 |
INTRODUCTION |
Amino acid biosynthesis may proceed via different metabolic routes
in Saccharomyces cerevisiae. For instance, glycine can potentially be formed from threonine via threonine aldolase, Gly1p (Fig. 1). This pathway, the "threonine pathway," has been suggested to be the main glycine source on glucose media (1), but this function
has not been verified. If glycine is formed, serine can subsequently be
produced by interconversion of serine by tetrahydrofolate (THF)
-dependent serine hydroxymethyltransferases, Shm1p and
Shm2p (2-4). Alternatively, serine and glycine can be formed from
glyoxylate, via the "glyoxylate pathway." However, since both the
formation of glyoxylate and the alanine glyoxylate
aminotransferase (encoded by YFL030W) needed for this
biosynthetic pathway is glucose-repressed, this alternative route for
the production of serine and glycine can only be employed in the
absence of glucose (5-8). However, a third alternative is to start
biosynthesis of serine and glycine from the glycolytic intermediate
3-phosphoglycerate (Fig. 1). The first reaction in this pathway, the
"phosphoglycerate pathway," is catalyzed by phosphoglycerate
dehydrogenase (EC 1.1.1.95), producing 3-phosphohydroxypyruvate plus
NADH from 3-phosphoglycerate and NAD+. The enzymes of the
subsequent two reactions are phosphoserine transaminase (Ser1p, EC
2.6.1.52) and phosphoserine phosphatase (Ser2p, EC 3.1.3.3). Deletion
mutants of either SER1 or SER2 need an external
source of serine during growth on glucose (5, 6, 9). However, genes
encoding the first enzyme of the pathway, phosphoglycerate
dehydrogenase, have as yet not been identified in S. cerevisiae.
Based on sequence similarity (47% identity) to the phosphoglycerate
dehydrogenase gene in Escherichia coli we have previously suggested that yeast has two putative phosphoglycerate dehydrogenases (10). Those genes, YER081W and YIL074C, encode
proteins that are 92% identical to each other. They are here denoted
SER3 and SER33, respectively. Sequence similarity
analysis of available phosphoglycerate dehydrogenases revealed two
groups of proteins; S. cerevisiae and E. coli
enzymes representing one group and rat liver and B. subtilis
enzymes representing the other (11). The E. coli and yeast
enzymes also have in common their preference for the co-substrate
NAD+ instead of NADP+ (5, 12).
Furthermore, Zhao and Winkler (12) have shown that the E. coli enzyme has hydroxyglutarate dehydrogenase activity (EC
1.1.99.2) in addition to phosphoglycerate dehydrogenase activity,
whereas this was not the case for the rat liver enzyme (11). Based on the above similarities we have recently suggested that the yeast enzyme
may exert dual activities (10). In S. cerevisiae, we showed
2-hydroxyglutarate to be formed from glutamate, probably via the
tricarboxylic acid cycle intermediate 2-oxoglutarate, when glutamate
served as the sole nitrogen source (10). However, hydroxyglutarate
dehydrogenase activity has as yet not been reported in yeast.
Other proteins with homology to Ser3/33p may also be candidates for
having hydroxyglutarate dehydrogenase activity in S. cerevisiae: (i) Ypl113cp (27% identity), (ii) Ygl185cp (21-23%
identity), with similarities to hydroxyacid dehydrogenases, (iii) Fdh1p
(26-27% identity), a formate dehydrogenase, and (iv) Ynl274cp
(25-26% identity), which is a putative hydroxyisocaproate
dehydrogenase (13).
In the present study, we have investigated physiological and expression
properties of yeast strains with single and double deletions of
SER3 and SER33. Our data establish that
SER3 and SER33 encode phosphoglycerate
dehydrogenases and that they appear to be the only enzymes with such
activity in S. cerevisiae. Ser33p seems to be the
main isoenzyme of the phosphoglycerate pathway of serine/glycine biosynthesis.
 |
EXPERIMENTAL PROCEDURES |
Strains, Media, and Growth Conditions--
We have used the
S. cerevisiae strain, CEN.PK113-7D
(MATa SUC2 GAL MAL2-8c)
as the protoptrophic wild type (14). Mutant strains of
YER081W and YIL074C genes, YVL87 and YVL88, were
obtained from the isogenic strains CEN.PK111-32D
(MATa leu2-3,112 SUC2 GAL
MAL2-8c) and CEN.PK110-10C (MAT
his3
1
SUC2 GAL MAL2-8c), respectively. All the CEN.PK
strains mentioned can be received from EUROSCARF, Frankfurt,
Germany (www.uni-frankfurt.de/fb15/mikro/EUROSCARF/).
YPD, containing 10 g/liter of yeast extract, 20 g/liter of peptone, 20 g/liter of glucose, was used as complex medium. Agar (20 g/liter)
plates were prepared from either YPD or, when defined conditions was
needed, from YNB (1.7 g/liter of yeast nitrogen base without amino
acids and ammonium sulfate, Difco), with appropriate additions of
carbon and nitrogen sources as well as supplements. Sporulation medium
contained 10 g/liter of potassium acetate and 20 g/liter of agar.
For liquid cultures, a synthetic defined medium was used, CBS (15),
with glucose as carbon and energy source at a concentration of 20 g/liter and glutamate (3.5 g/liter) or ammonium sulfate (5 g/liter) as
the nitrogen source. When needed, glycine (0.5 g/liter) or serine (0.7 g/liter) was added. The initial pH of the medium was adjusted to
6.0.
Inoculum cultures were grown on synthetic defined medium with glucose
and were supplemented with serine. Cultures were grown in Erlenmeyer
flasks (E-flasks) at 30 °C (the volume of flask was twice the volume
of medium) on a rotary shaker resulting in semi-aerobic conditions and
inoculated with 1.7% of the total culture volume.
Gene Disruptions--
Each open reading frame
(ORF)1 was substituted with a
deletion cassette containing either the HIS3 gene (to
replace ORF YIL074C) or the LEU2 gene (to replace
ORF YER081C). Deletion cassettes were prepared with 2 rounds
of PCR according to Wach (16) from the plasmids YDp-H and
YDp-L, respectively (17), using the following oligonucleotides (5' to 3', the sequence complementary to
YDp plasmids is underlined). For ORF YER081W:
L1, ACTCACAATCGAGTAATGCC; L2,
GCTCAATCAATCACCGGATCCCCGGAATGCTTGTCATTGCTGTCG; L3,
GCTCAATCAATCACCGGATCCGTCGCCTCTGCTAAGATCTCAATT; L4,
AATTCCATCGGTTCAGTGGA. For ORF YIL074C: L1,
AGGCTTGCAGGAGCAATTGT; L2,
GCTCAATCAATCACCGGATCCCCGGTCGGCAGCTGAATAAGACAT; L3,
GCTCAATCAATCACCGGATCCGTCGGCCAAAGTTTCCATCAGGTT; L4,
CAGTTCATTCGAGATCTCAG. PCR reactions were performed as follows: (i) first round with Taq DNA polymerase (Fermentas), 2 min
at 94 °C and 30 cycles of [30 s at 94 °C, 30 s at 50 °C,
1 min at 72 °C], and (ii) second round with the Expand Long
Template PCR System (Roche Molecular Biochemicals), 1 min at 94 °C
and 30 cycles of [15 s at 94 °C, 30 s at 45 °C, 1.5 min at
68 °C]. A final elongation step of 10 min was performed at the end
of both rounds. Deletion cassettes were then purified using the
QIAquick Gel Extraction kit (Qiagen) and introduced in yeast cells
according to Ito et al. (18).
For gene disruption, cells were routinely grown at 30 °C on YPD
plates. Deletion mutants were selected on YNB-HIS or YNB-LEU plates
(6.7 g/liter of a yeast nitrogen base with ammonium sulfate but without
amino acids, with addition of 0.77 g/liter CSM-HIS or 0.69 g/liter
CSM-LEU (BIO101), respectively). Correct integration of the replacement
cassettes was confirmed by PCR on genomic DNA (19) using primers L1 and
L4, and restriction analysis of the amplified fragment. Six individual
clones were tested for each disruption.
Double mutants were obtained by mating and subsequent tetrad analysis
of the strains YVL87 (MATa
yer081w::LEU2) and YVL88 (MAT
yil074c::HIS3). Genomic DNA from 20 segregants (5 tetrads) was prepared, and the presence of both replacement cassettes was verified by PCR and enzymatic restriction. No defects in mutant mating or in sporulation efficiency were observed.
Growth and Metabolite Analyses--
Biomass concentration was
determined from dry weight and optical density measurements at 610 nm
(OD610). Growth curves were performed by measurements of
the OD610 in E-flask cultures or in microtiter plates in
350-µl cultures (BioScreen, Labsystems) by measurement of the
turbidity during 36 h (OD measurements over 20 min). The turbidity
was recalculated to true OD using a calibration curve earlier
determined (20) to compensate for the non-linear OD measurements at
higher cell densities. From these curves the maximal specific growth
rate was determined.
Growth tests were performed on YNB plates, with a carbon source (20 g/liter of glucose or ethanol), a main nitrogen source (5 g/liter of
ammonium, 3.5 g/liter of glutamate, or 10 g/liter glycine or
threonine), and eventually an additional nitrogen source (120 mg/liter
serine, glycine, or threonine). Inocula were grown in liquid YPD. Cells
were washed in the corresponding YNB medium and diluted to an
OD610 of 1. Aliquots of 10 µl of serial one-tenth dilutions (undiluted and 5 subsequent dilutions) were dropped on plates
with appropriate medium and incubated for 2 days (ethanol plates for 6 days) at 30 °C.
Product formation and substrate consumption of the entire
respiro-fermentative growth phase were determined from medium samples taken at inoculation and directly after glucose exhaustion. Glucose depletion was checked using Diabur-Test® 5000 test-strips (Roche). Extracellular concentrations of metabolites (including glucose) were
measured with HPLC (Waters) using an ion-exchange column, HPX-87H,
BioRad, as described previously (10). Glutamic acid concentration was
determined using an enzymatic kit assay (Roche Molecular Biochemicals).
Glycine was determined by measurements of the total free amino acid
nitrogen concentration, by staining with ninhydrin (21), from which the
glutamic acid contribution was subtracted. The standard solution
contained both glutamate and glycine in the same concentration ranges
as present in the experiments.
Northern Blot Analyses--
Gene expression was investigated in
cells grown in CBS medium supplemented with glucose as carbon source,
and glutamate (± serine, threonine, or glycine) or ammonium as
nitrogen source. Cells were grown at 30 °C, and RNA was extracted
from cells during respiro-fermentative exponential growth to the
diauxic shift. Total RNA was isolated from yeast cells as described by
Ausubel et al. (19) using a FastPrep apparatus (BIO101). RNA
samples (10 µg per lane) were fractionated on 1% agarose gels
containing formaldehyde, transferred by downward capillary blotting
onto Hybond-N+ membranes (Amersham Biosciences) in 10× SSC (22) and cross-linked using a GS GeneLinker (BioRad). Blots were then
prehybridized at 65 °C for at least 2 h in 5× SSC, 50 mM NaH2PO4 (from a 1 M stock solution at pH 6.5), 5× Denhardt's solution, 0.5% SDS, and 0.1 mg/ml denatured salmon sperm DNA, and then hybridized at 65 °C for
16 h with a 32P-labeled probe. The mRNA encoding
the inorganic pyrophosphatase, IPP1, was selected as
reference. SER1, SER2, YNL274C,
YPL113C, YGL185C, FDH1, and
IPP1 probes were prepared from the following PCR fragments
(5' to 3'). The resulting fragment length is given in parenthesis.
SER1 (1110 bp): TTGGAAAGAGAGGAACCACAACA and
ATAGATGGAGGCTCTGAACCCAC. SER2 (868 bp):
GTTATCACCTGCATAGCTCATGGAG and TGTCAGTCATGCTCTTGGTATTCAA. YNL274C (950 bp): TGTTTTGAAATTAGGAAAGGATGCC and
TCTTTGCATTTTCAACGACCAGT. YPL113C (1107 bp):
TGGTGCCTTATAAAACCCAATGG and CCTCGACAAATATGTCCTGCACA. YGL185C
(1106 bp): ATGTGCGATTCTCCTGCAACGAC and GCTTCCCCAGACACTACCCGTAA. FDH1 (1104 bp): ATGTCGAAGGGAAAGGTTTTGCT and
GGCATAAGAACCATTCTGCACAATA. IPP1 (830 bp):
AGACAAATTGGTGCCAAGAA and AAGAACCACTTGTCAATAGAC. These were
labeled with [
-32P]dCTP (3000 Ci/ml) by use of a
Megaprime DNA labeling kit (Amersham Biosciences) and purified on a
Nick column (Amersham Biosciences). SER3 and
SER33 probes were prepared from the following
oligonucleotides (5' to 3', 24 nucleotides). SER3;
TAAGTTGTTAATGTCAATGCTTGT and ACAGCATTCAAGCGCTGTGGAACG.
SER33; TAAATTATCGGCAGCTGAATAAGA and GTAATGCTTACACGACGAGGTAGT. These were labeled with
[
-32P]ATP (3000 Ci/ml) by use of the T4
polynucleotide kinase (MBI) and purified on a microspin G25 column
(Amersham Biosciences). The specificities of the oligonucleotides used
for probing SER3 and SER33 mRNA were
controlled using the ser3
, ser33
, and
ser3
ser33
strains. Blots were washed 2× 5 min at
room temperature and 2× 5 min at 65 °C in 0.5× SSC/0.1% SDS, then
exposed 6-24 h to PhosphorImager screens. Non-saturated signals were
measured by a BioRad FX PhosphoImager and quantified by densitometry.
Values were normalized by comparison with IPP1 signals.
Protein Expression Analysis--
For labeling of proteins,
duplicate cultures were inoculated from overnight cultures giving a
starting OD610 of 0.07 and grown to an OD610 of
0.35-0.39 in glucose/glutamate medium supplemented with glycine. A
volume of 1 ml was transferred to a separate flask (10 ml) and 8 µl
(3.2 MBq) of L-[35S]methionine (specific
activity >37 TBq/mmol, Amersham Biosciences) was added. The cultures
were grown for another 30 min and then placed on ice. Cells were
harvested (15,000 × g, 4 °C, 5 min), washed once
with ice-cold milliQ water (Millipore), and the resulting cell pellet
was stored at
80 °C until used. Proteins were extracted, the
amount of incorporated 35S was measured and proteins (in
2,000,000 dpm of extract) were separated by two-dimensional PAGE (23).
The protein pattern was detected by phosphorimaging and protein
quantification was performed by image analysis with the PDQUEST
software (BioRad). At least 2-fold and statistically significant
changes (Student's t test on log-transformed data) in
protein levels were distinguished. Resolved proteins have previously
been identified by microsequencing or MALDI-MS (23, 24). Protein
identity data can be found at yeast-2DPAGE.gmm.gu.se.
Crude Cell Extract Preparation and Enzyme Activity
Measurements--
Crude cell extracts were prepared from 50 ml of
culture. Cells were harvested (2,000 × g, 4 °C, 5 min) and washed twice (20 and 1 ml) with washing buffer (10 mM KH2PO4, pH 7.5, containing 2 mM EDTA). The sedimented cell pellet was frozen in liquid
nitrogen and stored at
20 °C until further treatments. The thawed
cell pellet was resuspended in 1 ml of extraction buffer (2 mM MgCl2 and 1 mM dithiothreitol in
100 mM KH2PO4, pH 7.5) and
supplemented with protease inhibitors (1 µl of 35 g/liter
phenylmethylsulfonylfluoride in ethanol and 0.6 µl of 0.8 g/liter
pepstatin and 1.2 g/liter leupeptin in ethanol). Cells were disrupted
by vortexing with 1 g of glass beads (diameter 0.5 mm) for 5 min
at 4 °C. The suspension was then transferred to a 1.5-ml tube, and
the beads were washed with 0.5 ml of extraction buffer (supplemented
with appropriate amounts of protease inhibitors). After centrifugation
at 15,000 × g, 4 °C, 15 min (if necessary twice),
pooled supernatants were used immediately for measurement of enzyme
activity and protein content. For preparation of crude extracts used in
analysis of phosphoserine phosphatase (Ser2p) activity (see below),
Tris-HCl buffer at the same concentration and pH was used instead of
the ordinary phosphate buffer.
Enzyme activities (except for Ser2p activity) and protein content were
measured at 30 °C on a COBAS Fara Autoanalyser (Roche Molecular
Biochemicals). Protein concentration was determined according to Lowry
et al. (25), with bovine serum albumin as standard.
Phosphoglycerate dehydrogenase (EC 1.1.1.95) activity was measured by
reduction of hydroxypyruvate phosphate, following the decrease of NADH
at 340 nm. The reaction mixture contained 1 mM
dithiothreitol, 0.25 mM NADH, 400 mM KCl, and
0.36 mM hydroxypyruvate phosphate (prepared from the
corresponding dimethylketal, Sigma) in 40 mM
KH2PO4 buffer, pH 7.5.
For measurements of phosphoserine transaminase activity the assay of
Hirsch-Kolb and Greenberg was essentially used (26), following the
decrease of NADH. The reaction mixture contained 4 mM NaF,
0.25 mM NADH, 30 mM ammonium acetate, 20 µM pyridoxal phosphate, 10 units/ml of glutamate
dehydrogenase (NAD(P)-dependent, type III bovine liver,
Sigma), 8 mM Na-L-glutamate, and 0.36 mM hydroxypyruvate phosphate in 50 mM Tris-HCl
buffer, pH 8.2.
Phosphoserine phosphatase was determined manually at 30 °C with
crude extracts in a reagent solution containing 5 mM
O-phospho-L-serine and 5 mM
MgCl2 in 65 mM Tris-HCl buffer, pH 7.5. The
reaction was stopped in aliquots of reaction mixture (320 µl) with 80 µl of trichloroacetic acid (250 g/liter) at appropriate time
intervals after extract addition (up to 10 min). Subsequent
determination of released phosphate was performed according to Dryer
et al. (27). There was no background release of phosphate in
the reagent solution during the time of measurement, thus giving the
enzymatic activity directly from the rate of phosphate release.
Hydroxyglutarate dehydrogenase (EC 1.1.99.2) activity was measured by
reduction of 2-oxoglutarate, following the decrease of NADH. The
reaction mixture contained 1 mM dithiothreitol, 0.25 mM NADH, and 5 mM 2-oxoglutarate in 40 mM KH2PO4 buffer, pH 7.5. Formation
of 2-hydroxyglutarate during assay condition was checked by HPLC.
Glutamate dehydrogenase activity was shown to negligibly contribute to
the reduction of NADH in the hydroxyglutarate dehydrogenase assay,
despite the fact that the crude extracts contained small amounts of ammonium.
Activity of hydroxyisocaproate dehydrogenase was measured in the same
way as the hydroxyglutarate dehydrogenase, except that 6 mM
of 2-oxoisocaproate was used as substrate.
Enzyme activity (units, µmol/min) was determined from the difference
in slope of NADH absorbance (at 340 nm,
= 6.3 mM
1 cm
1) after and before
addition of substrate (3-phosphohydroxypyruvate, 3-phosphohydroxypyruvate plus glutamate, 2-oxoglutarate, or
2-oxoisocaproate). When the slope prior to substrate addition was equal
to or larger than the slope after substrate addition, then the
detection limit was estimated as follows. The variances of the two
slopes obtained in the linear regression of absorbance data were added
and the 95% confidence interval was calculated according to a
t-distribution. The detection limit was around 0.2 units/g
of protein for the phosphoglycerate dehydrogenase and between 0.1-0.6
units/g of protein for the hydroxyisocaproate dehydrogenase.
 |
RESULTS |
Ser3p and Ser33p Are Phosphoglycerate Dehydrogenases in S. cerevisiae--
The full-length coding sequences of SER3
(YER081W) and SER33 (YIL074C) were deleted and replaced
with LEU2 and HIS3 markers, respectively, in the
haploid strains CEN.PK111-32D and CEN.PK110-10C, respectively. This
yielded isogenic strains without auxotrophic markers. A haploid double
deletion mutant was obtained by mating and subsequent sporulation. The
single and double deletion mutants were viable and formed colonies of
normal size and morphology on complex media.
During growth on glucose, deletion mutants of all functional
phosphoglycerate dehydrogenases should result in a block in the phosphoglycerate pathway of serine/glycine biosynthesis. Such mutants
would require externally available serine or glycine, provided that no
alternative pathways are active, such as the glyoxylate or threonine
pathways (Fig. 1). As shown in Fig.
2A, the SER3 and
SER33 genes encode the only functional phosphoglycerate dehydrogenases since the double mutant required serine for growth, while the single ser3
and ser33
mutants
could grow in the absence of serine. Furthermore, the glyoxylate
pathway provides no alternative during growth on glucose since it is
glucose-repressed (5-8). In contrast, as expected the ser3
ser33
mutant grew well on ethanol as the only carbon source
with ammonium as the only nitrogen source (Fig. 2B).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Serine and glycine synthesis in S. cerevisiae, adapted from Refs. 1-3, 5, 8, 48, and 49.
Enzymes: Ser3p, Ser33p: phosphoglycerate dehydrogenases; Ser1p:
phosphoserine transaminase; Ser2p: phosphoserine phosphatase; Shm1p,
Shm2p: serine hydroxymethyltransferases; Gcv1p + Gcv2p + Gcv3p + Lpd1p:
a protein complex of these proteins in the glycine cleavage system,
i.e. glycine decarboxylase; Gly1p: threonine aldolase;
Yfl030wp: alanine glyoxylate aminotransferase; and Icl1p, Icl2p:
isocitrate lyases. THF, tetrahydrofolate.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Growth tests of wild type
(wt) and ser3 or/and
ser33 deletion mutants using serial one-tenth
dilutions on YNB plates. A, serine or glycine
supplementation. Glucose was used as carbon and energy source and the
ammonium ion as the main nitrogen source. B, ethanol was
used as carbon and energy source with the ammonium ion as the sole
nitrogen source. C, glycine or threonine supplementation.
Glucose was used as carbon and energy source and glutamate as the main
nitrogen source.
|
|
In addition, the double deletion mutant (ser3
ser33
)
provides an opportunity to investigate the function of the second
alternative pathway, the threonine pathway, which has been suggested to
be important during growth on glucose (1). However, addition of threonine did not allow growth of the double mutant, either when added
to ammonium (data not shown) or glutamate (Fig. 2C) as the main nitrogen sources or when used as the sole nitrogen source (data
not shown). Thus, the threonine pathway seems to be non-functional during all conditions tested.
Surprisingly, the addition of glycine to ammonium-containing medium did
not support growth of the double mutant (Fig. 2A). However,
ammonium mediates strong nitrogen catabolite repression on for example
uptake systems (28). We therefore tested other nitrogen sources (Fig.
2C). The double mutant could grow on both glycine (or
serine; data not shown)-supplemented glutamate medium or on glycine as
the sole nitrogen source (data not shown). Both single deletion mutants
could grow also on glutamate as sole nitrogen source (Fig.
2C).
We have measured enzymatic activities in crude extracts to confirm the
function of Ser3p and Ser33p as phosphoglycerate dehydrogenases (Table I). The activity of the
phosphoglycerate dehydrogenase in Escherichia coli is
inhibited by serine and to a lesser extent by glycine (12, 29, 30).
Since inhibition by serine has been reported also for yeast (5),
glycine was used as a supplementing nitrogen source to glutamate in the
following experiments in order to minimize inhibition of
phosphoglycerate dehydrogenase while still allowing growth on glucose
of the ser3
ser33
double mutant. The ser3
ser33
mutant showed no phosphoglycerate dehydrogenase activity
(Table I), indicating that only these two genes encode such an
activity. The specific activity determined in the wild-type strain was
equivalent to the sum of the activities found in the single mutants.
The reduction of phosphoglycerate dehydrogenase activity was more
pronounced in the ser33
mutant, indicating that Ser33p is
the major isoenzyme. As may be expected, since externally accessible
glycine reduces the need for its biosynthesis, addition of glycine
reduced the activity in all strains tested, most prominently in the
ser33
mutant. Externally available glycine may affect the
expression of the SER3 and SER33 genes or
modulate the activity of Ser3p and Ser33p directly. To clarify the
situation, the mRNA expression was studied during growth with
different nitrogen sources, see below. Also when glycine was added to
the medium, the activities measured in the single mutants added up to
that of the wild-type strain.
View this table:
[in this window]
[in a new window]
|
Table I
Phosphoglycerate dehydrogenase activity
Phosphoglycerate dehydrogenase activity during respiro-fermentative
growth of the wild-type strain (wt) and ser3 or/and
ser33 deletion mutants grown on glucose and glutamate or
glutamate as the main nitrogen source supplemented with glycine. Data
are means of activities from 4 to 9 independent cultures of each
strain, unless otherwise indicated. Samples with no detectable activity
were set as zero in the calculations. The mean S.D. was 0.5 units/g
protein and estimated from all measurements.
|
|
Expression of the SER Genes and Enzyme Activities during
Respiro-fermentative Growth--
The expression of genes encoding the
enzymes of the serine/glycine pathway was analyzed by Northern blot
analysis during respiro-fermentative growth and at the transition to
respiratory growth. Small but significant differences in gene
expression between the wild-type strain and the single mutants were
observed (Fig. 3, A and
B). The SER1, 2, and 33 genes showed a declining expression during late exponential growth.
After glucose exhaustion, the mRNA level of SER1
seemingly increased. However, this apparent increase of SER1
mRNA probably results from the normalization of mRNA levels with IPP1 expression. IPP1 seemed to be
down-regulated at the diauxic shift, since despite that the same amount
(concentration was measured) of total mRNA was loaded on the gels
the amount of IPP1 mRNA at this growth phase was low for
all strains and irrespective of type of nitrogen source (Fig.
3B; data not shown). The low enzymatic activity of Ser1p
determined at diauxic shift also indicates a true low expression of
SER1. However, down-regulation of IPP1 has not
been seen in recently reported microarray studies (31). SER3
expression was not affected by the deletion of SER33, whereas SER33 expression was slightly decreased in the
ser3
mutant.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
mRNA levels and enzyme activities of the
serine/glycine biosynthetic pathway during growth into the diauxic
shift on glucose as carbon and energy source and glutamate as nitrogen
source. True exponential growth lasted up to an OD610
of about 2.5-3. The dotted lines indicate glucose
exhaustion. Strains cultivated were wild type ( ), ser3
( ), and ser33 ( ). A, mRNA levels of
SER1, SER2, SER3, and SER33
relative to the amount of IPP1. Data are from single
cultures giving typical results. The S.D. of the analytical procedures
was 15% for SER1 and SER2 and 20% for
SER3 and SER33. B, images of Northern
blots of SER1, SER2, SER3,
SER33, and IPP1 for each sample in panel
A. n.a., not applicable. C, enzyme
activities of phosphoserine transaminase (Ser1p), phosphoserine
phosphatase (Ser2p), and phosphoglycerate dehydrogenase (Ser3p and
Ser33p) in the wild-type strain. Data are means from two independent
batch cultures, and error bars represent the mean S.D.,
which was estimated from all measurements.
|
|
The enzyme activities of the three reactions of the pathway (Ser1p,
Ser2p, Ser3/33p) were also analyzed to reveal correlations between gene
expression and protein activity (Fig. 3, A versus C). The phosphoserine transaminase activity stayed constant
during the respiro-fermentative growth phase but strongly decreased
after glucose depletion. The phosphoserine phosphatase activity behaved similarly, although decreased already before glucose exhaustion. The
specific activity of phosphoglycerate dehydrogenase first increased
monotonically until glucose depletion and then decreased drastically at
the diauxic shift. The SER enzyme activities followed the
mRNA expression in that both decreased during the shift from respiro-fermentative to respiratory growth. Hence, the activity of the
phosphoglycerate pathway seemed to some extent be regulated at the
level of gene expression. Down-regulated activities of enzymes in the
phosphoglycerate pathway at glucose exhaustion is expected because of
relief of glucose-repression and is in agreement with that the
glyoxylate pathway contributes significantly to serine/glycine
formation at growth on ethanol.
Expression of SER Genes during Growth on Different Nitrogen
Sources--
Since glycine addition was found to have an impact on the
phosphoglycerate dehydrogenase activity, the effect of different nitrogen sources on the expression of the SER genes was then
investigated. The expression of all SER genes, except for
SER3, was affected by the nitrogen source in a similar way
(Fig. 4). The SER3 mRNA level was very sensitive to additions of serine, glycine, and threonine, which largely reduced the expression, while the expression of the other SER genes was only sensitive to threonine
addition (Fig. 4). Hence, the reduced activities found in
glycine-supplemented medium (Table I) may partly be explained by
reduced expression of SER3.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
mRNA levels of SER1,
SER2, SER33, and SER3
relative to IPP1 in the midexponential growth
phase (OD610 2.1-2.6) in the wild-type strain. Cells
were grown using glucose as carbon source and ammonium sulfate
(NH ) or glutamate as the main nitrogen
sources. Different nitrogen supplements were added to the glutamate
medium: No supplement (No), serine (+S),
threonine (+T), or glycine (+G). S.D. of the
analytical procedures was 15% for SER1 and SER2
and 20% for SER3 and SER33. The images of
Northern blots are shown.
|
|
Although there was a tendency of decreased expression of the
SER1, SER2, and SER33 genes in the
mid-exponential phase during growth on ammonium as compared with
glutamate, this difference was not statistically significant. However,
a consistently lower enzymatic activity of phosphoglycerate
dehydrogenase (0.99 units/g of protein) was measured in the wild-type
strain when ammonium was used as the sole nitrogen source (data not
shown). This observed activity is similar to that reported previously
(1.1-1.5 units/g of protein) for growth on ammonium (6).
Consequences of Growth and Metabolism When Deleting the SER3/33
Genes--
In order to determine consequences of SER3 and
SER33 deletions on growth and metabolism, we first
determined the maximal specific growth rates (Table
II). Cells were grown on microtiter
plates in liquid medium, with and without additional glycine, in the presence of glucose as carbon source and glutamate as main nitrogen source. The wild-type strain grew only slightly faster than both single
mutants. Addition of glycine reduced the growth rate of both the
wild-type strain and the single mutants about 15%. The double mutant,
which was able to grow when glycine was supplemented, showed the
slowest growth rate of all strains (85% of the wild-type level). The
growth rate of the ser3
ser33
mutant was not reduced because the interconversion of glycine to serine was rate-limiting, since the maximal specific growth rate of the wild type remained the
same in the presence of both serine and glycine (data not shown).
View this table:
[in this window]
[in a new window]
|
Table II
Maximal specific growth rates
Maximal specific growth rates (µmax) of wild-type (wt) and
ser3 or/and ser33 strains during
respiro-fermentative growth in microtiter plates on glucose with
glutamate as the main nitrogen source and with or without glycine
supplementation as indicated. The means are calculated from two
independently grown cultures and the mean S.D. of growth rates was
0.009 h 1 as estimated from all measurements.
|
|
The metabolite product pattern during the entire period of
respiro-fermentative growth was also monitored. The strains were grown
on medium with glutamate as nitrogen source, without and with glycine;
to fulfill the auxotrophic requirement of the double deletion
mutant (Table III).
View this table:
[in this window]
[in a new window]
|
Table III
Product formation and substrate consumption
Product formation and substrate consumption during respiro-fermentative
growth on glucose with glutamate (3.5 g/liter) as main nitrogen source,
with and without glycine supplementation (0.5 g/liter). Data are means
of two independent experiments. S.D., mean standard deviation
(estimated from all measurements). ND, not detectable. NA, not
applicable.
|
|
With glutamate as the sole nitrogen source, deletion of either
SER3 or SER33 only slightly affected the
production of biomass and of major end products of growth (ethanol and
glycerol) compared with that of the wild type (Table III). On the
other hand, acetic acid production decreased in the mutants, which was
balanced with a substantial increase in pyruvic acid production.
Despite the fact that glutamate was consumed in similar amounts, two
products of its metabolism, succinic and 2-hydroxyglutaric acids, were formed in lower amounts in both single mutants, while this reduction was to some extent balanced with a slightly increased production of its
first conversion product, 2-oxoglutarate and of fumaric acid. The
recorded changes in metabolite production in both single mutants,
indicate an altered flux distribution to and within the tricarboxylic
acid cycle in ser3
and ser33
mutants
compared with the wild type during growth on glutamate as sole nitrogen source. In total, there were small differences between the
ser3
and ser33
mutants grown on glutamate
as the sole nitrogen source.
Glycine supplementation influenced largely the pattern of formed
metabolites in all strains (Table III). The addition of glycine to the
medium resulted in a diminished consumption of glutamate, while the
total amount of nitrogen taken up was similar for all strains with and
without glycine supplementation (0.80-0.83 mmol of nitrogen/g of glucose).
There were many indications of an altered metabolism during growth on
glutamate plus glycine when both SER3 and SER33
was deleted as compared with the wild type (Table III). Thus, in the double mutant the amounts of ethanol, glycerol, 2-oxoglutaric acid,
2-hydroxyglutaric acid, and fumaric acid formed decreased, while the
amounts of acetic acid and succinic acid increased. Formation of
2-hydroxyglutaric acid was not even detectable in the double mutant
(Table III). All these altered levels indicate a changed redox
metabolism in the double deletion mutant as compared with the wild-type strain.
In order to determine if effects of SER3 and
SER33 deletions on metabolism could be explained by altered
expression levels of cellular proteins, two-dimensional PAGE analysis
was performed with protein extracts of the wild type and the double
mutant from samples taken in mid-exponential growth phase in glutamate
plus glycine medium. However, very few and only minor changes were observed when about 500 proteins were analyzed (data not shown). All
recorded expression changes corresponded to unidentified proteins except for Tdh1p. This minor isoform of glyceraldehyde-3-phosphate dehydrogenase was up-regulated 3-fold in the double mutant (from 325 ± 11 ppm in the wild-type strain to 974 ± 75 ppm in the
double mutant, with the maximal deviation given). Interestingly, Shm2p, one of the serine/glycine-interconverting serine
hydroxymethyltransferases, was present in similar amounts in both
strains. Hence, the difference in metabolite levels were not due to an
altered amount of proteins. Possible spots in the two-dimensional PAGE
gels for Ser3p and Ser33p, which were absent for the double mutant,
were found at a molecular mass of 50 kDa and pI of 5.6 and 6.2, respectively, close to their theoretical values (5.39 and 6.18).
However, further identification is required.
Other Functions of the SER3/33 Genes--
In bacteria, the
formation of 2-hydroxyglutarate from 2-oxoglutarate is dependent on the
presence of a hydroxyglutarate dehydrogenase activity (12, 32). Indeed,
hydroxyglutarate dehydrogenase activity was also present in crude
extracts of S. cerevisiae (Table IV). The activity was highly dependent on
NADH as cofactor. Use of NADPH as cofactor in the activity assay
yielded only 15-20% of the activity as measured with NADH (data not
shown). The specific hydroxyglutarate dehydrogenase activity increased
about 4-fold during respiro-fermentative growth for both the wild-type
strain (Fig. 5) and all mutants (data not
shown).
View this table:
[in this window]
[in a new window]
|
Table IV
Hydroxyglutarate dehydrogenase activity in wild-type strain (wt) and
ser3 or/and ser33 deletion mutants
Cultures were grown to an OD610 of at least 3, to reach a
constant activity. Data are means of at least four independent
cultures, unless otherwise indicated. The mean S.D. was 11 units/g
protein as estimated from all measurements.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
Enzyme activities of hydroxyglutarate
dehydrogenase and of hydroxyisocaproate dehydrogenase, encoded by a
homologue (YNL274C) of the SER3 and
SER33 genes, and mRNA levels of YNL274C
and of the homologues YGL185C and
YPL113C. The wild-type strain was grown into the
diauxic shift on glucose as carbon and energy source and glutamate as
the sole nitrogen source. The dotted line indicates glucose
exhaustion. Enzyme activities are averaged using data from two
independently grown cultures and the error bars given
represent the mean S.D. of the activities estimated from all
measurements. The mRNA levels are normalized to IPP1 and
presented as relative to the level after glucose depletion. The
presented mRNA data are from a single culture giving typical
results. The S.D. of the analytical procedures was 1% for
YNL274C, 5% for YGL185C, and 3% for
YPL113C. A, enzyme activity of hydroxyglutarate
dehydrogenase ( ). B, enzyme activity of
hydroxyisocaproate dehydrogenase ( ), and mRNA levels of the
corresponding gene YNL274C (open bars).
C, mRNA levels of the ORFs YGL185C
(black bars) and YPL113C (open
bars).
|
|
Since the E. coli phosphoglycerate dehydrogenase has a
hydroxyglutarate dehydrogenase activity, candidates for yeast enzymes with such activity were Ser3p and Ser33p, as well as their homologues, Ynl274cp, Ygl185cp, Ypl113cp, and Fdh1p. However, absence of Ser33p, or
of both Ser3p and Ser33p, rather resulted in a higher hydroxyglutarate dehydrogenase activity (Table IV). On the other hand, the ser3
ser33
mutant did not form any 2-hydroxyglutarate in
glutamate/glycine medium (Table III) but traces of this metabolite were
found during anaerobic growth in glutamate/serine medium (data not shown).
One of the candidates for hydroxyglutarate dehydrogenase activity,
Ynl274cp, has been assigned a hydroxyisocaproate dehydrogenase activity
(13). The activity of hydroxyisocaproate dehydrogenase increased during
respiro-fermentative growth and reached a value of 1-5 units/g of
protein at the diauxic shift in both wild-type and mutants strains
(Fig. 5B and data not shown), which was in accordance with
the range reported previously (13) for a wild-type strain growing in
ethanol medium (2.3-5.9 units/g of protein). The Northern blot
analysis (Fig. 5B) confirmed that expression of
YNL274C is glucose-repressed (33). Also expression of both YGL185C and YPL113C was strongly diminished in
glucose medium (Fig. 5C), and the mRNA of the
FDH1 could not be detected. No clear difference in
expression of the homologues was seen comparing the ser3/33
mutants with the wild type (data not shown).
 |
DISCUSSION |
Phosphoglycerate Dehydrogenase Activity--
We have in this work
demonstrated that the gene products of YER081W and
YIL074C (in this study renamed SER3 and
SER33, respectively) both have phosphoglycerate
dehydrogenase activity. The double deletion mutant, ser3
ser33
, is auxotrophic for serine and glycine during growth on
glucose. Furthermore, phosphoglycerate dehydrogenase activity was
absent in crude extracts of the double mutant and lowered in single
deletion mutants. Consequently, Ser3p and Ser33p appear to be the only
enzymes with phosphoglycerate dehydrogenase activity present in
S. cerevisiae. In addition, the previously suggested pathway
for formation of glycine from threonine (1), the threonine pathway,
could not be confirmed. Even if threonine addition reduced the
expression of all SER genes, the ser3
ser33
mutant could neither grow on threonine as sole nitrogen source nor as
supplement to glutamate or ammonium. Hence, the main pathway during
growth on glucose for both serine and glycine biosynthesis seems to be
via Ser3p and Ser33p, i.e. by the phosphoglycerate pathway.
In contrast, our data support the existence of a glucose-repressed
pathway from glyoxylate to serine and glycine (5-8), because the
ser3
ser33
double mutant could grow on ethanol as the
sole carbon source in absence of glycine and serine. Consistently, the
mRNA expression of all genes in the phosphoglycerate pathway (SER1, SER2, SER3, and
SER33) was diminished after glucose depletion, and the
corresponding specific enzyme activities were reduced accordingly.
Deletion of either of the SER3/33 genes did only slightly
affect expression of its isogene and the sum of the specific activities in the single ser3
and ser33
mutants equals
that of the wild-type strain. Both isoenzymes are needed for optimal
growth, as illustrated by the slightly decreased growth rates of both
single mutants. On the other hand, given the fact that Ser3p and Ser33p
are 92% identical and that single deletion only slightly affected
growth, it appears that both proteins have largely redundant functions in the cell under the conditions tested. However, since Ser33p contributes to the major part of the enzymatic activity and that expression of this gene appears to be perfectly co-regulated with that
of SER1 and SER2, Ser33p appears as the main
biosynthetic isoenzyme of the serine/glycine pathway.
Metabolism on Different Nitrogen Sources--
Glycine added to
ammonium as main nitrogen source did not allow growth of the
ser3
ser33
double mutant (Fig. 2), although this
mutant needs either serine or glycine for growth. Ammonium mediates a
strong repression on amino acid transport proteins. The main protein
involved in uptake of glycine is Gap1p (36), and both protein function
and production are repressed in the presence of ammonium ions (37).
Also glutamate decreases the activity of Gap1p (38). The level of
GAP1 expression remains one fifth of that under derepressed
conditions (37). Also other proteins involved in glycine uptake, such
as Agp1p, Tat2p, Dip5, and Put4p, are all under nitrogen catabolite
repression (39). Thus, the effects of nitrogen repression on the uptake
of glycine provide a plausible explanation for the observed inhibited
growth when ammonium was accessible as the main nitrogen source. On the other hand, the level of uptake mediated by Gap1p in presence of
glutamate was sufficient for growth of the double mutant when glutamate
was the main nitrogen source (Fig. 2). In addition to effects on the
uptake system, we cannot exclude the possibility that ammonium ions
repress components involved in the conversion from glycine to serine,
for example the serine hydroxymethyltransferases (Fig. 1). Assimilation
of glycine into serine is catalyzed by the minor isoenzyme, the
mitochondrial Shm1p, together with the glycine cleavage system (3,
4).
Serine and glycine fulfill also a role as sources of one-carbon units
(4). The amounts of serine and glycine, as measured to be present in
yeast cells (15), corresponds to only 32% of the glycine taken up by
the cells (Table III). Thus, the residual glycine taken up must be
converted and is most probably used as one-carbon units. It also seems,
as the opposite is true, i.e. that one-carbon units can
serve as a source for serine and glycine production since addition of
exogenous one-carbon units (as formate, 10 mM) allowed slow
growth of the double mutant on ammonium salt as the nitrogen source
(data not shown). A similar observation has been reported for the
ser1
mutant (3).
Addition of amino acids largely reduced the expression of
SER3. Repression of SER3 mRNA by amino acids
is consistent with that found in rich medium as compared with minimal
medium (34). The promoter of the SER3 gene contains as many
as 8 potential Gcn4p binding sites. Gcn4p is required for stimulated
expression of genes encoding amino acid biosynthetic enzymes in
response to amino acid starvation (35). Hence, amino acid depletion may stimulate expression of SER3 via the Gcn4p pathway.
Effects on Redox Metabolism--
Glycerol production is crucial
during anaerobic conditions in order to reoxidize cytosolic NADH. The
largest source of cytosolic net NADH production is amino acid synthesis
for protein production (15, 40, 41). When glycine is added as an
additional nitrogen source the need for synthesis of glycine and serine
results in less NADH formation via the redox reaction catalyzed by
Ser3/33p. The amount of serine and glycine in biomass (15) corresponds to about 15 mg of glycerol per g of glucose consumed in terms of redox
equivalents (NADH). This is comparable to the decreased level of
glycerol formation observed in the wild-type strain when glycine was
added to the medium (Table III).
When glutamate is used as nitrogen source, its carbon skeleton is
converted to 2-oxoglutarate, succinate and 2-hydroxyglutarate, which
appear as extracellular products (10). This degradation pathway is in
accordance with our data. The ser3
ser33
double mutant
consumed less glutamate than the wild-type strain. The altered yield of
degradation products calculated in the double mutant (
0.068 mmol/g of
glucose) fits with the observed reduced glutamate consumption (
0.061
mmol/g of glucose), which has consequences on the redox metabolism. The
2-oxoglutarate formed is a product of glutamate in transamination
reactions (10, 42, 43), but no NADH formation is expected from these
reactions. In contrast, both the decreased 2-hydroxyglutarate and
increased succinate formation in the double mutant contribute to an
increased production of NADH (Fig. 1), which needs to be reoxidized. In
addition, acetate formation increased in the double mutant. Formation
of acetate from glucose is associated with formation of 1 or 2 NADH/acetate, depending on the use of NADP+- or
NAD+-dependent isoenzymes of aldehyde
dehydrogenase (15, 44). In addition, less glycerol was produced and
consequently almost all observed changes in metabolite formation in the
double mutant compared with the wild type resulted in increased
cytosolic NADH production. The amount of the minor isoenzyme of the
glyceraldehyde phosphate dehydrogenases in S. cerevisiae,
Tdh1p seems to be
redox-regulated.2
Accordingly, the amount of Tdh1p was increased in the ser3
ser33
double mutant indicating an increased cytosolic
NADH/NAD+ ratio. However, since the cells were cultured
under aerobic conditions, the surplus of NADH formed, both
cytosolically and/or in the mitochondria (45, 46), should not create a
redox problem since it can still be reoxidized in the respiratory
chain. This is also reflected by a relatively non-affected growth rate
of the double mutant. In fact, the slightly increased biomass
formation, and the simultaneously decreased ethanol and glycerol
production in the double mutant as compared with the wild type,
indicates an increased oxidative metabolism in the former.
Hydroxyglutarate Dehydrogenase Activity--
Enzyme activity
measurements did not indicate that Ser3p or Ser33p might have the
sought hydroxyglutarate dehydrogenase activity, but still the
ser3
ser33
double mutant formed only traces of 2-hydroxyglutarate. However, the amount of 2-hydroxyglutarate found
extracellularly reflects the balance between formation and consumption.
Hence, the ser3
and ser33
mutations may
indirectly enhance the degradation of 2-hydroxyglutarate. We have
previously found that yeast cells are able to consume
2-hydroxyglutarate added to the medium (47), but no degradation
pathways have yet been suggested in the literature. It appears that yet
unidentified enzyme(s) are responsible for 2-hydroxyglutarate formation
during glucose growth, since the alternative enzymes investigated in this study (Ynl274p, Ypl113p, and Ygl185p) are all
glucose-repressed.