|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 278, Issue 13, 10891-10899, March 28, 2003
From the Department of Biological Chemistry, University of Michigan
Medical School, Ann Arbor, Michigan 48109-0606
Received for publication, November 20, 2002, and in revised form, January 17, 2003
A lectin was purified from rhizomes of the fern
Phlebodium aureum by affinity chromatography on
mannose-Sepharose. The lectin, designated P. aureum lectin
(PAL), is composed of two identical subunits of ~15 kDa associated by
noncovalent bonds. From a cDNA library and synthetic
oligonucleotide probes based on a partial amino acid sequence, 5'- and
3'-rapid amplification of cDNA ends allowed the generation of two
similar full-length cDNAs, termed PALa and PALb, each of which had
an open reading frame of 438 bp encoding 146 amino acid residues. The
two proteins share 88% sequence identity and showed structural
similarity to jacalin-related lectins. PALa contained peptide sequences
exactly matching those found in the isolated lectin. PALa and PALb were
expressed in Escherichia coli using pET-22b(+) vector and
purified by one-step affinity chromatography. Native and recombinant
forms of PAL agglutinated rabbit erythrocytes and precipitated
with yeast mannan, dextran, and the high mannose-containing
glycoprotein invertase. The detailed carbohydrate-binding properties of
the native and recombinant lectins were elucidated by agglutination
inhibition assay, and native lectin was also studied by isothermal
titration calorimetry. Based on the results of these assays, we
conclude that this primitive vascular plant, like many higher plants,
contains significant quantities of a mannose/glucose-binding protein in
its storage tissue, whose binding specificity differs in detail from
either legume mannose/glucose-binding lectins or monocot
mannose-specific lectins. The identification of a jacalin-related
lectin in a true fern reveals for the first time the widespread
distribution and molecular evolution of this lectin family in the plant kingdom.
Lectins are proteins (or glycoproteins), other than antibodies and
enzymes, that bind specifically and reversibly to carbohydrates, resulting in cell agglutination or precipitation of polysaccharides and
glycoconjugates (1). They are ubiquitous in the biosphere, having been
found in viruses, bacteria, fungi, plants, and animals (2). Among the
divisions of the plant kingdom, the Pteridophyta, which includes the
class Filicinae, or true ferns, have been largely overlooked in the
study of lectins.
Lectins of known specificity serve as valuable reagents in
glycobiological research. They can be employed for the detection and
preliminary characterization of glycoconjugates on the surface of
cells. Although many lectins belong to the same major specificity group
of mannose- or mannose/glucose-binding lectins, their different reactivities toward more complex oligo- and polysaccharides render many
of them specifically valuable for recognizing a particular type of
saccharide structure and fuel the search for yet more novel lectins
(3). Lectins are found in greatest quantity and are most readily
purified from plant sources, especially storage tissues such as seeds,
bark, bulbs, rhizomes, etc. Many lectins have been isolated and
characterized from angiosperm subdivision of seed plants. On the basis
of structural and evolutionary development, most of these plant lectins
have been classified into seven families: legume lectins,
chitin-binding proteins, type 2 ribosome-inactivating proteins, monocot
mannose-binding lectins, amaranthins, curcurbitaceae phloem lectins,
and jacalin-related lectins
(JRLs)1 (4). Each family has
its own characteristic carbohydrate recognition domain. Jacalin, the
prototype of JRLs, was isolated from seeds of jack fruit
(Artocarpus integrifolia; Moraceae) (5). Subsequently, JRLs
have also been isolated and characterized from various plant families
of angiosperms such as Convolvulaceae (6), Asteraceae (7), Gramineae
(8, 9), Musaceae (10-12), Fagaceae (13), and Mimosaceae (14). Although
JRLs are widely distributed in higher plants, no information on JRLs
outside of angiosperms is available except for a recently isolated
lectin from the Japanese cycad (Cycas revoluta) of
gymnosperm subdivision (15).
In an ab initio search for lectins in understudied groups of
plants, we examined the large, fleshy, mesoterranian rhizomes of the
tropical fern Phlebodium aureum for the presence of
cell-agglutinating activity. We report herein the purification of
P. aureum lectin (PAL), a mannose/glucose-specific lectin
present in the rhizomes of this member of the Polypodiaceae family, as
well as the cDNA cloning, expression, and characterization of this
mannose/glucose-binding lectin and a closely related protein also
having lectin activity. cDNA sequencing revealed that these fern
lectins are novel members of the JRLs. This is the first report of the
molecular cloning of JRLs from a lower plant, fern, which shows the
structural and evolutionary relationship of JRLs in the plant kingdom.
The two lectin genes were expressed in E. coli, and their
physicochemical characterization is described and compared with the
native lectin. This expression system should also be useful for
mutagenesis studies to elucidate the structure-function relationship of JRLs.
Rhizomes of Phlebodium aureum (L) J. Smith (also
classified as Polypodium aureum L.) were collected from a
specimen plant growing in the greenhouse at the Matthaei Botanical
Gardens of the University of Michigan. Positive identification was
provided by Dr. David Michener, collections curator of the botanical gardens.
Unless stated otherwise, saccharides and their derivatives and
glycoproteins were purchased from Sigma. Ovine submaxillary mucin was a
gift of Dr. R. N. Knibbs (University of Michigan). Mannose-Sepharose, prepared by divinyl sulfone coupling of mannose to
Sepharose CL-4B (16), and yeast invertase-Sepharose, prepared using
cyanogen bromide-activated Sepharose, were available from previous studies.
Purification of the Lectin--
All procedures were conducted at
4 °C. Pieces of rhizome from P. aureum were scraped to
remove the soft, fuzzy layer and chopped into approximately 5-mm cubes.
The light green chopped tissue (146 g fresh weight) was homogenized and
extracted for 2-3 h with 600 ml of extraction buffer (PBS (10 mM sodium phosphate, 0.15 M NaCl, 0.135 mM CaCl2, 0.04% sodium azide, pH 7.2)
containing 10 mM thiourea, 0.25 mM
phenylmethylsulfonyl fluoride, and 1 g/liter ascorbic acid), with the
addition of 10 g of poly(vinylpolypyrrolidone). The homogenate was
squeezed through four layers of cheesecloth and centrifuged at
20,000 × g for 20 min. To the supernatant solution was
added solid ammonium sulfate to 10% saturation. After stirring overnight, any precipitate was removed by centrifugation, and the
supernatant was filtered through coarse filter paper to remove a small
amount of floating debris and was made 80% saturated with ammonium
sulfate. After stirring for several hours followed by centrifugation,
the precipitated protein was dissolved in approximately 60 ml of PBS,
dialyzed against 2-3 2-liter changes of PBS, and clarified by
centrifugation. This 10-80% precipitated protein solution was applied
onto a column (14 × 2.5 cm; bed volume of 68 ml) of
mannose-Sepharose, which had been equilibrated with PBS. The column was
washed with PBS until the absorbance of the effluent at 280 nm
decreased to a minimum value. The affinity-adsorbed lectin was desorbed
with 0.1 M Me Protein and Carbohydrate Estimations--
Protein concentration
was determined by a modified method of Lowry et al. (17),
using bovine serum albumin as a standard. Total neutral sugar was
determined colorimetrically by the phenol/sulfuric acid method (18).
Specific sugars were identified on reverse-phase HPLC by the method of
Fu and O'Neill (19).
Polyacrylamide Gel Electrophoresis in the Presence of
SDS--
SDS-PAGE was carried out on 0.75-mm slab gels in alkaline
buffer system (Tris/glycine, pH 8.3) (20), using a mini-Protean II
apparatus (Bio-Rad). BenchMark protein molecular mass standards used in
SDS-PAGE were from Invitrogen.
Hemagglutination Assay--
The hemagglutinating activity of the
lectin was determined by a 2-fold serial dilution procedure using
formaldehyde-treated (21) human and rabbit erythrocytes as described
previously (22). The hemagglutination titer was defined as the
reciprocal of the highest dilution exhibiting observable
hemagglutination. Inhibition of agglutination by haptenic saccharides
was assayed by serially diluting the solution of saccharide in the
microtiter wells, followed by the addition of four agglutinin units of
the lectin, followed by the addition of erythrocyte suspension after 30 min. The lowest concentration of saccharide that visibly decreased the
extent of agglutination was defined as the minimum inhibitory concentration.
Molecular Mass and Subunit Structure--
The molecular mass and
subunit structure of purified P. aureum lectins were
determined by gel filtration through a G2000-SWXL Progel-TSK column
(30 × 0.78 cm; Supelco, Bellefonte, PA) using a Beckman System
Gold HPLC system as described previously (23) and by SDS-PAGE performed
on samples with and without heating for 5 min in boiling water and in
the presence or absence of 2-mercaptoethanol.
Amino Acid Composition Analysis and N-terminal Sequence
Analysis--
The amino acid composition and the N-terminal
sequence of the purified lectin or peptides therefrom were analyzed by
the University of Michigan Protein and Carbohydrate Structure Core Facility.
Quantitative Precipitation and Hapten Inhibition
Assays--
Quantitative precipitation assays were performed by a
microprecipitation technique as described previously (22). Briefly, varying amounts of glycoproteins or polysaccharides, ranging from 0 to
100 µg, were added to 50 µg of purified PAL in a total volume of
250 µl of PBS, pH 7.2. In some experiments, 20 µg of lectin in a
total volume of 120 µl was used. After incubation at 37 °C for
1 h, the reaction mixtures were stored at 4 °C for 48-72 h. The precipitates formed were centrifuged, washed two times with 400 µl of ice-cold PBS, dissolved in 0.05 M NaOH, and
evaluated for protein content by the Lowry method (17) using bovine
serum albumin as a standard.
Hapten inhibition was performed in the same system with increasing
amounts of potentially inhibitory saccharides added to the reaction
mixture containing 50 µg of the purified lectin and 8 µg of
precipitating polysaccharide in 250 µl. The concentration of
saccharide required for 50% inhibition was interpolated from corresponding inhibition curves.
Isothermal Titration Calorimetry--
Isothermal titration
calorimetry was carried out, and results were calculated as previously
described (11) using lectin concentrations of approximately 4 mg/ml,
equivalent to a subunit concentration of approximately 0.25 mM. Titrations generally were conducted by 25 additions of
5 µl of ligand solutions having concentrations between 1 and 50 mM, depending on the expected range of binding constant.
RNA Isolation and cDNA Cloning--
For RNA isolation,
chopped rhizome tissue was immediately ground to a powder with a pestle
under liquid nitrogen. Total cellular RNA was isolated with Concert
Plant RNA reagent (Invitrogen), and subsequently poly(A)+
RNA was isolated with the Micro-FastTrack 2.0 kit (Invitrogen). Using
this protocol, 1 µg of poly(A)+ RNA per 10 g of
rhizome was isolated.
An adapter ligated cDNA library was constructed with the Marathon
cDNA amplification kit (Clontech, Palo Alto,
CA). Two degenerate forward primers (PALF1,
CARGTNGTNTAYGGNAAYGGNACNACNAAR; PALF2, GCNAAYGGNCARACNAARGARATHGAYGTN)
were designed from the amino acid sequence VNGLQVVYGNGTTKLHGXANGQTKEIDV
of a cyanogen bromide cleavage fragment of fern lectin for rapid
amplification of cDNA ends (RACE). 3'-RACE was conducted with a
combination of primers, adapter primer 1 (Invitrogen) and PALF1, and
Platinum Pfx DNA polymerase (Invitrogen) as follows. DNA was
denatured at 94 °C for 3 min, followed by three-step cycles (40 cycles) (92 °C for 0.5 min, 50 °C for 0.5 min, and 68 °C for 1 min), and further extended at 65 °C for 15 min. This amplified DNA
fragment was subsequently amplified with adapter primer 2 (Invitrogen)
and PALF2. The amplified 0.5-kbp fragment was cloned using Zero Blunt
TOPO PCR cloning kit (Invitrogen). Inserted DNA was sequenced with T7
and SP6 primers by the DNA Sequencing Core Facility of the University
of Michigan, and two similar but different genes (termed PALa and PALb)
including poly(A)+ were obtained. Two specific reverse
primers for each gene (PALaR1, GCCTAGTAAAGCGACCGACATGGCTACAAGAGCGCTAC; PALbR1,
GACATAGAGGCCGAGGCGATCCAAACGGTCTCC) were designed, and 5'-RACE was
conducted with adapter primer 1 and PALaR1/PALbR1, respectively.
Construction, Expression, and Purification of Recombinant Fern
Lectin--
The full-length coding sequence PCR products of PALa and
PALb incorporating NdeI and XhoI sites into its
forward and reverse primers, respectively, were cloned into pCR-Blunt
II-TOPO vector (Invitrogen) and subsequently cloned into expression
vector pET-22b(+) (Novagen) to generate carboxyl-terminally
His6-tagged proteins, yielding pET-PALa and pET-PALb,
respectively. The Nova Blue (DE3) strain of E. coli
harboring expression plasmid pET-PALa and pET-PALb was precultured in 5 ml of LB medium containing 50 µg/ml ampicillin at
37 °C for 3 h and was added to 1 liter of medium.
After the optical density at 600 nm reached 0.4-0.6, 1 ml of 1 M isopropyl-D-thiogalactoside was added to the
medium, and the cells were further cultured at 25 °C for 6 h.
The induced cells were collected by centrifugation, resuspended in a
lysis buffer (PBS, containing 10 mM
2-mercaptoethanol, 1% Nonidet P-40, and 1 mM
phenylmethylsulfonyl fluoride), and sonicated. The insoluble fraction
was removed by centrifugation at 10,000 × g for 30 min
at 4 °C. Recombinant PALa (rPALa) and recombinant PALb
(rPALb) were purified from the soluble fraction by absorption on a
mannose-Sepharose 4B column and elution by 0.2 M Me
Effect of Temperature and pH--
To examine their
thermostability, lectin solutions (0.1 mg/ml in PBS) were incubated for
various periods at 40, 50, 55, 60, or 70 °C. After 10 µl of lectin
solution was cooled on ice, its hemagglutination activity was assayed
as described above. pH stability of the lectins were determined in the
following buffers: 0.1 M glycine-HCl buffer (pH 2.0-3.0),
0.1 M sodium acetate buffer (pH 4.0-5.0), 0.1 M sodium phosphate buffer (pH 6.0-7.0), 0.1 M
Tris-HCl buffer (pH 8.0-9.0), and 0.1 M glycine-NaOH
buffer (pH 10.0). Lectin solution (10 µl) was incubated with 10 µl
of buffer at 4 °C overnight. After adjusting to pH 8.0 by the
addition of 30 µl of 1 M Tris-HCl buffer, pH 8.0, the
hemagglutination activity of the lectin was assayed as described above.
Sequence Data Processing--
Multiple sequence alignment was
performed by the ClustalW program (25). Homologous sequences were
searched for by the FASTA program. A phylogenetic tree was constructed
by the neighbor-joining algorithm based on an evolutionary distance
matrix constructed by Kimura's method (26) The degrees of confidence
for internal lineages in phylogenetic trees were calculated by the
bootstrap procedure.
Hemagglutinating Activity--
Crude extracts from P. aureum rhizomes weakly agglutinated formaldehyde-stabilized rabbit
erythrocytes (titer = 32-64) but not sheep nor any type of human
erythrocytes. After purification as described below, the lectin
agglutinated rabbit erythrocytes at a minimum concentration of 1 µg/ml (titer at 4 mg/ml = ~4,000), whereas sheep or any type
of human erythrocytes required approximately 150 µg/ml for
agglutination (titer at 4 mg/ml = ~64). Lectin that was dialyzed
extensively against metal-free, EDTA-containing buffer and assayed in
the same buffer had identical hemagglutination titer against rabbit
erythrocytes, indicating that it has no requirement for metal ions.
Purification of Native Fern Lectin--
Because the
hemagglutination activity of crude extracts of P. aureum was
inhibited by D-mannose, mannose-Sepharose was used as an
affinity absorbent for isolation of the lectin. After elution of
nonabsorbed protein from the mannose-Sepharose column, 0.1 M Me Molecular Mass and Subunit Structure--
The molecular mass was
also estimated by size exclusion chromatography on a silica-based
matrix. The purified lectin migrated as a single, nearly symmetrical
band of approximately 31 kDa, based on standardization with known
proteins (data not shown). Together with the SDS-PAGE analysis, these
results indicate that the lectin exists as a dimer of approximately
15-kDa subunits that requires boiling in SDS to dissociate completely.
Amino Acid Composition and N-terminal Amino Acid Sequence--
The
amino acid composition of the purified fern lectin (data not shown)
indicated that it contains a single residue each of methionine and
histidine and the typically large amounts of aspartic acid/asparagine,
serine, and glycine observed in many other lectins. Attempts to
sequence the N-terminal region were not successful; however,
after cyanogen bromide cleavage, a large peptide having the
N-terminal sequence
VNGLQVVYGNGTTKLHGXANGQTKEIDV was detected. Cleavage with
Achromobacter protease I yielded a peptide with the
partial sequence LGPWGGSGGDSFDDGSDNGG.
Carbohydrate Analysis--
No periodate-Schiff staining bands were
observed on SDS-polyacrylamide gels of the purified native lectin,
although a small amount of neutral sugar (approximately 0.8-1.5
hexose units/subunit) was detected in some preparations at high
concentration by the phenol/sulfuric acid assay. Analysis of such PAL
preparations by the method of Fu and O'Neill (19) indicated primarily
mannose to be present. Although the partial sequence shown above
contains a putative glycosylation sequence (NGT), the asparagine
residue must be largely or totally nonglycosylated to be detected by
automated sequencing. Most likely, the mannose arises from trace
amounts of endogenous mannan or high mannose glycoprotein contaminants, which remain associated with the lectin during the purification procedures, but the lectin itself is not glycosylated.
Inhibition of Agglutination--
The ability of a number of mono-
and oligosaccharides to inhibit agglutination of formaldehyde-treated
rabbit erythrocytes is shown in Table I.
It is evident that branched mannose oligosaccharides are the best
inhibitors, whereas glucose-containing disaccharides were much less
effective. This result indicates that PAL is a mannose/glucose-binding
lectin.
Quantitative Precipitation and Precipitation Inhibition--
In
qualitative precipitin tests in capillary tubes, mannans from
Saccharomyces cerevisae and Saccharomyces rouxii
and dextran B-1355-S from Leuconostoc mesenteroides (27)
gave visible precipitation, whereas many other polysaccharides,
glycoproteins, and neoglycoproteins did not. Quantitative precipitin
assays (Fig. 3) confirmed that the two
yeast mannans precipitated to a significant extent with an equal weight
of lectin; dextran B-1355-S at 3-4-fold higher concentration by weight
also strongly precipitated the lectin. Two other dextrans from L. mesenteroides, B-742-S and B-742-L (27), partially precipitated
the lectin at much higher concentrations. Among glycoproteins, only
yeast invertase, a high mannose glycoprotein, partially precipitated
the lectin. Soybean agglutinin, which also contains a high mannose
glycan, was inactive. Precipitation of yeast mannan was inhibited 50%
by Man3 at 3.1 mM, mannose at 19 mM, Me Titration Calorimetric Determination of Carbohydrate
Binding--
Thermodynamic parameters for the binding of various
mannose and glucose-containing saccharides are shown in Table
II. These results also agree with the
previous data, confirming that the branched mannose trisaccharide and
pentasaccharides are the best ligands, with the additional mannose
units strongly enhancing the binding.
Molecular Cloning of Fern Lectin--
3'-RACE with the adapter
primers and the degenerate primers that were designed from the cyanogen
bromide fragment yielded a 0.5-kbp product. Of eight clones sequenced,
seven were identical (PALa), whereas one clone contained a similar but
apparently different sequence (PALb). Cloning and sequencing of 5'-RACE
products generated two full-length nucleotide sequences including
polyadenylation. PALa contains a 24-bp 5'-untranslated region, followed
by a 438-bp open reading frame encoding 146 amino acid residues and 272 bp 3'-untranslated region, whereas PALb contains a 5-bp 5'-untranslated region, followed by a 438-bp open reading frame encoding 146 amino acid
residues and 275-bp 3'-untranslated region (Fig.
4). Neither contain an adenylation signal
sequence. Since the isolated lectin contains only one methionyl
residue, the N-terminal methionine of mature lectin has been
removed, resulting in N-terminal serine. The calculated
molecular masses of PALa (14,854 Da) and PALb (14,895 Da)
without N-terminal Met are in good agreement with the
molecular mass of native fern lectin (nPAL) (14,903 Da) determined by
matrix-assisted laser desorption ionization time-of-flight mass
spectrometry. Since nPAL appears to be blocked at its N terminus, the
slightly higher molecular mass of nPAL than the calculated molecular
mass of PALa is probably due to the presence of a blocking group, such as an N-acetyl moiety (M = 42 kDa) present
on the native lectin.
The deduced amino acid sequence of PALa contains the same sequences as
those found in the native fern lectin, but PALb contains a slightly
different sequence (Fig. 4), suggesting that the PALa gene encodes the
native PAL. No signal sequence could be discerned in the deduced amino
acid sequences of either PAL gene, indicating their syntheses on free
polysomes. PALa and PALb have two and one potential N-linked
glycosylation site (NX(S/T)), respectively in the sequences.
Construction, Isolation, and Characterization of Recombinant Fern
Lectin--
To express recombinant PALa (rPALa) and PALb (rPALb), the
entire open reading frames of each were cloned into expression vector pET-22b(+) and introduced into E. coli strain Nova Blue
(DE3) cells. Active recombinant lectins expressed as carboxyl-terminal His6-tagged fusion proteins were purified from E. coli extract by a single chromatographic step on a
mannose-Sepharose 4B column. The yields of rPALa and rPALb purified by
affinity chromatography were each approximately 4 mg from 1 liter of culture.
The N-terminal amino acid sequences of rPALa
(H2N-SSAGSEVAKLGPWGGSGGDS) and rPALb
(H2N-SSASSEVAKLGPWGGSGGDS), determined by a gas phase
protein sequencer without pretreatment, indicated that the initial
methionine of these proteins was also removed in the bacterial
expression system but that no N-terminal blocking occurred.
SDS-PAGE analysis of the recombinant lectins was compared with that of
native lectin (Fig. 5; cf.
Fig. 2). The two recombinant lectins gave virtually the same pattern of
bands as did the native lectins in both unheated and heated samples,
except for the absence of minor contaminating or isolectin
bands in the recombinant samples. After boiling for 5 min
either in the presence or in the absence of 2-mercaptoethanol in SDS
sample buffer, the three forms each gave a single band at about 14 kDa
(nPAL) or 14.5 kDa (rPALs), respectively. The slightly greater apparent
size of the recombinant subunits is accounted for by the presence of
the His6 tags. Likewise, size exclusion chromatography of
intact recombinant lectins in solution gave elution profiles
indistinguishable from that of the native lectin, indicating each to
have a molecular mass of ~31 kDa.
The minimum concentration for hemagglutination activity of rPALa and
rPALb against formaldehyde-treated rabbit erythrocytes was estimated to
be 0.6 µg/ml, which is not significantly different from the native
fern lectin (1 µg/ml). Sugar-binding specificities (estimated by
inhibition of hemagglutination) of recombinant fern lectins, especially
rPALa, were very similar to the native lectin (Table I). The branched
oligomannosides M5 and M3, as well as Man
rPALa generated quantitative precipitation curves with the same yeast
mannans and dextran 1355-S as did native PAL (Fig. 3). Interestingly,
rPALa also gave a modest precipitin curve with rabbit liver glycogen,
whereas native PAL gave no appreciable precipitation. rPALb
precipitated neither dextran 1355-S nor glycogen (Fig. 3B).
Native and recombinant fern lectins showed similar stability to pH and
temperature. No appreciable change was observed in the hemagglutinating
activity of lectins preincubated in a pH range from 4 to 9, and they
retained more than half of their activity at pH 2.0, 3.0, and 10.0. In
contrast, the lectins are less stable to heat; all forms retained their
activity up to 50 °C but lost half of their activity within 15 min
at 60 °C.
The so-called "primitive" vascular plants (ferns and fern
allies) have only occasionally been investigated for the presence of
lectins, despite the widespread occurrence of high levels of lectins in storage tissues (seeds, bark, rhizomes, bulbs, etc.) of
flowering plants and the carpophores of fungi and the almost universal
occurrence of low levels of lectins and related proteins in all types
of plant tissues, animals, and microorganisms. Mellor and co-workers
(28) purified a hexameric 120-kDa lectin from the
Azolla-Anabaena symbiosis and, at lower levels, from
nonsymbiotic Azolla (Salviniaceae) plants. This lectin was
inhibited by galactose and more weakly by GalNAc but not by
lactose. A brief report by Vasheka et al.
(29) showed the presence of agglutinating activity toward rat
erythrocytes in the rhizomes of three species of Dryopteris (Polypodiaceae) ferns; in one of the species, an extract of the fronds
also had high activity. These activities were not purified; nor was any
carbohydrate specificity established. Both of these genera are in the
class of true ferns, Filicinae. To our knowledge, no other reports of
lectins in true ferns or fern allies have been made. This report thus
represent the most detailed and extensive investigation of a lectin
from the plant division Pteridophyta to date.
Agglutination inhibition, precipitation, and calorimetric titration
data all indicate that PAL is a mannose/glucose-binding lectin,
although its affinity for glucose is considerably weaker than typical
mannose/glucose-binding legume lectins. Mannose-binding legume lectins
typically have affinities for glucose of 20-50% that of mannose,
whether comparing the free sugars or the Me By definition, a lectin is a sugar-binding protein or glycoprotein of
nonimmune origin that agglutinates cells and/or precipitates glycoconjugates (1). In order to form detectable precipitate, however,
both the lectin and the glycoconjugate must be multivalent and
must be mixed in an appropriate stoichiometric ratio. Furthermore, in
order to form the cross-linked aggregates necessary for precipitation, at least one of the components (lectin or polymeric ligand) must possess three or more binding sites; otherwise, only linear,
nonprecipitating aggregates can form. The strong precipitation of yeast
mannan is readily understandable. Likewise, yeast invertase contains 9-10 N-linked glycan structures/polypeptide, each
containing 26-54 mannose residues/residue of
N-acetylglucosamine (31, 32), which provides a high density
of branched mannose structures for cross-linking. On the other hand,
soybean agglutinin contains one Man9GlcNAc2
structure per subunit of a tetrameric protein and is readily
precipitated by concanavalin A (2). It fails to precipitate PAL,
however, suggesting that this lectin does not bind as tightly, either
because of differing fine specificity or poorer accessibility of the
binding sites than in the case of concanavalin A. Bovine ribonuclease B
possesses a single Man6GlcNAc2 structure per
15-kDa monomer (33) and thus would not be expected to precipitate with
the lectin in any case. Although glucose and its oligosaccharides are
very poor ligands, highly branched glucan structures might
provide sufficient binding interactions to precipitate the lectin. The
highly branched dextran B-1355-S, which contains almost equal amounts
of Estimates of relative binding (or dissociation) constants for mono- and
oligosaccharides by inhibition of erythrocyte agglutination, direct
calorimetric titration, and inhibition of mannan precipitation are in
good agreement, although absolute values vary with the assay system
used. To the limited extent that precipitation inhibition assays have
been carried out, inhibition constants are considerably higher
(e.g. 3 versus 0.1 mM for
Man3 and 80 versus 1-1.6 mM for Me
It is clear from Tables I and II that the most favorable structural
element for binding is the Man The complete amino acid sequences of two closely related gene products
were deduced from clones of two full-length cDNAs, termed PALa and
PALb, obtained by 5',3'-RACE procedure using primers designed from the
amino acid sequence of a cyanogen bromide cleavage fragment. The
subunits of these proteins were composed of 146 amino acid residues
each, with 88% sequence identity (Fig. 4).
A FASTA search revealed that PAL shows extensive sequence identities
(25-33% identity) with JRLs from the seeds of jackfruit (A. integrifolia; Jacalin and KM+) (34, 35), Osage orange (Maclura pomifera; MPA in Fig.
6) (36), and the bark of black mulberry
tree (Morus nigra; MornigaG and
MornigaM) (37) of Moraceae, rhizomes of hedge bindweed
(Calystegia sepium; Calsepa) of Convolvulaceae (6), tubers of the Jerusalem artichoke (Helianthus
tuberosus; Heltuba) of Asteraceae (7), leaves from salt-stressed
rice (Oryza sativa; Orysata) of Gramineae (8, 9),
pulp of banana (Musa acuminata; BanLec) fruits of
Musaceae (10), seeds of Japanese chestnut (Castanea crenata;
CCA) of Fagaceae (13), and seeds of Parkia
platycephala (Pk) of Mimosaceae (14). Multiple sequence alignment of PALa and PALb with previously isolated JRLs indicated that
only 10 amino acid residues are invariant within amino acid sequences
of isolated JRLs (Fig. 6). These key residues, consisting mainly of
glycine and aromatic residues, are important for making the compact
The mannose-binding site of Heltuba consists of five residues
(Gly18, Gly135, Asp136,
Val137, and Asp139) linked to O-3, O-4, O-5,
and O-6 of mannose by creating a network of eight hydrogen bonds
as shown by x-ray crystallographic
studies (24). In addition, Met92 mediates
hydrophobic interaction with the pyranose ring of mannose. Four of
the six amino acid residues are conserved in the PAL polypeptide (Gly18, Gly132, Asp133,
Asp136), although the replacement of Met92 and
Val137 of Heltuba with Gly89 and
Arg134 of PAL was observed (Fig. 6). The difference in
sugar binding specificity between Heltuba and fern lectin might be
caused by the replacement of these key residues. Man JRLs have been classified as galactose-specific (gJRLs) and
mannose-specific (mJRLs) according to their sugar specificities, which
relate to a specific structural difference. gJRLs including Jacalin and
M. pomifera lectin are built up of cleaved protomers consisting of a Although the physiological function of the JRLs is not known, there are several possibilities. mJRLs have been thought to be stress-responsive proteins. A JRL from rice is identical to a salt and drought stress-inducible salT gene product, and this lectin is expressed only after induction by either jasmonate or NaCl. Myrosinase-binding proteins from B. napus, which contain one or two jacalin-related lectin domains in the sequences, are also stress-inducible. mJRLs are also assumed to be self-defense proteins because of their binding affinity to mannose, which is a relatively scarce sugar in plants but is widely distributed in microorganisms, insects, and animals. The expression system of PALa and PALb containing carboxyl-terminal
His6 tags in E. coli was constructed, and their
sugar-binding specificity and physicochemical characteristics were
compared with those of the native lectin isolated from fern rhizomes.
The studies indicated that rPALa and rPALb resemble the native lectin in most respects. It is not surprising that rPALb had similar sugar
binding specificity to rPALa, because they share high (88%) sequence
identity and conserve all key amino acids among JRLs (Figs. 4 and
6). rPALa gave precipitin curves with the highly branched
The identification of a JRL in a true fern further expands the
widespread distribution of JRLs in the plant kingdom. Because fern
lectin is probably the closest known relative of the common ancestor of
JRLs, the finding of JRLs from ferns might help to explain the original
function of JRLs in plants. Although the specificity of PAL as detailed
here does not suggest any unique utility of this particular lectin at
this time, its distinct character is nevertheless of interest in
understanding lectin binding interactions. Recombinantly expressed fern
lectins will be useful for such investigations by site-directed
mutagenesis. Their applications in biological and medical research by
virtue of their specificities toward mannose and oligomannosides and
their ease of preparation as recombinant expression proteins from
E. coli by one-step affinity chromatography might also
be significant.
We thank Dr. David Michener (University of Michigan Matthaei Botanical Gardens) for identification of P. aureum.
* This work was supported by National Institutes of Health Grant GM29470.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB099932 (PALa) and AB099933 (PALb).
§ To whom correspondence should be addressed: Dept. of Biological Chemistry, University of Michigan, Medical School, Ann Arbor, MI 48109-0606. Tel.: 734-763-3511; Fax: 734-763-4581; E-mail: igoldste@umich.edu.
Published, JBC Papers in Press, January 21, 2003, DOI 10.1074/jbc.M211840200
The abbreviations used are:
JRL, Jacalin-related
lectin;
gJRL, galactose-specific JRL;
mJRL, mannose-specific JRL;
PAL, P. aureum lectin;
rPAL, recombinant PAL;
nPAL, native
PAL;
PBS, phosphate-buffered saline;
Man3, Man
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||