![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 12, 10214-10220, March 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Atherosclerosis and Endocrinology,
§ Department of Medicinal Chemistry, Merck Research
Laboratories, Rahway, New Jersey 07065 and the ¶ Centro de
Investigacion Basica, Merck Sharp and Dohme de Espana, S.A., Josefa
Valcarcel 38, 28027 Madrid, Spain
Received for publication, September 11, 2002, and in revised form, January 10, 2003
Guggulipid is an extract of the guggul tree
Commiphora mukul and has been widely used to treat
hyperlipidemia in humans. The plant sterol guggulsterone (GS) is the
active agent in this extract. Recent studies have shown that GS can act
as an antagonist ligand for farnesoid X receptor (FXR) and decrease
expression of bile acid-activated genes. Here we show that GS, although
an FXR antagonist in coactivator association assays, enhances FXR
agonist-induced transcription of bile salt export pump
(BSEP), a major hepatic bile acid transporter. In
HepG2 cells, in the presence of an FXR agonist such as
chenodeoxycholate or GW4064, GS enhanced endogenous BSEP expression with a maximum induction of 400-500% that
induced by an FXR agonist alone. This enhancement was also readily
observed in FXR-dependent BSEP promoter
activation using a luciferase reporter construct. In addition, GS alone
slightly increased BSEP promoter activation in the absence
of an FXR agonist. Consistent with the results in HepG2, guggulipid
treatment in Fisher rats increased BSEP mRNA.
Interestingly, in these animals expression of the orphan nuclear
receptor SHP (small heterodimer partner), a known FXR target, was also significantly increased, whereas expression of other
FXR targets including cholesterol 7 Guggulipid is an extract of the guggul tree Commiphora
mukul and has been widely used to treat hyperlipidemia in humans
(1, 2). Numerous clinical trials demonstrate that guggulipid
effectively lowers serum low density lipoprotein cholesterol and
triglyceride levels and increases high density lipoprotein cholesterol
levels (3, 4). The plant guggulsterones E and Z (stereoisomers) in
guggulipid were identified as active ingredients for lipid-lowering (5).
Recent studies have shown that guggulsterone
(GS)1 is an antagonist ligand
for the farnesoid X receptor (FXR) and inhibited expression of FXR
agonist-induced genes (6, 7). It has also been demonstrated that the
hepatic lipid-lowering effect of GS was mediated through FXR using FXR
knockout mice (6).
FXR is a nuclear receptor for bile acids and controls expression of
critical genes in bile acid and cholesterol homeostasis (8-11). It has
been shown that FXR inhibits expression of cholesterol 7 BSEP is the major hepatic bile acid transporter that mediates the
transport of bile acids across the canalicular membrane (25-27), the
rate-limiting step in overall hepatocellular bile salt excretion. BSEP
deficiencies in humans result in progressive familial intrahepatic
cholestasis type 2 (28). Recent studies have shown that BSEP
transcription is robustly activated by FXR via an FXR response element
in the BSEP promoter (21).
To examine the role of GS in regulation of BSEP expression,
we evaluated GS in HepG2 cells in combination with an FXR agonist to
assess the FXR antagonist activity. To our surprise and in contrast to
the FXR antagonist activity reported before, GS enhanced FXR
agonist-induced BSEP expression by 400-500% that induced
by an FXR agonist alone. A similar pattern of enhancement was also observed in FXR transactivation using a BSEP promoter-driven
luciferase reporter construct, indicating that the enhancement of
BSEP expression was mediated by FXR-dependent
promoter activation. Consistent with the results in HepG2 cells,
guggulipid treatment in rats increased BSEP expression in a
dose-dependent manner. In addition, expression of the
orphan nuclear receptor SHP (small heterodimer partner),
another direct target of FXR (14, 15), was also increased in
guggulipid-treated animals, whereas expression of the other FXR targets
including Cyp 7a1, Cyp 8b1, and I-BABP
was unchanged. These results suggest that GS is a selective
bile acid receptor
modulator (SBARM) that regulates expression of a subset of
FXR targets.
Reagents--
The following reagents were obtained from
Invitrogen: tissue culture media of DME and Opti-MEM I, regular fetal
bovine serum (FBS) and charcoal striped-FBS (CS-FBS), TRIZOL reagents,
PCR Supermix, and oligonucleotide primers for gene cloning. FuGENE 6 transfection reagent was obtained from Roche Molecular Diagnostics. Reagents for Plasmid
Constructs--
pGL3-enhancer-hBSEP-Promoter-Luc
was constructed by inserting the DNA fragment of the human
BSEP promoter from FXR Coactivator Association Assays--
Preparation of
GST-FXR-LBD fusion protein from Escherichia coli strain BL21
and protocols for a homogeneous time-resolved fluorescence-based
interaction of GST-FXR-LBD with the coactivator SRC-1 were described
previously (29). The expression and purification of peroxisome
proliferator-activated receptor-binding protein (PBP) and p120
peptides are essentially the same as described for SRC-1. Reactions for
compound antagonist activities included 9 µM CDCA (an FXR
agonist) in the assay buffer.
Nuclear Extraction and Western Blot Analysis for Expression of
FXR--
HepG2 cells, a human hepatoma cell line obtained from ATCC,
were maintained in DMEM containing 10% FBS, 1%
penicillin/streptomycin, and 1 mM sodium pyruvate.
Cells were seeded in 6-well plates at a density of 1.2 × 106 cells/well in DMEM 24 h prior to treatment. Cells
were treated with Me2SO, 10 µM Z-GS, 0.1 µM GW4064 or 10 µM Z-GS plus 0.1 µM GW4064 for ~24 h in fresh DMEM containing 0.5%
CS-FBS. At the end of the incubation, nuclear extraction was prepared
using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Pierce)
according to the manufacturer's instructions. Typically, 20 µg of
total nuclear proteins were separated by electrophoresis on a 4-20% SDS-PAGE (Invitrogen). Western blotting was carried out following the
manufacturer's instructions (Amersham Biosciences) using the polyclonal rabbit anti-human FXR antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Donkey anti-rabbit IgG conjugated to horseradish peroxidase and the ECL chemiluminescence kit were purchased from Amersham Biosciences.
FXR Transactivation--
HepG2 cells were transfected in 96-well
plates using the FuGENE 6 transfection reagent as previously described
(29). Transfection mixtures for each well contained 0.405 µl of
FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of
pcDNA3.1-hRXR Treatment of HepG2 Cells for Gene Expression--
HepG2 cells
were maintained in DMEM containing 10% FBS, 1%
penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For determination of gene-specific expression by
TaqMan analysis, cells were seeded in 6-well plates at a density of 1 million cells/well in DMEM containing 10% FBS, 1%
penicillin/streptomycin, and 25 mM HEPES. Twenty-four hours
after seeding, cells were treated with various concentrations of
compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin,
and 25 mM HEPES. Unless specified, cells were treated for
24 h.
RNA Isolation and Real-time Quantitative PCR--
Total RNA was
extracted from the cultured cells or rat tissues using the TRIZOL
reagent according the manufacturer's instructions. Reverse
transcription reactions and TaqMan PCRs were performed according to the
manufacturer's instructions (Applied Biosystems). Sequence-specific
amplification was detected with an increased fluorescent signal of FAM
(reporter dye) during the amplification cycles. Amplification of human
18 S RNA was used in the same reaction of all samples as an internal
control. Gene-specific mRNA was subsequently normalized to 18 S
RNA. Levels of human BSEP mRNA were expressed as -fold
difference of compound-treated cells against Me2SO-treated
cells. Levels of rat BSEP, SHP, and
I-BABP were expressed as -fold difference of GUGGUL-treated
animals against control animals.
TaqMan Primers and Probes--
Oligonucleotide primers and
probes for human and murine BSEP were designed using the
Primer Express program and were synthesized by Applied Biosystems.
These sequences (5' to 3') are as follows: human BSEP,
forward primer (GGGCCATTGTACGAGATCCTAA), probe
(6FAM-TCTTGCTACTAGATGAAGCCACTTCTGCCTTAGA-TAMRA), and reverse
primer (TGCACCGTCTTTTCACTTTCTG); rat BSEP, forward primer
(GATGAAGCTACGTCTGCCCTAGAC), probe
(6FAM-CATTGTCATTGCTCATCGTTTGTCCACC-TAMRA), and reverse primer
(GACACGACAGCAATGATATCTGAGTT); rat SHP
(AGCTTGGATTTCCTCGGTTTG), probe
(6FAM-ATACAGTGTTTGACTAACTGTCCAGCAG-TAMRA), and reverse primer (GAGGTTTTGGGAGCCATCAA); rat I-BABP, forward primer
(GGGCAACATCATGAGCAACA), probe
(6FAM-ATTGGCAAAGAATGTGAAATGCAGACCATG-TAMRA), and reverse primer
(TCACGGTTGCCTTGAACTTCT); rat Cyp 7a1, forward primer
(CGCCCTAGCGACTGGATTAG), probe
(6FAM-AAGAACTTTGTTCTCGCTGCCCACATTCC-TAMRA), and reverse primer
(GGCCCCAGCTATGTGAACA); rat Cyp 8b1, forward primer
(AGCTCCCATGAGTCAAACAGTATCT), probe
(6FAM-TGCCTCAGCCCATCCTACCTGCCTTA-TAMRA), and reverse primer (AGGATTTGGAGTAAGGGCATCA); human ABCA1, forward primer
(GAGGATGTCCAGTCCAGTAATGGT), probe
(6FAM-ACACCTGGAGAGAAGCTTTCAACGAGACTAACC-TAMRA), and reverse primer
(AGCGAGATATGGTCCGGATTG); human ABCG1, forward primer
(TGCAATCTTGTGCCATATTTGA), probe (6FAM-
TACCACAACCCAGCAGATTTTGTCATGGA-TAMRA), and reverse primer
(CCAGCCGACTGTTCTGATCA). Primers and probe for human 18 S RNA were also
purchased from Applied Biosystems.
Guggulipid Treatment in Fischer Rats--
Six-week-old male
Fischer rats (Taconic) were randomly divided into three groups with 9 animals per group. Animals in the control group were fed a ground-chow
diet, and the two treatment groups were fed a ground-chow diet
containing 2.8 and 5.6% content of GUGGUL capsules, respectively. At
the end of the 10-day treatment, rats were sacrificed and blood samples
were collected by heart puncture. Liver and ileum tissues were
collected for determination of gene expression by TaqMan.
Determination of Serum Total Cholesterol and Triglyceride
Levels--
Serum total cholesterol and triglyceride levels were
determined using the kits from WAKO Diagnostics following the
manufacturer's instructions. The sample volume used for total
cholesterol determination was 20 µl and for triglyceride
determination was 60 µl. Lipid concentrations were calculated based
on the standard provided with the kits. Both assays were individually
performed for the sample from each animal.
Hepatic Cholesterol Determination--
0.1-0.2 grams of liver
were homogenized in 4 ml of chloroform/methanol (2:1, v/v), washed with
1 ml of 50 mM NaCl, and centrifuged at 1500 × g for 10 min. The organic phase was carefully transferred to
a new glass tube, washed with 1 ml of 0.36 M
CaCl2, methanol (1:1, v/v) twice, then centrifuged
at 1500 × g for 10 min. The organic phase was
carefully transferred to a new glass tube again, and the volume was
brought up to 5 ml with chloroform. To a 1-ml aliquot, 100 µl of 50%
Triton X-100 in chloroform was added and the mixture was dried under
nitrogen, then dissolved in 200 µl of H2O. The
cholesterol determination was performed using the kit from WAKO
Diagnostics and expressed as micrograms of cholesterol per milligrams
of liver tissue.
Hepatic Triglyceride Determination--
80-100 mg of liver
tissue was homogenized in 0.5 ml of phosphate-buffered saline, and 0.25 ml of homogenate was transferred to a glass tube containing 0.25 ml of
phosphate-buffered saline and 2.3 ml of 0.85% NaCl. 7 milliliters
of methanol were added and mixed, followed by adding 3.5 ml of
chloroform. The mixture was cooled for 10 min on ice, followed by
centrifugation at 2000 rpm for 20 min at 4 °C. The supernatant was
transferred to a clean glass tube, and 3.5 ml of 0.85% NaCl and 3.5 ml
of chloroform were added, followed by mixing and centrifugation as
above. The lower phase was recovered and 2 ml of this solution was
transferred to a new tube containing 1 ml of 1% Triton X-100 in
chloroform (w/v). The samples were mixed gently, dried under nitrogen
with low heat, and dissolved in 0.25 ml of H2O. The
triglyceride determination was performed using the kit from Roche
Molecular Diagnostics and expressed as micrograms of triglyceride per
milligram of liver tissue.
FPLC Analysis for Serum Lipoprotein Profile--
To perform FPLC
analysis, the serum sample from each animal in the same treatment group
was pooled equally. To a volume of 350 µl of pooled sample, 3.5 µl
of 200 mM lipase inhibitor (Sigma) and 8.75 µl of
protease mixture inhibitors (Sigma) were added. The mixed sample was
then filtered, and a volume of 250 µl was loaded to FPLC (Bio-Rad).
Serum lipoproteins were fractionated by the size-exclusion column
Superose 6 HR 10/30 (Amersham Biosciences) at a running speed of 0.2 ml/min. Eighty fractions were collected with 0.27 ml per fraction. The
cholesterol concentration of each fraction was measured using the kit
from WAKO Diagnostics.
GS Effectively Enhances FXR Agonist-induced Endogenous Expression
of BSEP--
It has been recently reported that GS (Z or E isomer) is
an FXR antagonist that decreases FXR agonist-induced expression of several FXR targets (6, 7). BSEP, the major bile acid transporter in
the liver, is transcriptionally activated by FXR through an FXR
response element in the promoter (21). We asked whether GS would also
decrease FXR agonist-induced BSEP expression. To answer this
question, HepG2 cells were treated with Z-GS in the presence of the
bile acid agonist ligand CDCA, and BSEP mRNA was quantified by real-time PCR (TaqMan). CDCA alone at 25 µM, a concentration sufficient for half-maximal induction
of BSEP expression, induced BSEP expression by
60-80-fold (data not shown). To our surprise, treatment of HepG2 cells
with Z-GS did not inhibit but enhanced the CDCA-induced BSEP
expression (Fig. 1A). This
enhancement was in a GS dose-dependent fashion with a
maximum of 400-500% that induced by CDCA alone (Fig.
1A).
GW4064 is a potent and specific synthetic FXR agonist (30). Similar to
CDCA, GW4064 robustly induced BSEP expression in HepG2 cells
with an over 100-fold induction at a concentration of 100 nM (data not shown) (22). As with CDCA, in the presence of
100 nM GW4064, Z-GS also enhanced BSEP
expression in a GS dose-dependent fashion with a maximum of
500% that induced by GW4064 alone (Fig. 1B). This result
indicates that GS can enhance BSEP expression induced by
different classes of FXR agonists.
In the absence of an FXR agonist ligand, GS treatment alone did not
significantly increase BSEP mRNA in HepG2 cells (Fig. 1C). As previously reported, HepG2 cells expressed a low
basal level of BSEP with a threshold cycle number ~40 in
TaqMan (22). Thus, it is possible that GS alone did not significantly
increase BSEP mRNA or this increase was too small to be
detected in this assay. Essentially identical results were
obtained with E-GS, but the Z isomer was used for the studies described here.
GS Enhances FXR-dependent BSEP Promoter
Activation--
To determine whether the enhancement of endogenous
BSEP mRNA by GS is a promoter-dependent
event, GS was also evaluated in FXR transactivation using
BSEP promoter-driven luciferase gene expression. In the
presence of GW4064, Z-GS enhanced GW4064-induced luciferase activity in
a dose-dependent manner with a maximal increase ~200%
that by GW4064 alone (Fig.
2A).
The enhancement on BSEP promoter activity was also analyzed
at various concentrations of GW4064 with a fixed concentration of Z-GS.
As shown in Fig. 2B, Z-GS at 8 µM enhanced the
GW4064-induced luciferase activity throughout the entire titration of
GW4064. Taken together, these data indicate that GS enhances
FXR-dependent BSEP promoter activation resulting
in the enhancement of BSEP mRNA.
In FXR transactivation with the BSEP promoter, treatment of
HepG2 cells with Z-GS alone (in the absence of an FXR agonist) slightly
increased luciferase activities in a dose-dependent fashion with a maximum induction of 4-fold (Fig. 2C). In the same
experiment, GW4064 treatment alone increased luciferase activities by a
maximum of 23-fold (Fig. 2B). The low level of activation on
BSEP promoter was mediated through FXR because in this
system expression of the luciferase gene required co-transfection of an
FXR expression vector. In the absence of exogenous FXR, GS did not
increase the luciferase activities (data not shown).
GS Does Not Alter FXR Protein Levels or Isoforms--
GS
up-regulation on FXR protein was one of the potential mechanisms to
explain the enhanced BSEP expression. To test this hypothesis, HepG2 cells were treated with Z-GS, GW4064, or Z-GS plus
GW4064, and FXR protein was detected by Western blot using the antibody
against amino acid residues 1-130 of the N terminus of human FXR (31).
This antibody should detect all four FXR isoforms reported by Zhang
et al. (32). Fig. 3 shows that
treatment with GW4064 significantly up-regulated FXR protein,
consistent with the reported up-regulation of FXR activities by bile
acids in vivo (33). However, treatment with GS alone did not
significantly change FXR protein levels or the FXR molecular weight,
suggesting that GS has no significant effects on FXR protein levels or
isoforms. Treatment with GW4064 alone is indistinguishable from the
treatment with GW4064 plus Z-GS, further supporting the notion that GS
does not alter FXR proteins and isoforms.
GS Is an FXR Antagonist in a Coactivator Association
Assay--
A homogeneous time-resolved fluorescence-based FXR
coactivator association assay was used to assess FXR agonism/antagonism of GS in the cell-free system. This assay measures
ligand-dependent association of FXR with the coactivator
SRC-1 (29). Consistent with the previous report of GS as an FXR
antagonist (6, 7), GS alone, either the Z or E isomer failed to
activate FXR (Fig. 4A). In the
presence of CDCA, GS decreased CDCA-induced FXR activation with an
IC50 of 17 and 15 µM for Z- and E-GS,
respectively (Fig. 4B). Consistent with the previous
reports, these results confirm that GS is an FXR antagonist in the
coactivator association assay.
To determine whether the antagonism behavior of GS was only limited to
SRC-1, parallel analysis was also performed using coactivators p120
(34) and PBP (35). Similar to the results with SRC-1, GS alone failed
to recruit either of the two coactivators (Fig. 5A). In the presence of CDCA,
GS inhibited FXR activation with an IC50 value of 6.6 µM for p120 and 9.9 µM for PBP (Fig.
5B). These values are close to that from the assay with
SRC-1 (Fig. 4B). As a control, CDCA activated FXR resulting
in recruitment of p120 and PBP with an EC50 of 3.1 and 2.5 µM, respectively (Fig. 5A). Again, these
values are similar to that using SRC-1 (22). These data indicate that
GS acts as an FXR antagonist in the coactivator association assays with
coactivators including SRC-1, PBP, and p120.
Guggulipid Selectively Regulates Expression of FXR Target Genes in
Vivo--
To assess the FXR activity of GS in vivo, Fisher
rats were treated with GUGGUL for 10 days by feeding animals with a
chow diet containing 2.8 and 5.6% GUGGUL. These doses are equivalent to 25 and 50 mpk of guggulsterones (2.5% guggulsterones in
GUGGUL). At the end of treatment, tissue samples were collected for
determination of FXR target gene expression and blood samples for
determination of serum lipids.
Guggulipid treatment resulted in a dose-dependent increase
in BSEP expression in the liver. Compared with the control
group, 2.8 and 5.6% guggulipid increased BSEP mRNA by
1.3- and 1.6-fold, respectively (Table
I). This increase is consistent with the observation of GS enhancement of BSEP expression in HepG2
cells. Interestingly, in these animals expression of another FXR
target, the orphan nuclear receptor SHP, was much more
robustly induced by guggulipid. The induction of SHP
mRNA also showed dose dependence with an increase of 1.5- and
2.8-fold at the two doses of guggulipid (Table I). The increase in
SHP and BSEP mRNA (at 5.6%) was significant with p < 0.05 compared with the controls. It is known
that transcription of Cyp 7a1 and Cyp 8b1 are
regulated by FXR via an indirect mechanism involving SHP and LRH-1.
Interestingly, expression of these two genes was not changed by
guggulipid (Table I).
It has been shown that transcription of I-BABP in the ileum
is robustly up-regulated by an agonist-activated FXR via an FXR response element in the promoter (19). However, guggulipid treatment did not significantly increase I-BABP mRNA (Table
I).
To confirm the results of guggulipid feeding in Fisher rats, another
set of experiments was also carried out under the same conditions as
described above except that lower doses of guggulipid were used (1.5 and 3%). Basically, similar results were obtained for expression of
the five FXR target genes as described above (Table I). Taken together,
these data suggest that guggulipid/guggulsterone is an agent that
regulates only a subset of FXR target gene expression.
Guggulipid Decreases Serum Triglyceride and Increases Serum High
Density Lipoprotein Cholesterol Levels in Rats--
The serum lipid
levels in guggulipid-treated rats were also determined. Guggulipid
effectively decreased serum triglycerides (TG) in a
dose-dependent manner with a reduction of 45 and 70% with
doses of 2.8 and 5.6%, respectively, in the first experiment, and a
reduction of 22 and 49% with doses of 1.5 and 3% in the second
experiment (Table II). Total cholesterol
(TC) increased 8, 10, 23, and 21% at the four doses, respectively
(Table II).
Hepatic TC and TG were also determined in sets of animal experiments.
Compared with controls, guggulipid treatment did not significantly
change hepatic TG levels, whereas the hepatic TC concentration seems to
be significantly increased by 3 and 5.6% guggulipid (Table II).
FPLC analysis of serum lipoproteins indicated that the increase in
total cholesterol was all in high density lipoprotein cholesterol. Fig.
6 presents the serum lipoprotein profile
from the experiment with 2.8 and 5.6% guggulipid. The peak for high
density lipoprotein (fractions 49-60) was significantly increased over
that of the control, whereas peaks for low density lipoprotein and very
low density lipoprotein were decreased by guggulipid (Fig. 6). These results are consistent with previous studies in the animal (36, 37) and
also reflect the lipoprotein changes by guggulipid in humans (3,
4).
In this study we demonstrate that GS is an FXR antagonist in
coactivator association assays but enhanced FXR agonist-induced BSEP expression in cells and in animals. It is particularly
interesting that GS acts as an SBARM that selectively regulates
expression of a subset of FXR targets in vivo.
We have explored several possibilities to explain the SBARM activities.
The first one is coactivator usage. It is possible that GS binding to
FXR results in dynamic changes within the transcription complex
including recruitment of some coactivators and dissociation of others.
To test this hypothesis, we have evaluated three different coactivators, SRC-1, p120, and PBP, in FXR coactivator association assay. Although GS showed antagonism with each of the three
coactivators (Figs. 4B and 5B), it does not
eliminate the possibility that GS-liganded FXR recruits a subset of
coactivators to BSEP promoter that are not normally
recruited by an agonist-bound FXR resulting in the enhanced
transcription. A second possibility is FXR phosphorylation. It has been
shown that ligand binding to GR or VDR causes receptor phosphorylation,
which in turn activates target gene transcription (38-41). However, GS
treatment in HepG2 did not change FXR phosphorylation in our
preliminary metabolic labeling experiment (data not shown). We also
explored the possibility whether GS treatment in HepG2 would change the
expression of FXR protein levels and isoforms. Western blot analysis
indicates that GS treatment did not significantly alter FXR protein
levels or isoforms (Fig. 3).
It has been proposed that FXR down-regulates expression of Cyp
7a1 and this down-regulation is mediated by up-regulation of SHP expression that subsequently inhibits LRH-1 activity on
activating Cyp 7a1 transcription. Guggulipid treatment in
rats significantly increased expression of SHP. However, in
these animals Cyp 7a1 mRNA was not changed significantly
(Table I). These data support the notion that Cyp 7a1 is
controlled by mechanisms in addition to SHP pathways (42, 43).
Urizar et al. (6) reported that GS treatment deceased
hepatic cholesterol in mice fed with a high-fat diet. In our
experiments, guggulipid feeding increased hepatic cholesterol content
(Table II) despite the increased BSEP expression, which
should in turn increase cholesterol catabolism and decrease hepatic
cholesterol. One explanation for this discrepancy is that different
diets were used in the two studies. Urizar et al. (6) used a
high-fat diet in their GS feeding experiments, whereas we used chow in ours. The Fisher rats fed with the chow diet have a low level of
hepatic cholesterol to start with, it may be hard to get a further
decrease, particularly with the increased serum cholesterol levels in
these animals.
The enhanced BSEP expression by GS is FXR specific. In HepG2
cells, Z-GS did not enhance expression of the LXR targets
ABCA1 and ABCG1 in the presence of the LXR
agonist APD (44) (Fig. 7). The mechanisms
for GS-mediated enhancement on expression of a subset of FXR targets
are currently under intensive investigation in our group.
GS, an SBARM, may represent a new class of FXR ligands that antagonize
FXR agonist-induced coactivator recruitment in coactivator association
assays but selectively enhance FXR target expression in cells and
animals. In addition to GS, other FXR ligands were also observed to
have a similar SBARM activity as reported here for
GS.2 Given the fact that
guggulipid is an effective agent for treatment of hyperlipidemia in
humans, it is likely that an SBARM superior to GS in FXR binding
affinities and pharmacokinetic properties would be a more efficacious
drug for treatment of dyslipidemia and atherosclerosis. Approaches
described in this study including FXR coactivator association assay to
assess FXR antagonist activities, TaqMan analysis to assess the SBARM
activities in HepG2 cells followed by evaluation in rats for effects in
serum lipids provide a practical means for identification of SBARM agents.
We thank Drs. Guy Harris and Erik Lund for
critically reading the manuscript.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, January 13, 2003, DOI 10.1074/jbc.M209323200
2
J. Cui, J. Yu, J. Lew, A. Zhao, L. Huang,
and S. Wright, unpublished data.
The abbreviations used are:
GS, guggulsterone;
BSEP, bile salt export pump;
FXR, farnesoid X receptor;
CDCA, chenodeoxycholate;
Cyp 7a, cholesterol 7
Guggulsterone Is a Farnesoid X Receptor Antagonist in
Coactivator Association Assays but Acts to Enhance Transcription of
Bile Salt Export Pump*
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-hydroxylase (Cyp
7a1), sterol 12
-hydroxylase (Cyp 8b1), and the
intestinal bile acid-binding protein (I-BABP), remained
unchanged. Thus, we propose that GS is a selective
bile acid receptor
modulator that regulates expression of a subset of FXR
targets. Guggulipid treatment in rats lowered serum triglyceride and
raised serum high density lipoprotein levels. Taken together, these
data suggest that guggulsterone defines a novel class of FXR ligands
characterized by antagonist activities in coactivator association
assays but with the ability to enhance the action of agonists on
BSEP expression in vivo.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-hydroxylase
(Cyp 7a1) (12-15), sterol 12
-hydroxylase (16), the
Na+/taurocholate co-transporting polypeptide (17) and
apolipoprotein A-I (18), and activates expression of intestinal bile
acid-binding protein (I-BABP) (19), phospholipid transfer
protein (20), bile salt export pump (BSEP) (21, 22),
dehydroepiandrosterone sulfotransferase (23), and apolipoprotein C-II
(24).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase and luciferase assays were purchased from Promega (Madison, WI). CDCA and guggulsterones Z and E were obtained from Steraloids, Inc. (Newport, RI). GW4064 was synthesized at
Merck. The guggulipid GUGGUL with a brand name of SOLARAY was purchased
from a health food store in Cranford, NJ. TaqMan reagents for cDNA
synthesis and real-time PCR, and TaqMan oligonucleotide primers and
probes for human BSEP, rat BSEP, rat
SHP-1, and rat I-BABP were purchased from Applied
Biosystems (Foster City, CA). SA/XL665 and (Eu)K were from CIS
Biointernational (Bagnols-sur-Ceze, France) and Packard Instrument Co.
The goat anti-GST antibody and glutathione-Sepharose were from Amersham
Biosciences. Dry milk was from Bio-Rad. The Fisher rats were purchased
from Taconic (Germantown, NY). Assay kits for determination of total
plasma cholesterol and triglycerides were from WAKO Diagnostics
(Richmond, VA).
1440 to +77 (GenBankTM
accession number AF190696) into the plasmid vector pGL3-enhancer (Promega) at NheI/HindIII. The expression vector
pcDNA3.1-hFXR was constructed by inserting the cDNA
fragment encoding the full-length human FXR (GenBankTM
accession number NP_005114) into pcDNA3.1 at
NheI/BamHI. The integrity of sequence for both
constructs was confirmed by DNA sequencing. pGST-hFXR-LBD,
pcDNA3.1-hRXR
, and pCMV-lacZ were described previously (29).
, 10.4 ng of
pGL3-enhancer-hBSEP-Promoter-Luc, and 103.8 ng of
pCMV-lacZ. The treatment of transfected cells with various
FXR ligands, assays for luciferase, and
-galactosidase activities
were also following the same protocols as previously described (29).
This assay was performed at Merck Sharp and Dohme de España, Spain.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (24K):
[in a new window]
Fig. 1.
Enhancement of Z-guggulsterone on FXR
agonist-induced BSEP expression. HepG2 cells at a
density of 1 million cells/well in 6-well plates were treated with
various concentrations of Z-guggulsterone (Z-GS) in the
presence of 25 µM CDCA (A) or 100 nM GW4064 (B) for 24 h in DMEM containing
0.5% CS-FBS. Total RNA was prepared and BSEP mRNA was
analyzed by TaqMan-PCR as described under "Materials and Methods."
Results are normalized as -fold of control (treated cells
versus vehicle), and data are the mean ± S.D. of three
determinations.

View larger version (18K):
[in a new window]
Fig. 2.
Effect of Z-guggulsterone on
FXR-dependent BSEP promoter
activation. HepG2 cells at a density of 3.2 × 104 cells/well in 96-well plates were transfected with
0.405 µl of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXR
, 10.4 ng of
pGL3-enhancer-hBSEP-Promoter-Luc, and 103.8 ng of
pCMV-lacZ in serum-free Opti-MEM I medium using the FuGENE 6 transfection reagent according to the manufacturer's instructions. The
transfected cells were treated with various concentrations of Z-GS in
the presence of 50 nM GW4064 (A), treated with
various concentrations of GW4064 in the presence of 8 µM
Z-guggulsterone (B), or treated with various concentrations
of Z-guggulsterone alone (C). After 24 h treatment,
cells were harvested and the cell lysate was used for determination of
luciferase and
-galactosidase activities as described under
"Materials and Methods." Luciferase activities were normalized to
-galactosidase activities individually for each well. Each value
represents the mean ± S.D. of six determinations.

View larger version (11K):
[in a new window]
Fig. 3.
Western blot analysis for FXR proteins and
isoforms. HepG2 cells were treated with Me2SO, 10 µM Z-GS, 0.1 µM GW4064, or 10 µM Z-GS plus 0.1 µM GW4064 for ~24 h in
fresh DMEM containing 0.5% CS-FBS. At the end of the incubation,
nuclear extraction was prepared using a Nuclear and Cytoplasmic
Extraction kit (Pierce) according to the manufacturer's instructions.
20 µg of total nuclear proteins were separated by 4-20% SDS-PAGE.
Western blotting was carried out following the manufacturer's
instructions (Amersham Biosciences) using the polyclonal rabbit
anti-human FXR antibody (Santa Cruz Biotechnologies), donkey
anti-rabbit IgG conjugated to horseradish peroxidase, and the ECL
chemiluminescence kit.

View larger version (18K):
[in a new window]
Fig. 4.
Effects of guggulsterones on interaction of
FXR with coactivator SRC-1. 4 nM purified GST-FXR were
incubated with 2 nM anti-GST-(Eu)K, 10 nM
biotin-SRC-1-(568-780), 20 nM SA/XL665, and various
concentrations of guggulsterones in the absence (A) or
presence (B) of 9 µM CDCA. The mixture was
incubated overnight at 4 °C. The fluorescent signal was measured,
and results were calculated as described under "Materials and
Methods." Each value represents the mean ± S.D. of three
determinations.

View larger version (21K):
[in a new window]
Fig. 5.
Effects of Z-guggulsterones on interaction of
FXR with coactivator p120 and PBP. 4 nM purified
GST-FXR were incubated with 2 nM anti-GST-(Eu)K, 10 nM biotin-p120-(186-297), or PBP-(568-737), 20 nM SA/XL665, and various concentrations of Z-guggulsterone
or CDCA alone (A) or Z-guggulsterone in the presence of 9 µM CDCA (B). The mixture was incubated
overnight at 4 °C. The fluorescent signal was measured, and results
were calculated as described under "Materials and Methods." Each
value represents the mean ± S.D. of three determinations.
Gene expression in rats treated with guggulipid
Serum and liver total cholesterol (TC) and triglyceride (TG) levels in
rats treated with guggulipid

View larger version (17K):
[in a new window]
Fig. 6.
Serum lipoprotein profile in Fisher rats
treated with guggulipid in. Six-week-old male Fischer rats
(n = 9) were fed a ground-chow diet alone (controls) or
the same diet containing 2.8 and 5.6% content of GUGGUL capsules,
respectively. At the end of the 10-day treatment, rats were sacrificed
and blood samples were collected. The serum lipoprotein profile was
determined by FPLC as described under "Materials and
Methods."
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (32K):
[in a new window]
Fig. 7.
Effect of Z-guggulsterone on ABCA1
and ABCG1 mRNA. HepG2 cells at a
density of 1 million cells/well in 6-well plates were treated with
various concentrations of Z-guggulsterone (Z-GS) in the presence of 100 nM APD for 24 h in DMEM containing 0.5% CS-FBS. Total
RNA was prepared and ABCA1 (A) or
ABCG1 (B) mRNA were analyzed by TaqMan-PCR as
described under "Materials and Methods." Results are normalized as
-fold of control (treated cells versus vehicle), and data
are the mean ± S.D. of two determinations.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of
Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P. O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-594-6369; Fax: 732-594-7926; E-mail: jisong_cui@merck.com.
![]()
ABBREVIATIONS
-hydroxylase;
I-BABP, intestinal bile acid-binding protein;
RXR
, retinoid X receptor
;
SHP, small heterodimer partner;
SRC-1, steroid receptor coactivator
protein-1;
SBARM, selective bile acid receptor modulator;
FBS, fetal
bovine serum;
CS-FBS, charcoal-striped fetal bovine serum;
DMEM, Dulbecco's modified Eagle's medium;
GST, glutathione
S-transferase;
FPLC, fast protein liquid chromatography;
TG, triglycerides;
TC, total cholesterol.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Satyavati, G. V.
(1988)
Indian J. Med. Res.
87,
327-335[Medline]
[Order article via Infotrieve]
2.
Dev, S.
(1999)
Environ. Health Perspect.
107,
783-789
3.
Nityanand, S.,
Srivastava, J. S.,
and Asthana, O. P.
(1989)
J. Assoc. Physicians India
37,
323-328[Medline]
[Order article via Infotrieve]
4.
Singh, R. B.,
Niaz, M. A.,
and Ghosh, S.
(1994)
Cardiovasc. Drugs Ther.
8,
659-664[CrossRef][Medline]
[Order article via Infotrieve]
5.
Beg, M.,
Singhal, K. C.,
and Afzaal, S.
(1996)
Indian J. Physiol. Pharmacol.
40,
237-240[Medline]
[Order article via Infotrieve]
6.
Urizar, N. L.,
Liverman, A. B.,
Dodds, D. T.,
Silva, F. V.,
Ordentlich, P.,
Yan, Y.,
Gonzalez, F. J.,
Heyman, R. A.,
Mangelsdorf, D. J.,
and Moore, D. D.
(2002)
Science
296,
1703-1706 7.
Wu, J.,
Xia, C.,
Meier, J.,
Li, S.,
Hu, X.,
and Lala, D. S.
(2002)
Mol. Endocrinol.
16,
1590-1597 8.
Makishima, M.,
Okamoto, A. Y.,
Repa, J. J.,
Tu, H.,
Learned, R. M.,
Luk, A.,
Hull, M. V.,
Lustig, K. D.,
Mangelsdorf, D. J.,
and Shan, B.
(1999)
Science
284,
1362-1365 9.
Parks, D. J.,
Blanchard, S. G.,
Bledsoe, R. K.,
Chandra, G.,
Consler, T. G.,
Kliewer, S. A.,
Stimmel, J. B.,
Willson, T. M.,
Zavacki, A. M.,
Moore, D. D.,
and Lehmann, J. M.
(1999)
Science
284,
1365-1368 10.
Wang, H.,
Chen, J.,
Hollister, K.,
Sowers, L. C.,
and Forman, B. M.
(1999)
Mol. Cell
3,
543-553[Medline]
[Order article via Infotrieve]
11.
Tu, H.,
Okamoto, A. Y.,
and Shan, B.
(2000)
Trends Cardiovasc. Med.
10,
30-35[CrossRef][Medline]
[Order article via Infotrieve]
12.
Chiang, J. Y.,
Kimmel, R.,
Weinberger, C.,
and Stroup, D.
(2000)
J. Biol. Chem.
275,
10918-10924 13.
Bramlett, K. S.,
Yao, S.,
and Burris, T. P.
(2000)
Mol. Genet. Metab.
71,
609-615[CrossRef][Medline]
[Order article via Infotrieve]
14.
Goodwin, B.,
Jones, S. A.,
Price, R. R.,
Watson, M. A.,
McKee, D. D.,
Moore, L. B.,
Galardi, C.,
Wilson, J. G.,
Lewis, M. C.,
Roth, M. E.,
Maloney, P. R.,
Willson, T. M.,
and Kliewer, S. A.
(2000)
Mol. Cell
6,
517-526[CrossRef][Medline]
[Order article via Infotrieve]
15.
Lu, T. T.,
Makishima, M.,
Repa, J. J.,
Schoonjans, K.,
Kerr, T. A.,
Auwerx, J.,
and Mangelsdorf, D. J.
(2000)
Mol. Cell
6,
507-515[CrossRef][Medline]
[Order article via Infotrieve]
16.
Zhang, M.,
and Chiang, J. Y.
(2001)
J. Biol. Chem.
276,
41690-41699 17.
Denson, L. A.,
Sturm, E.,
Echevarria, W.,
Zimmerman, T. L.,
Makishima, M.,
Mangelsdorf, D. J.,
and Karpen, S. J.
(2001)
Gastroenterology
121,
140-147[CrossRef][Medline]
[Order article via Infotrieve]
18.
Claudel, T.,
Sturm, E.,
Duez, H.,
Torra, I. P.,
Sirvent, A.,
Kosykh, V.,
Fruchart, J. C.,
Dallongeville, J.,
Hum, D. W.,
Kuipers, F.,
and Staels, B.
(2002)
J. Clin. Invest.
109,
961-971[CrossRef][Medline]
[Order article via Infotrieve]
19.
Grober, J.,
Zaghini, I.,
Fujii, H.,
Jones, S. A.,
Kliewer, S. A.,
Willson, T. M.,
Ono, T.,
and Besnard, P.
(1999)
J. Biol. Chem.
274,
29749-29754 20.
Urizar, N. L.,
Dowhan, D. H.,
and Moore, D. D.
(2000)
J. Biol. Chem.
275,
39313-39317 21.
Ananthanarayanan, M.,
Balasubramanian, N.,
Makishima, M.,
Mangelsdorf, D. J.,
and Suchy, F. J.
(2001)
J. Biol. Chem.
276,
28857-28865 22.
Yu, J.,
Lo, J. L.,
Huang, L.,
Zhao, A.,
Metzger, E.,
Adams, A.,
Meinke, P. T.,
Wright, S. D.,
and Cui, J.
(2002)
J. Biol. Chem.
277,
31441-31447 23.
Song, C. S.,
Echchgadda, I.,
Baek, B. S.,
Ahn, S. C.,
Oh, T.,
Roy, A. K.,
and Chatterjee, B.
(2001)
J. Biol. Chem.
276,
42549-42556 24.
Kast, H. R.,
Nguyen, C. M.,
Sinal, C. J.,
Jones, S. A.,
Laffitte, B. A.,
Reue, K.,
Gonzalez, F. J.,
Willson, T. M.,
and Edwards, P. A.
(2001)
Mol. Endocrinol.
15,
1720-1728 25.
Lecureur, V.,
Courtois, A.,
Payen, L.,
Verhnet, L.,
Guillouzo, A.,
and Fardel, O.
(2000)
Toxicology
153,
203-219[CrossRef][Medline]
[Order article via Infotrieve]
26.
Kullak-Ublick, G. A.,
Stieger, B.,
Hagenbuch, B.,
and Meier, P. J.
(2000)
Semin. Liver Dis.
20,
273-292[CrossRef][Medline]
[Order article via Infotrieve]
27.
Hofmann, A. F.
(1999)
Arch. Intern. Med.
159,
2647-2658 28.
Strautnieks, S. S.,
Bull, L. N.,
Knisely, A. S.,
Kocoshis, S. A.,
Dahl, N.,
Arnell, H.,
Sokal, E.,
Dahan, K.,
Childs, S.,
Ling, V.,
Tanner, M. S.,
Kagalwalla, A. F.,
Nemeth, A.,
Pawlowska, J.,
Baker, A.,
Mieli-Vergani, G.,
Freimer, N. B.,
Gardiner, R. M.,
and Thompson, R. J.
(1998)
Nat. Genet.
20,
233-238[CrossRef][Medline]
[Order article via Infotrieve]
29.
Cui, J.,
Heard, T. S., Yu, J.,
Lo, J. L.,
Huang, L.,
Li, Y.,
Schaeffer, J. M.,
and Wright, S. D.
(2002)
J. Biol. Chem.
277,
25963-25969 30.
Maloney, P. R.,
Parks, D. J.,
Haffner, C. D.,
Fivush, A. M.,
Chandra, G.,
Plunket, K. D.,
Creech, K. L.,
Moore, L. B.,
Wilson, J. G.,
Lewis, M. C.,
Jones, S. A.,
and Willson, T. M.
(2000)
J. Med. Chem.
43,
2971-2974[CrossRef][Medline]
[Order article via Infotrieve]
31.
Forman, B. M.,
Goode, E.,
Chen, J.,
Oro, A. E.,
Bradley, D. J.,
Perlmann, T.,
Noonan, D. J.,
Burka, L. T.,
McMorris, T.,
and Lamph, W. W.
(1995)
Cell
81,
687-693[CrossRef][Medline]
[Order article via Infotrieve]
32.
Zhang, Y.,
Kast-Woelbern, H. R.,
and Edwards, P. A.
(2003)
J. Biol. Chem.
278,
104-110 33.
Xu, G.,
Pan, L. X.,
Li, H.,
Forman, B. M.,
Erickson, S. K.,
Shefer, S.,
Bollineni, J.,
Batta, A. K.,
Christie, J.,
Wang, T. H.,
Michel, J.,
Yang, S.,
Tsai, R.,
Lai, L.,
Shimada, K.,
Tint, G. S.,
and Salen, G.
(2002)
J. Biol. Chem.
277,
50491-50496 34.
Monden, T.,
Kishi, M.,
Hosoya, T.,
Satoh, T.,
Wondisford, F. E.,
Hollenberg, A. N.,
Yamada, M.,
and Mori, M.
(1999)
Mol. Endocrinol.
13,
1695-1703 35.
McKenna, N. J.,
Lanz, R. B.,
and O'Malley, B. W.
(1999)
Endocr. Rev.
20,
321-344 36.
Chander, R.,
Khanna, A. K.,
and Kapoor, N. K.
(1996)
Phytotherapy Res.
10,
508-511[CrossRef]
37.
Dixit, V. P.,
Joshi, S.,
Sinha, R.,
Bharvava, S. K.,
and Varma, M.
(1980)
Biochem. Exp. Biol.
16,
421-424[Medline]
[Order article via Infotrieve]
38.
Wang, Z.,
Frederick, J.,
and Garabedian, M. J.
(2002)
J. Biol. Chem.
277,
26573-26580 39.
Orti, E.,
Hu, L. M.,
and Munck, A.
(1993)
J. Biol. Chem.
268,
7779-7784 40.
Hsieh, J. C.,
Jurutka, P. W.,
Galligan, M. A.,
Terpening, C. M.,
Haussler, C. A.,
Samuels, D. S.,
Shimizu, Y.,
Shimizu, N.,
and Haussler, M. R.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
9315-9319 41.
Jurutka, P. W.,
Hsieh, J. C.,
Nakajima, S.,
Haussler, C. A.,
Whitfield, G. K.,
and Haussler, M. R.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
3519-3524 42.
Wang, L.,
Lee, Y. K.,
Bundman, D.,
Han, Y.,
Thevananther, S.,
Kim, C. S.,
Chua, S. S.,
Wei, P.,
Heyman, R. A.,
Karin, M.,
and Moore, D. D.
(2002)
Dev. Cell
2,
721-731[CrossRef][Medline]
[Order article via Infotrieve]
43.
Kerr, T. A.,
Saeki, S.,
Schneider, M.,
Schaefer, K.,
Berdy, S.,
Redder, T.,
Shan, B.,
Russell, D. W.,
and Schwarz, M.
(2002)
Dev. Cell
2,
713-720[CrossRef][Medline]
[Order article via Infotrieve]
44.
Sparrow, C. P.,
Baffic, J.,
Lam, M. H.,
Lund, E. G.,
Adams, A. D.,
Fu, X.,
Hayes, N.,
Jones, A. B.,
Macnaul, K. L.,
Ondeyka, J.,
Singh, S.,
Wang, J.,
Zhou, G.,
Moller, D. E.,
Wright, S. D.,
and Menke, J. G.
(2002)
J. Biol. Chem.
277,
10021-10027
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
D. Xiao and S. V. Singh z-Guggulsterone, a constituent of Ayurvedic medicinal plant Commiphora mukul, inhibits angiogenesis in vitro and in vivo Mol. Cancer Ther., January 1, 2008; 7(1): 171 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Singh, S. Choi, Y. Zeng, E.-R. Hahm, and D. Xiao Guggulsterone-Induced Apoptosis in Human Prostate Cancer Cells Is Caused by Reactive Oxygen Intermediate Dependent Activation of c-Jun NH2-Terminal Kinase Cancer Res., August 1, 2007; 67(15): 7439 - 7449. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Deng, D. Yang, A. Radke, J. Yang, and B. Yan The Hypolipidemic Agent Guggulsterone Regulates the Expression of Human Bile Salt Export Pump: Dominance of Transactivation over Farsenoid X Receptor-Mediated Antagonism J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1153 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Rizzo, M. Disante, A. Mencarelli, B. Renga, A. Gioiello, R. Pellicciari, and S. Fiorucci The Farnesoid X Receptor Promotes Adipocyte Differentiation and Regulates Adipose Cell Function in Vivo Mol. Pharmacol., October 1, 2006; 70(4): 1164 - 1173. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caron, B. Cariou, and B. Staels FXR: More than a Bile Acid Receptor? Endocrinology, September 1, 2006; 147(9): 4022 - 4024. [Full Text] [PDF] |
||||
![]() |
S. Wang, K. Lai, F. J. Moy, A. Bhat, H. B. Hartman, and M. J. Evans The Nuclear Hormone Receptor Farnesoid X Receptor (FXR) Is Activated by Androsterone Endocrinology, September 1, 2006; 147(9): 4025 - 4033. [Abstract] [Full Text] |