|
Originally published In Press as doi:10.1074/jbc.M202347200 on January 16, 2003
J. Biol. Chem., Vol. 278, Issue 13, 10900-10907, March 28, 2003
Mitochondrial and Nuclear Localization of Topoisomerase II in
the Flagellate Bodo saltans (Kinetoplastida), a Species
with Non-catenated Kinetoplast DNA*
Ivana
Ga iová and
Julius
Luke §
From the Institute of Parasitology, Czech Academy of Sciences and
Faculty of Biology, University of South Bohemia,
37005 eské Bud jovice, Czech Republic
Received for publication, March 11, 2002
 |
ABSTRACT |
We have studied topoisomerase II (topo II) in the
cells of Bodo saltans, a free-living bodonid
(Kinetoplastida). Phylogenetic analysis based on the sequence of the
entire topo II gene, which is a single-copy gene, confirmed that
B. saltans is a predecessor of parasitic trypanosomatids.
Antibodies generated against either an overexpressed unique C-terminal
region of topo II or a synthetic oligopeptide derived from the same
region did not cross-react with cell lysates of related
trypanosomatids, while they recognized a single specific band in the
B. saltans lysate. Immunolocalization experiments
using both antibodies showed that topo II is evenly dispersed
throughout the kinetoplast. This is in striking difference from the
localization of topo II in other flagellates, where it occurs in two
antipodal centers flanking the kinetoplast disk. Moreover, the same
topo II has a distinct localization in multiple loci at the periphery
of the nucleus of B. saltans. With a minicircle probe
derived from the conserved region we have shown that all relaxed
non-catenated minicircles are confined to the globular kinetoplast DNA
bundle. Therefore, in the mitochondrion of this primitive eukaryote
topo II does not catenate relaxed DNA circles into a network in
vivo, while a decatenating activity is present in partially
purified cell lysates.
 |
INTRODUCTION |
Topoisomerase II (topo
II)1 is a ubiquitous enzyme
that catalyzes strand passing of double-stranded DNA in an
ATP-dependent manner. It is involved in a number of
processes, including replication and transcription of nuclear and
mitochondrial DNA, chromosome segregation, and chromatin organization
(1).
Topo II is an important component of the kinetoplast-mitochondrion
organelle of the kinetoplastid protozoa. These flagellates represent
one of the most primitive groups of eukaryotes, equipped with a number
of unique features. Their mitochondrial DNA, termed kinetoplast (k)
DNA, contains up to 40% of total cellular DNA and is composed of
thousands of minicircles and dozens of maxicircles. Maxicircles encode
mitochondrial genes, the transcripts of which undergo extensive editing
of the uridine insertion/deletion type. Minicircles bear guide
RNA genes, which provide information for the editing process
(for recent review see Refs. 2 and 3).
The order Kinetoplastida is divided into the suborder Bodonina, which
comprises free-living commensalic or parasitic biflagellated species,
and the suborder Trypanosomatina, members of which are equipped with a
single flagellum and are obligatory parasitic. In the mitochondrion of
Trypanosomatina, the DNA molecules are present as relaxed circles
catenated into a single giant network (for recent review see Refs. 4
and 5). So far, topo II was studied in detail in the model
trypanosomatids Crithidia fasciculata and Trypanosoma
brucei, where it is involved in decatenation, replication, and
recatenation of the kDNA minicircles (6-8). The enzyme has also a very
characteristic localization in two opposing antipodal protein centers
(8). Topoisomerases are considered to be a prime target for the
antitrypanosomial (9, 10) and antileishmanial (11) therapy.
In primitive kinetoplastids that belong to the Bodonina, the kDNA is
composed of either large circles (~200 kb) bearing tandemly arranged
minicircle-like sequences, as is the case in Trypanoplasma borreli (12), or small circles (1.4-10.0-kb-long minicircles). In
Cryptobia helicis, these minicircles are supercoiled and
non-catenated (13), while they are relaxed and non-catenated in
Bodo saltans and Dimastigella spp. (14, 15).
B. saltans is a free-living omnipresent flagellate that
represents a significant component of the biological community of the
sewage cleaning technologies. As an evolutionary predecessor of
parasitic trypanosomatids (14, 16, 17), it qualifies as an important
model organism for the studies of RNA editing and kDNA structure (18).
Its minicircles encode classical guide RNA genes (14), which serve for
editing of the maxicircle-located genes that have a novel order and
editing pattern (19). Due to their function, proper replication and segregation of minicircles is therefore critical for the survival of
daughter cells.
Insight into the role of topo II in this primitive bodonid is important
for our understanding of evolution of catenation, replication, and
other exciting features of the kinetoplast. Herein, we present
characterization of the topo II gene of B. saltans and
novel localization of the protein in its mitochondrion and nucleus.
Surprisingly, topo II is dispersed throughout the kinetoplast bundle,
despite the absence of a catenated kDNA network in this species. This
suggests a significant functional difference between the B. saltans and trypanosomatid topoisomerases.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Cultivation of B. saltans, strain
K1 isolated from Lake Konstanz, Germany, was up-scaled to obtain
sufficient amount of cells (108-109) and
performed essentially as described (19). Feeder bacteria Alcaligenes xylosoxidans denitrificans were carefully
removed by repeated overnight sedimentation in columns at 4 °C
followed by multiple differential sedimentation of bacteria and
flagellates during centrifugations. C. fasciculata,
Leishmania tarentolae, and T. brucei were
cultivated according to standard protocols.
Construction and Screening of the Genomic Library--
Total DNA
of B. saltans was isolated as described elsewhere (14,
19). The 1.5-kb-long ATP-binding domain of the topo II gene of B. saltans (BstopoII) was PCR-amplified with degenerate oligonucleotides 12C6
(CATGT(A/C)CT(C/G)(A/C)T(A/G)(C/A)(G/A)CC(G/A)GAGA(T/C)GTAC) and
12C7 (CC(A/G)TC(T/G)GC(A/G)TCCTG(A/C)TC(T/G)GTCAT(G/A)A) using the
following program: 94 °C for 1 min, 54 °C for 1 min, and 72 °C
for 2 min (30 cycles). The amplicon was cloned into the pBluescript SK vector (Stratagene) and sequenced using the Prism
DyeDeoxy Terminator Cycle Sequencing Kit (PerkinElmer Life
Sciences). A genomic library was constructed using partially
Sau3AI-digested DNA that was, after phenol-chloroform
extraction and ethanol precipitation, ligated into the
BamHI-digested GEM11 vector arms and subsequently packaged using the Packagene extract (Promega) and amplified in the
MB406 Escherichia coli cells. The resulting library
contained ~1.25 × 105 plaque-forming units, and
half of it was screened with a fragment containing the ATP-binding
domain of the BstopoII gene radioactively labeled by nick translation.
Screening was performed in the hybridization solution (3× SSC, 5×
Denhardt's solution (0.1% Ficol, 0.1% BSA, 0.1% polyvinyl
pyrrolidone), 0.1% SDS, 25 µg/ml sheared herring sperm DNA, and 10%
dextran sulfate) at 65 °C overnight. The membranes were washed twice
in 3x SSC, 0.1% SDS, twice in 1x SSC, 0.1% SDS, twice in 0.3x SSC,
0.1% SDS, and twice in 0.1x SSC, 0.1% SDS, each wash at 65 °C for
20 min. Three positive plaques were purified by two rounds of plating
and hybridization. The recombinant phage DNA from two different
selected clones was analyzed by Southern hybridization after the
digestions with EcoRI, BamHI, HindIII, SacI, and SalI, resolved on 0.75% ethidium
bromide-stained agarose gel, transferred to a Hybond N+
membrane (Amersham Biosciences), and hybridized with the same probe.
Hybridizing fragments were cloned into appropriately predigested pGEM11f or pGEM7f vectors (Promega) and sequenced.
Phylogenetic Analysis--
Additional topo II gene sequences
used in this work were retrieved from GenBankTM and
include: Leishmania infantum (AY004225), Leishmania
donovani (AF150876), Leishmania chagasi (O61078),
Crithidia fasciculata (P27570), T. brucei (P12531), Trypanosoma cruzi (P30190), Dictyostelium discoideum (P90520), Plasmodium
falciparum (P41001), Saccharomyces cerevisiae (P06786),
Schizosaccharomyces pombe (AL031174), Encephalitozoon
cuniculi (AL590444), Drosophila melanogaster (P15348),
Caenorhabditis elegans (Z49069), Sus scrofa
(O46374), and Homo sapiens (P11388) and (Q02880)
subunits. Multiple alignment of the amino acid sequences was performed
using the CLUSTAL W package (www.ddbj.nig.ac.jp/searches/e.html) and is available upon request. Maximum likelihood and maximum parsimony
analyses were performed using PUZZLE-TREE (20) and PAUP* (21),
respectively, with P. falciparum as an outgroup. The Dayhoff
amino acid substitution model and the model of rate heterogeneity with
 distribution in 10 rate categories, as implemented in PUZZLE-TREE,
were applied. The corresponding Quartet-puzzling and bootstrap analyses
included 1000 replicates.
Southern Hybridization and RT-PCR--
10-µg aliquots of total
genomic DNA of B. saltans were digested with
BamHI, EcoRI, SalI, SmaI,
and XhoI, separated on 0.75% ethidium bromide-stained
agarose gel, and blotted. A C-terminal region of BstopoII used for
expression (see below) was labeled with DIG/dUTP (Roche
Molecular Biochemicals) by PCR and used as a probe. Total cellular
mRNA was extracted from 1 × 108 exponentially
growing cells using the QuickPrep micro mRNA kit according to
manufacturer's instructions (Amersham Biosciences). The first cDNA
strand was synthesized from 300 ng of poly(A) using the SuperScript
Preamplification system (Invitrogen). Control was performed without the
addition of reverse transcriptase. Two primer pairs were used:
IK2-GCAAGGAGCTCTGTGATCTC (positions 1481-1500 within the coding
region) and IK6-CTTCTTGAGTTGCGTGTTCAG (positions 3091-3111), and IK20
and IK21 (positions 2896-2916 and 3572-3591; for sequences see
below). The PCR program consisted of 94 °C for 5 min followed by 35 cycles of 94 °C for 1 min, 62 °C for 1 min, and 72 °C for
90 s with a final extension 72 °C for 10 min.
Expression and Purification of Recombinant Protein--
A
700-bp-long fragment covering most of the C-terminal variable region of
BstopoII was PCR-amplified from the EcoRI genomic clone with
oligonucleotide
IK20-GCCATATGCATCATCATCATCATCATGCAGATTCCTCCGCAAGCCCC (containing the NdeI site that creates the initiation codon
and six histidine codons (underlined)) and
IK21-GCGGATCCTCAACGCACCACCATCTCCCCAG (containing the BamHI site and the stop codon (underlined)).
The amplicon digested with NdeI and BamHI was
gel-purified and cloned into the pRSET A expression vector (Invitrogen)
digested with the same restriction enzymes. The resulting expression
plasmid encoding the His6-3'-topo II end was transformed
into the E. coli strain BL21(DE3) (Novagen). 1 ml of
overnight culture was added to 0.5 liter of medium and incubated at
25 °C until A600 reached 1.0. Isopropyl-1-thio- -D-galactopyranoside was then added to a final concentration 0.05 mM, and the culture was grown
for another hour at 25 °C. The cells were collected by
centrifugation, resuspended in the 1× binding buffer (Novagen), and
lysed by the addition of 100 µg/ml lysozyme and three cycles of
freezing and thawing followed by sonication for 30 s. The
suspension was centrifuged, and the His-tagged overexpressed protein
was purified from the supernatant by the metal-chelate affinity
chromatography on a Ni2+ chelate resin under native
conditions as specified by the manufacturer (Novagen).
Preparation of Antibodies and Western Blotting--
Polyclonal
antibody BstopoII-1 was prepared by immunizing rabbit at 2-week
intervals with four subcutaneous injections of 0.5 mg of purified
recombinant topo II protein emulsified with complete (first injection)
and incomplete (following injections) Freund's adjuvant. Another
rabbit antibody (BstopoII-2) was raised against a synthetic
oligopeptide corresponding to the 1163-1177-amino acid region
(QRSNEKWKFFRRKKC) from the unique C terminus of the B. saltans topo II gene. The last cysteine was added to
enhance efficient conjugation of the synthetic peptide to ovalbumin.
Conjugation was performed as recommended by the manufacturer (Pierce).
Each injection, containing 0.3 mg of a conjugate of the synthetic
BstopoII peptide and ovalbumin, was injected into a rabbit following
the protocol described above. Serum was collected 7-10 days after the
third and fourth injections and was tested by Western blotting. Both
the His-topo II fusion protein and the synthetic peptide were
immobilized on the AminoLink Plus Coupling Gel (Pierce) and used for
affinity purification of both polyclonal antisera. Columns were washed
with 10 mM Tris (pH 7.5), equilibrated with 100 mM glycine (pH 2.5), and washed again with 10 mM Tris (pH 8.8). Following equilibration was made with 100 mM triethylamine (pH 11.5) and washed with 10 mM Tris (pH 7.5) until pH 7.5 was reached. The antisera
were diluted 10 times with 10 mM Tris (pH 7.5) and passed through the columns, which were than washed with 10 mM Tris
(pH 7.5). The majority of bound antibodies was eluted with 100 mM glycine (pH 2.5), and after a wash with 10 mM Tris (pH 8.8), the remaining antibodies were released
with 100 mM triethylamine (pH 11.5). The
antibody-containing fractions were pooled and dialyzed against PBS with
0.02% sodium azide. Cell lysates were prepared from the B. saltans, C. fasciculata, L. tarentolae, and
T. brucei cells at 1 × 107
cells/10 µl as described elsewhere (22), analyzed on a 8% SDS-PAGE gel, and blotted. The E. coli extracts containing
recombinant His-tagged protein (30 kDa) were analyzed on 12% SDS-PAGE
gels. Blots were probed with polyclonal antisera raised against either the fusion protein (BstopoII-1; 1:2000) or the synthetic peptide (BstopoII-2; 1:1000). The secondary anti-rabbit IgG antibody (1:4000) coupled to alkaline phosphatase was visualized according to
manufacturer's protocols using the ECL kit (Amersham Biosciences).
Immunocytochemistry--
Cells were partially purified from the
feeder bacteria by differential centrifugation and overnight
sedimentation and resuspended in PBS at a concentration 1 × 107 cells/100 µl. 20 µl of the cell suspension was
spotted onto poly-L-lysine-coated slides, and cells were
allowed to adhere for 20 min in a humidity chamber. The slides were
submerged into 4% paraformaldehyde in PBS for 3 min at room
temperature, and fixation was stopped by washing the slides with 0.1 M glycine, pH 8.6, in PBS for 5 min followed by two washes
in PBS for 5 min. Cells were permeabilized in 0.5% Tween 20 in PBS,
and the blocking solution (10% BSA and 10% goat serum) in a humid
chamber for 30 min at room temperature. After washing once in PBST
(0.05% Tween 20 in PBS) for 5 min, slides were incubated with the
affinity-purified primary antibody diluted in PBST (BstopoII-1; 1:100;
BstopoII-2; 1:20), and incubation was performed under the same
conditions for 2 h. Slides were washed four times in PBST 5 min
each and then incubated with the Cy3-conjugated goat anti-rabbit IgG
antibody (1:400; Amersham Biosciences) for 1 h at room temperature
in a humidity chamber. The incubation was followed by three washes in
PBST and one wash in PBS 5 min each at room temperature. Finally, the
slides were incubated in PBS containing 0.1 µg/ml DAPI for 3 min at
room temperature, rinsed with distilled water, and mounted into the
antifade Dabco (Fluka). The slides were examined with a Zeiss Axioplan
100 microscope, and black and white images were recorded with a cooled
charge-coupled device camera Mega F-View II (Soft Imaging Systems,
Munster), pseudo-colored, and superimposed with the aid of an
image-processing program Adobe PhotoShop version 5.0.
In Situ Hybridization with the Minicircle Probe--
The
minicircle conserved region of B. saltans (BSM1) was
amplified using the primers MB1 (GGGGTACCCCAGCGTTTTTGATGCTGTT) and MB2
(GGAATTCCCTCTTTCCCTGGTACT) derived from the available minicircle sequences (14). Biotin labeling of BMS1 (1 unit of Taq
polymerase, 5 µM each primer, 0.1 mM dATP,
dCTP, and dGTP, 0.065 mM dTTP, and 0.35 mM
Biotin-N6-dTTP (Renaissance, PerkinElmer Life Sciences)) was carried
out under the following conditions: 94 °C for 1 min, 55 °C for
1.5 min, and 72 °C for 2 min (30 cycles) with a final extension of
72 °C for 10 min. The amplicon was gel-purified before use. The
cells were processed and fixed as described for immunocytochemistry, but the fixation was stopped by washing the slides in the TN buffer (0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl). They
were then placed in a humidity chamber for the following incubations:
30 min at 37 °C in 100 µg/ml RNase A; 5 min at room temperature in
2× SSC; 10 min at room temperature in 4% formaldehyde; dehydrated and finally air-dried. After denaturation in the PCR buffer with
Mg2+ for 3 min at 94 °C and immediate dehydration in icy
methanol and air drying, the slides were incubated in the hybridization mix (50% formamide, 10% dextran sulfate, 12.5 µg of salmon sperm DNA, 0.125% SDS, and 1 ng of probe per slide; the probe was denatured at 76 °C for 15 min, cooled on ice, and supplemented with 2× SSC before use) overnight at 37 °C in a humidity chamber. They were washed in 2× SSC for 5 min at 39 °C, 50% formamide in 2× SSC for 10 min at 39 °C, 2× SSC for 5 min at room temperature (twice), and
the TN buffer for 1 min at room temperature. Detection was by the
Renaissance Tyramide Signal Amplification kit (PerkinElmer Life
Sciences) as follows: incubation in the TNB buffer (TN buffer + blocking reagent) for 30 min at 37 °C; streptavidin-horseradish peroxidase conjugate (diluted 1:100 in the TNB buffer) for 30 min at
room temperature; wash in the TNT buffer (TN buffer + 0.05% Tween 20)
trice for 5 min at room temperature; incubation with biotinyl
tyramide (diluted 1:50 in the amplification diluent) for 10 min at room
temperature; wash in the TNT buffer trice for 5 min at room
temperature; incubation with streptavidin-Texas Red (diluted 1:500 in
the TNB buffer) for 30 min at 37 °C, and final wash in the TNT
buffer trice for 5 min at room temperature. DNA was visualized with
DAPI (0.1 µg/ml) or YOYO1 (1 nM) staining, and the slides
were examined with a Zeiss Axioplan 100 microscope or a Zeiss LSM410
confocal microscope, respectively.
 |
RESULTS |
Isolation of the Topo II Gene and Sequence Analysis--
To
isolate the protein-coding region of the kinetoplast-associated type II
topoisomerase, we designed degenerate oligonucleotides based on the
multiple alignment of available topo II sequences of the
trypanosomatids T. brucei, C. fasciculata, and
T. cruzi, and PCR-amplified a conserved 1.5-kb-long
ATP-binding region located in the N-terminal part of the gene (Fig.
1A). The PCR
product of expected size was cloned, sequenced, and found to have a
high similarity to the topo II of trypanosomatids. Next, we prepared a
genomic library from the total DNA of B. saltans and
more than 50,000 plaque-forming units were screened with the
amplicon as a probe. Recombinant phage DNA from two positive phages
(6-1, and 7-2) was purified and shown by Southern hybridization to
contain parts of the gene of interest. Fragments generated by
EcoRI (3.3 kb long), SalI (1.2 kb long), and
SacI (3.5 kb long) were subcloned into either pGEM7 or
pGEM11 vectors and sequenced. The sequence analysis showed that the
cloned fragments overlap and contain the entire Bstopo II gene.


View larger version (183K):
[in this window]
[in a new window]
|
Fig. 1.
A, schematic diagram of the
B. saltans topo II protein. The PCR-amplified region used to
screen the genomic library and the overexpressed region used to
generate the BstopoII-1 polyclonal antibodies are shown with a
bar. The conserved catalytic Tyr-786 is highlighted. The
position and sequence of the synthetic oligopeptide against which the
BstopoII-2 polyclonal antibodies were made is indicated. Also,
positions of the predicted bipartite nuclear localization signals
(NLS-BP1 and 2) are shown. B, multiple alignment of
predicted protein sequences of topo II from T. cruzi
(P30190), T. brucei (P12531), C. fasciculata
(P27570), L. chagasi (O61078), L. donovani
(AF150876), and B. saltans (AY083347). The amino acids are
numbered to the left of the respective sequences. Conserved positions
are in black, conservatively substituted in gray,
and variable positions in white. Gaps were introduced to
optimize the alignment.
|
|
The BstopoII protein-coding region is 1247 amino acids long with the
predicted molecular mass being 139 kDa. Protein data base search
with the predicted polypeptide using BLAST revealed homology with
several topo II genes. On the amino acid level significant similarity
with the homologs was observed throughout most of the open reading
frame, while the C-terminal domain of BstopoII is unique. The most
closely related sequences (42-49% identity) were the topo II genes of
the trypanosomatids T. brucei, T. cruzi, Leishmania spp., and C. fasciculata (Fig.
1B). Mutual identity among the trypanosomatid topo II is
much higher, ranging between 61 and 76%. On the amino acid level
BstopoII has an identity of about 30% with other eukaryotic type II
topoisomerases, represented by the Saccharomyces cerevisiae,
human and D. melanogaster topo II genes. The identity with
the subunit B of the prokaryotic DNA gyrase dropped to about 13% (data
not shown).
In a phylogenetic analysis based on the amino acid sequences of
selected eukaryotic topo II genes, including all homologs available
from flagellates, B. saltans constituted the earliest lineage within the long branch leading to the kinetoplastids (Fig. 2). Maximum parsimony and likelihood
analyses produced trees with generally the same topology and high
support for the branching order. The analyses differed only in respect
to the mutual relationship among C. fasciculata and
Leishmania spp. that cannot be unambiguously resolved with
the available data (Fig. 2). The topology of an unrooted tree analyzed
with the above methods confirmed the position of B. saltans
on the basis of the Kinetoplastida clade (data not shown).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Maximum likelihood tree inferred from the
amino acid sequences of topo II of selected eukaryotes. From 1052 sites used for analysis, 154 sites were constant. Tree was rooted using
P. falciparum as an outgroup. Quartet-puzzling support (1000 replicates) for maximum likelihood (upper value) and bootstrap support
for maximum parsimony with gaps excluded (1052 characters; 810 parsimony informative; 4222 steps-long tree) (middle value) and
included (1820 characters; 1160 parsimony informative; 6645 steps-long
tree)(lower value) are shown. * indicates nodes with 100% support by
all methods used. ns, no support.
|
|
The studied protein-coding region contains features characteristic for
the eukaryotic topo II genes, like the ATP-binding domain, the
conserved Tyr-786 in the catalytic site, and the typical motif
TEGDSAKA. Topo II is relatively short in trypanosomatids, and the
Bstopo II gene is no exception. We did not find a mitochondrial target
signal, which is also absent from genes coding for mitochondrially located topo II of other flagellates. Interestingly, within regions of
high conservation, the B. saltans sequence
contains two unique insertions 17 and 10 amino acids long. Moreover,
the Profile server of the Prosite data base search identified two
putative bipartite nuclear localization signals that are composed of
basic amino acid residues. The terminal 100 amino acids have no
similarity with other topo II genes (Fig. 1B). We have
performed Southern hybridization to determine the copy number of the
Bstopo II gene. The presence of a single hybridizing band in total DNA
cut with the restriction enzymes BamHI, EcoRI,
SmaI, and XhoI or two hybridizing bands after the
SalI digestion (this enzyme cuts once in the region covered
by the probe) probed with the unique C-terminal domain strongly
suggests that it is a single-copy gene (Fig.
3). This is in accordance with other
eukaryotes where topo II is also present in a single copy.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Southern blot analysis of the
B. saltans genomic DNA digested with restriction
enzymes that cleave inside (SalI) and outside
(SmaI, EcoRI, XhoI,
and BamHI) the topo II gene. 10 µg of digested
DNA was fractionated on a 0.75% ethidium bromide-stained agarose gel,
blotted, and hybridized as described under "Experimental
Procedures." The position of molecular mass markers is indicated
to the left.
|
|
The cloned fragment contained also 1.9 kb of the region 5' to the start
codon of the topo II protein-coding sequence and 150-bp long
region behind the stop codon. In the adjacent regions no element
involved in cycling of topo II, known from the related C. fasciculata (23), was identified. Several attempts to detect the
topo II mRNA by Northern hybridization were not successful. Therefore, we have resorted to the RT-PCR approach to detect this apparently rare transcript. Two primer pairs were used that spanned most of the coding region. In both cases, a single amplicon of expected
size was obtained, while the omission of reverse transcriptase rendered
the reaction negative (Fig. 4). Thus, we
have confirmed that the topo II gene is transcribed.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4.
Results of the RT-PCR analysis. 10 µl
of each PCR reaction was loaded on a 0.75% ethidium bromide-stained
agarose gel. Above the slots, the primer pair used is shown (see
"Experimental Procedures"). The (+) and ( ) symbols indicate the
addition and omission of reverse transcriptase. The position of
molecular mass markers is indicated to the right.
|
|
Expression of Topo II--
We have first attempted to detect the
topo II protein in B. saltans using the monoclonal
antibodies against C. fasciculata topo II (anti-CftopoII)
that was shown to be localized exclusively in the kinetoplast (8).
While the antibody recognized a single specific protein of expected
size (~130 kDa) in the lysate of C. fasciculata and
L. tarentolae, under stringency conditions it failed to
detect the protein in B. saltans and T. brucei
(Fig. 5C).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 5.
Western blot analysis of B. saltans, T. brucei, L. tarentolae, and C. fasciculata.
Lysates of ~107 cells per lane were loaded on 8%
SDS-PAGE gels, which were hybridized with the BstopoII-1
(A), the BstopoII-2 (B), and the CftopoII
(C) antisera. The position of molecular mass markers is
indicated to the left.
|
|
Therefore we prepared specific polyclonal antibodies raised against the
B. saltans topo II protein. To avoid possible
cross-reactivity with the ATP-binding domain-containing proteins or
with a different topo II, we decided to prepare antibodies against the
C-terminal domain of BstopoII, which is a least conserved region.
Affinity purified polyclonal antibodies raised against the His-tagged
30-kDa recombinant protein purified from the bacterial lysate showed a
peptide of ~130 kDa (Fig. 5A), compatible with the
expected size based on the deduced amino acid sequence. Moreover,
several significantly weaker bands in the lower size range were also
visible, while there was no cross-reactivity with cell lysates of the
other kinetoplastid flagellates. We assume that the weakly
cross-reacting proteins are derived from feeder bacteria rather than
results of partial proteolysis since they were not recognized by the
second antibody (see below).
To verify the specificity of the 130-kDa band, a second rabbit
polyclonal antibody was generated against a synthetic 15-amino acid-long oligopeptide synthesized according to a region in the C
terminus of BstopoII (Fig. 1A). In Western analysis of the
B. saltans lysate, this affinity-purified antiserum reacted
with a protein of the same size as the first one and no
cross-hybridization with other proteins was observed (Fig.
5B).
Subcellular Localization of Topo II--
From results obtained by
Western analysis of the cell lysates we concluded that both antibodies
are specific for the B. saltans topo II protein. The region
against which these antibodies were prepared is unique for the target
gene, and the homology search revealed no similarity with other genes
available in GenBankTM. We have used the affinity-purified
antisera to investigate the cellular localization of the protein. After
about a 1-week-long cultivation, the flagellates were purified by
several rounds of differential centrifugation and sedimentation to
remove most of the feeder bacteria. The cells were smeared and
counter-stained with DAPI to visualize both the kinetoplast and the
nucleus (Fig. 6). This staining revealed
a prominent kinetoplast that occurred as a single globular nucleoid
located in the paraflagellar position, close to the kinetosomes of the
two flagella. In most cells, the kinetoplast was distinguishable by its
slightly oval or circular shape and evenly intense staining. The
nucleus was usually irregular in shape, larger than the kinetoplast,
while the intensity of DAPI staining was lower and uneven throughout
the nucleus (Fig. 6).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Immunofluorescence analysis of the
paraformaldehyde-fixed B. saltans cells. The
left and right panels show the DAPI- and
antibody-staining of the same cells, respectively. The
arrowheads point to the kinetoplast, while the
arrows indicate the nucleus. Panel A shows
cells treated with either the BstopoII-1 or BstopoII-2 antisera under
conditions when the nucleus is less intensely labeled (see
"Experimental Procedures"). Panel B shows cells treated
with a higher concentration of the BstopoII-2 antisera. Note distinct
loci on the nuclear periphery indicated by arrows.
Bar indicates 1 µm.
|
|
In cells treated with the secondary antibody, the cyanin signal was
localized throughout the kinetoplast and followed that of DAPI. The
topo II protein seems therefore to be evenly spread throughout the
kinetoplast (Fig. 6A). Unexpectedly, both antisera recognized the topo II protein also in the nucleus of B. saltans. At lower concentrations, rather diffuse staining of
varying intensity was observed in the nuclear chromatin (Fig.
6A). However, when the blocking solution was supplemented
with 10% BSA and higher concentration of the antisera (BstopoII-1,
1:100; BstopoII-2, 1:20) were used, a characteristic labeling pattern
emerged. About a dozen distinct loci located on the periphery of the
rounded nucleus became visible (Fig. 6B). The antibody
generated against the overexpressed protein (BstopoII-1) recognized the
nuclear topo II with higher intensity.
Localization of the kDNA Minicircles--
We have PCR-amplified
and biotin-labeled a 350-bp-long region that is highly conserved in the
B. saltans minicircles (14) and used it as a probe
for in situ hybridization. As shown in Fig.
7, the probe hybridized only with the
kinetoplast bundle that is located in the anterior part of the
mitochondrion between the flagellar kinetosomes and the nucleus. No
signal was detected elsewhere in the mitochondrial lumen thus proving
that all minicircles are confined to the kDNA globule. When the cells
were counter-stained with DAPI or YOYO1, the kinetoplast appeared as a
prominent oval to circular structure, staining more intensely than the
nucleus (Fig. 7, A and B).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Localization of the kDNA minicircles in
B. saltans detected by in situ
hybridization with the BSM1 probe. An example of the same
cell stained with DAPI, labeled with the BSM1 probe, and examined in
the Zeiss Axioplan 100 microscope is shown in panel A. The
bar indicates 1 µm. A B. saltans cell stained
with YOYO1, labeled with the BSM1 probe, and examined at a higher
magnification (bar indicates 1 µm) in the confocal
microscope Zeiss LSM410 is shown in panel B under conditions
that the nucleus is not stained with BSM1.
|
|
 |
DISCUSSION |
In most eukaryotes mitochondrial DNA occurs as a circular
molecule(s) (24), replication and transcription of which will introduce
topological stress that must be relieved by topoisomerases. While
activities of topo II have been described in the eukaryotic mitochondrion, little is known about its biochemistry and localization within the organelle (25). Kinetoplastid flagellates harbor in their
single mitochondrion the most complex organellar DNA known, composed of
thousands of circular molecules (4, 5, 26). Due to this fact, their
mitochondrial topo II is quite abundant and thus belongs to the most
studied mitochondrial topoisomerases. Moreover, it seems that, at least
in the mitochondrion of C. fasciculata, there are two
topoisomerases II (7, 8) that may perform slightly different functions
during replication of the kDNA network. In this study, we were
interested in the localization of topo II in the mitochondrion of
B. saltans, the primitive status of which among
kinetoplastids (16-18) was confirmed by phylogenetic analysis of the
topo II sequence. In all trypanosomatids studied thus far, the
kinetoplast occurs as a disc-shaped structure with a high concentration
of DNA that is located in the paraflagellar position (26, 27). The kDNA
of B. saltans has a similar intracellular localization;
however, it forms a single globular nucleoid with a bundle-like
structure (18).
We have cloned and sequenced the entire topo II gene along with its 5'-
and 3'-untranslated regions. The alignment with the C. fasciculata mitochondrial topo II (22) (genomic sequence is
available only for one mitochondrial topo II), and other available trypanosomatid topo II genes revealed a level of identity similar to
that observed in other bodonid versus trypanosomatid gene
alignments (17, 28). We have identified neither a mitochondrial
targeting signal nor a cycling element that confers cycling to topo II
in C. fasciculata (23). To detect the topo II protein in
Bodo, we have first tried polyclonal antibodies generated
against the C. fasciculata topo II (8). Under high
stringency conditions we were able to show that it recognized the topo
II protein only in C. fasciculata and closely related
L. tarentolae. Two polyclonal antibodies directed
against the unique C terminus of the B. saltans topo II did
not react with total cell lysates of other flagellates and are
therefore highly specific for the topo II protein of
Bodo.
In the current kDNA replication model, topo II mediates decatenation of
individual minicircles from the kDNA network. After their replication
as free molecules, the progeny minicircles are reattached by another
topo II action (6, 8, 29). The localization of topo II was studied in
detail in the kinetoplast of C. fasciculata and T. brucei. Although both species are representatives of two different
kDNA replication types (30, 31), their topo II is confined to two
discrete antipodal sites that flank the kDNA network (8, 29, 32). The
kDNA structure of B. saltans is significantly different
from the kDNA network, since it is composed of relaxed non-catenated
circles. It is well known that aggregated relaxed molecules are
efficiently interlocked into catenanes by topo II (33, 34) and that by
neutralizing the DNA phosphate charge, polycations such as spermidine
and histones promote catenation (35). Several histone-like
kinetoplast-associated proteins are apparently involved in packaging of
the minicircles in the kDNA disk of C. fasciculata (36, 37).
However, within the elongated mitochondrion of B. saltans,
topo II is localized evenly throughout the globular kDNA bundle, which
is in sharp contrast to the polar distribution of the enzyme in the
trypanosomatid kDNA. The lack of catenation in the presence of topo II
is a unique feature. We can only speculate whether the minicircular DNA
is naked and therefore not located close enough for topo II to
interlock the circles or that some yet unidentified protein(s) prevents
the action of the enzyme.
The massive decatenation and reattachment of minicircles, performed by
topo II in the trypanosomatids, is a function dispensable for the
replication of Bodo kDNA. However, when the intact kDNA network of C. fasciculata was added to a partially purified
lysate of B. saltans from which all nuclear and kDNA has
been removed, a decatenating activity was detected, similar to that
present in C. fasciculata (data not shown). Although in
these preliminary experiments we did not prove that the decatenating
activity pertained to the enzyme under study, it seems that in
Bodo topo II may be responsible for the segregation of
minicircle dimers and small catenanes formed by the replication of free
minicircles. We suggest that the abundant presence of topo II in the
non-catenated kDNA testifies for this function, which was also proposed
for the T. brucei topo II (6). With the biotin-labeled
minicircle probe we have shown in situ that all minicircles
present in the Bodo kDNA as free molecules (14, 19) are
indeed located within the single DNA globule. From the evolutionary
perspective the appearance of massive catenation and network formation
may have coincided with a possible gain of function in the more
recently evolved trypanosomatid topo II.
Interestingly, the same topo II is also present in the nucleus of
B. saltans. This conclusion is based on Southern
hybridizations of the total DNA probed with the unique C-terminal
domain that revealed a single band and by the immunolocalization
experiments in which both antibodies reacted specifically with a
nuclear protein. In this cellular compartment, however, the topo II
protein occurs in multiple discrete loci, which seem to be associated
with the nuclear membrane. The mitochondrial topo II protein was
originally not found outside the organelle (8, 29), and only recent use
of the anti-CftopoII and anti-TctopoII antibodies with C. fasciculata and T. cruzi cells lead Fragoso et
al. (38) to suggest that the same enzyme may also be present in
the nucleus. In both species the topo II signal co-localized with the
propidium-stained nuclei, but no observation on subnuclear distribution
was presented (38). Moreover, the polyclonal antiserum raised against
the total overexpressed topo II of L. donovani reacted with
the protein both inside the kinetoplast and the nucleus. The authors
speculated that the same enzyme is responsible for activities in both
cellular compartments, the division of which is synchronized in
kinetoplastid flagellates (11).
The localization of topo II in the nucleus of B. saltans is
reminiscent of distribution of its homolog in the nuclei of higher eukaryotes. In the nucleus of yeast, Drosophila, and
mammalian cells the enzyme was co-localized with distinct replication
centers (39-42). Our results suggest that in the nucleus of
B. saltans, an early branching eukaryote, such an
intranuclear association, has already been established.
 |
ACKNOWLEDGEMENTS |
We thank Paul Michels and Fred Opperdoes (De
Duve Institute of Cellular Pathology, Brussels, Belgium) for their
hospitality and help with construction of the genomic library, Dan Ray
(University of California, Los Angeles, CA) for the anti-CfTopoII
antibody, and Mirek Oborník (Institute of Parasitology,
eské Bud jovice, Czech Republic) for help
with molecular phylogeny. The contribution of Nuraly Avliyakulov
(University of California, Los Angeles, CA) and Jan Votýpka
(Faculty of Biology, Charles University, Prague, Czech Republic) in the
initial stages of this work is gladly acknowledged. We appreciate
comments by Rob Benne (University of Amsterdam, Amsterdam,
Netherlands), Marek Jindra (Institute of Entomology,
eské Bud jovice), and members of our
laboratory and technical assistance of Jana
Fi áková.
 |
FOOTNOTES |
*
This work was supported by Ministry of Education Grants
MSM123100003 and 123100002.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY083347.
Present address: Institute of Entomology, Czech Academy of
Sciences, 37005 Ceské Budejovice, Czech Republic.
§
To whom correspondence should be addressed: Institute of
Parasitology, Czech Academy of Sciences, Brani ovská 31, 37005 eské Bud jovice, Czech Republic.
Tel.: 00420-38-7775416; Fax: 00420-38-5310388; E-mail:
jula@paru.cas.cz.
Published, JBC Papers in Press, January 16, 2003, DOI 10.1074/jbc.M202347200
 |
ABBREVIATIONS |
The abbreviations used are:
topo II, topoisomerase II;
kDNA, kinetoplast DNA;
RT, reverse
transcriptase;
PBS, phosphate-buffered saline;
DAPI, 4',6-diamidino-2-phenylindole;
BSA, bovine serum albumin.
 |
REFERENCES |
| 1.
|
Wang, J. C.
(1985)
Annu. Rev. Biochem.
54,
665-697[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Estévez, A. M.,
and Simpson, L.
(1999)
Gene
240,
247-260[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Gott, J. M.,
and Emeson, R. B.
(2000)
Annu. Rev. Genet.
34,
499-531[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Morris, J. C.,
Drew, M. E.,
Klingbeil, M. M.,
Motyka, S. A.,
Saxowsky, T. T.,
Wang, Z.,
and Englund, P. T.
(2001)
Int. J. Parasitol.
31,
453-458[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Klingbeil, M. M.,
Drew, M. E.,
Liu, Y.,
Morris, J. C.,
Motyka, S. A.,
Saxowsky, T. T.,
Wang, Z.,
and Englund, P. T.
(2001)
Protist
4,
255-262
|
| 6.
|
Wang, Z.,
and Englund, P. T.
(2001)
EMBO J.
20,
4674-4683[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Shlomai, J.,
and Zadok, A.
(1983)
Nucleic Acids Res.
11,
4019-4034[Abstract/Free Full Text]
|
| 8.
|
Melendy, T.,
Sheline, C.,
and Ray, D. S.
(1988)
Cell
55,
1083-1088[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Shapiro, T. A.
(1993)
Acta Trop.
54,
251-260[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Burri, C.,
Bodley, A. L.,
and Shapiro, T. A.
(1996)
Parasitol. Today
12,
226-231[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Das, A.,
Dasgupta, A.,
Sharma, S.,
Ghosh, M.,
Sengupta, T.,
Bandopadhyay, S.,
and Majumder, H. K.
(2001)
Nucleic Acids Res.
29,
1844-1851[Abstract/Free Full Text]
|
| 12.
|
Yasuhira, S.,
and Simpson, L.
(1996)
RNA
2,
1153-1160[Abstract]
|
| 13.
|
Luke , J.,
Jirk , M.,
Avliyakulov, N.,
and Benada, O.
(1998)
EMBO J.
17,
838-846[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Blom, D.,
de Haan, A.,
van den Burg, J.,
van den Berg, M.,
Sloof, P.,
Jirk , M.,
Luke , J.,
and Benne, R.
(2000)
RNA
6,
1-15[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
tolba, P.,
Jirk , M.,
and Luke , J.
(2001)
Mol. Biochem. Parasitol.
113,
323-326[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Dole el, D.,
Jirk , M.,
Maslov, D. A.,
and Luke , J.
(2000)
Int. J. Syst. Evol. Microbiol.
50,
1943-1951[Abstract]
|
| 17.
|
Simpson, A. G. B.,
Luke , J.,
and Roger, A. J.
(2002)
Mol. Biol. Evol.
19,
2071-2083[Abstract/Free Full Text]
|
| 18.
|
Luke , J.,
Guilbride, D. L.,
Votýpka, J.,
Zíková, A.,
Benne, R.,
and Englund, P. T.
(2002)
Eukaryot. Cell
1,
495-502[Free Full Text]
|
| 19.
|
Blom, D.,
de Haan, A.,
van den Berg, M.,
Sloof, P.,
Jirk , M.,
Luke , J.,
and Benne, R.
(1998)
Nucleic Acids Res.
26,
1205-1213[Abstract/Free Full Text]
|
| 20.
|
Strimmer, K.,
and Haeseler, A.
(1996)
Mol. Biol. Evol.
13,
964-969
|
| 21.
|
Swofford, D. L.
(1998)
PAUP*, Version 4.
, Sinauer Assoc., Sunderland, MA
|
| 22.
|
Pasion, S. G.,
Hines, J. C.,
Aebersold, R.,
and Ray, D. S.
(1992)
Mol. Biochem. Parasitol.
50,
57-68[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Mahmood, R.,
Hines, J. C.,
and Ray, D. S.
(1999)
Mol. Cell. Biol.
19,
6174-6182[Abstract/Free Full Text]
|
| 24.
|
Lang, B. F.,
Gray, M. W.,
and Burger, G.
(1999)
Annu. Rev. Genet.
33,
351-397[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Komori, K.,
Maruo, F.,
Morio, T.,
Urushihara, H.,
and Tanaka, Y.
(1997)
J. Plant Res.
110,
65-75[CrossRef]
|
| 26.
|
Shlomai, J.
(1994)
Parasitol. Today
10,
341-346[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Shapiro, T. A.,
and Englund, P. T.
(1995)
Annu. Rev. Microbiol.
49,
117-143[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Luke , J.,
Arts, G.-J.,
van den Burg, J.,
de Haan, A.,
Opperdoes, F.,
Sloof, P.,
and Benne, R.
(1994)
EMBO J.
13,
5086-5098[Medline]
[Order article via Infotrieve]
|
| 29.
|
Ferguson, M. F.,
Torri, A. F.,
Ward, D. C.,
and Englund, P. T.
(1992)
Cell
70,
621-629[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Guilbride, D. L.,
and Englund, P. T.
(1998)
J. Cell Sci.
111,
675-679[Abstract]
|
| 31.
|
Ferguson, M. F.,
Torri, A. F.,
Perez-Morga, D.,
Ward, D. C.,
and Englund, P. T.
(1994)
J. Cell Biol.
126,
631-639[Abstract/Free Full Text]
|
| 32.
|
Johnson, C. E.,
and Englund, P. T.
(1998)
J. Cell Biol.
143,
911-919[Abstract/Free Full Text]
|
| 33.
|
Krasnow, M. A.,
and Cozzarelli, N. R.
(1982)
J. Biol. Chem.
257,
2687-2693[Free Full Text]
|
| 34.
|
Rybenkov, V. V.,
Ullsperger, C.,
Vologodskii, A. V.,
and Cozzarelli, N. R.
(1997)
Science
277,
690-693[Abstract/Free Full Text]
|
| 35.
|
Kreuzer, K. N.,
and Cozzarelli, N. R.
(1980)
Cell
20,
245-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Xu, C. W.,
Hines, J. C.,
Engel, M. L.,
Russell, D. G.,
and Ray, D. S.
(1996)
Mol. Cell. Biol.
16,
564-576[Abstract]
|
| 37.
|
Luke , J.,
Hines, J. C.,
Evans, C. J.,
Avliyakulov, N. K.,
Prabhu, V. P.,
Chen, J.,
and Ray, D. S.
(2001)
Mol. Biochem. Parasitol.
117,
179-186[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Fragoso, S. P.,
Mattei, D.,
Hines, J. C.,
Ray, D. S.,
and Goldenberg, S.
(1998)
Mol. Biochem. Parasitol.
94,
197-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Swedlow, J. R.,
Sedat, J. W.,
and Agard, D. A.
(1993)
Cell
73,
97-108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Mo, Y.-Y.,
and Beck, W. T.
(1999)
Exp. Cell Res.
252,
50-62[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Niimi, A.,
Suka, N.,
Harata, M.,
Kikuchi, A.,
and Mizuno, S.
(2001)
Chromosoma (Berl.)
110,
102-114
|
| 42.
|
Sakaguchi, A.,
Akashi, T.,
and Kikuchi, A.
(2001)
Biochem. Biophys. Res. Commun.
283,
876-882[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|