![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 12, 10824-10830, March 21, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, August 14, 2002, and in revised form, January 12, 2003
Hepatocellular carcinoma (HCC) is a major
malignancy in many parts of the world, especially in Asia and Africa.
Loss of heterozygosity (LOH) on the long arm of chromosome 13 has been
reported in HCC. In search of tumor suppressor genes in this region,
here we have identified DLC2 (for deleted in
liver cancer 2) at 13q12.3 encoding a novel Rho family GTPase-activating protein (GAP). DLC2
mRNA is ubiquitously expressed in normal tissues but was
significantly underexpressed in 18% (8/45) of human HCCs.
DLC2 is homologous to DLC1, a previously
identified tumor suppressor gene at 8p22-p21.3 frequently deleted in
HCC. DLC2 encodes a novel protein with a RhoGAP domain, a
SAM (sterile Hepatocellular carcinoma
(HCC)1 is a major malignancy
worldwide and is particularly prevalent in Asia and Africa, being one of the most common causes of mortality (1). Risk factors for HCC,
including infection with hepatitis B or C virus and exposure to
aflatoxin B1, have been well documented (1). However, the molecular
events leading to the development and progression of HCC remain elusive.
Clonal expansion of genetically modified cells with inactivated tumor
suppressor genes is a hallmark of cancer (2). One major challenge in
HCC research is the identification and characterization of tumor
suppressors whose inactivation alters major cellular signaling
pathways. The delineation of the mechanisms for hepatocarcinogenesis is
of importance, because it provides novel opportunities for diagnosis,
prognosis, and therapeutic interventions.
The dysregulation of p53, Rb, c-myc, and Wnt signaling
through epigenetic changes and somatic mutations has been implicated in
some cases of HCC (3-9). However, a number of independent studies
based on comparative genomic hybridization, spectral karyotyping, and
microsatellite analyses for loss of heterozygosity (LOH) have provided
strong evidence for the inactivation of additional tumor suppressors in
HCC (8-18). In particular, deletions on chromosome 13q have been found
to be rather common (9, 12-18), but a definite gene target in this
region has not been identified.
GTPases of the Rho family are members of the Ras superfamily of small
GTP-binding proteins that act as molecular switches to regulate various
cellular signaling pathways (19, 20). The Rho family has 18 members so
far. Rac1, RhoA, and Cdc42 are three representative and well-studied
Rho proteins showing distinct functions. Rho proteins control actin
cytoskeleton and influence cell proliferation and survival. These
functions implicate Rho proteins as key regulators in oncogenic
transformation mediated by Ras and other oncoproteins (21, 22). In
addition, Rho proteins also stimulate tumor cell invasion and
metastasis (20). Balancing the oncogenic potential of Rho proteins are
Rho GTPase-activating proteins (GAPs) that activate the intrinsic
GTPase activity of Rho proteins and switch them off by converting the
active GTP-bound state to the inactive GDP-bound state. Notably, a
candidate tumor suppressor gene at chromosome 8p22-p21.3, which has
been shown to be frequently deleted in HCC tissue samples and cell
lines (23, 24), contains a putative RhoGAP domain. The re-introduction of this gene termed DLC1 (deleted in
liver cancer 1) exerts inhibitory effects on the proliferation of DLC1-defective hepatoma cell
lines (24). However, it is not understood whether DLC1 has RhoGAP activity. Nor is it clear exactly how DLC1 suppresses cell growth and proliferation.
In search for candidate tumor suppressor loci on chromosome 13q, here
we identified a novel gene DLC2 at 13q12.3. DLC2 is apparently a DLC1 homolog. Interestingly, DLC2 is
underexpressed in HCC tissues. We provide the first evidence that DLC2
has GAP activity specific for RhoA and Cdc42. We demonstrate that the GAP domain of DLC2 inhibits the Rho-mediated assembly of actin stress
fibers in cultured cells. In addition to the RhoGAP domain, DLC2 also
contains a SAM domain related to p73/p63, and a lipid-binding START
domain. Finally, we show that DLC2 counteracts Ras signaling and Ras
transformation likely through inhibition of RhoA and Cdc42. Taken
together, our data implicate the involvement of a particular subfamily
of RhoGAP proteins in hepatocarcinogenesis.
Patients and Tumor Samples--
Forty-five Chinese patients who
had had surgical resection of the tumors at the University of Hong Kong
Medical Center were randomly selected for study. Paired samples of
their HCCs and corresponding non-tumorous liver tissues were used. The
patients' ages ranged from 29 to 74 years (mean: 55.6 years).
Thirty-three were men and 12 were women. The tumor ranged from 1.5 to
27 cm in size (mean: 7.6 cm), with 16 (35.9%) of them being
All specimens were obtained immediately after surgical resection,
snap-frozen in liquid nitrogen, and kept at Cloning of DLC2 Gene--
DLC2 is a previously
unidentified gene located at human chromosome 13q12.3. The full-length
DLC2 cDNA was assembled from expressed sequence tag
clones using the DLC2 genomic sequence
(GenBankTM accession numbers Z92540, AL139187, and Z84483)
as a reference. DLC2 genomic clones from human PAC libraries
were obtained from the Sanger Center, UK. Primers
5'-CCGGATCCGGACAGCCCCTGCCTCAA-3' (forward) and
5'-CCGAATTCTCATTTCTTCAATAAATTAAGATG-3' (reverse) were used to
PCR-subclone the GAP-coding sequences of DLC2. DLC2-GAP corresponds to amino acids 673-826 of DLC2. A point mutant of DLC2-GAP
designated R699A was generated through site-directed mutagenesis using
primer 5'-GGTGGGTCTTTTTGCCAAATCAGGAGTGAAG-3'. This R699A
mutant has alanine in place of arginine at position 699 corresponding
to the full-length sequence of DLC2, thereby dominantly inactivating
the GAP activity. All constructs were confirmed by DNA sequencing.
Northern Blot Analysis--
Multiple tissues Northern blot was
purchased from Clontech (Palo Alto, CA). The
hybridization was performed according to the manufacturer's protocol.
A PCR fragment amplified with primers 5'-CTTTCTATTGAAAGCCTCTCTCC-3'
(forward) and 5'-ATCCCTCCTGTCTCTGACC-3' (reverse) was used as probe.
LOH Studies with 13q Markers--
Two polymorphic microsatellite
markers, D13S171 and D13S267, which flank the DLC2 locus on
both sides and are located at 13q12.3-13q13, were used for LOH
analyses. PCR using these two microsatellite markers was performed on
the DNA extracted from the fresh frozen blocks of HCCs and the
corresponding non-tumorous livers, as previously described (25). PCR
products were then analyzed on a model 377 automatic DNA sequencer
(Applied Biosystems, Foster City, CA) according to the manufacturer's
instructions, and the results were analyzed with Genotyper software
(Applied Biosystems). Cases were defined as LOH when an allele peak
signal from tumor DNA was reduced by 50% compared with their
corresponding non-tumorous liver, as we described previously (25).
RT-PCR--
Total RNA was extracted from HCC and their
corresponding non-tumorous livers from with TRIzol reagent as described
by the manufacturer (Invitrogen, Gaithersburg, MD). cDNA was
synthesized from 1 µg of total RNA by using oligo(dT)16
as primer and with GeneAmp RNA PCR kit (Applied Biosystems, Foster
City, CA). PCR amplification using a set of primers (forward: 5'-AGC
CCC TGC CTC AAA GTA TT-3', reverse: 5'-ATG GGC GTC ATC TGA TTC TC-3') was performed to give a product of 403 bp (from nucleotide 2021 to
nucleotide 2423), which covered most of the GAP domain of
DLC2. A fragment of Phylogenetic Analysis--
Phylogenetic analysis of DLC2-related
proteins was performed using the PHYLIP software package version 3.6 (available at evolution.genetics.washington.edu) as previously
described (26, 27).
Focus Formation Assay--
Focus formation assay was carried out
as described previously (28, 29). Briefly, NIH3T3 cells were
co-transfected with DLC2-GAP or DLC2-GAP-R699A plasmid (900 ng) plus
pUSE-RasV12 construct (Upstate Biotechnology) (100 ng) or plus pRSVvJun
(100 ng) using the LipofectAMINE 2000 reagent (Life Technologies).
Plasmid pRSVvJun has been described elsewhere (30, 31). Cells were
selected in medium containing 800 µg/ml G418 after 24 h, and the
number of foci was scored after 14-21 days.
GTPase Activity Assay--
GTPase activity was assayed as
described previously (32). Briefly, GST fusion forms of Rac1, Cdc42,
and RhoA proteins were purified and digested with thrombin to release
the small G-proteins. Purified GST-free small G-proteins (1 µM) were preloaded with [ Protein Purification--
GST fusion protein was purified as
described previously (29, 34). The protein was eluted with 10 mM reduced glutathione and dialyzed in low salt buffer (10 mM Tris, pH 7.6, 2 mM MgCl2, and
0.1 mM DTT) overnight. Thrombin digestion was performed to cleave the fusion proteins. The excess thrombin was removed by p-aminobenzamidine-Sepharose (Amersham Biosciences), and the
quality of the GST-free proteins was verified on SDS-PAGE gels stained with Coomassie Blue. All purified proteins are of over 85% homogeneity.
Luciferase Assay--
Luciferase activity recovered from
extracts of transiently transfected NIH3T3 cells was assayed as
previously described (34). The reporter plasmid pSRE-luc was from
Stratagene (La Jolla, CA). This plasmid contains five copies of the SRE
element (AGGATGTCCATATTAGGACATCT) in the promoter that drives the
expression of firefly luciferase.
Immunofluorescence Microscopy--
Laser-scanning confocal
microscopy was performed using a Zeiss Axiophot microscope as
previously described (29, 34). Dual immunofluorescent detection was
achieved with primary antibodies from two species coupled to
pre-absorbed species-specific secondary antibodies. The primary
antibodies are a mouse monoclonal antibody against Identification of Human DLC2--
LOH studies from many
independent groups have strongly suggested the existence of
HCC-associated tumor suppressor loci on chromosome 13q (9, 12-18). In
particular, a small commonly deleted region harboring one or more tumor
suppressors has been mapped to 13q12.3 in close proximity to the
BRCA2 locus, and a microsatellite marker D13S171 telomeric
to BRCA2 has been widely used in the definition of this
small region (13-15). To search for candidate tumor suppressor in this
region, we identified a novel gene designated DLC2
(deleted in liver cancer
2) due to striking homologies to DLC1 at
8p22-p21.3, a frequently deleted locus in HCC (23, 24). Thus,
DLC2 was chosen to be further characterized because it
localizes to a small region of 13q12.3 commonly deleted in HCC, it is
homologous to DLC1, and it encodes a putative RhoGAP protein
that down-regulates Rho family GTPases.
The physical mapping of DLC2 in human genome has been
determined (available at www.ncbi.nlm.nih.gov). The relative positions of DLC2 and the adjacent KL and RFC3
loci (Fig. 1A) were confirmed independently by PCR analysis and by restriction mapping (data not
shown). The human DLC2 gene spans ~182 kb, and it contains 14 coding exons (Fig. 1B). Data base searches for expressed
sequence tag clones that match the DLC2 genomic sequences
generated several cDNAs, and these cDNA clones were obtained
from the American Type Culture Collections (Manassas, VA) to assemble a
DLC2 cDNA containing the complete coding sequences. The
assembled 5886-bp DLC2 cDNA (GenBankTM
AY082589) encodes an open reading frame of 1114 amino acids with a
predicted molecular size of 125 kDa. An in-frame stop codon is found
immediately upstream the initiating ATG.
To assess the expression patterns of DLC2 in human tissues,
we performed Northern blot analysis using an internal fragment of the
DLC2 cDNA as probe (Fig. 1C). Two
DLC2 transcripts of 7.2 and 4.2 kb in size were detected in
all tissues tested, but they were more abundant in heart, skeletal
muscle, kidney, and pancreas. Although the existence of other
DLC2 isoform(s) cannot be ruled out, these two transcripts
likely represent the major alternatively spliced variants of
DLC2.
LOH at 13q12.3 and Underexpression of DLC2 in Human HCC
Tissues--
In an attempt to assess the status of allelic losses at
chromosome 13q12.3, HCC samples from 45 patients were analyzed. The heterozygosity values of microsatellite markers D13S171 and D13S267 in
our cases were 0.73 (33/45) and 0.60 (27/45), respectively. Of those
informative loci, allelic losses at D13S171 and D13S267 were detected
in 33.3% (11/33) and 40.7% (11/27) of the informative cases,
respectively. Among the 45 cases examined, 39 cases were informative
and 15 cases (38.5%) showed allelic losses at either one or both loci
(Fig. 2A).
The localization of DLC2 to chromosome 13q12.3 prompted us
to examine its expression in human HCC tissues. To this end, we carried
out RT-PCR to detect DLC2 mRNA in the 45 cases of human HCC having LOH analysis performed. Notably, 8 (17.8%) of the 45 cases
showed significant underexpression (more than 2-fold) of DLC2 mRNA when compared with the corresponding
non-tumorous liver tissues from the same patients (Fig. 2B).
Thus, DLC2 is commonly underexpressed in HCC.
DLC2 Is a Multifunctional Protein with RhoGAP Activity--
DLC2
contains multiple domains highly relevant to its putative tumor
suppressor function (Fig. 3A).
At the amino acid sequence level DLC2 shares 51% identity and 65%
similarity with DLC1. One of most conserved regions between DLC1 and
DLC2 locates in the RhoGAP domain (residues 677-826) where 80%
residues are identical (Fig. 3B). Plausibly, this degree of
conservation suggests that DLC1 and DLC2 may serve related functions in
tumor suppression. A phylogenetic analysis of DLC2-related sequences
(Fig. 3C) lends further support to the notion that DLC1 and
DLC2 represent a separate and evolutionarily conserved group of GAP
proteins distinct from other GAP proteins such as Macgap or
n-chimerin.
Four domains or motifs can be identified in the DLC2 sequence (Fig.
3A). First, DLC2 conserves a RhoGAP domain (35) closely related to that of DLC1 and of other proteins (Fig. 3B).
Thus DLC2 is predicted to show GAP activity on Rho family small
GTPases. Second, it has a SAM domain at the N terminus. SAM domains
have been found in p53-related proteins p73 and p63, protein kinases such as Eph receptor, Ets transcription factors, as well as other signaling proteins (36, 37). The SAM domain has been thought to
function as a protein interaction module through homo- and hetero-oligomerization with other SAM domains (36, 37). Third, DLC2
processes a START domain at the C terminus. START is a lipid-binding domain present in StAR, HD-ZIP, and other proteins (38, 39). Finally,
an ATP/GTP-binding site was identified in residues 322-329 of DLC2.
Plausibly, the RhoGAP domain has catalytic activity and the other
structures may serve regulatory functions.
To establish the RhoGAP activity of DLC2, we performed in
vitro GAP assays using recombinant proteins. A full-length DLC2 protein was bacterially expressed as GST fusion and affinity-purified through glutathione-agarose (Fig.
4A, lane 2).
Purified GST and DLC2 proteins were tested for GAP activity on GST-free
RhoA (Fig. 4B), Rac1 (Fig. 4C), and Cdc42 (Fig.
4D). Interestingly, DLC2 stimulated not only GTP hydrolysis
of RhoA, but also of Cdc42 (Fig. 4, B and D).
However, DLC2 poorly activated the GTP hydrolysis of Rac1 if compared
with n-chimerin (Fig. 4C), a known stimulator of
Rac1 (33). DLC2 did not activate another small G-protein Ras (data not
shown).
DLC2-GAP Suppresses Ras Signaling and Ras-induced Cellular
Transformation--
A growing body of evidence has suggested that
small GTPases of the Rho family are critically involved in the
regulation of cytoskeleton and metastasis of cancer cells (19-22). It
is noteworthy that some GAP proteins, such as neurofibromin 1, which
has RasGAP activity, are well-known tumor suppressors (40). The
demonstration of the RhoGAP activity of DLC2 (Fig. 4) prompted us to
investigate the influence of DLC2 in cell signaling. Specifically, we
asked whether the expression of DLC2 would suppress Ras- and
Rho-mediated oncogenic signaling and cellular transformation. However,
the full-length DLC2 protein could not be stably overexpressed in cultured mammalian cells (data not shown) probably due to cytotoxicity. This observation is consistent with a previous finding that rat DLC1
cannot be stably overexpressed in adherent cells, because it induces
morphological changes and cell detachment (41).
To resolve the above issue and to explore the significance of the
RhoGAP activity of DLC2 to its cellular functions, we performed functional studies in cultured cells using a truncated form of DLC2,
which contains the intact RhoGAP domain. This form of DLC2, designated
DLC2-GAP, can be efficiently expressed both in Escherichia coli (Fig. 5A) and in
cultured mammalian cells. DLC2-GAP exhibits GAP activity on Cdc42 (Fig.
5B) as potent as the DLC2 full-length protein (Fig.
4D). First we wished to assess the influence of DLC-GAP on
Ras signaling, because Ras has been well documented for its oncogenic
property (42) and because Ras induces cell transformation partly
through the activation of RhoA and Cdc42 (19-22). SRE represents one
effector of Ras (43) and is efficiently activated by RasV12, a dominant
active mutant of Ras (Fig. 5C, compare column 2 to column 1). We observed that DLC2-GAP specifically repressed the RasV12-induced activation of SRE-dependent
luciferase reporter activity (Fig. 5C, compare column
3 to column 2). This repression was absolutely
dependent on the GAP activity, because the R699A mutant of DLC2-GAP,
which did not show any GAP activity (Fig. 5B), did not
influence the RasV12 activation of SRE (Fig. 5C, compare
column 4 to columns 2 and 3). DLC2-GAP
had GAP activity on Cdc42 (Fig. 5B) and more mildly on Rac1
(data not shown), but it did not show appreciable GAP activity on Ras
(Fig. 5D) or RhoA (data not shown) in the in
vitro assay. RhoA, Rac1, and Cdc42 have previously been shown (43)
to activate transcription by serum response factor. Among them, RhoA,
but not Rac1 and Cdc42, is required for the stimulation of serum
response factor by serum, lysophosphatidic acid, and
AlF
Rho GTPases are well known activators of the actin cytoskeleton (19).
In particular, RhoA plays a pivotal role in cytoskeletal reorganization
and the formation of actin stress fibers (19, 44). As a functional
RhoGAP protein, rat DLC1 has been shown to induce disassembly of stress
fibers and the morphological rounding of various adherent cells (41).
To assess the functional status of DLC2-GAP in the cell, we expressed
HA-tagged DLC2-GAP in HeLa cells and co-stained for HA and
Next we asked whether DLC2-GAP suppressed Ras-induced cellular
transformation. NIH3T3 cells were induced by RasV12 to form foci (Fig.
7B, compare column
2 to column 1), which is a characteristic property of
transformed cells. When DLC2-GAP was co-transfected with
RasV12, significantly less number of foci was observed compared with
the vector control or the DLC2-GAP R699A mutant that has lost the
RhoGAP activity (Fig. 7, A and B, compare
column 4 to columns 2 and 3). In
contrast, the expression of DLC2-GAP did not affect the formation of
transformed foci induced by v-Jun (Fig. 7B, columns
5 and 6), a viral oncoprotein recovered from avian
sarcoma virus 17 (30). Our interpretation to the specific suppression
of Ras-induced transformation of NIH3T3 cells is that DLC2-GAP acts
through inactivating the RhoA and/or Cdc42 activity.
This study has established the growth suppressor function of DLC2
and the underexpression of DLC2 in human HCC tissues. We have shown that DLC2 at chromosome 13q12.3 (Fig. 1) encodes
a novel RhoGAP protein (Fig. 3) exhibiting specific GAP activity on
RhoA and Cdc42 (Fig. 4) and is underexpressed in HCC (Fig. 2). In
addition, DLC2 suppresses Ras activation of SRE (Fig. 5), inhibits
Rho-mediated cytoskeletal reorganization (Fig. 6), and counteracts
Ras-mediated cellular transformation in a GAP-dependent manner (Fig. 7).
Allelic loss on chromosome band 13q12.3 has been frequently detected in
human HCC as well as in other cancers. However, the putative tumor
suppressor gene targets for allelic loss in this region have not yet
been identified. DLC2 is located at 13q12.3, flanked by
microsatellite markers D13S171 and D13S267. Our results indicate that
LOH on these two markers were frequently found in HCC (33 and 41%).
Southern blotting analysis performed on some of the cases showing LOH
with the two microsatellite markers confirmed heterozygous deletion of
DLC2 gene (data not shown). These indicate that allelic loss at 13q12.3
where DLC2 is harbored is common in human HCCs. Moreover,
DLC2 was underexpressed at mRNA level in 18% of the
human HCC samples. The significant underexpression of DLC2
in human HCC samples compared with the corresponding non-tumorous livers implies that DLC2 may be a putative tumor suppressor
important in hepatocarcinogenesis. It is noteworthy that we cannot
establish a statistically significant correlation between the
underexpression of DLC2 mRNA and LOH on the two
microsatellite markers. Some cases that did not show LOH had reduced
expression of DLC2. These results suggest that in addition
to allelic loss, other factors such as promoter hypermethylation might
also contribute to the underexpression of DLC2 gene. Further
investigations into the genetic and epigenetic alterations of
DLC2 are warranted in this regard.
DLC2 contains multiple functional domains, including SAM, RhoGAP, and
START, which may be important for its regulation. Little information is
available for the function of START domain apart from that it can bind
lipids and target proteins to membrane (38). Although the exact role of
this domain in the regulation of DLC2 protein remains to be elucidated,
it is tempting to speculate that the START domain is responsible for
the recruitment of DLC2 to the membrane, where the substrates for its
GAP activity are localized. Moreover, binding of one or more lipids to
START may provide a mechanism to regulate the GAP activity of DLC2,
analogous to the enhancement of GAP activity in n-chimerin
through phospholipid binding to a protein kinase C-like domain
(46).
DLC2 can stimulate the GTP hydrolysis of small GTPases RhoA and Cdc42
(Fig. 4, B and D). The full-length DLC2 protein
also exhibits relatively low GAP activity on Rac1 (Fig. 4C).
We noted that the truncated DLC2-GAP protein has a moderate GAP
activity on Rac1 but it poorly stimulates the GTP hydrolysis of RhoA in our assay (data not shown). We hypothesized that this
discordance might be caused by conformational change of the
recombinant DLC2-GAP protein, possibly induced during the process of
purification. Nevertheless, our findings that the expression of
DLC2-GAP in cells has an impact on SRE activation (Fig. 5C),
cytoskeletal reorganization (Fig. 6), and transformation (Fig. 7)
consistently support the notion that DLC2-GAP and DLC2 function as
RhoGAP in vivo.
It is generally accepted that Rho family proteins are involved in cell
transformation; the molecular events for this process are, however, not
well defined. The dissection of the signaling pathway is hampered by
the cross-talk between the Rho family members and by the limited
information available for the downstream effectors. For example, the
most common effector for Rac and Cdc42 is p21-activating kinase (PAK)
1, which does not induce transformation. However, a recently identified
group II PAK family member, called PAK4, is able to induce
transformation and is overexpressed in a large number of tumor cell
lines (47). Interestingly, PAK4 is more preferentially activated by
Cdc42 (48). We noted that DLC2 selectively activated the GTP hydrolysis
of Cdc42 (Figs. 4 and 5). This raised the possibility that PAK4 is a
direct target for DLC2 signaling. Further experiments are undergoing to
test this hypothesis.
Interactions between SAM domains are known to mediate homo- and
hetero-oligomerization of proteins (36, 37). Notably, the
oligomerization of SAM domain has recently been implicated in
leukemogenesis and transcriptional repression (49). In this context, it
would be of interest to elucidate whether SAM domain in DLC2 would be
used for self-association and for interaction with other partners,
including DLC1. A better understanding of DLC2 function in liver
physiology and pathology requires a clear definition of the structural
basis of SAM domain association and interaction.
Ras, Rho, and Rho-associate protein kinase have previously been
implicated in the development and metastasis of HCC (50, 51). Our
demonstration of a novel RhoGAP protein as a candidate tumor suppressor
in HCC supports the critical involvement of Rho signaling in
hepatocarcinogenesis. Interestingly, GTPase-defective mutants of Rho
proteins have not been identified in tumors, whereas many RhoGEF
proteins have been isolated as oncogenes (20). Countering the effects
of RhoGEF are various RhoGAP proteins. The variety of RhoGAP proteins
may provide the versatility and specificity for fine-tuning Rho GTPase
activity in an orderly and timely fashion. Thus, it is not surprising
that a particular RhoGAP may function as a tumor suppressor. Our
findings corroborate the notion that the cycling of Rho proteins
between the GTP- and GDP-bound states represents a critical point for
growth control and for cellular transformation.
We thank S. Gutkind, L. Lim, M. Karin, and
the Sanger Center for clones and reagents and W. H. Lee and A. Hall for helpful comments and suggestions.
*
This work was supported in part by a grant (to I. O.-L. N.
and D. Y. J.) from the Hong Kong Research Grants Council (Project HKU
7281/01M).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY082589.
§
Both authors contributed equally to this work.
**
A Leukemia and Lymphoma Society Scholar.
Published, JBC Papers in Press, January 16, 2003, DOI 10.1074/jbc.M208310200
The abbreviations used are:
HCC, hepatocellular
carcinoma;
GAP, GTPase-activating protein;
LOH, loss of heterozygosity;
SAM, sterile
Deleted in Liver Cancer (DLC) 2 Encodes a RhoGAP
Protein with Growth Suppressor Function and Is Underexpressed in
Hepatocellular Carcinoma*
§,
,
,
**
, and
Institute of Molecular Biology, the
¶ Department of Pathology, and the
Department of
Biochemistry, University of Hong Kong, Hong Kong, China
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
motif) domain related to p73/p63, and a lipid-binding
StAR-related lipid transfer (START) domain. Biochemical analysis
indicates that DLC2 protein has GAP activity specific for small GTPases
RhoA and Cdc42. Expression of the GAP domain of DLC2 sufficiently
inhibits the Rho-mediated formation of actin stress fibers.
Introduction of human DLC2 into mouse fibroblasts
suppresses Ras signaling and Ras-induced cellular transformation in a
GAP-dependent manner. Taken together, our findings suggest
a role for DLC2 in growth suppression and hepatocarcinogenesis.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
5 cm in diameter. Seventeen (37.8%) of the tumors were at earlier stages (tumor, node, and metastasis (TNM) stages I and II), and the
remaining 64.4% were at more advanced stages (TNM stages III
and IV). The serum was positive for hepatitis B surface antigen (HBsAg)
in 26 (80%) patients.
70 °C. Frozen sections
were cut from the tumor and non-tumorous liver blocks separately and
stained for histological examination to ensure homogeneous cell
populations of tissues.
-actin was amplified as control. The
PCR reaction was performed in a 9700 thermocycler (PerkinElmer Life
Sciences). The PCR was stopped at the exponential phases, 30 cycles for
DLC2 and 22 cycles for
-actin, with one cycle of
hot-start at 95 °C for 12 min, followed by amplification at 94 °C
for 30 s, 55 °C for 30 s, 72 °C for 45 s, and a
final elongation at 72 °C for 10 min. The PCR products were analyzed
by electrophoresis on 1.5% agarose gels, and their signal intensities
were measured by GelWorks 1D Intermediate Software (UVP).
Significant underexpression was defined when the ratio of
DLC2 mRNA of the tumor to that of the corresponding
non-tumorous liver was <0.5 after normalization with
-actin.
-32P]GTP (600 Ci/mmol) in GTP loading buffer (20 mM Tris-HCl, pH 7.6, 0.1 mM DTT, 25 mM NaCl, and 4 mM EDTA)
for 10 min at 30 °C. The preloaded small GTPase protein was diluted
with dilution buffer (20 mM Tris-HCl, pH 7.6, 0.1 mM DTT, 1 mM GTP, 1 mg/ml bovine serum
albumin), and the hydrolysis was initiated by addition of DLC2 (0.25 µM) or GST (0.25 µM). The samples were then
spotted onto filters and washed with 20 ml of cold assay buffer, and
the radioactivity was determined by scintillation counting.
n-Chimerin, a known activator of Rac (33), was used as a
positive control in the assay. The expression plasmid for
n-chimerin has been described (33).
-actin (ZSA1 from
Zymax) and rabbit polyclonal antibodies against HA (Y-11 from Santa
Cruz Biotechnology). The secondary antibodies are Cy5-conjugated goat
anti-mouse immunoglobulin G (Zymax) and fluorescein-conjugated goat
anti-rabbit immunoglobulin G (Zymax). Plasmid pHM6 (Roche Molecular
Biochemicals) was used for expression of DLC2-GAP in HeLa cells.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (52K):
[in a new window]
Fig. 1.
Genomic characterization of human
DLC2. A, chromosomal map location of
human DLC2 at 13q 12.3. Arrows underneath the
gene symbols indicate the orientation of transcription.
RFC3, replication factor C subunit 3; KL, Klotho;
AS3, androgen shutoff 3; BRCA2, breast cancer 2, early onset; Tel, telomeric; Cen, centromeric.
B, genomic organization of human DLC2 locus.
Non-coding (open boxes) and coding (filled boxes)
are shown. C, Northern blot analysis of DLC2 in
human tissues. To normalize for differences in RNA loading, the same
blot was also probed for
-actin after stripping the DLC2
signal.

View larger version (39K):
[in a new window]
Fig. 2.
LOH and RT-PCR results. A, a
representative case showing LOH with both microsatellite markers
D13S171 and D13S267. B, cases of HCCs with significant
underexpression of DLC2 are shown. Significant
underexpression was defined when the ratio of DLC2 mRNA
of the tumor to that of the corresponding non-tumorous liver was <0.5
after normalization with
-actin. T, tumor; NT,
non-tumorous liver.

View larger version (38K):
[in a new window]
Fig. 3.
DLC2 is a novel multifunctional protein with
a RhoGAP domain. A, diagram of protein domains in DLC2.
SAM, sterile alpha motif; ATP/GTP binding,
ATP/GTP-binding site motif A; GAP, RhoGAP domain;
START, StAR-related lipid transfer domain. B,
sequence alignment of RhoGAP domains from representative DLC2-related
proteins. Perfect matches and conservative substitutions are
boxed in black and gray, respectively.
The conserved arginine residue at position 699 of DLC2 is highlighted
(#). C, consensus phylogenetic tree relating DLC2 to other
GAP proteins. Phylogenies were inferred from protein sequences using
parsimony. Bootstrap replication was performed and the majority rule
consensus tree was generated from 100 replicates. The
numbers are bootstrap confidence probabilities (%).
GenBankTM identification numbers of the aligned
sequences are: mouse DLC1: 7656902; human DLC1: 18571106; rat DLC1:
1083784; mouse DLC2: 14422213; KIAA0189: 17644266; fruit fly RE02250p:
18447379; fruit fly CG8480: 7299877; Macgap: 15723376;
n-chimerin: 399249.

View larger version (24K):
[in a new window]
Fig. 4.
GAP activity of DLC2. Recombinant DLC2
purified from E. coli was assessed on SDS-PAGE gel
(A). GST and DLC2 were added to a GAP assay containing RhoA
(B), Rac1 (C), or Cdc42 (D). The
reactions contain GTPase alone (
), GTPase plus GST (
), GTPase
plus DLC2 (
), or GTPase plus n-chimerin (×). The basal
activity due to spontaneous conversion of RhoA, Rac1, and Cdc42
proteins from GTP- to GDP-bound status has been previously documented
(52, 53). Results are representative of three independent experiments.
Chi., n-chimerin.


View larger version (35K):
[in a new window]
Fig. 5.
DLC2-GAP-dependent suppression of
Ras signaling. A, production of recombinant
GST-DLC2-GAP protein. The purity of GST (lane 1) and
GST-DLC2-GAP proteins was assessed by SDS-PAGE. DLC2-GAP corresponds to
amino acids 673-826 of DLC2. B, GAP activity on Cdc42. GAP
activity was assayed as in Fig. 5D using wild-type DLC2-GAP
(
) and mutant DLC2-GAP-R699A (×). C, DLC2-GAP inhibition
of Ras-mediated activation of SRE. NIH3T3 cells were co-transfected
with pSRE-luc (column 1), pSRE-luc + RasV12 + pHM6 empty
vector (column 2), pSRE-luc + RasV12 + wild-type DLC2-GAP
(column 3), or pSRE-luc + RasV12 + DLC2-GAP-R699A mutant
(column 4). Results represent three independent experiments.
D, GAP activity on Ras. GAP activity was assayed as in Fig.
5 using GST-Ras alone (
), GST-Ras + GST (
), and GST-Ras + GST-DLC2-GAP (
).
-actin (Fig. 6). DLC2-GAP was abundantly expressed without inducing notable cytotoxic effects (Fig.
6, panel 1, note cell with an arrow). However,
the formation of actin stress fibers in the DLC2-GAP-expressing cells
was significantly inhibited if compared with non-transfected cells
(Fig. 6, panels 2 and 3, see the cell with an
arrow for an ~60% inhibition compared with cells with
no arrow; computer-aided quantitation of the intensities of
-actin-specific fluorescent signal in 200 transfected cells versus 200 untransfected cells indicates a 53.8 ± 4.6% inhibition of stress fiber formation by DLC2-GAP). In sharp
contrast, the expression of the RhoGAP-defective DLC2-GAP R699A mutant
had no effect on stress fiber formation (Fig. 6, panels 5 and 6, cells highlighted by arrow).
This GAP-dependent inhibition of Rho-mediated cytoskeletal
reorganization by DLC2-GAP suggests that DLC2 might function as a
RhoGAP in vivo.

View larger version (106K):
[in a new window]
Fig. 6.
Inhibition of stress fiber formation by
DLC2-GAP. HeLa cells were transfected, respectively, with plasmids
expressing HA-tagged DLC2-GAP (panels 1-3) and DLC2-GAP
R699A mutant (panels 4-6). Cells were serum-starved for
18 h and a complete medium with 10% fetal calf serum was
re-supplied to stimulate stress fiber formation for 1 h. Cells
were fixed 42 h after transfection and co-stained with rabbit
anti-HA (panels 1 and 4) and mouse anti-
-actin
(panels 2 and 5). The DLC2-GAP (red;
probed with anti-HA) and
-actin (green) fluorescent
signals were overlaid by computer assistance (panels 3 and
6). The same fields are shown in panels 1-3 and
4-6. Arrows indicate transfected cells. The
patterns shown represent 76 and 68%, respectively, of 200 transfected
cells. Computer-aided quantitation of the intensities of
-actin-specific fluorescent signal in 200 transfected cells
versus 200 untransfected cells indicates a 53.8 ± 4.6% inhibition of stress fiber formation by DLC2-GAP. Bar,
20 µm.

View larger version (86K):
[in a new window]
Fig. 7.
DLC2-GAP-dependent suppression of
Ras-induced transformation. A, examples of focus
formation assays. NIH3T3 cells were transfected with RasV12 plus
DLC2-GAP (panel 1) or RasV12 plus DLC2-GAP-R699A
(panel 2). B, DLC2-GAP suppresses RasV12-induced
formation of transformation foci. NIH3T3 cells were transfected with
empty vectors pUSE + pHM6 (column 1), RasV12 + pHM6
(column 2), RasV12 + DLC-GAP-R699A (column 3),
RasV12 + DLC-GAP (column 4), pRSVvJun + pHM6 (column
5), or pRSVvJun + DLC-GAP (column 6). Results represent
three independent experiments.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES

To whom correspondence should be addressed. Tel.:
852-2855-4197; Fax: 852-2872-5197; E-mail: dyjin@hkucc.hku.hk or
iolng{at}hku.hk.
![]()
ABBREVIATIONS
motif;
HA, hemagglutinin;
START, StAR-related lipid
transfer domain;
RT, reverse transcription;
GST, glutathione
S-transferase;
DTT, dithiothreitol;
PAK, p21-activating
kinase;
SRE, serum-response element.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Bosch, F. X.
(1997)
in
Liver Cancer
(Okuda, K.
, and Tabor, E., eds)
, pp. 13-28, Churchill Livingston, New York
2.
Lengauer, C.,
Kinzler, K. W.,
and Vogelstein, B.
(1998)
Nature
396,
643-649[CrossRef][Medline]
[Order article via Infotrieve]
3.
Scorsone, K. A.,
Zhou, Y. Z.,
Butel, J. S.,
and Slagle, B. L.
(1992)
Cancer Res.
52,
1635-1638 4.
Ng, I. O. L.,
Chung, L. P.,
Tsang, S. W.,
Lam, C. L.,
Lai, E. C. S.,
Fan, S. T.,
and Ng, M.
(1994)
Oncogene
9,
985-990[Medline]
[Order article via Infotrieve]
5.
de La Coste, A.,
Romagnolo, B.,
Billuart, P.,
Renard, C. A.,
Buendia, M. A.,
Soubrane, O.,
Fabre, M.,
Chelly, J.,
Beldjord, C.,
Kahn, A.,
and Perret, C.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8847-8851 6.
Wong, C. M.,
Fan, S. T.,
and Ng, I. O. L.
(2001)
Cancer
92,
136-145[CrossRef][Medline]
[Order article via Infotrieve]
7.
Satoh, S.,
Daigo, Y.,
Furukawa, Y.,
Kato, T.,
Miwa, N.,
Nishiwaki, T.,
Kawasoe, T.,
Ishiguro, H.,
Fujita, M.,
Tokino, T.,
Sasaki, Y.,
Imaoka, S.,
Murata, M.,
Shimano, T.,
Yamaoka, Y.,
and Nakamura, Y.
(2000)
Nat. Genet.
24,
245-250[CrossRef][Medline]
[Order article via Infotrieve]
8.
Thorgeirsson, S. S.,
and Grisham, J. W.
(2002)
Nat. Genet.
31,
339-346[CrossRef][Medline]
[Order article via Infotrieve]
9.
Laurent-Puig, P.,
Legoix, P.,
Bluteau, O.,
Belghiti, J.,
Franco, D.,
Binot, F.,
Monges, G.,
Thomas, G.,
Bioulac-Sage, P.,
and Zucman-Rossi, J.
(2001)
Gastroenterology
120,
1763-1773[CrossRef][Medline]
[Order article via Infotrieve]
10.
Kawai, H.,
Suda, T.,
Aoyagi, Y.,
Isokawa, O.,
Mita, Y.,
Waguri, N.,
Kuroiwa, T.,
Igarashi, M.,
Tsukada, K.,
Mori, S.,
Shimizu, T.,
Suzuki, Y.,
Abe, Y.,
Takahashi, T.,
Nomoto, M.,
and Asakura, H.
(2000)
Hepatology
31,
1246-1250[CrossRef][Medline]
[Order article via Infotrieve]
11.
Guan, X. Y.,
Fang, Y.,
Sham, J. S.,
Kwong, D. L.,
Zhang, Y.,
Liang, Q.,
Li, H.,
Zhou, H.,
and Trent, J. M.
(2000)
Genes Chromosomes Cancer
29,
110-116[CrossRef][Medline]
[Order article via Infotrieve]
12.
Piao, Z.,
Park, C.,
Park, J. H.,
and Kim, H.
(1998)
Int. J. Cancer
75,
29-33[CrossRef][Medline]
[Order article via Infotrieve]
13.
Kuroki, T.,
Fujiwara, Y.,
Nakamori, S.,
Imaoka, S.,
Kanematsu, T.,
and Nakamura, Y.
(1995)
Br. J. Cancer
72,
383-385[Medline]
[Order article via Infotrieve]
14.
Nagai, H.,
Pineau, P.,
Tiollais, P.,
Buendia, M. A.,
and Dejean, A.
(1997)
Oncogene
14,
2927-2933[CrossRef][Medline]
[Order article via Infotrieve]
15.
Lin, Y. W.,
Sheu, J. C.,
Liu, L. Y.,
Chen, C. H.,
Lee, H. S.,
Huang, G. T.,
Wang, J. T.,
Lee, P. H.,
and Lu, F. J.
(1999)
Eur. J. Cancer
35,
1730-1734[CrossRef][Medline]
[Order article via Infotrieve]
16.
Zondervan, P. E.,
Wink, J.,
Alers, J. C.,
Ijzermans, J. N.,
Schalm, S. W.,
de Man, R. A.,
and van Dekken, H.
(2000)
J. Pathol.
192,
207-215[CrossRef][Medline]
[Order article via Infotrieve]
17.
Wong, N.,
Lai, P.,
Pang, E.,
Leung, T. W.,
Lau, J. W.,
and Johnson, P. J.
(2000)
Hepatology
32,
1060-1068[CrossRef][Medline]
[Order article via Infotrieve]
18.
Wang, G.,
Zhao, Y.,
Liu, X.,
Wang, L.,
Wu, C.,
Zhang, W.,
Liu, W.,
Zhang, P.,
Cong, W.,
Zhu, Y.,
Zhang, L.,
Chen, S.,
Wan, D.,
Zhao, X.,
Huang, W.,
and Gu, J.
(2001)
Genes Chromosomes Cancer
31,
221-227[CrossRef][Medline]
[Order article via Infotrieve]
19.
Bar-Sagi, D.,
and Hall, A.
(2000)
Cell
103,
227-238[CrossRef][Medline]
[Order article via Infotrieve]
20.
Sahai, E.,
and Marshall, C. J.
(2002)
Nat. Rev. Cancer
2,
133-142[CrossRef][Medline]
[Order article via Infotrieve]
21.
Qiu, R. G.,
Chen, J.,
Kirn, D.,
McCormick, F.,
and Symons, M.
(2002)
Nature
374,
457-459
22.
Roux, P.,
Gauthier-Rouviere, C.,
Doucet-Brutin, S.,
and Fort, P.
(1997)
Curr. Biol.
7,
629-637[CrossRef][Medline]
[Order article via Infotrieve]
23.
Yuan, B. Z.,
Miller, M. J.,
Keck, C. L.,
Zimonjic, D. B.,
Thorgeirsson, S. S.,
and Popescu, N. C.
(1998)
Cancer Res.
58,
2196-2199 24.
Ng, I. O. L.,
Liang, Z. D.,
Cao, L.,
and Lee, T. K. W.
(2000)
Cancer Res.
60,
6581-6584 25.
Wong, C. M.,
Lee, J. M.,
Lau, T. C.,
Fan, S. T.,
and Ng, I. O.-L.
(2002)
Clin. Cancer Res.
8,
2266-2272 26.
Felsenstein, J.
(1996)
Methods Enzymol.
266,
418-427[Medline]
[Order article via Infotrieve]
27.
Zhou, Y.,
Kok, K. H.,
Chun, A. C. S.,
Wong, C. M,
Wu, H. W.,
Lin, M. C. M.,
Fung, P. C. W.,
Kung, H. F.,
and Jin, D. Y.
(2000)
Biochem. Biophys. Res. Commun.
268,
921-927[CrossRef][Medline]
[Order article via Infotrieve]
28.
Clark, G. J.,
Cox, A. D.,
Graham, S. M.,
and Der, C. J.
(1995)
Methods Enzymol.
255,
395-412[Medline]
[Order article via Infotrieve]
29.
Jin, D. Y.,
Wang, H. L.,
Zhou, Y.,
Chun, A. C. S.,
Kibler, K. V.,
Hou, Y. D.,
Kung, H. F.,
and Jeang, K. T.
(2000)
EMBO J.
19,
729-740[CrossRef][Medline]
[Order article via Infotrieve]
30.
Angel, P.,
Smeal, T.,
Meek, J.,
and Karin, M.
(1989)
New Biologist
1,
35-43[Medline]
[Order article via Infotrieve]
31.
Jeang, K.-T.,
Chiu, R.,
Santos, E.,
and Kim, S.-J.
(1991)
Virology
181,
218-227[CrossRef][Medline]
[Order article via Infotrieve]
32.
Self, A. J.,
and Hall, A.
(1995)
Methods Enzymol.
256,
67-76[Medline]
[Order article via Infotrieve]
33.
Ahmed, S.,
Lee, J.,
Kozma, R.,
Best, A.,
Monfries, C.,
and Lim, L.
(1993)
J. Biol. Chem.
268,
10709-10712 34.
Zhou, H. J.,
Wong, C. M.,
Chen, J. H.,
Qiang, B. Q.,
Yuan, J. G.,
and Jin, D. Y.
(2001)
J. Biol. Chem.
276,
28933-28938 35.
Peck, J.,
Douglas, G., IV,
Wu, C. H.,
and Burbelo, P. D.
(2002)
FEBS Lett.
528,
27-34[CrossRef][Medline]
[Order article via Infotrieve]
36.
Stapleton, D.,
Balan, I.,
Pawson, T.,
and Sicheri, F.
(1999)
Nat. Struct. Biol.
6,
44-49[CrossRef][Medline]
[Order article via Infotrieve]
37.
Chi, S. W.,
Ayed, A.,
and Arrowsmith, C. H.
(1999)
EMBO J.
18,
4438-4445[CrossRef][Medline]
[Order article via Infotrieve]
38.
Ponting, C. P.,
and Aravind, L.
(1999)
Trends Biochem. Sci.
24,
130-132[CrossRef][Medline]
[Order article via Infotrieve]
39.
Tsujishita, Y.,
and Hurley, J. H.
(2000)
Nat. Struct. Biol.
7,
408-414[CrossRef][Medline]
[Order article via Infotrieve]
40.
Cichowski, K.,
and Jacks, T.
(2001)
Cell
104,
593-604[CrossRef][Medline]
[Order article via Infotrieve]
41.
Sekimata, M.,
Kabuyama, Y.,
Emori, Y.,
and Homma, Y.
(1999)
J. Biol. Chem.
274,
17757-17762 42.
Takai, Y.,
Sasaki, T.,
and Matozaki, T.
(2001)
Physiol. Rev.
81,
153-208 43.
Hill, C. S.,
Wynne, J.,
and Treisman, R.
(1995)
Cell
81,
1159-1170[CrossRef][Medline]
[Order article via Infotrieve]
44.
Zohar, M.,
Teramoto, H.,
Katz, B.-Z.,
Yamada, K. M.,
and Gutkind, J. S.
(1998)
Oncogene
17,
991-998[CrossRef][Medline]
[Order article via Infotrieve]
45.
Sahai, E.,
Alberts, A. S.,
and Treisman, R.
(1998)
EMBO J.
17,
1350-1361[CrossRef][Medline]
[Order article via Infotrieve]
46.
Ahmed, S.,
Kozma, R.,
Hall, C.,
and Lim, L.
(1995)
Methods Enzymol.
256,
114-125[Medline]
[Order article via Infotrieve]
47.
Callow, M. G.,
Clairvoyant, F.,
Zhu, S.,
Schryver, B.,
Whyte, D. B.,
Bischoff, J. R.,
Jallal, B.,
and Smeal, T.
(2002)
J. Biol. Chem.
277,
550-558 48.
Abo, A.,
Qu, J.,
Cammarano, M. S.,
Dan, C.,
Fritsch, A.,
Baud, V.,
Belisle, B.,
and Minden, A.
(1998)
EMBO J.
17,
6527-6540[CrossRef][Medline]
[Order article via Infotrieve]
49.
Kim, C. A.,
Phillips, M. L.,
Kim, W.,
Gingery, M.,
Tran, H. H.,
Robinson, M. A.,
Faham, S.,
and Bowie, J. U.
(2001)
EMBO J.
20,
4173-4182[CrossRef][Medline]
[Order article via Infotrieve]
50.
Shen, H. M.,
and Ong, C. N.
(1996)
Mutat. Res.
366,
23-44[Medline]
[Order article via Infotrieve]
51.
Genda, T.,
Sakamoto, M.,
Ichida, T.,
Asakura, H.,
Kojiro, M.,
Narumiya, S.,
and Hirohashi, S.
(1999)
Hepatology
30,
1027-1036[CrossRef][Medline]
[Order article via Infotrieve]
52.
Lamarche-Vane, N.,
and Hall, A.
(1998)
J. Biol. Chem.
273,
29172-29177 53.
Self, A. J.,
and Hall, A.
(1995)
Methods Enzymol.
256,
3-10[Medline]
[Order article via Infotrieve]
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
G. M. Hatch, Y. Gu, F. Y. Xu, J. Cizeau, S. Neumann, J.-S. Park, S. Loewen, and M. R.A. Mowat StARD13(Dlc-2) RhoGap Mediates Ceramide Activation of Phosphatidylglycerolphosphate Synthase and Drug Response in Chinese Hamster Ovary Cells Mol. Biol. Cell, March 1, 2008; 19(3): 1083 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Qian, G. Li, H. K. Asmussen, L. Asnaghi, W. C. Vass, R. Braverman, K. M. Yamada, N. C. Popescu, A. G. Papageorge, and D. R. Lowy Oncogenic inhibition by a deleted in liver cancer gene requires cooperation between tensin binding and Rho-specific GTPase-activating protein activities PNAS, May 22, 2007; 104(21): 9012 - 9017. [Abstract] [Full Text] [PDF] |
||||
![]() |
N H Park, I H Song, and Y-H Chung Chronic hepatitis B in hepatocarcinogenesis. Postgrad. Med. J., August 1, 2006; 82(970): 507 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sterpetti, L. Marucci, C. Candelaresi, D. Toksoz, G. Alpini, L. Ugili, G. S. Baroni, G. Macarri, and A. Benedetti Cell proliferation and drug resistance in hepatocellular carcinoma are modulated by Rho GTPase signals Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G624 - G632. [Abstract] [Full Text] |