Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M212541200 on January 21, 2003

J. Biol. Chem., Vol. 278, Issue 13, 11107-11114, March 28, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/13/11107    most recent
M212541200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhar-Mascareño, M.
Right arrow Articles by Golde, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhar-Mascareño, M.
Right arrow Articles by Golde, D. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Granulocyte-Macrophage Colony-stimulating Factor Signals for Increased Glucose Transport via Phosphatidylinositol 3-Kinase- and Hydrogen Peroxide-dependent Mechanisms*

Manya Dhar-MascareñoDagger §, Jian Chen§, Rong Hua ZhangDagger , Juan M. CárcamoDagger ||, and David W. GoldeDagger **

From the Dagger  Program in Molecular Pharmacology and Chemistry and the || Department of Clinical Chemistry, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 and the  Department of Pharmacology, Weill Graduate School of Medical Sciences of Cornell University, New York, New York, 10021

Received for publication, December 9, 2002, and in revised form, January 15, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Granulocyte-macrophage colony-stimulating factor (GM-CSF) stimulates cellular glucose uptake by decreasing the apparent Km for substrate transport through facilitative glucose transporters on the plasma membrane. Little is known about this signal transduction pathway and the role of the alpha  subunit of the GM-CSF receptor (alpha GMR) in modulating transporter activity. We examined the function of phosphatidylinositol 3-kinase (PI 3-kinase) in GM-CSF-stimulated glucose uptake and found that PI 3-kinase inhibitors, wortmannin and LY294002, completely blocked the GM-CSF-dependent increase of glucose uptake in Xenopus oocytes expressing the low affinity alpha GMR and in human cells expressing the high affinity alpha beta GMR complex. We identified a Src homology 3 domain-binding motif in alpha GMR at residues 358-361 as a potential interaction site for the PI 3-kinase regulatory subunit, p85. Physical evidence for p85 binding to alpha GMR was obtained by co-immunoprecipitation with antibodies to alpha GMR and p85, and an alpha GMR mutant with alteration of the Src homology 3 binding domain lost the ability to bind p85. Experiments with a construct eliminating most of the intracellular portion of alpha GMR showed a 50% reduction in GM-CSF-stimulated glucose uptake with residual activity blocked by wortmannin. Searching for a proximally generated diffusible factor capable of activating PI 3-kinase, we identified hydrogen peroxide (H2O2), generated by ligand or antibody binding to alpha GMR, as the initiating factor. Catalase treatment abrogated GM-CSF- or anti-alpha GMR antibody-stimulated glucose uptake in alpha GMR-expressing oocytes, and H2O2 activated PI 3-kinase and led to some stimulation of glucose uptake in uninjected oocytes. Human myeloid cell lines and primary explant human lymphocytes expressing high affinity GM-CSF receptors responded to alpha GMR antibody with increased glucose uptake. These results identify the early events in the stimulation of glucose uptake by GM-CSF as involving local H2O2 generation and requiring PI 3-kinase activation. Our findings also provide a mechanistic explanation for signaling through the isolated alpha  subunit of the GM-CSF receptor.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Granulocyte-macrophage colony-stimulating factor (GM-CSF)1 is an important cytokine involved in the growth and maturation of hematopoietic cells and in regulating host defense functions (1). The receptor for GM-CSF is composed of two subunits, alpha  (alpha GMR) and beta  (beta GMR), and is found on hematopoietic cells, myeloid progenitors, mature granulocytes, and mononuclear phagocytes (2, 3). The GM-CSF receptor is also expressed on non-hematopoietic tissues including endothelial cells, oligodendrocytes, placenta, spermatozoa, prostate, and various immortalized cell lines (4-12). The isolated alpha GMR binds GM-CSF with low affinity (Kd 2-5 nM) and forms a complex with beta GMR to create the high affinity receptor (Kd 30 pM). While the GM-CSF, IL-5, and IL-3 receptors share a common beta  chain (beta GMR), the alpha  subunit is unique to each receptor and determines the binding specificity and the distinct responses mediated by each ligand (13, 14). The beta GMR subunit plays a central role in GM-CSF cell signaling (15); however, the alpha  subunit is also required for signaling mediated by the high affinity receptor beyond its role in ligand binding (16, 17). A direct signaling function for an isolated alpha  subunit was recently elucidated by the finding that the alpha  IL-5 receptor interacts with syntenin, inducing IL-5-mediated transcriptional responses (18).

It has long been known that cytokines like IL-3 and GM-CSF modulate glucose uptake in hematopoietic cells (19-24). Stimulation of cellular glucose uptake by cytokines is believed to be part of their function as survival factors by enhancing the availability of substrate for energy generation required for cell metabolism (25). Non-hematopoietic cells expressing high affinity GMR and melanoma cells expressing an isolated alpha GMR also respond to GM-CSF by increasing glucose uptake (12, 26). We previously found that Xenopus oocytes expressing only the isolated alpha GMR respond to GM-CSF with increased glucose uptake (27). The only physiological signaling role tentatively assigned to the low affinity GM-CSF receptor, independent of the beta GMR, is the regulation of glucose uptake (22, 27). The in vivo relevance of GM-CSF in mediating glucose uptake was demonstrated in the development of preimplantation embryos in mice where an isolated alpha GMR is expressed without beta GMR. Signaling through this low affinity receptor is associated with increased glucose uptake and enhanced proliferation and viability of blastomeres (28). Studies with bone marrow from beta GMR-null mice, however, have suggested that beta GMR may be required for GM-CSF signaling for glucose transport in mouse bone marrow cells (29).

Neoplastic transformation and viral infection increase cellular glucose uptake through augmented facilitative glucose transporter (GLUT) expression on the cell surface (30-32). Similarly insulin and certain growth factors cause increased GLUT translocation to the cell membrane that is dependent on activation of PI 3-kinase and its downstream targets (33, 34). Up-regulation of glucose transport in a cell model for chronic myeloid leukemia is also mediated via activation of PI 3-kinase (35). The ability of GM-CSF to decrease the apparent Km of GLUT1 without changing the Vmax suggests that initial signaling from the GMR results in modulation of the intrinsic properties of the transporters (26, 36, 37). GM-CSF also signals for increased transport of the oxidized form of vitamin C, as dehydroascorbic acid, through GLUT1 by a similar mechanism (37). To elucidate this signaling process and the role of the isolated alpha GMR, we undertook experiments in frog oocytes expressing alpha GMR and human cells expressing both the alpha GMR and beta GMR subunits. The results reported here point to a central role for PI 3-kinase in signaling for increased glucose uptake and indicate that hydrogen peroxide generated proximally at the receptor is a key initial signaling event.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Lines and Culture Methods-- 293T cells (38) were maintained in high glucose Dulbecco's modified Eagle's medium supplemented with 10% bovine calf serum, 1% sodium pyruvate, 1% L-glutamine, and antibiotics. Neutrophilic and promyelocytic HL-60 cells were maintained in Iscove's modified Dulbecco's medium supplemented with 10% fetal bovine serum, 1% L-glutamine, and antibiotics. Leukopacks from normal donor blood were provided by the New York Blood Center, and the lymphocytes were purified by Ficoll-Hypaque density centrifugation followed by plastic adherence depletion of monocytes/macrophages. U937 cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum.

In Vitro Transcription and RNA Injection-- Plasmid containing human alpha GMR cDNA cloned in pBluescript (Stratagene) was linearized with NotI. The digested DNA was extracted with phenol and precipitated with ethanol, and RNA was transcribed in vitro (Ambion, Austin, TX). Stage V and VI oocytes were harvested from the ovaries of adult female Xenopus laevis frogs (Nasco, Ft. Atkinson, WI) and cultured in OR2 (Bufferad Inc.) as described previously (27). After 48 h of culture, 20 ng of capped mRNA in 50 µl of diethyl pyrocarbonate water was microinjected into the vegetal pole of the oocytes as described previously (27). Glucose uptake experiments were performed 48 h postinjection. alpha GMR mutants were generated in pcDNA4/His-V5c (Invitrogen). RNA was generated by in vitro transcription of these plasmids, linearized with XhoI, and injected as described.

2-Deoxy-D-glucose Uptake-- The uptake of 2-deoxy-D-glucose (DOG) by Xenopus oocytes was measured as described previously (27). Briefly, oocytes (15 per group) were incubated with GM-CSF (1 nM) (R&D Systems, Minneapolis, MN) or the antibodies S20 (0.4 µg/ml) (recognizing an extracellular epitope of alpha GMR, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), 17A (0.4 µg/ml) (recognizing an extracellular epitope of alpha GMR, Sigma), or N20 (0.4 µg/ml) (recognizing the extracellular portion of beta GMR, Santa Cruz Biotechnology, Inc.) at room temperature for 1 h. Oocytes were incubated with 2-deoxy-D-[1,2-3H]glucose (PerkinElmer Life Sciences) and DOG to a final concentration of 0.1-0.4 µCi/ml and 0.2 mM, respectively. After 10 min at room temperature, DOG uptake was terminated by dilution with OR2, and the oocytes were washed with cold OR2 medium four times. Oocytes were then lysed in 20 mM Tris-HCl (pH 8.0) containing 0.2% SDS, and the amount of radioactive DOG trapped intracellularly was measured by scintillation counting. The uptake of DOG in HL-60, U937 cells, and human lymphocytes was measured as described above. Catalase (Sigma) was added to a final concentration of 1900 or 3800 units/ml for 5 min before GM-CSF treatment.

Immunoprecipitation of alpha GMR and beta GMR from Transfected 293T Cells-- 293T cells were transfected using Superfect (Qiagen) in 100-mm plates at 50% confluence with 5 µg of plasmids for alpha GMR, alpha GMR-PA, alpha GMR-A351, or alpha GMR-YA according to the manufacturer's instructions. Forty-eight hours after transfection the cells were harvested and lysed by sonication in lysis buffer (20 mM Tris, 150 mM NaCl, 0.1% Triton X-100) containing protease and phosphatase inhibitor mixtures (Sigma). For immunoprecipitation the samples were centrifuged at 12,000 × g for 10 min at 4 °C, and the cleared lysates were further treated with protein A-Sepharose beads (Sigma). Anti-alpha GMR antibody S20 was added at 1 µg per sample for 2 h, and the antibodies were captured on protein A-Sepharose beads for 2 h at 4 °C. The beads were washed with lysis buffer four times, and the proteins were analyzed by immunoblotting. Anti-alpha GMR antibodies C18 and S50 and anti-p85 antibody were used for detection of alpha GMR and p85, respectively.

Detection of p85 in HL-60-- Lysates from HL-60 cells with or without treatment with GM-CSF were incubated with 1 µg of anti-alpha GMR antibody (S20) for 16 h at 4 °C on an oscillating platform. Protein G-agarose (20 µg) was then added and left for 1 h at 4 °C. The protein G beads were collected by centrifugation and washed three times with lysis buffer. The supernatants were removed carefully, and the beads were resuspended with 1× sample loading buffer and heated for 5 min at 95 °C before separation by 7.5% SDS-PAGE. Western blotting to analyze the PI 3-kinase (p85) was performed in the following manner. Nonspecific sites were blocked using 5% nonfat milk in Tris-buffered saline before incubating the blot with anti-p85 antibody (Santa Cruz Biotechnology, Inc.) for 16 h at 4 °C at a final dilution of 1:1000 in fresh blocking buffer. The membrane was washed three times in Tris-buffered saline, incubated for 1 h at room temperature with anti-mouse IgG, horseradish peroxidase-linked whole antibody (Amersham Biosciences), diluted 1:4000 in blocking buffer, and washed with Tris-buffered saline and 0.1% Tween 20, and proteins were revealed using the ECL detection system (Amersham Biosciences).

Construction of Mutant Plasmids-- Human alpha GMR was subcloned into HindIII and NotI sites of pcDNA4/His-V5c (Invitrogen) using the following 5' primer: GCCGCAAGCTTAGCACCATGCTTCTCCTGGT GACA-3'. The reverse primer for full-length alpha GMR was GATAGTTTAGCGGCCGCGGTAATTTCCTTCACGGT to generate plasmid alpha GMR. The reverse primer for the carboxyl-terminal deletion alpha GMR-A351 was 5'-TTTAAAAGGTTCCTTAGGGCGGCCGCTAAACTATC-3'.

Site-specific mutants were generated in the plasmid alpha GMR using a mutagenesis kit (Stratagene). Briefly, alpha GMR-containing plasmid was denatured and annealed with oligonucleotide primers containing the desired mutation. The following primers were used for proline substitution by alanine: forward primer, 5'-CTTAGGATACAGCGGCTGTTCGCAGCAGTTGCACAGATCAAAGACAACTGAAT-3'; reverse primer, 5'-ATTCAGTTTGTCTTTGATCTGTGCAACTGCTGCGAACA GCCGCTGTA TCCTAAG-3'. For tyrosine substitution by alanine the forward primer was 5'-ATCATCTGGGAGGAATTCACCCCAGAGGAAGGGAAAGGCGCACGCGAAGAGGT-3', and the reverse primer was 5'-GACCTCTTCGCGTGCGCCTTTCCCTTCCTCTGGGGTGAAT TCCTCCCAGATGAT-3'. The mutagenic primers were incorporated using Pfu Turbo DNA polymerase. The non-mutagenic methylated parental DNA template was digested with DpnI. The resultant circular nicked double-stranded DNA was transformed into XL10-Gold ultra competent cells (Stratagene). The mutation was confirmed by sequencing of the resultant plasmids.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

GM-CSF-stimulated Glucose Transport Depends on PI 3-Kinase-- We investigated the role of PI 3-kinase in GM-CSF-stimulated transport of glucose in Xenopus oocytes expressing the human alpha GMR. Oocytes injected with alpha GMR RNA expressed alpha GMR as detected by immunoblotting using an anti-alpha GMR antibody, C18 (Fig. 1A). Reverse transcription PCR analysis indicated that Xenopus oocytes do not express a beta GMR transcript detectable by primers specific for human beta GMR (data not shown). Also beta GMR protein was not detectable by immunoblotting using anti-human beta  subunit antibody. These results are consistent with our previous finding that oocytes expressing the alpha GMR had only low affinity GM-CSF binding. Oocytes expressing the alpha GMR and incubated with 1 nM GM-CSF for 1 h showed a 2-fold increase in glucose uptake (Fig. 1B) (27). The increase in glucose uptake was completely inhibited by incubation with 100 nM wortmannin for 15 min prior to GM-CSF treatment, while the vehicle control buffer had no effect (Fig. 1B). Wortmannin is a highly specific inhibitor of PI 3-kinase (39), and the inhibitory effect of wortmannin was dose-dependent and did not affect the basal level of glucose transport. The IC50 for inhibition of GM-CSF-stimulated glucose uptake by wortmannin was 2 nM (Fig. 1C). LY294002, a structurally distinct synthetic inhibitor of PI 3-kinase, also suppressed GM-CSF-stimulated glucose uptake. At 50 µM, LY294002 completely inhibited GM-CSF-induced glucose uptake with no effect on basal glucose transport (Fig. 1D). In these experiments the vehicle control (ethanol) slightly inhibited the stimulation by GM-CSF, but the effect of LY294002 was dose-dependent with IC50 of 2 µM. These results suggest that PI 3-kinase is involved in alpha GMR-dependent signaling for glucose transport.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   PI 3-kinase inhibitors block GM-CSF-dependent glucose uptake in Xenopus oocytes. A, expression of alpha GMR in oocytes injected with RNA encoding alpha GMR. Extracts from oocytes were subjected to SDS-PAGE, and alpha GMR was detected by immunoblotting with anti-alpha GMR antibody C18. B, wortmannin inhibits glucose uptake induced by GM-CSF. Oocytes expressing alpha GMR were incubated with 100 nM wortmannin or Me2SO (DMSO) for 15 min prior to GM-CSF treatment. Uptake of DOG by oocytes was quantified after 10 min. The closed bars indicate oocytes incubated with 1 nM GM-CSF. C, dose-dependent inhibition of [3H]DOG uptake by wortmannin. DOG uptake is expressed as percentage of increase of basal uptake. Data represent the average of triplicate experiments, and standard deviation is indicated. D, LY294002 inhibits glucose uptake induced by GM-CSF. Oocytes expressing alpha GMR were preincubated with LY294002 or vehicle (ethanol) prior to GM-CSF treatment. DOG uptake was quantitated 10 min after and is expressed as pmol/oocytes. The closed bars indicate oocytes incubated with 1 nM GM-CSF. Standard deviation of triplicate experiments is indicated. E, dose-dependent inhibition of [3DOG] uptake by LY294002. DOG uptake is expressed as percentage of increase of basal uptake. Data represent the average of triplicate experiments, and standard deviation is indicated. F, wortmannin inhibits GM-CSF-dependent glucose uptake in neutrophilic HL-60 cells. HL-60 cells were treated with 50 nM wortmannin prior to GM-CSF treatment for 1 h. DOG uptake was quantitated 10 min after GM-CSF stimulation. Data are expressed as -fold induction. Data represent the average of experiments in triplicate, and standard deviation is indicated.

GM-CSF induces glucose uptake in human cells expressing the high affinity receptors alpha GMR and beta GMR (27). We evaluated the effect of the PI 3-kinase inhibitor wortmannin on GM-CSF-induced glucose uptake in neutrophilic HL-60 cells (40). Cells treated with 1 nM GM-CSF showed a 2.1-fold increase in glucose uptake that was completely inhibited by 50 nM wortmannin (Fig. 1F). These results suggest that signaling for GM-CSF-stimulated glucose uptake in cells expressing the high affinity receptor is also PI 3-kinase-dependent.

The p85 Regulatory Subunit of PI 3-Kinase Associates with alpha GMR-- To investigate the mechanism of activation of PI 3-kinase pathway by alpha GMR we performed experiments to determine whether the regulatory subunit of PI 3-kinase (p85) interacts with alpha GMR. The alpha GMR monoclonal antibody S20 was used to immunoprecipitate cellular extracts from HL-60 cells treated or untreated with GM-CSF. The immunoprecipitates were analyzed by SDS-PAGE and immunoblotted with anti-p85 antibody. As shown in Fig. 2A, there is a ligand-independent interaction between alpha GMR and p85. The interaction between alpha GMR and p85 was confirmed by co-immunoprecipitation with an anti-p85 antibody and detected by immunoblotting with an anti-alpha GMR antibody (Fig. 2B). These results indicate a physical interaction between PI 3-kinase and alpha GMR.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   alpha GMR interacts with PI 3-kinase. A, cell lysates from HL-60 cells incubated with 1 nM GM-CSF for the period of time indicated were immunoprecipitated with anti-alpha GMR (S20), separated by SDS-PAGE, and immunoblotted with anti-p85 antibody. B, cell lysates from HL-60 cells incubated with 1 nM GM-CSF for the time indicated were immunoprecipitated with anti-p85 antibody, separated by SDS-PAGE, and immunoblotted with anti-alpha GMR antibody. IP, immunoprecipitation; WB, Western blot.

Identification of a p85-binding Motif in the Cytoplasmic Domain of alpha GMR-- p85 associates with alpha GMR whose cytoplasmic domain has 54 amino acid residues. We identified an SH-3 domain-binding motif consisting of a proline-rich segment (PPVP) proximal to the transmembrane domain of the alpha GMR that could potentially be an anchoring site for p85. Distal to this region near the carboxyl terminus is the only tyrosine residue in the carboxyl terminus. To investigate the role of these residues, alanine substitution mutations were introduced whereby proline-rich SH-3 domain-binding region (PPVP) was changed (AAVA) using site-directed mutagenesis to generate the plasmid alpha GMR-PA, and the tyrosine residue was mutated (Y389A) to generate the plasmid alpha GMR-YA. We also generated a truncation mutant, alpha GMR-A351, that carries a deletion of the cytoplasmic domain retaining only four amino acid residues proximal to the transmembrane domain. A schematic representation of the alpha GMR constructs is shown in Fig. 3A. Wild type or mutant plasmid cDNA was transfected into 293T cells, total cell lysates were subjected to immunoprecipitation with anti-alpha GMR antibody (S20), and the immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted using anti-p85 antibody. While the wild type receptor showed binding to p85, there was loss of binding to the truncation mutant alpha GMR-A351 and to the alpha GMR-PA (Fig. 3B, top panel). The mutant alpha GMR-YA, however, retained binding, suggesting that the proline motif is critical for binding to p85 in quiescent cells. The membrane was stripped and reprobed with anti-alpha GMR antibodies. C18 antibody recognizes an intracellular epitope and therefore does not recognize the truncation mutant alpha GMR-A351. Antibody S50 against an extracellular epitope was used to detect the expression of all the constructs (Fig. 3B, lower panel). These results point to the proline-rich motif as the site of p85 binding to alpha GMR.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Identification of p85 binding domains in alpha GMR. A, schematic representation of alpha GMR mutants. B, cell lysates from 293T cells transfected with wild type and mutant alpha GMR were immunoprecipitated with S20 antibody, and the immunoprecipitates were analyzed by Western blotting using anti-p85 antibody (upper panel). The blot was stripped and reprobed with anti-alpha GMR antibody S50 (lower panel) and with anti-alpha GMR antibody C18 (middle panel). IP, immunoprecipitation; WB, Western blot.

The Cytoplasmic Domain of alpha GMR Is Important but Not Essential for GM-CSF-stimulated Glucose Uptake in Oocytes-- RNA from the wild type (alpha GMR) and mutant plasmids alpha GMR-A351, alpha GMR-PA, and alpha GMR-YA was injected into oocytes and tested for the ability to mediate increased glucose uptake in response to GM-CSF (Fig. 4A). GM-CSF-treated oocytes expressing wild type alpha GMR showed a 2.5-fold increase in glucose uptake; however, oocytes injected with beta GMR RNA alone did not respond to GM-CSF. GM-CSF-stimulated glucose uptake in oocytes expressing the alpha GMR mutant alpha GMR-PA was decreased but not eliminated (Fig. 4A). When the truncation mutant of the cytoplasmic domain of alpha GMR-A351 was used in the same experiment there was approximately a 50% decrease in the stimulated glucose uptake compared with the wild type receptor. The alpha GMR-YA mutant mediated a moderately attenuated glucose uptake compared with the wild type alpha GMR (Fig. 4A). The expression levels of the different alpha GMR constructs were comparable (data not shown).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4.   Disruption of alpha GMR function by mutations in the cytoplasmic domain. A, oocytes injected with wild type alpha GMR or mutants alpha GMR-A351, alpha GMR-PA, and alpha GMR-YA were treated with GM-CSF, and glucose uptake was measured as explained under "Experimental Procedures." B, oocytes injected with wild type alpha GMR or mutants alpha GMR-A351 were treated with 0.1, 1, and 10 nM wortmannin 15 min before GM-CSF stimulation. DOG uptake is shown as pmol/oocyte. wt, wild type.

We addressed the question whether the residual glucose uptake induced by GM-CSF through alpha GMR-A351 is dependent on PI 3-kinase. Oocytes injected with alpha GMR-A351 and wild type alpha GMR were preincubated with wortmannin and treated with GM-CSF. As shown in Fig. 4B wortmannin inhibited the stimulation of glucose uptake in the truncation mutant. These results indicate that GM-CSF-stimulated glucose uptake is attenuated by deletion of the intracellular domain of alpha GMR but that the residual activity is also dependent on PI 3-kinase. These results imply that there is PI 3-kinase activation by GM-CSF even when p85 cannot bind to alpha GMR.

GM-CSF-induced Activation of PI 3-Kinase Involves Generation of H2O2-- It is known that GM-CSF uses reactive oxygen species (ROS) as second messenger molecules in its signaling pathway (41, 42) and that ROS in the form of hydrogen peroxide has a role in stimulating glucose uptake (43, 44). We hypothesized that GM-CSF binding to the low affinity receptor generates H2O2 extracellularly, and H2O2 diffuses through the plasma membrane to activate PI 3-kinase. Oocytes expressing alpha GMR or the truncation mutant receptor alpha GMR-A351 were incubated with different concentrations of catalase for 5 min before treatment with GM-CSF. As shown in the Fig. 5A catalase markedly inhibited GM-CSF-stimulated glucose uptake indicating a key role for H2O2 in stimulating glucose transport. To further establish the role of H2O2 in stimulated glucose uptake we directly tested the effect of peroxide on glucose uptake in control oocytes and oocytes expressing alpha GMR constructs. Exposure to 50 µM H2O2 for 30 min caused about 2-fold stimulation of glucose uptake in oocytes expressing alpha GMR (Fig. 5B). Oocytes injected with alpha GMR-A351 showed only a 1.3-fold activation in response to H2O2, a result similar to that in uninjected oocytes (Fig. 5B). These results indicate a role for H2O2 in stimulating glucose transport and show that alpha GMR plays an important but not essential role in mediating the response. The activation of glucose transport in the truncation mutant is similar to uninjected oocytes indicating that PI 3-kinase can be activated by H2O2 in oocytes.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   Role of peroxide in GM-CS-induced glucose uptake. A, oocytes injected with wild type alpha GMR or mutant alpha GMR-A351 were pretreated with 1900 units of catalase (1×) or 3800 units of catalase (2×) prior to GM-CSF stimulation. Experiments were done in triplicate, and the standard deviation is indicated. B, oocytes injected with wild type alpha GMR or mutant alpha GMR-A351 or not injected were stimulated with 50 µM H2O2 and then assayed for DOG uptake as described under "Experimental Procedures." C, oocytes injected with wild type alpha GMR or mutants alpha GMR-A351 or not injected were stimulated with 50 µM H2O2 in the presence or absence of 25 nM wortmannin and then assayed for DOG uptake as described under "Experimental Procedures." wt, wild type.

We further tested the effect of wortmannin on H2O2-induced glucose uptake in oocytes injected with alpha GMR or the truncation mutant alpha GMR-A351. As in GM-CSF-stimulated oocytes, the peroxide-induced stimulation of glucose uptake in oocytes expressing wild type or mutant alpha GMR was inhibited by 25 nM wortmannin (Fig. 5C). These findings link peroxide generation to PI 3-kinase activation and indicate the role of p85 binding site in alpha GMR in the stimulation of glucose uptake.

Monoclonal Antibodies to alpha GMR Stimulate Glucose Transport-- It has been shown that antibody-antigen interaction can lead to the generation of hydrogen peroxide (45). We reasoned that, similar to ligand, antibody to alpha GMR could lead to the generation of H2O2 and stimulation of glucose uptake. We investigated whether the commercially available anti-alpha GMR antibodies S20 and 17A, which recognize the extracellular region of alpha GMR, could stimulate glucose uptake. Fig. 6A shows that anti-alpha GMR monoclonal antibodies S20 and 17A stimulated glucose transport about 2-fold in oocytes injected with alpha GMR. In contrast, the polyclonal antibody N20 that recognizes an extracellular epitope of beta GMR had no effect. Oocytes injected with H2O and incubated with GM-CSF, S20, 17A, and N20 antibodies showed no stimulation of glucose uptake. Oocytes expressing alpha GMR and incubated with the antibodies 17A and S20 for 15 min showed an increase in glucose uptake of about 2-fold. After 60 min of incubation, similar levels of stimulation of glucose uptake were induced by the antibodies and GM-CSF (Fig. 6B). The stimulation of glucose uptake by S20 antibody was completely inhibited by wortmannin (Fig. 6C), indicating that PI 3-kinase is required for antibody- as well as GM-CSF-induced glucose transport. Treatment of alpha GMR-injected oocyte with catalase also abrogated antibody-induced increase in glucose uptake (Fig. 6C). These results indicate that antibody or ligand interaction with alpha GMR on oocytes leads to increased glucose uptake that is dependent on the generation of peroxide and subsequent activation of PI 3-kinase.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6.   Antibodies against the extracellular portion of the alpha GMR stimulate glucose transport. A, uptake of DOG by oocytes. Oocytes were injected with either RNA encoding the alpha GMR or water (control). After 48 h at room temperature the oocytes were incubated for 1 h with 1 nM GM-CSF (GM) or 0.4 µg/ml antibodies as indicated. Uptake of DOG was quantified after 10 min. B, time course effect of GM-CSF and antibodies on DOG uptake in oocytes expressing alpha GMR. Oocytes injected with RNA encoding the alpha GMR were incubated with the antibodies indicated for 15, 30, and 60 min. The DOG uptake was determined over a 10-min period. C, effect of wortmannin and catalase on monoclonal antibody S20-induced glucose uptake. Oocytes injected with wild type alpha GMR were pretreated with 3800 units of catalase (Cat) or 50 nM wortmannin (W) before treatment with GM-CSF or monoclonal antibody S20.

Antibody to alpha GMR Stimulates Glucose Uptake in Mammalian Cells-- To extend the oocyte experiments we investigated the effect of anti-alpha GMR antibodies on human cells expressing the high affinity receptor. Similar to the results in oocytes, we found that antibodies to the alpha  subunit (S20 and 17A) stimulated glucose uptake in the promyelocytic HL-60 cell line and in the monocytic cell line U937 (Fig. 7, A and B). The antibody N20, which reacts with the beta  subunit, had no effect on glucose uptake. HL-60 cells treated with anti-alpha GMR antibodies showed a 20% increase in glucose uptake. In U937 cells, GM-CSF and the anti-alpha GMR antibodies stimulated glucose uptake to comparable levels. We also tested the effect of the antibodies on freshly isolated peripheral blood lymphocytes and observed an increase in glucose uptake in response to GM-CSF and antibodies S20 and 17A but not with antibody N20 (Fig. 7C).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7.   Antibodies against the alpha GMR signal for increased DOG uptake in human cells. Cells were incubated with GM-CSF (GM) and the antibodies for 1 h, and uptake of DOG was measured with 2-min uptake time. A, promyelocytic HL-60 cell line. B, monocytic U937 cell line. C, normal blood lymphocytes. DOG uptake is expressed as percentage of increase over basal uptake.

We propose a signaling pathway for GM-CSF-induced glucose uptake whereby GM-CSF receptor interaction with ligand or antibody leads to local generation of H2O2 that permeates the cell membrane and activates PI 3-kinase signaling. This pathway is illustrated in Fig. 8.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Schematic representation of the mechanisms of GM-CSF-dependent glucose uptake. GM-CSF binding to alpha GMR induces glucose uptake by changing the affinity of facilitative glucose transporters. The initial step for glucose signaling involves H2O2 production followed by activation of the PI 3-kinase signaling pathway, which is inhibited by wortmannin and LY294002. TM, transmembrane.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Hematopoietic cytokines stimulate the proliferation of precursor cells and promote the survival and function of mature cells. These processes require energy, and cytokines such as IL-3, lL-1, and GM-CSF are known to enhance glucose transport in target cells (19, 20, 27, 46-48). Transport of glucose across the plasma membrane occurs predominantly through facilitative GLUTs, and cellular glucose uptake can be modulated by regulating the number of transporters on the cell surface and/or by altering their transport efficiency (49-52). Both GM-CSF and IL-3 enhance the intrinsic efficiency of GLUT1 as reflected by a decrease in the Km without a change in maximum velocity (Vmax) (36, 37). GM-CSF stimulates glucose transport in Xenopus oocytes expressing the isolated human alpha GMR, HL-60 neutrophilic cells expressing the alpha beta GMR heterodimer, and certain other cell types responsive to GM-CSF (12, 26, 27, 36). Little is known, however, about how GM-CSF signals for increased glucose uptake, and there is controversy regarding the requirement for beta GMR (29). Signaling from the isolated alpha GMR for glucose uptake in oocytes does not involve activation of the mitogen-activated protein kinase pathway, and GM-CSF stimulation of glucose uptake in HL-60 neutrophilic cells does not appear to involve activation of kinase pathways that are inhibitable by staurosporine (27). More recently the in vivo relevance of GM-CSF-stimulated glucose uptake through the low affinity alpha GMR has been described in the development of preimplantation embryos in mice. These embryos express an isolated alpha GMR, and there is increased glucose uptake and enhanced proliferation and viability of blastomeres in response to GM-CSF (28). We investigated the initial signaling events of GM-CSF-stimulated glucose uptake and sought to mechanistically define a role for the isolated alpha GMR.

In oocytes, as in mammalian cells, PI 3-kinase activation has been implicated as an important signaling intermediate for insulin-stimulated glucose uptake (53, 54). We hypothesized that PI 3-kinase was involved in the stimulation of glucose uptake by GM-CSF. In oocytes expressing alpha GMR, GM-CSF-stimulated glucose uptake was inhibited by wortmannin and a structurally distinct inhibitor of PI 3-kinase, LY294002, in a dose-dependent manner. GM-CSF-stimulated glucose uptake in HL-60 cells expressing the high affinity receptor was also blocked by wortmannin. The inhibitor results therefore implicate the involvement of PI 3-kinase in the stimulation of glucose uptake signaled through alpha GMR and the alpha beta GMR high affinity receptor. We also found clear evidence for a physical interaction between alpha GMR and p85. In searching for potential domains of alpha GMR that interact with p85, we examined an SH-3 domain-binding motif, QRLFPPVP, that is conserved among the GM-CSF, IL-3, and IL-5 receptors in the intracellular membrane proximal region (17, 55). A tyrosine residue toward the carboxyl end of alpha GMR (amino acid residue 389) is not in the context of a consensus motif used for p85 binding by certain receptors (56, 57). Mutation of the SH-3 domain-binding site abrogated the interaction of p85 to alpha GMR as did a mutation deleting most of the cytoplasmic region of the alpha GMR. Oocytes expressing these mutants showed GM-CSF-stimulated glucose uptake of about 50% of wild type alpha GMR. This result suggested that interaction of p85 with the SH-3 domain-binding motif, while required for PI 3-kinase binding, was only partly responsible for GM-CSF-induced glucose uptake. The residual activity of the mutants was dependent on PI 3-kinase activation as it was completely blocked by wortmannin.

In several cell types insulin elicits rapid production of hydrogen peroxide (44), and one of the subsequent cell responses to the H2O2 production by insulin is increase in glucose uptake (58). Generation of extracellular peroxide has been demonstrated previously in fibroblasts and endothelial cells treated with transforming growth factor-beta and ROS-generating systems such as glucose/glucose oxidase or xanthine/xanthine oxidase can increase glucose uptake in 3T3-L1 adipocytes and L6 myotubes (43). Treatment with peroxidase in these cases inhibited the increase in glucose uptake indicating that extracellular H2O2 was connected to stimulation of glucose transport (43). In addition, GM-CSF is known to use ROS for signaling (41, 42), and ROS can act as a second messenger in cellular signaling by modifying the activity of redox-sensitive enzymes including kinases and phosphatases (59-61). We found that catalase and PI 3-kinase inhibitors markedly decreased GM-CSF-stimulated glucose uptake in oocytes expressing wild type or truncated alpha GMR. Hydrogen peroxide also induced PI 3-kinase-dependent glucose uptake in oocytes expressing wild type and to a lesser extent the truncated alpha GMR. H2O2 had some activity in stimulating glucose uptake in oocytes not expressing alpha GMR. The experiments in oocytes expressing alpha GMR yielded results consistent with the thesis that GM-CSF binding to the low affinity receptor generates H2O2, which then stimulates glucose uptake via the activation of PI 3-kinase.

Lerner and colleagues (45) have provided strong evidence for antigen-antibody interaction leading to generation of H2O2 through catalysis of molecular oxygen and H2O. We found that anti-alpha GMR antibody stimulated glucose transport in Xenopus oocytes expressing alpha GMR and also in HL-60 cells, U937, and peripheral blood lymphocytes in a wortmannin-inhibitable manner. Antibody to alpha GMR induced glucose uptake that was blocked by catalase, suggesting that peroxide production was mediating induction of glucose uptake.

The role of the alpha  subunit of the GM-CSF receptor in signal transduction through the high affinity receptor has been illuminated by mutational and structural studies (55, 62-64); however, there has been controversy regarding the ability of the isolated alpha GMR to signal (29). The results reported here define a signaling system for enhanced glucose uptake dependent on H2O2 generation leading to the activation of PI 3-kinase. The most proximal initiation appears to be peroxide generated from ligand or antibody interaction with the extracellular domain of alpha GMR. Permeation of peroxide leads to PI 3-kinase activation, which is facilitated by an SH-3 domain-binding motif in the cytoplasmic portion of the alpha GMR. Since most of the intracellular portion of alpha GMR is not absolutely required for PI 3-kinase activation, we envision that such activation could occur at a proximal cell membrane location. PI 3-kinase initiates well known signaling pathways; however, it is not known how it causes increased transport by reducing Km. Since vitamin C is transported as dehydroascorbic acid through GLUT1 and its uptake is stimulated by GM-CSF (37), the GM-CSF-stimulated PI 3-kinase pathways can operate to enhance cellular antioxidant function as well as provide increased metabolic substrate for cellular function.

    ACKNOWLEDGEMENTS

We thank Dr. Isabel Perez-Cruz for isolation of lymphocytes from blood and Oriana Bórquez-Ojeda and Alicia Pedraza for technical help.

    FOOTNOTES

* This study was supported by National Institutes of Health Grants CA30388 and 2P30 CA08748-28, New York State Department of Health Grant M010283, the Schultz Foundation, and the Lebensfeld Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Both authors contributed equally to this work.

** To whom correspondence should be addressed. Tel.: 212-639-8483; Fax: 212-772-8589; E-mail: d-golde@ski.mskcc.org.

Published, JBC Papers in Press, January 21, 2003, DOI 10.1074/jbc.M212541200

    ABBREVIATIONS

The abbreviations used are: GM-CSF, granulocyte-macrophage colony-stimulating factor; GMR, GM-CSF receptor; PI, phosphatidylinositol; SH-3, Src homology 3; GLUT, glucose transporter; DOG, 2-deoxy-D-glucose; ROS, reactive oxygen species; IL, interleukin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Gasson, J. C. (1991) Blood 77, 1131-1145[Free Full Text]
2. McKinstry, W. J., Li, C. L., Rasko, J. E., Nicola, N. A., Johnson, G. R., and Metcalf, D. (1997) Blood 89, 65-71[Abstract/Free Full Text]
3. Hayashida, K., Kitamura, T., Gorman, D. M., Arai, K., Yokota, T., and Miyajima, A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9655-9659[Abstract/Free Full Text]
4. Bussolino, F., Wang, J. M., Defilippi, P., Turrini, F., Sanavio, F., Edgell, C. J., Aglietta, M., Arese, P., and Mantovani, A. (1989) Nature 337, 471-473[CrossRef][Medline] [Order article via Infotrieve]
5. Avalos, B. R., Gasson, J. C., Hedvat, C., Quan, S. G., Baldwin, G. C., Weisbart, R. H., Williams, R. E., Golde, D. W., and DiPersio, J. F. (1990) Blood 75, 851-857[Abstract/Free Full Text]
6. Baldwin, G. C., Gasson, J. C., Kaufman, S. E., Quan, S. G., Williams, R. E., Avalos, B. R., Gazdar, A. F., Golde, D. W., and DiPersio, J. F. (1989) Blood 73, 1033-1037[Abstract/Free Full Text]
7. Baldwin, G. C., Golde, D. W., Widhopf, G. F., Economou, J., and Gasson, J. C. (1991) Blood 78, 609-615[Abstract/Free Full Text]
8. Taketazu, F., Chiba, S., Shibuya, K., Kuwaki, T., Tsumura, H., Miyazono, K., Miyagawa, K., and Takaku, F. (1991) J. Cell. Physiol. 146, 251-257[CrossRef][Medline] [Order article via Infotrieve]
9. Lee, S. C., Liu, W., Roth, P., Dickson, D. W., Berman, J. W., and Brosnan, C. F. (1993) J. Immunol. 150, 594-604[Abstract]
10. Rivas, C. I., Vera, J. C., Delgado-Lopez, F., Heaney, M. L., Guaiquil, V. H., Zhang, R. H., Scher, H. I., Concha, I. I., Nualart, F., Cordon-Cardo, C., and Golde, D. W. (1998) Blood 91, 1037-1043[Abstract/Free Full Text]
11. Hirsch, T., Eggstein, S., Frank, S., Farthmann, E. H., and von Specht, B. U. (1995) Biochem. Biophys. Res. Commun. 217, 138-143[CrossRef][Medline] [Order article via Infotrieve]
12. Zambrano, A., Noli, C., Rauch, M. C., Werner, E., Brito, M., Amthauer, R., Slebe, J. C., Vera, J. C., and Concha, I. I. (2001) J. Cell. Biochem. 80, 625-634[CrossRef][Medline] [Order article via Infotrieve]
13. Scheid, M. P., Lauener, R. W., and Duronio, V. (1995) Biochem. J. 312, 159-162[Medline] [Order article via Infotrieve]
14. Geijsen, N., Koenderman, L., and Coffer, P. J. (2001) Cytokine Growth Factor Rev. 12, 19-25[CrossRef][Medline] [Order article via Infotrieve]
15. Miyajima, A., Mui, A. L., Ogorochi, T., and Sakamaki, K. (1993) Blood 82, 1960-1974[Free Full Text]
16. Polotskaya, A., Zhao, Y., Lilly, M. L., and Kraft, A. S. (1993) Cell Growth & Differ. 4, 523-531[Abstract]
17. Moon, B. G., Yoshida, T., Shiiba, M., Nakao, K., Katsuki, M., Takaki, S., and Takatsu, K. (2001) Immunology 102, 289-300[CrossRef][Medline] [Order article via Infotrieve]
18. Geijsen, N., Uings, I. J., Pals, C., Armstrong, J., McKinnon, M., Raaijmakers, J. A., Lammers, J. W., Koenderman, L., and Coffer, P. J. (2001) Science 293, 1136-1138[Abstract/Free Full Text]
19. Whetton, A. D., Bazill, G. W., and Dexter, T. M. (1985) J. Cell. Physiol. 123, 73-78[CrossRef][Medline] [Order article via Infotrieve]
20. Nefesh, I., Bauskin, A. R., Alkalay, I., Golembo, M., and Ben-Neriah, Y. (1991) Int. Immunol. 3, 827-831[Abstract/Free Full Text]
21. Dexter, T. M., Whetton, A. D., and Bazill, G. W. (1984) Differentiation 27, 163-167[CrossRef][Medline] [Order article via Infotrieve]
22. Tan, A. S., Ahmed, N., and Berridge, M. V. (1998) Blood 91, 649-655[Abstract/Free Full Text]
23. Berridge, M. V., and Tan, A. S. (1995) Biochem. J. 305, 843-851[Medline] [Order article via Infotrieve]
24. McCoy, K. D., Ahmed, N., Tan, A. S., and Berridge, M. V. (1997) J. Biol. Chem. 272, 17276-17282[Abstract/Free Full Text]
25. Vander Heiden, M. G., Plas, D. R., Rathmell, J. C., Fox, C. J., Harris, M. H., and Thompson, C. B. (2001) Mol. Cell. Biol. 21, 5899-5912[Abstract/Free Full Text]
26. Spielholz, C., Heaney, M. L., Morrison, M. E., Houghton, A. N., Vera, J. C., and Golde, D. W. (1995) Blood 85, 973-980[Abstract/Free Full Text]
27. Ding, D. X., Rivas, C. I., Heaney, M. L., Raines, M. A., Vera, J. C., and Golde, D. W. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 2537-2541[Abstract/Free Full Text]
28. Robertson, S. A., Sjoblom, C., Jasper, M. J., Norman, R. J., and Seamark, R. F. (2001) Biol. Reprod. 64, 1206-1215[Abstract/Free Full Text]
29. Scott, C. L., Hughes, D. A., Cary, D., Nicola, N. A., Begley, C. G., and Robb, L. (1998) Blood 92, 4119-4127[Abstract/Free Full Text]
30. Medina, R. A., and Owen, G. I. (2002) Biol. Res. 35, 9-26[Medline] [Order article via Infotrieve]
31. Siegert, W., and Monch, T. (1981) Blut 43, 297-305[CrossRef][Medline] [Order article via Infotrieve]
32. Corkey, R. F., Corkey, B. E., and Gimbrone, M. A., Jr. (1981) J. Cell. Physiol. 106, 425-434[CrossRef][Medline] [Order article via Infotrieve]
33. Ishizuka, T., Kajita, K., Miura, A., Ishizawa, M., Kanoh, Y., Itaya, S., Kimura, M., Muto, N., Mune, T., Morita, H., and Yasuda, K. (1999) Am. J. Physiol. 276, E196-E204[Medline] [Order article via Infotrieve]
34. Egawa, K., Sharma, P. M., Nakashima, N., Huang, Y., Huver, E., Boss, G. R., and Olefsky, J. M. (1999) J. Biol. Chem. 274, 14306-14314[Abstract/Free Full Text]
35. Bentley, J., Walker, I., McIntosh, E., Whetton, A. D., Owen-Lynch, P. J., and Baldwin, S. A. (2001) Br. J. Haematol. 112, 212-215[CrossRef][Medline] [Order article via Infotrieve]
36. Ahmed, N., Kansara, M., and Berridge, M. V. (1997) Biochem. J. 327, 369-375[Medline] [Order article via Infotrieve]
37. Vera, J. C., Rivas, C. I., Zhang, R. H., and Golde, D. W. (1998) Blood 91, 2536-2546[Abstract/Free Full Text]
38. Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8392-8396[Abstract/Free Full Text]
39. Davies, S. P., Reddy, H., Caivano, M., and Cohen, P. (2000) Biochem. J. 351, 95-105[CrossRef][Medline] [Order article via Infotrieve]
40. Tomonaga, M., Gasson, J. C., Quan, S. G., and Golde, D. W. (1986) Blood 67, 1433-1441[Abstract/Free Full Text]
41. Carcamo, J. M., Borquez-Ojeda, O., and Golde, D. W. (2002) Blood 99, 3205-3212[Abstract/Free Full Text]
42. Sattler, M., Winkler, T., Verma, S., Byrne, C. H., Shrikhande, G., Salgia, R., and Griffin, J. D. (1999) Blood 93, 2928-2935[Abstract/Free Full Text]
43. Kozlovsky, N., Rudich, A., Potashnik, R., and Bashan, N. (1997) Free Radic. Biol. Med. 23, 859-869[CrossRef][Medline] [Order article via Infotrieve]
44. Mahadev, K., Zilbering, A., Zhu, L., and Goldstein, B. J. (2001) J. Biol. Chem. 276, 21938-21942[Abstract/Free Full Text]
45. Wentworth, P., Jr., Jones, L. H., Wentworth, A. D., Zhu, X., Larsen, N. A., Wilson, I. A., Xu, X., Goddard, W. A., III, Janda, K. D., Eschenmoser, A., and Lerner, R. A. (2001) Science 293, 1806-1811[Abstract/Free Full Text]
46. Whetton, A. D., Bazill, G. W., and Dexter, T. M. (1984) EMBO J. 3, 409-413[Medline] [Order article via Infotrieve]
47. Hamilton, J. A., Vairo, G., and Lingelbach, S. R. (1988) J. Cell. Physiol. 134, 405-412[CrossRef][Medline] [Order article via Infotrieve]
48. Freedman, M. H., Grunberger, T., Correa, P., Axelrad, A. A., Dube, I. D., and Cohen, A. (1993) Blood 81, 3068-3075[Abstract/Free Full Text]
49. Gould, G. W., and Holman, G. D. (1993) Biochem. J. 295, 329-341[Medline] [Order article via Infotrieve]
50. Cushman, S. W., and Wardzala, L. J. (1980) J. Biol. Chem. 255, 4758-4762[Free Full Text]
51. Cushman, S. W., Goodyear, L. J., Pilch, P. F., Ralston, E., Galbo, H., Ploug, T., Kristiansen, S., and Klip, A. (1998) Adv. Exp. Med. Biol. 441, 63-71[Medline] [Order article via Infotrieve]
52. Bird, T. A., Davies, A., Baldwin, S. A., and Saklatvala, J. (1990) J. Biol. Chem. 265, 13578-13583[Abstract/Free Full Text]
53. Egert, S., Nguyen, N., Brosius, F. C., and Schwaiger, M. (1997) Cardiovasc. Res. 35, 283-293[Abstract/Free Full Text]
54. Gould, G. W., Jess, T. J., Andrews, G. C., Herbst, J. J., Plevin, R. J., and Gibbs, E. M. (1994) J. Biol. Chem. 269, 26622-26625[Abstract/Free Full Text]
55. Matsuguchi, T., Zhao, Y., Lilly, M. B., and Kraft, A. S. (1997) J. Biol. Chem. 272, 17450-17459[Abstract/Free Full Text]
56. Thakker, G. D., Hajjar, D. P., Muller, W. A., and Rosengart, T. K. (1999) J. Biol. Chem. 274, 10002-10007[Abstract/Free Full Text]
57. Kontos, C. D., Stauffer, T. P., Yang, W. P., York, J. D., Huang, L., Blanar, M. A., Meyer, T., and Peters, K. G. (1998) Mol. Cell. Biol. 18, 4131-4140[Abstract/Free Full Text]
58. Mahadev, K., Wu, X., Zilbering, A., Zhu, L., Lawrence, J. T., and Goldstein, B. J. (2001) J. Biol. Chem. 276, 48662-48669[Abstract/Free Full Text]
59. Finkel, T. (2000) FEBS Lett. 476, 52-54[CrossRef][Medline] [Order article via Infotrieve]
60. Kamata, H., and Hirata, H. (1999) Cell. Signal. 11, 1-14[CrossRef][Medline] [Order article via Infotrieve]
61. Suzuki, Y. J., Forman, H. J., and Sevanian, A. (1997) Free Radic. Biol. Med. 22, 269-285[CrossRef][Medline] [Order article via Infotrieve]
62. DiPersio, J. F., Golde, D. W., and Gasson, J. D. (1990) Int. J. Cell Cloning 8 Suppl. 1, 63-75[Abstract]
63. Lilly, M. B., Zemskova, M., Frankel, A. E., Salo, J., and Kraft, A. S. (2001) Blood 97, 1662-1670[Abstract/Free Full Text]
64. Evans, C. A., Ariffin, S., Pierce, A., and Whetton, A. D. (2002) Blood 100, 3164-3174[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
G. J. DeYulia Jr., J. M. Carcamo, O. Borquez-Ojeda, C. C. Shelton, and D. W. Golde
Hydrogen peroxide generated extracellularly by receptor-ligand interaction facilitates cell signaling
PNAS, April 5, 2005; 102(14): 5044 - 5049.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. B. Carter, L. A. Tephly, S. Venkataraman, L. W. Oberley, Y. Zhang, G. R. Buettner, D. R. Spitz, and G. W. Hunninghake
High Levels of Catalase and Glutathione Peroxidase Activity Dampen H2O2 Signaling in Human Alveolar Macrophages
Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 43 - 53.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. B. Gaynor
A role for extracellular matrix binding receptors in regulating hematopoietic growth factor signaling
PNAS, November 25, 2003; 100(24): 13737 - 13738.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Chen, J. M. Carcamo, O. Borquez-Ojeda, H. Erdjument-Bromage, P. Tempst, and D. W. Golde
From the Cover: The laminin receptor modulates granulocyte-macrophage colony-stimulating factor receptor complex formation and modulates its signaling
PNAS, November 25, 2003; 100(24): 14000 - 14005.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/13/11107    most recent
M212541200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dhar-Mascareño, M.
Right arrow Articles by Golde, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dhar-Mascareño, M.
Right arrow Articles by Golde, D. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement