was not changed significantly (Table I). These data support the notion that Cyp 7a1 is controlled by mechanisms in addition to SHP pathways (42, 43).

Urizar et al. (6) reported that GS treatment deceased hepatic cholesterol in mice fed with a high-fat diet. In our experiments, guggulipid feeding increased hepatic cholesterol content (Table II) despite the increased BSEP expression, which should in turn increase cholesterol catabolism and decrease hepatic cholesterol. One explanation for this discrepancy is that different diets were used in the two studies. Urizar et al. (6) used a high-fat diet in their GS feeding experiments, whereas we used chow in ours. The Fisher rats fed with the chow diet have a low level of hepatic cholesterol to start with, it may be hard to get a further decrease, particularly with the increased serum cholesterol levels in these animals.

The enhanced BSEP expression by GS is FXR specific. In HepG2 cells, Z-GS did not enhance expression of the LXR targets ABCA1 and ABCG1 in the presence of the LXR agonist APD (44) (Fig. 7). The mechanisms for GS-mediated enhancement on expression of a subset of FXR targets are currently under intensive investigation in our group.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of Z-guggulsterone on ABCA1 and ABCG1 mRNA. HepG2 cells at a density of 1 million cells/well in 6-well plates were treated with various concentrations of Z-guggulsterone (Z-GS) in the presence of 100 nM APD for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was prepared and ABCA1 (A) or ABCG1 (B) mRNA were analyzed by TaqMan-PCR as described under "Materials and Methods." Results are normalized as -fold of control (treated cells versus vehicle), and data are the mean ± S.D. of two determinations.

GS, an SBARM, may represent a new class of FXR ligands that antagonize FXR agonist-induced coactivator recruitment in coactivator association assays but selectively enhance FXR target expression in cells and animals. In addition to GS, other FXR ligands were also observed to have a similar SBARM activity as reported here for GS.2 Given the fact that guggulipid is an effective agent for treatment of hyperlipidemia in humans, it is likely that an SBARM superior to GS in FXR binding affinities and pharmacokinetic properties would be a more efficacious drug for treatment of dyslipidemia and atherosclerosis. Approaches described in this study including FXR coactivator association assay to assess FXR antagonist activities, TaqMan analysis to assess the SBARM activities in HepG2 cells followed by evaluation in rats for effects in serum lipids provide a practical means for identification of SBARM agents.

    ACKNOWLEDGEMENTS

We thank Drs. Guy Harris and Erik Lund for critically reading the manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P. O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-594-6369; Fax: 732-594-7926; E-mail: jisong_cui@merck.com.

Published, JBC Papers in Press, January 13, 2003, DOI 10.1074/jbc.M209323200

2 J. Cui, J. Yu, J. Lew, A. Zhao, L. Huang, and S. Wright, unpublished data.

    ABBREVIATIONS

The abbreviations used are: GS, guggulsterone; BSEP, bile salt export pump; FXR, farnesoid X receptor; CDCA, chenodeoxycholate; Cyp 7a, cholesterol 7alpha -hydroxylase; I-BABP, intestinal bile acid-binding protein; RXRalpha , retinoid X receptor alpha ; SHP, small heterodimer partner; SRC-1, steroid receptor coactivator protein-1; SBARM, selective bile acid receptor modulator; FBS, fetal bovine serum; CS-FBS, charcoal-striped fetal bovine serum; DMEM, Dulbecco's modified Eagle's medium; GST, glutathione S-transferase; FPLC, fast protein liquid chromatography; TG, triglycerides; TC, total cholesterol.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Satyavati, G. V. (1988) Indian J. Med. Res. 87, 327-335[Medline] [Order article via Infotrieve]
2. Dev, S. (1999) Environ. Health Perspect. 107, 783-789
3. Nityanand, S., Srivastava, J. S., and Asthana, O. P. (1989) J. Assoc. Physicians India 37, 323-328[Medline] [Order article via Infotrieve]
4. Singh, R. B., Niaz, M. A., and Ghosh, S. (1994) Cardiovasc. Drugs Ther. 8, 659-664[CrossRef][Medline] [Order article via Infotrieve]
5. Beg, M., Singhal, K. C., and Afzaal, S. (1996) Indian J. Physiol. Pharmacol. 40, 237-240[Medline] [Order article via Infotrieve]
6. Urizar, N. L., Liverman, A. B., Dodds, D. T., Silva, F. V., Ordentlich, P., Yan, Y., Gonzalez, F. J., Heyman, R. A., Mangelsdorf, D. J., and Moore, D. D. (2002) Science 296, 1703-1706[Abstract/Free Full Text]
7. Wu, J., Xia, C., Meier, J., Li, S., Hu, X., and Lala, D. S. (2002) Mol. Endocrinol. 16, 1590-1597[Abstract/Free Full Text]
8. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362-1365[Abstract/Free Full Text]
9. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365-1368[Abstract/Free Full Text]
10. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543-553[Medline] [Order article via Infotrieve]
11. Tu, H., Okamoto, A. Y., and Shan, B. (2000) Trends Cardiovasc. Med. 10, 30-35[CrossRef][Medline] [Order article via Infotrieve]
12. Chiang, J. Y., Kimmel, R., Weinberger, C., and Stroup, D. (2000) J. Biol. Chem. 275, 10918-10924[Abstract/Free Full Text]
13. Bramlett, K. S., Yao, S., and Burris, T. P. (2000) Mol. Genet. Metab. 71, 609-615[CrossRef][Medline] [Order article via Infotrieve]
14. Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., and Kliewer, S. A. (2000) Mol. Cell 6, 517-526[CrossRef][Medline] [Order article via Infotrieve]
15. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., and Mangelsdorf, D. J. (2000) Mol. Cell 6, 507-515[CrossRef][Medline] [Order article via Infotrieve]
16. Zhang, M., and Chiang, J. Y. (2001) J. Biol. Chem. 276, 41690-41699[Abstract/Free Full Text]
17. Denson, L. A., Sturm, E., Echevarria, W., Zimmerman, T. L., Makishima, M., Mangelsdorf, D. J., and Karpen, S. J. (2001) Gastroenterology 121, 140-147[CrossRef][Medline] [Order article via Infotrieve]
18. Claudel, T., Sturm, E., Duez, H., Torra, I. P., Sirvent, A., Kosykh, V., Fruchart, J. C., Dallongeville, J., Hum, D. W., Kuipers, F., and Staels, B. (2002) J. Clin. Invest. 109, 961-971[CrossRef][Medline] [Order article via Infotrieve]
19. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 29749-29754[Abstract/Free Full Text]
20. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275, 39313-39317[Abstract/Free Full Text]
21. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 28857-28865[Abstract/Free Full Text]
22. Yu, J., Lo, J. L., Huang, L., Zhao, A., Metzger, E., Adams, A., Meinke, P. T., Wright, S. D., and Cui, J. (2002) J. Biol. Chem. 277, 31441-31447[Abstract/Free Full Text]
23. Song, C. S., Echchgadda, I., Baek, B. S., Ahn, S. C., Oh, T., Roy, A. K., and Chatterjee, B. (2001) J. Biol. Chem. 276, 42549-42556[Abstract/Free Full Text]
24. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720-1728[Abstract/Free Full Text]
25. Lecureur, V., Courtois, A., Payen, L., Verhnet, L., Guillouzo, A., and Fardel, O. (2000) Toxicology 153, 203-219[CrossRef][Medline] [Order article via Infotrieve]
26. Kullak-Ublick, G. A., Stieger, B., Hagenbuch, B., and Meier, P. J. (2000) Semin. Liver Dis. 20, 273-292[CrossRef][Medline] [Order article via Infotrieve]
27. Hofmann, A. F. (1999) Arch. Intern. Med. 159, 2647-2658[Abstract/Free Full Text]
28. Strautnieks, S. S., Bull, L. N., Knisely, A. S., Kocoshis, S. A., Dahl, N., Arnell, H., Sokal, E., Dahan, K., Childs, S., Ling, V., Tanner, M. S., Kagalwalla, A. F., Nemeth, A., Pawlowska, J., Baker, A., Mieli-Vergani, G., Freimer, N. B., Gardiner, R. M., and Thompson, R. J. (1998) Nat. Genet. 20, 233-238[CrossRef][Medline] [Order article via Infotrieve]
29. Cui, J., Heard, T. S., Yu, J., Lo, J. L., Huang, L., Li, Y., Schaeffer, J. M., and Wright, S. D. (2002) J. Biol. Chem. 277, 25963-25969[Abstract/Free Full Text]
30. Maloney, P. R., Parks, D. J., Haffner, C. D., Fivush, A. M., Chandra, G., Plunket, K. D., Creech, K. L., Moore, L. B., Wilson, J. G., Lewis, M. C., Jones, S. A., and Willson, T. M. (2000) J. Med. Chem. 43, 2971-2974[CrossRef][Medline] [Order article via Infotrieve]
31. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMorris, T., and Lamph, W. W. (1995) Cell 81, 687-693[CrossRef][Medline] [Order article via Infotrieve]
32. Zhang, Y., Kast-Woelbern, H. R., and Edwards, P. A. (2003) J. Biol. Chem. 278, 104-110[Abstract/Free Full Text]
33. Xu, G., Pan, L. X., Li, H., Forman, B. M., Erickson, S. K., Shefer, S., Bollineni, J., Batta, A. K., Christie, J., Wang, T. H., Michel, J., Yang, S., Tsai, R., Lai, L., Shimada, K., Tint, G. S., and Salen, G. (2002) J. Biol. Chem. 277, 50491-50496[Abstract/Free Full Text]
34. Monden, T., Kishi, M., Hosoya, T., Satoh, T., Wondisford, F. E., Hollenberg, A. N., Yamada, M., and Mori, M. (1999) Mol. Endocrinol. 13, 1695-1703[Abstract/Free Full Text]
35. McKenna, N. J., Lanz, R. B., and O'Malley, B. W. (1999) Endocr. Rev. 20, 321-344[Abstract/Free Full Text]
36. Chander, R., Khanna, A. K., and Kapoor, N. K. (1996) Phytotherapy Res. 10, 508-511[CrossRef]
37. Dixit, V. P., Joshi, S., Sinha, R., Bharvava, S. K., and Varma, M. (1980) Biochem. Exp. Biol. 16, 421-424[Medline] [Order article via Infotrieve]
38. Wang, Z., Frederick, J., and Garabedian, M. J. (2002) J. Biol. Chem. 277, 26573-26580[Abstract/Free Full Text]
39. Orti, E., Hu, L. M., and Munck, A. (1993) J. Biol. Chem. 268, 7779-7784[Abstract/Free Full Text]
40. Hsieh, J. C., Jurutka, P. W., Galligan, M. A., Terpening, C. M., Haussler, C. A., Samuels, D. S., Shimizu, Y., Shimizu, N., and Haussler, M. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9315-9319[Abstract/Free Full Text]
41. Jurutka, P. W., Hsieh, J. C., Nakajima, S., Haussler, C. A., Whitfield, G. K., and Haussler, M. R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 3519-3524[Abstract/Free Full Text]
42. Wang, L., Lee, Y. K., Bundman, D., Han, Y., Thevananther, S., Kim, C. S., Chua, S. S., Wei, P., Heyman, R. A., Karin, M., and Moore, D. D. (2002) Dev. Cell 2, 721-731[CrossRef][Medline] [Order article via Infotrieve]
43. Kerr, T. A., Saeki, S., Schneider, M., Schaefer, K., Berdy, S., Redder, T., Shan, B., Russell, D. W., and Schwarz, M. (2002) Dev. Cell 2, 713-720[CrossRef][Medline] [Order article via Infotrieve]
44. Sparrow, C. P., Baffic, J., Lam, M. H., Lund, E. G., Adams, A. D., Fu, X., Hayes, N., Jones, A. B., Macnaul, K. L., Ondeyka, J., Singh, S., Wang, J., Zhou, G., Moller, D. E., Wright, S. D., and Menke, J. G. (2002) J. Biol. Chem. 277, 10021-10027[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
D. Xiao and S. V. Singh
z-Guggulsterone, a constituent of Ayurvedic medicinal plant Commiphora mukul, inhibits angiogenesis in vitro and in vivo
Mol. Cancer Ther., January 1, 2008; 7(1): 171 - 180.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. V. Singh, S. Choi, Y. Zeng, E.-R. Hahm, and D. Xiao
Guggulsterone-Induced Apoptosis in Human Prostate Cancer Cells Is Caused by Reactive Oxygen Intermediate Dependent Activation of c-Jun NH2-Terminal Kinase
Cancer Res., August 1, 2007; 67(15): 7439 - 7449.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Deng, D. Yang, A. Radke, J. Yang, and B. Yan
The Hypolipidemic Agent Guggulsterone Regulates the Expression of Human Bile Salt Export Pump: Dominance of Transactivation over Farsenoid X Receptor-Mediated Antagonism
J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1153 - 1162.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
G. Rizzo, M. Disante, A. Mencarelli, B. Renga, A. Gioiello, R. Pellicciari, and S. Fiorucci
The Farnesoid X Receptor Promotes Adipocyte Differentiation and Regulates Adipose Cell Function in Vivo
Mol. Pharmacol., October 1, 2006; 70(4): 1164 - 1173.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Caron, B. Cariou, and B. Staels
FXR: More than a Bile Acid Receptor?
Endocrinology, September 1, 2006; 147(9): 4022 - 4024.
[Full Text] [PDF]


Home page
EndocrinologyHome page
S. Wang, K. Lai, F. J. Moy, A. Bhat, H. B. Hartman, and M. J. Evans
The Nuclear Hormone Receptor Farnesoid X Receptor (FXR) Is Activated by Androsterone
Endocrinology, September 1, 2006; 147(9): 4025 - 4033.
[Abstract] [Full Text]