JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M208310200 on January 16, 2003

J. Biol. Chem., Vol. 278, Issue 12, 10824-10830, March 21, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/12/10824    most recent
M208310200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ching, Y.-P.
Right arrow Articles by Ng, I. O.-l.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ching, Y.-P.
Right arrow Articles by Ng, I. O.-l.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Deleted in Liver Cancer (DLC) 2 Encodes a RhoGAP Protein with Growth Suppressor Function and Is Underexpressed in Hepatocellular Carcinoma*

Yick-Pang ChingDagger §, Chun-Ming Wong§, Shing-Fai Chan||, Thomas Ho-Yin Leung, David Chi-Heng Ng||, Dong-Yan JinDagger ||**DaggerDagger, and Irene Oi-lin NgDaggerDagger

From the Dagger  Institute of Molecular Biology, the  Department of Pathology, and the || Department of Biochemistry, University of Hong Kong, Hong Kong, China

Received for publication, August 14, 2002, and in revised form, January 12, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Hepatocellular carcinoma (HCC) is a major malignancy in many parts of the world, especially in Asia and Africa. Loss of heterozygosity (LOH) on the long arm of chromosome 13 has been reported in HCC. In search of tumor suppressor genes in this region, here we have identified DLC2 (for deleted in liver cancer 2) at 13q12.3 encoding a novel Rho family GTPase-activating protein (GAP). DLC2 mRNA is ubiquitously expressed in normal tissues but was significantly underexpressed in 18% (8/45) of human HCCs. DLC2 is homologous to DLC1, a previously identified tumor suppressor gene at 8p22-p21.3 frequently deleted in HCC. DLC2 encodes a novel protein with a RhoGAP domain, a SAM (sterile alpha  motif) domain related to p73/p63, and a lipid-binding StAR-related lipid transfer (START) domain. Biochemical analysis indicates that DLC2 protein has GAP activity specific for small GTPases RhoA and Cdc42. Expression of the GAP domain of DLC2 sufficiently inhibits the Rho-mediated formation of actin stress fibers. Introduction of human DLC2 into mouse fibroblasts suppresses Ras signaling and Ras-induced cellular transformation in a GAP-dependent manner. Taken together, our findings suggest a role for DLC2 in growth suppression and hepatocarcinogenesis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Hepatocellular carcinoma (HCC)1 is a major malignancy worldwide and is particularly prevalent in Asia and Africa, being one of the most common causes of mortality (1). Risk factors for HCC, including infection with hepatitis B or C virus and exposure to aflatoxin B1, have been well documented (1). However, the molecular events leading to the development and progression of HCC remain elusive.

Clonal expansion of genetically modified cells with inactivated tumor suppressor genes is a hallmark of cancer (2). One major challenge in HCC research is the identification and characterization of tumor suppressors whose inactivation alters major cellular signaling pathways. The delineation of the mechanisms for hepatocarcinogenesis is of importance, because it provides novel opportunities for diagnosis, prognosis, and therapeutic interventions.

The dysregulation of p53, Rb, c-myc, and Wnt signaling through epigenetic changes and somatic mutations has been implicated in some cases of HCC (3-9). However, a number of independent studies based on comparative genomic hybridization, spectral karyotyping, and microsatellite analyses for loss of heterozygosity (LOH) have provided strong evidence for the inactivation of additional tumor suppressors in HCC (8-18). In particular, deletions on chromosome 13q have been found to be rather common (9, 12-18), but a definite gene target in this region has not been identified.

GTPases of the Rho family are members of the Ras superfamily of small GTP-binding proteins that act as molecular switches to regulate various cellular signaling pathways (19, 20). The Rho family has 18 members so far. Rac1, RhoA, and Cdc42 are three representative and well-studied Rho proteins showing distinct functions. Rho proteins control actin cytoskeleton and influence cell proliferation and survival. These functions implicate Rho proteins as key regulators in oncogenic transformation mediated by Ras and other oncoproteins (21, 22). In addition, Rho proteins also stimulate tumor cell invasion and metastasis (20). Balancing the oncogenic potential of Rho proteins are Rho GTPase-activating proteins (GAPs) that activate the intrinsic GTPase activity of Rho proteins and switch them off by converting the active GTP-bound state to the inactive GDP-bound state. Notably, a candidate tumor suppressor gene at chromosome 8p22-p21.3, which has been shown to be frequently deleted in HCC tissue samples and cell lines (23, 24), contains a putative RhoGAP domain. The re-introduction of this gene termed DLC1 (deleted in liver cancer 1) exerts inhibitory effects on the proliferation of DLC1-defective hepatoma cell lines (24). However, it is not understood whether DLC1 has RhoGAP activity. Nor is it clear exactly how DLC1 suppresses cell growth and proliferation.

In search for candidate tumor suppressor loci on chromosome 13q, here we identified a novel gene DLC2 at 13q12.3. DLC2 is apparently a DLC1 homolog. Interestingly, DLC2 is underexpressed in HCC tissues. We provide the first evidence that DLC2 has GAP activity specific for RhoA and Cdc42. We demonstrate that the GAP domain of DLC2 inhibits the Rho-mediated assembly of actin stress fibers in cultured cells. In addition to the RhoGAP domain, DLC2 also contains a SAM domain related to p73/p63, and a lipid-binding START domain. Finally, we show that DLC2 counteracts Ras signaling and Ras transformation likely through inhibition of RhoA and Cdc42. Taken together, our data implicate the involvement of a particular subfamily of RhoGAP proteins in hepatocarcinogenesis.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Patients and Tumor Samples-- Forty-five Chinese patients who had had surgical resection of the tumors at the University of Hong Kong Medical Center were randomly selected for study. Paired samples of their HCCs and corresponding non-tumorous liver tissues were used. The patients' ages ranged from 29 to 74 years (mean: 55.6 years). Thirty-three were men and 12 were women. The tumor ranged from 1.5 to 27 cm in size (mean: 7.6 cm), with 16 (35.9%) of them being <= 5 cm in diameter. Seventeen (37.8%) of the tumors were at earlier stages (tumor, node, and metastasis (TNM) stages I and II), and the remaining 64.4% were at more advanced stages (TNM stages III and IV). The serum was positive for hepatitis B surface antigen (HBsAg) in 26 (80%) patients.

All specimens were obtained immediately after surgical resection, snap-frozen in liquid nitrogen, and kept at -70 °C. Frozen sections were cut from the tumor and non-tumorous liver blocks separately and stained for histological examination to ensure homogeneous cell populations of tissues.

Cloning of DLC2 Gene-- DLC2 is a previously unidentified gene located at human chromosome 13q12.3. The full-length DLC2 cDNA was assembled from expressed sequence tag clones using the DLC2 genomic sequence (GenBankTM accession numbers Z92540, AL139187, and Z84483) as a reference. DLC2 genomic clones from human PAC libraries were obtained from the Sanger Center, UK. Primers 5'-CCGGATCCGGACAGCCCCTGCCTCAA-3' (forward) and 5'-CCGAATTCTCATTTCTTCAATAAATTAAGATG-3' (reverse) were used to PCR-subclone the GAP-coding sequences of DLC2. DLC2-GAP corresponds to amino acids 673-826 of DLC2. A point mutant of DLC2-GAP designated R699A was generated through site-directed mutagenesis using primer 5'-GGTGGGTCTTTTTGCCAAATCAGGAGTGAAG-3'. This R699A mutant has alanine in place of arginine at position 699 corresponding to the full-length sequence of DLC2, thereby dominantly inactivating the GAP activity. All constructs were confirmed by DNA sequencing.

Northern Blot Analysis-- Multiple tissues Northern blot was purchased from Clontech (Palo Alto, CA). The hybridization was performed according to the manufacturer's protocol. A PCR fragment amplified with primers 5'-CTTTCTATTGAAAGCCTCTCTCC-3' (forward) and 5'-ATCCCTCCTGTCTCTGACC-3' (reverse) was used as probe.

LOH Studies with 13q Markers-- Two polymorphic microsatellite markers, D13S171 and D13S267, which flank the DLC2 locus on both sides and are located at 13q12.3-13q13, were used for LOH analyses. PCR using these two microsatellite markers was performed on the DNA extracted from the fresh frozen blocks of HCCs and the corresponding non-tumorous livers, as previously described (25). PCR products were then analyzed on a model 377 automatic DNA sequencer (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions, and the results were analyzed with Genotyper software (Applied Biosystems). Cases were defined as LOH when an allele peak signal from tumor DNA was reduced by 50% compared with their corresponding non-tumorous liver, as we described previously (25).

RT-PCR-- Total RNA was extracted from HCC and their corresponding non-tumorous livers from with TRIzol reagent as described by the manufacturer (Invitrogen, Gaithersburg, MD). cDNA was synthesized from 1 µg of total RNA by using oligo(dT)16 as primer and with GeneAmp RNA PCR kit (Applied Biosystems, Foster City, CA). PCR amplification using a set of primers (forward: 5'-AGC CCC TGC CTC AAA GTA TT-3', reverse: 5'-ATG GGC GTC ATC TGA TTC TC-3') was performed to give a product of 403 bp (from nucleotide 2021 to nucleotide 2423), which covered most of the GAP domain of DLC2. A fragment of beta -actin was amplified as control. The PCR reaction was performed in a 9700 thermocycler (PerkinElmer Life Sciences). The PCR was stopped at the exponential phases, 30 cycles for DLC2 and 22 cycles for beta -actin, with one cycle of hot-start at 95 °C for 12 min, followed by amplification at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, and a final elongation at 72 °C for 10 min. The PCR products were analyzed by electrophoresis on 1.5% agarose gels, and their signal intensities were measured by GelWorks 1D Intermediate Software (UVP). Significant underexpression was defined when the ratio of DLC2 mRNA of the tumor to that of the corresponding non-tumorous liver was <0.5 after normalization with beta -actin.

Phylogenetic Analysis-- Phylogenetic analysis of DLC2-related proteins was performed using the PHYLIP software package version 3.6 (available at evolution.genetics.washington.edu) as previously described (26, 27).

Focus Formation Assay-- Focus formation assay was carried out as described previously (28, 29). Briefly, NIH3T3 cells were co-transfected with DLC2-GAP or DLC2-GAP-R699A plasmid (900 ng) plus pUSE-RasV12 construct (Upstate Biotechnology) (100 ng) or plus pRSVvJun (100 ng) using the LipofectAMINE 2000 reagent (Life Technologies). Plasmid pRSVvJun has been described elsewhere (30, 31). Cells were selected in medium containing 800 µg/ml G418 after 24 h, and the number of foci was scored after 14-21 days.

GTPase Activity Assay-- GTPase activity was assayed as described previously (32). Briefly, GST fusion forms of Rac1, Cdc42, and RhoA proteins were purified and digested with thrombin to release the small G-proteins. Purified GST-free small G-proteins (1 µM) were preloaded with [gamma -32P]GTP (600 Ci/mmol) in GTP loading buffer (20 mM Tris-HCl, pH 7.6, 0.1 mM DTT, 25 mM NaCl, and 4 mM EDTA) for 10 min at 30 °C. The preloaded small GTPase protein was diluted with dilution buffer (20 mM Tris-HCl, pH 7.6, 0.1 mM DTT, 1 mM GTP, 1 mg/ml bovine serum albumin), and the hydrolysis was initiated by addition of DLC2 (0.25 µM) or GST (0.25 µM). The samples were then spotted onto filters and washed with 20 ml of cold assay buffer, and the radioactivity was determined by scintillation counting. n-Chimerin, a known activator of Rac (33), was used as a positive control in the assay. The expression plasmid for n-chimerin has been described (33).

Protein Purification-- GST fusion protein was purified as described previously (29, 34). The protein was eluted with 10 mM reduced glutathione and dialyzed in low salt buffer (10 mM Tris, pH 7.6, 2 mM MgCl2, and 0.1 mM DTT) overnight. Thrombin digestion was performed to cleave the fusion proteins. The excess thrombin was removed by p-aminobenzamidine-Sepharose (Amersham Biosciences), and the quality of the GST-free proteins was verified on SDS-PAGE gels stained with Coomassie Blue. All purified proteins are of over 85% homogeneity.

Luciferase Assay-- Luciferase activity recovered from extracts of transiently transfected NIH3T3 cells was assayed as previously described (34). The reporter plasmid pSRE-luc was from Stratagene (La Jolla, CA). This plasmid contains five copies of the SRE element (AGGATGTCCATATTAGGACATCT) in the promoter that drives the expression of firefly luciferase.

Immunofluorescence Microscopy-- Laser-scanning confocal microscopy was performed using a Zeiss Axiophot microscope as previously described (29, 34). Dual immunofluorescent detection was achieved with primary antibodies from two species coupled to pre-absorbed species-specific secondary antibodies. The primary antibodies are a mouse monoclonal antibody against alpha -actin (ZSA1 from Zymax) and rabbit polyclonal antibodies against HA (Y-11 from Santa Cruz Biotechnology). The secondary antibodies are Cy5-conjugated goat anti-mouse immunoglobulin G (Zymax) and fluorescein-conjugated goat anti-rabbit immunoglobulin G (Zymax). Plasmid pHM6 (Roche Molecular Biochemicals) was used for expression of DLC2-GAP in HeLa cells.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Identification of Human DLC2-- LOH studies from many independent groups have strongly suggested the existence of HCC-associated tumor suppressor loci on chromosome 13q (9, 12-18). In particular, a small commonly deleted region harboring one or more tumor suppressors has been mapped to 13q12.3 in close proximity to the BRCA2 locus, and a microsatellite marker D13S171 telomeric to BRCA2 has been widely used in the definition of this small region (13-15). To search for candidate tumor suppressor in this region, we identified a novel gene designated DLC2 (deleted in liver cancer 2) due to striking homologies to DLC1 at 8p22-p21.3, a frequently deleted locus in HCC (23, 24). Thus, DLC2 was chosen to be further characterized because it localizes to a small region of 13q12.3 commonly deleted in HCC, it is homologous to DLC1, and it encodes a putative RhoGAP protein that down-regulates Rho family GTPases.

The physical mapping of DLC2 in human genome has been determined (available at www.ncbi.nlm.nih.gov). The relative positions of DLC2 and the adjacent KL and RFC3 loci (Fig. 1A) were confirmed independently by PCR analysis and by restriction mapping (data not shown). The human DLC2 gene spans ~182 kb, and it contains 14 coding exons (Fig. 1B). Data base searches for expressed sequence tag clones that match the DLC2 genomic sequences generated several cDNAs, and these cDNA clones were obtained from the American Type Culture Collections (Manassas, VA) to assemble a DLC2 cDNA containing the complete coding sequences. The assembled 5886-bp DLC2 cDNA (GenBankTM AY082589) encodes an open reading frame of 1114 amino acids with a predicted molecular size of 125 kDa. An in-frame stop codon is found immediately upstream the initiating ATG.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1.   Genomic characterization of human DLC2. A, chromosomal map location of human DLC2 at 13q 12.3. Arrows underneath the gene symbols indicate the orientation of transcription. RFC3, replication factor C subunit 3; KL, Klotho; AS3, androgen shutoff 3; BRCA2, breast cancer 2, early onset; Tel, telomeric; Cen, centromeric. B, genomic organization of human DLC2 locus. Non-coding (open boxes) and coding (filled boxes) are shown. C, Northern blot analysis of DLC2 in human tissues. To normalize for differences in RNA loading, the same blot was also probed for beta -actin after stripping the DLC2 signal.

To assess the expression patterns of DLC2 in human tissues, we performed Northern blot analysis using an internal fragment of the DLC2 cDNA as probe (Fig. 1C). Two DLC2 transcripts of 7.2 and 4.2 kb in size were detected in all tissues tested, but they were more abundant in heart, skeletal muscle, kidney, and pancreas. Although the existence of other DLC2 isoform(s) cannot be ruled out, these two transcripts likely represent the major alternatively spliced variants of DLC2.

LOH at 13q12.3 and Underexpression of DLC2 in Human HCC Tissues-- In an attempt to assess the status of allelic losses at chromosome 13q12.3, HCC samples from 45 patients were analyzed. The heterozygosity values of microsatellite markers D13S171 and D13S267 in our cases were 0.73 (33/45) and 0.60 (27/45), respectively. Of those informative loci, allelic losses at D13S171 and D13S267 were detected in 33.3% (11/33) and 40.7% (11/27) of the informative cases, respectively. Among the 45 cases examined, 39 cases were informative and 15 cases (38.5%) showed allelic losses at either one or both loci (Fig. 2A).


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 2.   LOH and RT-PCR results. A, a representative case showing LOH with both microsatellite markers D13S171 and D13S267. B, cases of HCCs with significant underexpression of DLC2 are shown. Significant underexpression was defined when the ratio of DLC2 mRNA of the tumor to that of the corresponding non-tumorous liver was <0.5 after normalization with beta -actin. T, tumor; NT, non-tumorous liver.

The localization of DLC2 to chromosome 13q12.3 prompted us to examine its expression in human HCC tissues. To this end, we carried out RT-PCR to detect DLC2 mRNA in the 45 cases of human HCC having LOH analysis performed. Notably, 8 (17.8%) of the 45 cases showed significant underexpression (more than 2-fold) of DLC2 mRNA when compared with the corresponding non-tumorous liver tissues from the same patients (Fig. 2B). Thus, DLC2 is commonly underexpressed in HCC.

DLC2 Is a Multifunctional Protein with RhoGAP Activity-- DLC2 contains multiple domains highly relevant to its putative tumor suppressor function (Fig. 3A). At the amino acid sequence level DLC2 shares 51% identity and 65% similarity with DLC1. One of most conserved regions between DLC1 and DLC2 locates in the RhoGAP domain (residues 677-826) where 80% residues are identical (Fig. 3B). Plausibly, this degree of conservation suggests that DLC1 and DLC2 may serve related functions in tumor suppression. A phylogenetic analysis of DLC2-related sequences (Fig. 3C) lends further support to the notion that DLC1 and DLC2 represent a separate and evolutionarily conserved group of GAP proteins distinct from other GAP proteins such as Macgap or n-chimerin.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   DLC2 is a novel multifunctional protein with a RhoGAP domain. A, diagram of protein domains in DLC2. SAM, sterile alpha motif; ATP/GTP binding, ATP/GTP-binding site motif A; GAP, RhoGAP domain; START, StAR-related lipid transfer domain. B, sequence alignment of RhoGAP domains from representative DLC2-related proteins. Perfect matches and conservative substitutions are boxed in black and gray, respectively. The conserved arginine residue at position 699 of DLC2 is highlighted (#). C, consensus phylogenetic tree relating DLC2 to other GAP proteins. Phylogenies were inferred from protein sequences using parsimony. Bootstrap replication was performed and the majority rule consensus tree was generated from 100 replicates. The numbers are bootstrap confidence probabilities (%). GenBankTM identification numbers of the aligned sequences are: mouse DLC1: 7656902; human DLC1: 18571106; rat DLC1: 1083784; mouse DLC2: 14422213; KIAA0189: 17644266; fruit fly RE02250p: 18447379; fruit fly CG8480: 7299877; Macgap: 15723376; n-chimerin: 399249.

Four domains or motifs can be identified in the DLC2 sequence (Fig. 3A). First, DLC2 conserves a RhoGAP domain (35) closely related to that of DLC1 and of other proteins (Fig. 3B). Thus DLC2 is predicted to show GAP activity on Rho family small GTPases. Second, it has a SAM domain at the N terminus. SAM domains have been found in p53-related proteins p73 and p63, protein kinases such as Eph receptor, Ets transcription factors, as well as other signaling proteins (36, 37). The SAM domain has been thought to function as a protein interaction module through homo- and hetero-oligomerization with other SAM domains (36, 37). Third, DLC2 processes a START domain at the C terminus. START is a lipid-binding domain present in StAR, HD-ZIP, and other proteins (38, 39). Finally, an ATP/GTP-binding site was identified in residues 322-329 of DLC2. Plausibly, the RhoGAP domain has catalytic activity and the other structures may serve regulatory functions.

To establish the RhoGAP activity of DLC2, we performed in vitro GAP assays using recombinant proteins. A full-length DLC2 protein was bacterially expressed as GST fusion and affinity-purified through glutathione-agarose (Fig. 4A, lane 2). Purified GST and DLC2 proteins were tested for GAP activity on GST-free RhoA (Fig. 4B), Rac1 (Fig. 4C), and Cdc42 (Fig. 4D). Interestingly, DLC2 stimulated not only GTP hydrolysis of RhoA, but also of Cdc42 (Fig. 4, B and D). However, DLC2 poorly activated the GTP hydrolysis of Rac1 if compared with n-chimerin (Fig. 4C), a known stimulator of Rac1 (33). DLC2 did not activate another small G-protein Ras (data not shown).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 4.   GAP activity of DLC2. Recombinant DLC2 purified from E. coli was assessed on SDS-PAGE gel (A). GST and DLC2 were added to a GAP assay containing RhoA (B), Rac1 (C), or Cdc42 (D). The reactions contain GTPase alone (black-square), GTPase plus GST (black-triangle), GTPase plus DLC2 (), or GTPase plus n-chimerin (×). The basal activity due to spontaneous conversion of RhoA, Rac1, and Cdc42 proteins from GTP- to GDP-bound status has been previously documented (52, 53). Results are representative of three independent experiments. Chi., n-chimerin.

DLC2-GAP Suppresses Ras Signaling and Ras-induced Cellular Transformation-- A growing body of evidence has suggested that small GTPases of the Rho family are critically involved in the regulation of cytoskeleton and metastasis of cancer cells (19-22). It is noteworthy that some GAP proteins, such as neurofibromin 1, which has RasGAP activity, are well-known tumor suppressors (40). The demonstration of the RhoGAP activity of DLC2 (Fig. 4) prompted us to investigate the influence of DLC2 in cell signaling. Specifically, we asked whether the expression of DLC2 would suppress Ras- and Rho-mediated oncogenic signaling and cellular transformation. However, the full-length DLC2 protein could not be stably overexpressed in cultured mammalian cells (data not shown) probably due to cytotoxicity. This observation is consistent with a previous finding that rat DLC1 cannot be stably overexpressed in adherent cells, because it induces morphological changes and cell detachment (41).

To resolve the above issue and to explore the significance of the RhoGAP activity of DLC2 to its cellular functions, we performed functional studies in cultured cells using a truncated form of DLC2, which contains the intact RhoGAP domain. This form of DLC2, designated DLC2-GAP, can be efficiently expressed both in Escherichia coli (Fig. 5A) and in cultured mammalian cells. DLC2-GAP exhibits GAP activity on Cdc42 (Fig. 5B) as potent as the DLC2 full-length protein (Fig. 4D). First we wished to assess the influence of DLC-GAP on Ras signaling, because Ras has been well documented for its oncogenic property (42) and because Ras induces cell transformation partly through the activation of RhoA and Cdc42 (19-22). SRE represents one effector of Ras (43) and is efficiently activated by RasV12, a dominant active mutant of Ras (Fig. 5C, compare column 2 to column 1). We observed that DLC2-GAP specifically repressed the RasV12-induced activation of SRE-dependent luciferase reporter activity (Fig. 5C, compare column 3 to column 2). This repression was absolutely dependent on the GAP activity, because the R699A mutant of DLC2-GAP, which did not show any GAP activity (Fig. 5B), did not influence the RasV12 activation of SRE (Fig. 5C, compare column 4 to columns 2 and 3). DLC2-GAP had GAP activity on Cdc42 (Fig. 5B) and more mildly on Rac1 (data not shown), but it did not show appreciable GAP activity on Ras (Fig. 5D) or RhoA (data not shown) in the in vitro assay. RhoA, Rac1, and Cdc42 have previously been shown (43) to activate transcription by serum response factor. Among them, RhoA, but not Rac1 and Cdc42, is required for the stimulation of serum response factor by serum, lysophosphatidic acid, and AlF<UP><SUB>4</SUB><SUP>−</SUP></UP> (43-45). Thus, the inhibitory effect of DLC2-GAP on RasV12-induced activation of SRE could be attributed at least in part to its GAP activity on Cdc42 and/or other members in the Ras superfamily of small GTP-binding proteins.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5.   DLC2-GAP-dependent suppression of Ras signaling. A, production of recombinant GST-DLC2-GAP protein. The purity of GST (lane 1) and GST-DLC2-GAP proteins was assessed by SDS-PAGE. DLC2-GAP corresponds to amino acids 673-826 of DLC2. B, GAP activity on Cdc42. GAP activity was assayed as in Fig. 5D using wild-type DLC2-GAP () and mutant DLC2-GAP-R699A (×). C, DLC2-GAP inhibition of Ras-mediated activation of SRE. NIH3T3 cells were co-transfected with pSRE-luc (column 1), pSRE-luc + RasV12 + pHM6 empty vector (column 2), pSRE-luc + RasV12 + wild-type DLC2-GAP (column 3), or pSRE-luc + RasV12 + DLC2-GAP-R699A mutant (column 4). Results represent three independent experiments. D, GAP activity on Ras. GAP activity was assayed as in Fig. 5 using GST-Ras alone (black-square), GST-Ras + GST (black-triangle), and GST-Ras + GST-DLC2-GAP (open circle ).

Rho GTPases are well known activators of the actin cytoskeleton (19). In particular, RhoA plays a pivotal role in cytoskeletal reorganization and the formation of actin stress fibers (19, 44). As a functional RhoGAP protein, rat DLC1 has been shown to induce disassembly of stress fibers and the morphological rounding of various adherent cells (41). To assess the functional status of DLC2-GAP in the cell, we expressed HA-tagged DLC2-GAP in HeLa cells and co-stained for HA and alpha -actin (Fig. 6). DLC2-GAP was abundantly expressed without inducing notable cytotoxic effects (Fig. 6, panel 1, note cell with an arrow). However, the formation of actin stress fibers in the DLC2-GAP-expressing cells was significantly inhibited if compared with non-transfected cells (Fig. 6, panels 2 and 3, see the cell with an arrow for an ~60% inhibition compared with cells with no arrow; computer-aided quantitation of the intensities of alpha -actin-specific fluorescent signal in 200 transfected cells versus 200 untransfected cells indicates a 53.8 ± 4.6% inhibition of stress fiber formation by DLC2-GAP). In sharp contrast, the expression of the RhoGAP-defective DLC2-GAP R699A mutant had no effect on stress fiber formation (Fig. 6, panels 5 and 6, cells highlighted by arrow). This GAP-dependent inhibition of Rho-mediated cytoskeletal reorganization by DLC2-GAP suggests that DLC2 might function as a RhoGAP in vivo.


View larger version (106K):
[in this window]
[in a new window]
 
Fig. 6.   Inhibition of stress fiber formation by DLC2-GAP. HeLa cells were transfected, respectively, with plasmids expressing HA-tagged DLC2-GAP (panels 1-3) and DLC2-GAP R699A mutant (panels 4-6). Cells were serum-starved for 18 h and a complete medium with 10% fetal calf serum was re-supplied to stimulate stress fiber formation for 1 h. Cells were fixed 42 h after transfection and co-stained with rabbit anti-HA (panels 1 and 4) and mouse anti-alpha -actin (panels 2 and 5). The DLC2-GAP (red; probed with anti-HA) and alpha -actin (green) fluorescent signals were overlaid by computer assistance (panels 3 and 6). The same fields are shown in panels 1-3 and 4-6. Arrows indicate transfected cells. The patterns shown represent 76 and 68%, respectively, of 200 transfected cells. Computer-aided quantitation of the intensities of alpha -actin-specific fluorescent signal in 200 transfected cells versus 200 untransfected cells indicates a 53.8 ± 4.6% inhibition of stress fiber formation by DLC2-GAP. Bar, 20 µm.

Next we asked whether DLC2-GAP suppressed Ras-induced cellular transformation. NIH3T3 cells were induced by RasV12 to form foci (Fig. 7B, compare column 2 to column 1), which is a characteristic property of transformed cells. When DLC2-GAP was co-transfected with RasV12, significantly less number of foci was observed compared with the vector control or the DLC2-GAP R699A mutant that has lost the RhoGAP activity (Fig. 7, A and B, compare column 4 to columns 2 and 3). In contrast, the expression of DLC2-GAP did not affect the formation of transformed foci induced by v-Jun (Fig. 7B, columns 5 and 6), a viral oncoprotein recovered from avian sarcoma virus 17 (30). Our interpretation to the specific suppression of Ras-induced transformation of NIH3T3 cells is that DLC2-GAP acts through inactivating the RhoA and/or Cdc42 activity.


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 7.   DLC2-GAP-dependent suppression of Ras-induced transformation. A, examples of focus formation assays. NIH3T3 cells were transfected with RasV12 plus DLC2-GAP (panel 1) or RasV12 plus DLC2-GAP-R699A (panel 2). B, DLC2-GAP suppresses RasV12-induced formation of transformation foci. NIH3T3 cells were transfected with empty vectors pUSE + pHM6 (column 1), RasV12 + pHM6 (column 2), RasV12 + DLC-GAP-R699A (column 3), RasV12 + DLC-GAP (column 4), pRSVvJun + pHM6 (column 5), or pRSVvJun + DLC-GAP (column 6). Results represent three independent experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

This study has established the growth suppressor function of DLC2 and the underexpression of DLC2 in human HCC tissues. We have shown that DLC2 at chromosome 13q12.3 (Fig. 1) encodes a novel RhoGAP protein (Fig. 3) exhibiting specific GAP activity on RhoA and Cdc42 (Fig. 4) and is underexpressed in HCC (Fig. 2). In addition, DLC2 suppresses Ras activation of SRE (Fig. 5), inhibits Rho-mediated cytoskeletal reorganization (Fig. 6), and counteracts Ras-mediated cellular transformation in a GAP-dependent manner (Fig. 7).

Allelic loss on chromosome band 13q12.3 has been frequently detected in human HCC as well as in other cancers. However, the putative tumor suppressor gene targets for allelic loss in this region have not yet been identified. DLC2 is located at 13q12.3, flanked by microsatellite markers D13S171 and D13S267. Our results indicate that LOH on these two markers were frequently found in HCC (33 and 41%). Southern blotting analysis performed on some of the cases showing LOH with the two microsatellite markers confirmed heterozygous deletion of DLC2 gene (data not shown). These indicate that allelic loss at 13q12.3 where DLC2 is harbored is common in human HCCs. Moreover, DLC2 was underexpressed at mRNA level in 18% of the human HCC samples. The significant underexpression of DLC2 in human HCC samples compared with the corresponding non-tumorous livers implies that DLC2 may be a putative tumor suppressor important in hepatocarcinogenesis. It is noteworthy that we cannot establish a statistically significant correlation between the underexpression of DLC2 mRNA and LOH on the two microsatellite markers. Some cases that did not show LOH had reduced expression of DLC2. These results suggest that in addition to allelic loss, other factors such as promoter hypermethylation might also contribute to the underexpression of DLC2 gene. Further investigations into the genetic and epigenetic alterations of DLC2 are warranted in this regard.

DLC2 contains multiple functional domains, including SAM, RhoGAP, and START, which may be important for its regulation. Little information is available for the function of START domain apart from that it can bind lipids and target proteins to membrane (38). Although the exact role of this domain in the regulation of DLC2 protein remains to be elucidated, it is tempting to speculate that the START domain is responsible for the recruitment of DLC2 to the membrane, where the substrates for its GAP activity are localized. Moreover, binding of one or more lipids to START may provide a mechanism to regulate the GAP activity of DLC2, analogous to the enhancement of GAP activity in n-chimerin through phospholipid binding to a protein kinase C-like domain (46).

DLC2 can stimulate the GTP hydrolysis of small GTPases RhoA and Cdc42 (Fig. 4, B and D). The full-length DLC2 protein also exhibits relatively low GAP activity on Rac1 (Fig. 4C). We noted that the truncated DLC2-GAP protein has a moderate GAP activity on Rac1 but it poorly stimulates the GTP hydrolysis of RhoA in our assay (data not shown). We hypothesized that this discordance might be caused by conformational change of the recombinant DLC2-GAP protein, possibly induced during the process of purification. Nevertheless, our findings that the expression of DLC2-GAP in cells has an impact on SRE activation (Fig. 5C), cytoskeletal reorganization (Fig. 6), and transformation (Fig. 7) consistently support the notion that DLC2-GAP and DLC2 function as RhoGAP in vivo.

It is generally accepted that Rho family proteins are involved in cell transformation; the molecular events for this process are, however, not well defined. The dissection of the signaling pathway is hampered by the cross-talk between the Rho family members and by the limited information available for the downstream effectors. For example, the most common effector for Rac and Cdc42 is p21-activating kinase (PAK) 1, which does not induce transformation. However, a recently identified group II PAK family member, called PAK4, is able to induce transformation and is overexpressed in a large number of tumor cell lines (47). Interestingly, PAK4 is more preferentially activated by Cdc42 (48). We noted that DLC2 selectively activated the GTP hydrolysis of Cdc42 (Figs. 4 and 5). This raised the possibility that PAK4 is a direct target for DLC2 signaling. Further experiments are undergoing to test this hypothesis.

Interactions between SAM domains are known to mediate homo- and hetero-oligomerization of proteins (36, 37). Notably, the oligomerization of SAM domain has recently been implicated in leukemogenesis and transcriptional repression (49). In this context, it would be of interest to elucidate whether SAM domain in DLC2 would be used for self-association and for interaction with other partners, including DLC1. A better understanding of DLC2 function in liver physiology and pathology requires a clear definition of the structural basis of SAM domain association and interaction.

Ras, Rho, and Rho-associate protein kinase have previously been implicated in the development and metastasis of HCC (50, 51). Our demonstration of a novel RhoGAP protein as a candidate tumor suppressor in HCC supports the critical involvement of Rho signaling in hepatocarcinogenesis. Interestingly, GTPase-defective mutants of Rho proteins have not been identified in tumors, whereas many RhoGEF proteins have been isolated as oncogenes (20). Countering the effects of RhoGEF are various RhoGAP proteins. The variety of RhoGAP proteins may provide the versatility and specificity for fine-tuning Rho GTPase activity in an orderly and timely fashion. Thus, it is not surprising that a particular RhoGAP may function as a tumor suppressor. Our findings corroborate the notion that the cycling of Rho proteins between the GTP- and GDP-bound states represents a critical point for growth control and for cellular transformation.

    ACKNOWLEDGEMENTS

We thank S. Gutkind, L. Lim, M. Karin, and the Sanger Center for clones and reagents and W. H. Lee and A. Hall for helpful comments and suggestions.

    FOOTNOTES

* This work was supported in part by a grant (to I. O.-L. N. and D. Y. J.) from the Hong Kong Research Grants Council (Project HKU 7281/01M).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY082589.

§ Both authors contributed equally to this work.

** A Leukemia and Lymphoma Society Scholar.

Dagger Dagger To whom correspondence should be addressed. Tel.: 852-2855-4197; Fax: 852-2872-5197; E-mail: dyjin@hkucc.hku.hk or iolng{at}hku.hk.

Published, JBC Papers in Press, January 16, 2003, DOI 10.1074/jbc.M208310200

    ABBREVIATIONS

The abbreviations used are: HCC, hepatocellular carcinoma; GAP, GTPase-activating protein; LOH, loss of heterozygosity; SAM, sterile alpha  motif; HA, hemagglutinin; START, StAR-related lipid transfer domain; RT, reverse transcription; GST, glutathione S-transferase; DTT, dithiothreitol; PAK, p21-activating kinase; SRE, serum-response element.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Bosch, F. X. (1997) in Liver Cancer (Okuda, K. , and Tabor, E., eds) , pp. 13-28, Churchill Livingston, New York
2. Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1998) Nature 396, 643-649[CrossRef][Medline] [Order article via Infotrieve]
3. Scorsone, K. A., Zhou, Y. Z., Butel, J. S., and Slagle, B. L. (1992) Cancer Res. 52, 1635-1638[Abstract/Free Full Text]
4. Ng, I. O. L., Chung, L. P., Tsang, S. W., Lam, C. L., Lai, E. C. S., Fan, S. T., and Ng, M. (1994) Oncogene 9, 985-990[Medline] [Order article via Infotrieve]
5. de La Coste, A., Romagnolo, B., Billuart, P., Renard, C. A., Buendia, M. A., Soubrane, O., Fabre, M., Chelly, J., Beldjord, C., Kahn, A., and Perret, C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 8847-8851[Abstract/Free Full Text]
6. Wong, C. M., Fan, S. T., and Ng, I. O. L. (2001) Cancer 92, 136-145[CrossRef][Medline] [Order article via Infotrieve]
7. Satoh, S., Daigo, Y., Furukawa, Y., Kato, T., Miwa, N., Nishiwaki, T., Kawasoe, T., Ishiguro, H., Fujita, M., Tokino, T., Sasaki, Y., Imaoka, S., Murata, M., Shimano, T., Yamaoka, Y., and Nakamura, Y. (2000) Nat. Genet. 24, 245-250[CrossRef][Medline] [Order article via Infotrieve]
8. Thorgeirsson, S. S., and Grisham, J. W. (2002) Nat. Genet. 31, 339-346[CrossRef][Medline] [Order article via Infotrieve]
9. Laurent-Puig, P., Legoix, P., Bluteau, O., Belghiti, J., Franco, D., Binot, F., Monges, G., Thomas, G., Bioulac-Sage, P., and Zucman-Rossi, J. (2001) Gastroenterology 120, 1763-1773[CrossRef][Medline] [Order article via Infotrieve]
10. Kawai, H., Suda, T., Aoyagi, Y., Isokawa, O., Mita, Y., Waguri, N., Kuroiwa, T., Igarashi, M., Tsukada, K., Mori, S., Shimizu, T., Suzuki, Y., Abe, Y., Takahashi, T., Nomoto, M., and Asakura, H. (2000) Hepatology 31, 1246-1250[CrossRef][Medline] [Order article via Infotrieve]
11. Guan, X. Y., Fang, Y., Sham, J. S., Kwong, D. L., Zhang, Y., Liang, Q., Li, H., Zhou, H., and Trent, J. M. (2000) Genes Chromosomes Cancer 29, 110-116[CrossRef][Medline] [Order article via Infotrieve]
12. Piao, Z., Park, C., Park, J. H., and Kim, H. (1998) Int. J. Cancer 75, 29-33[CrossRef][Medline] [Order article via Infotrieve]
13. Kuroki, T., Fujiwara, Y., Nakamori, S., Imaoka, S., Kanematsu, T., and Nakamura, Y. (1995) Br. J. Cancer 72, 383-385[Medline] [Order article via Infotrieve]
14. Nagai, H., Pineau, P., Tiollais, P., Buendia, M. A., and Dejean, A. (1997) Oncogene 14, 2927-2933[CrossRef][Medline] [Order article via Infotrieve]
15. Lin, Y. W., Sheu, J. C., Liu, L. Y., Chen, C. H., Lee, H. S., Huang, G. T., Wang, J. T., Lee, P. H., and Lu, F. J. (1999) Eur. J. Cancer 35, 1730-1734[CrossRef][Medline] [Order article via Infotrieve]
16. Zondervan, P. E., Wink, J., Alers, J. C., Ijzermans, J. N., Schalm, S. W., de Man, R. A., and van Dekken, H. (2000) J. Pathol. 192, 207-215[CrossRef][Medline] [Order article via Infotrieve]
17. Wong, N., Lai, P., Pang, E., Leung, T. W., Lau, J. W., and Johnson, P. J. (2000) Hepatology 32, 1060-1068[CrossRef][Medline] [Order article via Infotrieve]
18. Wang, G., Zhao, Y., Liu, X., Wang, L., Wu, C., Zhang, W., Liu, W., Zhang, P., Cong, W., Zhu, Y., Zhang, L., Chen, S., Wan, D., Zhao, X., Huang, W., and Gu, J. (2001) Genes Chromosomes Cancer 31, 221-227[CrossRef][Medline] [Order article via Infotrieve]
19. Bar-Sagi, D., and Hall, A. (2000) Cell 103, 227-238[CrossRef][Medline] [Order article via Infotrieve]
20. Sahai, E., and Marshall, C. J. (2002) Nat. Rev. Cancer 2, 133-142[CrossRef][Medline] [Order article via Infotrieve]
21. Qiu, R. G., Chen, J., Kirn, D., McCormick, F., and Symons, M. (2002) Nature 374, 457-459
22. Roux, P., Gauthier-Rouviere, C., Doucet-Brutin, S., and Fort, P. (1997) Curr. Biol. 7, 629-637[CrossRef][Medline] [Order article via Infotrieve]
23. Yuan, B. Z., Miller, M. J., Keck, C. L., Zimonjic, D. B., Thorgeirsson, S. S., and Popescu, N. C. (1998) Cancer Res. 58, 2196-2199[Abstract/Free Full Text]
24. Ng, I. O. L., Liang, Z. D., Cao, L., and Lee, T. K. W. (2000) Cancer Res. 60, 6581-6584[Abstract/Free Full Text]
25. Wong, C. M., Lee, J. M., Lau, T. C., Fan, S. T., and Ng, I. O.-L. (2002) Clin. Cancer Res. 8, 2266-2272[Abstract/Free Full Text]
26. Felsenstein, J. (1996) Methods Enzymol. 266, 418-427[Medline] [Order article via Infotrieve]
27. Zhou, Y., Kok, K. H., Chun, A. C. S., Wong, C. M, Wu, H. W., Lin, M. C. M., Fung, P. C. W., Kung, H. F., and Jin, D. Y. (2000) Biochem. Biophys. Res. Commun. 268, 921-927[CrossRef][Medline] [Order article via Infotrieve]
28. Clark, G. J., Cox, A. D., Graham, S. M., and Der, C. J. (1995) Methods Enzymol. 255, 395-412[Medline] [Order article via Infotrieve]
29. Jin, D. Y., Wang, H. L., Zhou, Y., Chun, A. C. S., Kibler, K. V., Hou, Y. D., Kung, H. F., and Jeang, K. T. (2000) EMBO J. 19, 729-740[CrossRef][Medline] [Order article via Infotrieve]
30. Angel, P., Smeal, T., Meek, J., and Karin, M. (1989) New Biologist 1, 35-43[Medline] [Order article via Infotrieve]
31. Jeang, K.-T., Chiu, R., Santos, E., and Kim, S.-J. (1991) Virology 181, 218-227[CrossRef][Medline] [Order article via Infotrieve]
32. Self, A. J., and Hall, A. (1995) Methods Enzymol. 256, 67-76[Medline] [Order article via Infotrieve]
33. Ahmed, S., Lee, J., Kozma, R., Best, A., Monfries, C., and Lim, L. (1993) J. Biol. Chem. 268, 10709-10712[Abstract/Free Full Text]
34. Zhou, H. J., Wong, C. M., Chen, J. H., Qiang, B. Q., Yuan, J. G., and Jin, D. Y. (2001) J. Biol. Chem. 276, 28933-28938[Abstract/Free Full Text]
35. Peck, J., Douglas, G., IV, Wu, C. H., and Burbelo, P. D. (2002) FEBS Lett. 528, 27-34[CrossRef][Medline] [Order article via Infotrieve]
36. Stapleton, D., Balan, I., Pawson, T., and Sicheri, F. (1999) Nat. Struct. Biol. 6, 44-49[CrossRef][Medline] [Order article via Infotrieve]
37. Chi, S. W., Ayed, A., and Arrowsmith, C. H. (1999) EMBO J. 18, 4438-4445[CrossRef][Medline] [Order article via Infotrieve]
38. Ponting, C. P., and Aravind, L. (1999) Trends Biochem. Sci. 24, 130-132[CrossRef][Medline] [Order article via Infotrieve]
39. Tsujishita, Y., and Hurley, J. H. (2000) Nat. Struct. Biol. 7, 408-414[CrossRef][Medline] [Order article via Infotrieve]
40. Cichowski, K., and Jacks, T. (2001) Cell 104, 593-604[CrossRef][Medline] [Order article via Infotrieve]
41. Sekimata, M., Kabuyama, Y., Emori, Y., and Homma, Y. (1999) J. Biol. Chem. 274, 17757-17762[Abstract/Free Full Text]
42. Takai, Y., Sasaki, T., and Matozaki, T. (2001) Physiol. Rev. 81, 153-208[Abstract/Free Full Text]
43. Hill, C. S., Wynne, J., and Treisman, R. (1995) Cell 81, 1159-1170[CrossRef][Medline] [Order article via Infotrieve]
44. Zohar, M., Teramoto, H., Katz, B.-Z., Yamada, K. M., and Gutkind, J. S. (1998) Oncogene 17, 991-998[CrossRef][Medline] [Order article via Infotrieve]
45. Sahai, E., Alberts, A. S., and Treisman, R. (1998) EMBO J. 17, 1350-1361[CrossRef][Medline] [Order article via Infotrieve]
46. Ahmed, S., Kozma, R., Hall, C., and Lim, L. (1995) Methods Enzymol. 256, 114-125[Medline] [Order article via Infotrieve]
47. Callow, M. G., Clairvoyant, F., Zhu, S., Schryver, B., Whyte, D. B., Bischoff, J. R., Jallal, B., and Smeal, T. (2002) J. Biol. Chem. 277, 550-558[Abstract/Free Full Text]
48. Abo, A., Qu, J., Cammarano, M. S., Dan, C., Fritsch, A., Baud, V., Belisle, B., and Minden, A. (1998) EMBO J. 17, 6527-6540[CrossRef][Medline] [Order article via Infotrieve]
49. Kim, C. A., Phillips, M. L., Kim, W., Gingery, M., Tran, H. H., Robinson, M. A., Faham, S., and Bowie, J. U. (2001) EMBO J. 20, 4173-4182[CrossRef][Medline] [Order article via Infotrieve]
50. Shen, H. M., and Ong, C. N. (1996) Mutat. Res. 366, 23-44[Medline] [Order article via Infotrieve]
51. Genda, T., Sakamoto, M., Ichida, T., Asakura, H., Kojiro, M., Narumiya, S., and Hirohashi, S. (1999) Hepatology 30, 1027-1036[CrossRef][Medline] [Order article via Infotrieve]
52. Lamarche-Vane, N., and Hall, A. (1998) J. Biol. Chem. 273, 29172-29177[Abstract/Free Full Text]
53. Self, A. J., and Hall, A. (1995) Methods Enzymol. 256, 3-10[Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
G. M. Hatch, Y. Gu, F. Y. Xu, J. Cizeau, S. Neumann, J.-S. Park, S. Loewen, and M. R.A. Mowat
StARD13(Dlc-2) RhoGap Mediates Ceramide Activation of Phosphatidylglycerolphosphate Synthase and Drug Response in Chinese Hamster Ovary Cells
Mol. Biol. Cell, March 1, 2008; 19(3): 1083 - 1092.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Qian, G. Li, H. K. Asmussen, L. Asnaghi, W. C. Vass, R. Braverman, K. M. Yamada, N. C. Popescu, A. G. Papageorge, and D. R. Lowy
Oncogenic inhibition by a deleted in liver cancer gene requires cooperation between tensin binding and Rho-specific GTPase-activating protein activities
PNAS, May 22, 2007; 104(21): 9012 - 9017.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
N H Park, I H Song, and Y-H Chung
Chronic hepatitis B in hepatocarcinogenesis.
Postgrad. Med. J., August 1, 2006; 82(970): 507 - 515.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Sterpetti, L. Marucci, C. Candelaresi, D. Toksoz, G. Alpini, L. Ugili, G. S. Baroni, G. Macarri, and A. Benedetti
Cell proliferation and drug resistance in hepatocellular carcinoma are modulated by Rho GTPase signals
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G624 - G632.
[Abstract] [Full Text]