Originally published In Press as doi:10.1074/jbc.M212606200 on January 21, 2003
J. Biol. Chem., Vol. 278, Issue 13, 11115-11122, March 28, 2003
Regulators of G-protein Signaling (RGS) 4, Insertion into
Model Membranes and Inhibition of Activity by Phosphatidic Acid*
Ying-Shi
Ouyang
,
Yaping
Tu§,
Sheryll A.
Barker§, and
Fuyu
Yang
¶
From the
National Laboratory of Biomacromolecules,
Institute of Biophysics, Chinese Academy of Sciences, Beijing, 100101, China and the § Department of Pharmacology, University of
Texas Southwestern Medical Center, Dallas, Texas 75390-9041
Received for publication, December 11, 2002
 |
ABSTRACT |
Regulators of G-protein signaling (RGS) proteins
are critical for attenuating G protein-coupled signaling pathways. The
membrane association of RGS4 has been reported to be crucial for its
regulatory activity in reconstituted vesicles and physiological roles
in vivo. In this study, we report that RGS4 initially binds
onto the surface of anionic phospholipid vesicles and subsequently inserts into, but not through, the membrane bilayer. Phosphatidic acid,
one of anionic phospholipids, could dramatically inhibit the ability of
RGS4 to accelerate GTPase activity in vitro. Phosphatidic acid is an effective and potent inhibitor of RGS4 in a
G
i1-[
-32P]GTP single turnover assay
with an IC50 ~ 4 µM and maximum inhibition of over 90%. Furthermore, phosphatidic acid was the only phospholipid tested that inhibited RGS4 activity in a receptor-mediated,
steady-state GTP hydrolysis assay. When phosphatidic acid (10 mol %)
was incorporated into m1 acetylcholine receptor-G
q
vesicles, RGS4 GAP activity was markedly inhibited by more than 70%
and the EC50 of RGS4 was increased from 1.5 to 7 nM. Phosphatidic acid also induced a conformational change
in the RGS domain of RGS4 measured by acrylamide-quenching experiments.
Truncation of the N terminus of RGS4 (residues 1-57) resulted in the
loss of both phosphatidic acid binding and lipid-mediated functional
inhibition. A single point mutation in RGS4 (Lys20 to Glu)
permitted its binding to phosphatidic acid-containing vesicles
but prevented lipid-induced conformational changes in the RGS domain
and abolished the inhibition of its GAP activity. We speculate that the
activation of phospholipase D or diacylglycerol kinase via G
protein-mediated signaling cascades will increase the local
concentration of phosphatidic acid, which in turn block RGS4 GAP
activity in vivo. Thus, RGS4 may represent a novel effector of phosphatidic acid, and this phospholipid may function as a feedback
regulator in G protein-mediated signaling pathways.
 |
INTRODUCTION |
The G-protein signaling pathway is one of the most important
signaling cascades used to relay extracellular signals and sensory stimuli in eukaryotic cells. Classically, this signaling system is
composed of three major components: G protein-coupled receptors, heterotrimeric G proteins, and second messenger-producing effectors (1). Recently, regulators of G-protein
signaling (RGS)1
have been identified as GTPase-activating proteins (GAP) for G
subunits, thereby attenuating a number of
G-protein-dependent signaling cascades (Ref. 2,
and for review see Ref. 3). Members of this protein family
share a conserved domain of ~120 amino acid residues, defined as the
RGS domain. This domain retains GAP activity in vitro
comparable with the full-length RGS protein (4). The structure of the
RGS4·G
i1 complex in the presence of both GDP
and AlF
shed light on the mechanism whereby RGS
proteins promote the intrinsic GTPase activity of G
subunits (5).
Flanking sequences outside the RGS domain exhibit considerable
diversity and constitute additional domains that enable RGS proteins to
interact with membranes or proteins beyond G
subunits (6).
The membrane binding of RGS proteins is essential for their
physiological functions. RGSZ1, a Gz-selective RGS protein
in the brain, requires membrane association for its GAP activity toward
Gz (7). The association of RGS4 with the plasma membrane occurs through an N-terminal
-helix that is also found in RGS16 and
RGS2. Plasma membrane association is required for most RGS proteins to
inhibit G-protein signaling in vivo and confers receptor selectivity (8-11). A recent study indicated that RGS4 binds to phospholipid surfaces in a slow, multistep process where the binding of
RGS4 is initially reversible but becomes irreversible within minutes
(12). However, whether RGS4 is simply bound to the membrane surface or
can penetrate into the membrane bilayer remains unknown.
It has been previously reported that RGS4 binds to anionic phospholipid
liposomes (13). However, relatively little is known about what
modulates RGS4 activity on signaling pathways when bound to the
membrane. RGS4 must bind to model membranes in a specific orientation
for its optimal GAP activity in vitro (12). Popov and
co-workers (14) reported that RGS4 binds to phosphatidylinositol 3,4,5-trisphosphate, another anionic phospholipid, at a site
within the RGS domain distinct from and opposite to the RGS/G
contact face. As a consequence, phosphatidylinositol
3,4,5-trisphosphate binding inhibits GAP activity of RGS4 (14, 15).
Using model membranes, we demonstrate here that RGS4 can insert into
one leaflet of some anionic phospholipid membranes following its
initial membrane association. Although both phosphatidylserine (PS) and
phosphatidic acid (PA) are effective in promoting RGS4 insertion into
the membrane bilayer, PA selectively inhibits its GAP activity in both
single-turnover and reconstituted vesicle assays. PA-mediated
inhibition of GAP activity of RGS4 requires its N-terminal domain.
Also, a mutation of Lys20 in the N terminus of RGS4 blocks
the PA-induced conformational change in the RGS domain and diminishes
PA-conferred inhibition of its GAP activity. PA is a putative second
messenger (21) and arises principally from two major signal
transduction pathways via phospholipase D (PLD) (16) and diacylglycerol
kinase (DGK) (17, 18), both of which are regulated by G protein-coupled receptors (19, 20). Based on our results, we speculate that RGS4 may
represent a novel effector of phosphatidic acid.
 |
EXPERIMENTAL PROCEDURES |
Materials
Myristoylated G
i1, RGS4 wild type, and the
N-terminal truncation mutant (
57RGS4) with an N-terminal
His6 tag were purified from Escherichia coli as
described previously (12). Untagged RGS4 was a gift from Maurine Linder
(Washington University School of Medicine). G
q (22),
G
1
2 (23), and m1 AchR (24) were purified
from Sf9 cells. PS (bovine brain), phosphatidylinositol (egg yolk), cardiolipin (bovine brain), cholesteryl hemisuccinate (CHS), dansyl-PE, imidazole, and Tween 20 were purchased from Sigma.
Phosphatidylcholine (PC) (bovine brain), phosphatidic acid (egg yolk),
phosphatidylglycerol (PG) (bovine brain), and
1-palmitoyl-2-stearoyl-(5-doxyl)-sn-glycero-3-phosphocholine (DPC) were products of Avanti Polar Lipids Inc. GTP
S and GTP were
purchased from Roche Molecular Biochemicals.
[
-32P]GTP (30 Ci/mmol) and [35S]GTP
S
(1250 Ci/mmol) were obtained from PerkinElmer Life Sciences. Acrylamide
(Ultrapure) was from Invitrogen. The antibody to the C terminus
of RGS4 and secondary antibody were purchased from Santa Cruz
Biotechnology. p-Nitrophenyl phosphate was from Ameresco. The 96-well microtiter plates were obtained from Nunc. Other reagents were of analytic grade available in China.
Site-directed Mutagenesis of RGS4
RGS4K20E was generated by the QuikChange mutagenesis kit
(Stratagene) using the following primers (the mutated codons are in
bold): primer 1, GCAAAGGATATGGAACATCGGCTGGG, and primer 2, CCCAGCCGATGTTCCATATCCTTTGC. RGS4W59A was generated using Gene Editor (Promega). The mutagenic oligonucleotide (the mutated codon
is in bold) was: GAAGTCAAGAAAGCGGCTGAATCGCTG. RGS4 coding
regions of all constructs were sequenced to verify that only the
desired mutations had been introduced.
Preparation of Liposomes
Lipids of desired compositions were mixed in chloroform/methanol
(3:1) and dried under a stream of nitrogen. Residual solvents were
removed under vacuum for 3-4 h. The phospholipid films were then
resuspended in an appropriate buffer and vortexed thoroughly for
hydration. Small unilamellar vesicles (SUVs) were prepared by
sonicating lipid suspensions to optical clarity at ~2-3-min intervals. Large unilamellar vesicles were prepared according to
Rietveld et al. (25). For centrifugation binding
experiments, large unilamellar vesicles were made in 10 mM
Pipes, pH 7.4, 50 mM NaCl, and 0.1 mM EDTA. For
fluorescence measurements, SUVs were prepared in 10 mM
Hepes, pH 7.4, and 1 mM dithiothreitol. Phospholipid
concentration was determined after perchloric acid digestion (26).
Assays to Measure RGS4 Protein Binding to Phospholipid
Vesicles
Centrifugation Assay--
RGS4 (0.6-1.8 µg) was incubated for
45 min at 30 °C with 50 µl of large unilamellar vesicles with the
desired components at varied concentrations. The mixture was subjected
to centrifugation at 100,000 × g for 1 h at
4 °C. In a control experiment, RGS4 was centrifuged without
phospholipid vesicle preincubation. The supernatants were separated by
SDS-PAGE, electrophoretically transferred to nitrocellulose, and
Western blotted (27). The amount of unbound RGS4 was estimated by
comparing the amount of RGS4 found in the supernatant with varying
amounts of defined RGS4 standards. The bound RGS4 was determined by
subtraction of the unbound protein from the total. The RGS4 in the
supernatant from control experiments was used as the total to calculate
the binding efficiency of RGS4 to vesicles.
Fluorescence Resonance Energy Transfer Method--
Fluorescence
resonance energy transfer between tryptophans in the RGS4 protein
(excitation at 280 nm) and dansyl in the phospholipid (emission at 515 nm) was used to monitor the association of protein with phospholipid
vesicles (28). Direct excitation of the dansyl group at 280 nm produced
a reference emission intensity (F0). Fluorescence energy transfer was expressed as (F
F0)/F0, where F and F0 are the fluorescence
emission intensities of phospholipid at 515 nm with and without
addition of RGS4, respectively. Dansyl-PE was mixed at 5 mol % in SUVs
with the desired phospholipid compositions. The measurements were
performed at 30 °C in a Hitachi F4010 fluorescence spectrophotometer.
Binding of RGS4 or RGS4 Mutants to PA Assayed by ELISAs
All procedures were performed as described previously (29). In
brief, PA solutions (10 µg/well) diluted in methanol were allowed to
bind overnight at 4 °C. The following ELISA steps were performed at
room temperature. The wells were blocked with 3% bovine serum albumin
in phosphate-buffered saline, pH 7.5, for 2 h. RGS4 or RGS4
mutants were added to the wells and incubated for 1 h. Bound
proteins were detected using anti-RGS4 C terminus goat polyclonal
antibody (1:500) followed by donkey anti-goat IgG-alkaline phosphatase
conjugate (1:8000) and developed using p-nitrophenyl
phosphate. The resulting absorbance was read at 405 nm using an ELISA
plate reader (Bio-Rad). The magnitude of the absorbance was directly
related to the bound amount of RGS4 and/or its mutant proteins, and
this measurement was used to determine the dissociation constant
according to the one-site binding equation.
Insertion of RGS4 into Phospholipid Monolayer
The monolayer surface pressure (
), defined as the change in
surface tension after spreading a monolayer on a water surface, was
measured by the Wilhelmy plate method with a Han-2000 microbalance designed by Dr. X. H. Han in our laboratory (30). The temperature was controlled at 20.0 ± 1.0 °C. Phospholipid monolayers were formed from a chloroform/methanol (3:1, v/v) stock solution of PC, PS,
or PA (250 µg/ml). The experiments were performed as follows. The
circular trough used for the penetration assay was filled with 3 ml of
Pipes buffer (10 mM Pipes, 50 mM NaCl, 0.1 mM EDTA, pH 7.4). Then, the phospholipid monolayers were
prepared by carefully spreading aliquots of phospholipid solution on
the buffer surface. After the film pressure stabilized at a constant
value (defined as the initial surface pressure (
i)),
RGS4 was injected through a side sample hole into the subphase
containing a magnetic stirring bar. The pressure changes were recorded
until the increase of surface pressure (
) reached a maximal value.
To measure the ability of RGS4 to insert into the phospholipid
monolayers, the values of 
at 270 nM RGS4 were
plotted as a function of varied initial surface pressure
(
i). The plot of 
versus
i yields a straight line with a negative slope that intersects the abscissa at a limiting surface pressure. This limiting surface pressure is named the exclusion pressure (
ex)
and is the point at which RGS4 no longer penetrates into the
phospholipid monolayer.
Protein-induced Calcein Release Experiment
Calcein-enclosed vesicles were prepared and release experiments
were performed as previously reported (31). Liposomes were made from
PC, PA, PE, and CHS (3:3:1:1). Calcein-containing liposomes were
separated from free calcein by AcA34 chromatography and used immediately. Fluorescence was monitored on a Hitachi F2000 fluorescence spectrophotometer. Excitation was at 490 nm and emission was monitored at 520 nm.
Fluorescence Spectroscopy
RGS4 contains two tryptophans at positions 59 and 92. Intrinsic
tryptophan fluorescence of RGS4 was measured using a Hitachi F4500
fluorescence spectrophotometer with a 1-cm quartz fluorescence cuvette.
RGS4 was incubated with the indicated liposomes at 30 °C for 30 min
before measurements. For the quenching experiments, excitation was set
at 295 nm instead of 280 nm to excite only Trp residues. After each
addition of a quencher, the mixture was stirred and equilibrated for at
least 5 min before the emission intensity at 340 nm was recorded.
Background fluorescence in samples without protein was subtracted, and
the data of emission fluorescence intensities were determined from the
corrected spectra. Unless otherwise noted, the emission and excitation
slit widths were set at 5 and 10 nm, respectively. The temperature was
maintained at 30 °C. The assay buffer was 10 mM Hepes, 1 mM dithiothreitol, pH 7.4.
For the depth quenching experiments, DPC was incorporated into the SUVs
at a concentration of 10% (molar percent). Aliquots of SUVs with and
without DPC were added to the cuvette containing RGS4 (3.2 µM). The F0/F values
were obtained from the corrected spectra described above by using the
fluorescence intensities of samples without and with DPC labels.
Acrylamide, a hydrophilic quencher, was used to determine the
conformational change in hydrophilic regions of RGS4. Acrylamide was
added to the assay buffer containing 1.4 µM RGS4 or RGS4
mutants plus PA vesicles (100:1 molar ratio of vesicles to proteins). The acrylamide quenching data were corrected for dilution and background contributions and fitted by the Stern-Volmer equation (32):
F0/F = 1 + KSV [Q], where
F0 and F are the fluorescence intensities in the absence and presence of quencher, respectively, [Q] is the concentration of quencher and
KSV is the Stern-Volmer quenching constant
(M
1).
RGS4 GAP Assays
Single Turnover [
-32P]GTPase Assays--
Single
turnover assays using ~100 nM
G
i1-[
-32P]GTP were performed on ice as
described previously (12). Briefly, purified G
i1 (2 µM) was first bound to [
-32P]GTP in 25 mM Hepes, pH 7.5, 10 mM EDTA, 0.05% Triton
X-100, 50 mM NaCl, 1 mM dithiothreitol. The
reaction mixture was chilled on ice and
G
i1-[
-32P]GTP was immediately purified
by centrifugal gel filtration. The rate of
G
i1-[
-32P]GTP hydrolysis was measured
in 25 mM Hepes, pH 7.5, 50 mM NaCl, 1 mM dithiothreitol, and 1 mM free
Mg2+ in the presence or absence of RGS4. 2 µM RGS4 was preincubated with the indicated lipids
(25-750 µM) (Fig. 4) or 200 µM PA vesicles (Fig. 6) for 30 min at 4 °C before initiation of the reaction. In
this assay, GAP activity is defined as the increase in the first-order
hydrolysis rate constant (khydrol) or is
approximated as an increase in the initial rate of hydrolysis (33).
Steady-state GTPase Assays--
A presumably more physiological
assay for GAP activity of RGS4 monitors the enhancement of
agonist-stimulated, steady-state GTPase activity in proteoliposomes
reconstituted with receptor and heterotrimeric G proteins.
Reconstitution of m1 AchR with Gq was performed as
described (22). We kept PE/CHS/PS at a constant molar ratio of 60:10:20
in our reconstituted vesicles and added PC, PS, PG, or PA at 10 mol % to evaluate the effect of different phospholipids on GAP activity of
RGS4. RGS4 was added to the vesicles and incubated for 30 min at
30 °C prior to assay. Steady-state assays were carried out at
30 °C for 20 min. Data are given as increases in steady-state GTPase
activity (34).
 |
RESULTS AND DISCUSSION |
Association of RGS4 with Anionic Phospholipid Membranes--
RGS4
was incubated with vesicles composed of the indicated phospholipids,
and then unbound RGS4 was separated from the membrane-bound population
by sedimentation of vesicles using ultracentrifugation. The amount of
RGS4 present in each supernatant was determined by Western blotting
(not shown), and the amount of RGS4 bound under each condition was
determined as described under "Experimental Procedures."
To investigate whether the binding of RGS4 to membranes depends on the phospholipid composition of the vesicles, we first examined the ability of RGS4 to bind to vesicles containing PS/PC (PS,
20 mol %), PA/PC (PA, 20 mol %), PE/PC (PE, 20 mol %), or PC alone.
Fig. 1A demonstrates that RGS4
did bind to vesicles containing anionic phospholipids in a
concentration-dependent fashion. In contrast, no RGS4 was
associated with vesicles composed exclusively of the neutral
phospholipids PC and PE, implying that electrostatic interaction plays
a role in binding. These results are consistent with what has been
observed previously (12, 13). The nature of the binding interaction
between RGS4 and PA was further investigated using liposome association
experiments. PE/CHS/PA liposomes (400 µM) containing
constant CHS (10 mol %) and varying mole fractions of PA (0-30 mol
%) were prepared and incubated with RGS4 (1 µM). The
amount of RGS4 bound was quantitated as described above, and plotted as
a function of the concentration of PA. The results of the liposome
association experiment are shown in Fig. 1B. Notably, a
significant increase in RGS4-PA association was observed at more than
10 mol % PA. The data was plotted and fit to the Hill equation for
receptor-ligand binding (35). Using a sigmoidal fit, the half-maximal
binding affinity (apparent Kd) of RGS4 for PA was
estimated to be 8 ± 1 mol % PA. A Hill coefficient of about 2.5 was also obtained, suggesting positive cooperativity of binding of RGS4
to membranes. This observation may reflect cooperative sequestering of
PA around RGS4.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1.
Association of RGS4 with vesicles containing
different phospholipids. A, binding of RGS4 to membranes was
measured in vesicles isolated by centrifugation. Varying liposome
concentrations (80 mol % of PC and 20 mol % of PA, PS, PE, or PC)
were incubated with 0.5 µM RGS for 45 min at 30 °C.
The extent of protein association with vesicles was determined relative
to the amount of protein recovered in the absence of phospholipids
(y axis = fraction of RGS4 bound). B,
binding of RGS4 to liposomes as a function of PA molar percent. 0.5 µM RGS4 was incubated with vesicles containing PA/PE/CHS.
The total lipid invariant was 400 µM, CHS was maintained
at 10 mol %, and the mole percent of PA was varied from 0 to 30 mol
%. Results shown are the mean of assays performed in triplicate. The
data were fit to the modified Hill equation as described in the text.
C, association of RGS4 with phospholipid vesicles measured
by fluorescence resonance energy transfer. Dansyl-PE (5 mol %) was
added to vesicles containing the indicated phospholipid. The measurements were performed at
30 °C. Excitation and emission wavelengths were set at 280 and 515 nm, respectively. F and F0 are the
fluorescence emission intensities of phospholipid vesicles at 515 nm
with and without addition of RGS4. D, effect of ionic
strength on RGS4-PA/PC liposomes interactions. Vesicles containing 400 µM PA/PC (PA, 20 mol %) were incubated with RGS4 in the
presence of increasing concentrations of NaCl (0-1000 mM)
and then assayed for binding efficiency. The experiments were carried
out at RGS4 concentrations of 0.5 (open triangles) and 1.5 µM (filled triangles). Results are the mean of
assays performed in duplicate.
|
|
To corroborate these results, we used fluorescence resonance energy
transfer, a more sensitive assay, to monitor the association of RGS4
with vesicle membranes. Dansyl-PE, labeled at the head group of
phospholipids, accepts tryptophan-donated energy from the protein and
undergoes a change in its fluorescence intensity as the protein binds
to phospholipid vesicles (28). As shown in Fig. 1C, there
were significant increases in 515 nm fluorescence when anionic
phospholipid vesicles were titrated with RGS4, whereas no fluorescence
energy transfer was observed in the presence of the vesicles composed
exclusively of PC. This result further confirms that RGS4 binding to
phospholipid vesicles requires the presence of anionic phospholipids.
Whereas we have not attempted to analyze the selectivity of RGS4 among
phospholipids in great detail, PA was the most efficient anionic
phospholipid tested in facilitating its binding to liposomes. This is
surprising because other phospholipids, such as cardiolipin, have
higher negative charge density than PA. We therefore studied the effect
of increasing ionic strength on RGS4-PA interaction and the results are
shown in Fig. 1D. At each concentration of RGS4 tested (0.5 and 1.5 µM), its binding to PA/PC (400 µM
PA, 20 mol %) vesicles is weak in the absence of salt. RGS4/lipid
vesicle binding progressively increases up to 100 mM NaCl,
after which additional increases in salt concentration (up to 1 M) diminish the binding. Protein/lipid binding cannot be
completely blocked even at 1 M NaCl, suggesting that other forces besides electrostatic interactions (e.g. hydrophobic
interactions) may have a role in stabilizing the RGS4-PA interaction.
It has been previously reported that PA can induce membrane regions to adopt a concave surface contour and to form a hexagonal phase (36). It
is possible that such distinctive properties of PA may contribute to
its strong enhancement of RGS4 binding to membranes. It should be
mentioned that data shown in this paper used N-terminal His6-tagged RGS4, but similar results were obtained in
experiments using untagged RGS4 (data not shown).
Insertion of RGS4 into Phospholipid Monolayers--
Whereas the
binding of RGS4 to phospholipid vesicles appears to be dependent on
anionic phospholipids, it is unclear whether RGS4 simply attaches on
the surface of membranes or inserts into the phospholipid bilayer. To
answer this question, we utilize the monolayer technique to evaluate
the capability of RGS4 penetrating into membranes.
First we measured the penetration of RGS4 into an air/water interface
without spread to the phospholipid monolayer to acquire the
appropriate conditions of the following experiments. The maximal increase of surface pressure induced by RGS4 itself was found to be
23.5 mN/m and the minimal concentration of RGS4 to reach such a
maximum was 270 nM. Therefore, we kept the initial surface pressures (
i) of phospholipid monolayers spread onto the
subphase surface at 23.5 mN/m or higher and the concentration of RGS4
injected into the subphase at 270 nM in the following
experiments. Subsequently, we monitored the insertion of RGS4 into PA
monolayers. Our results indicated that 270 nM RGS4
dramatically increased the surface pressure of the PA monolayer,
whereas injecting only buffer or proteinase K-treated RGS4 did not
alter the surface pressure (data not shown). It has been previously
established that proteins that exclusively interact with the
phospholipid surface headgroups do not increase the surface pressure of
the monolayer (for review see Ref. 37). Therefore, a change in the
surface pressure (
) following the addition of RGS4 indicates that
this protein inserted into the phospholipid monolayer. We also measured

for RGS4 under different initial surface pressures,
i (Fig. 2). The resulting plot of 
versus
i yielded a straight
line with a negative slope that intersects the abscissa at the limiting
surface pressure,
ex.
ex is the maximum
surface pressure at which RGS4 can penetrate into the different
phospholipid monolayers (37). Fig. 2 shows the plot of 
versus
i for RGS4 insertion into anionic
phospholipid monolayers. From these data,
ex was
calculated for RGS4 insertion into the following anionic phospholipids:
48 mN/m for PA, 50.5 mN/m for PS, and 33.6 mN/m for PC. The
ex of a phospholipid monolayer with a surface pressure
35 mN/m is believed to be comparable with the packing density of
biological membranes (37, 38). By comparing our values of
ex measured for RGS4 with 35 mN/m, we extrapolate that
RGS4 should have the potential to insert into biological membranes.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 2.
 - i
plot of RGS4 insertion into different phospholipid monolayers. 270 nM RGS4 was injected into the subphase and changes in the
surface pressure ( ) were recorded for the different phospholipid
monolayers as indicated at different initial surface pressures
( i). The plot of  versus
i yields a straight line with a negative slope that
intersects the abscissa at a limiting surface pressure. This limiting
surface pressure is named the exclusion pressure and is the point at
which RGS4 no longer penetrates into the phospholipid monolayer.
|
|
Penetration of RGS4 into Anionic Phospholipid Vesicles--
To
further study RGS4 insertion into phospholipid bilayers, we measured
RGS4 fluorescence quenching by DPC. DPC contains a doxylstearate
labeled at carbon-5 of the fatty acid in PC, and this chemical side
group quenches tryptophan (Trp) fluorescence. This quenching is
primarily static rather than collisional. Only when the doxyl moiety
(buried within the membrane bilayer) is no more than 5 Å from Trp
residues can the Trp fluorescence be efficiently quenched (39). This
method is only valid when at least one of the two RGS4 Trp residues
insert into the membrane proximal to the quenching moiety embedded in
the phospholipid bilayer.
Fig. 3A shows that Trp
fluorescence of RGS4 is sharply decreased by DPC. This indicates that
at least one Trp residue of RGS4 has inserted into the membrane bilayer
of PA- or PS-containing phospholipid vesicles. In contrast, little to
no changes in Trp fluorescence of RGS4 were observed using neutral
phospholipid vesicles. This result shows that RGS4 has the intrinsic
potential to penetrate into anionic phospholipid membranes. We also
tested the quenching of RGS4 fluorescence by DPC with doxyl groups
labeling the 12th carbon position of the fatty acid. Using this
alternate label, only slight quenching was observed (data not shown).
These data indicate that the N terminus of RGS4 inserted into the
membrane bilayer, but not deeply such that Trp can be quenched by the
12-doxyl form of DPC.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3.
Demonstration of RGS4 inserting into anionic
phospholipid vesicles. A, quenching of Trp fluorescence
of RGS4 by DPC. 3.2 µM RGS4 was added to phospholipid
vesicles with and without DPC. F0 and
F represent the fluorescence intensities measured using
RGS4/phospholipid membranes in the absence or presence of DPC,
respectively. The excitation wavelength was 295 nm, and emission was
monitored at 340 nm. B, RGS4 and apocytochrome c
(Apo c)-induced calcein release from phospholipid bilayers.
50 µM Calcein-enclosed PC/PA/PE/CHS (3:3:1:1) vesicles
were incubated until fluorescence intensity was stable. Then, RGS4 (1.5 µM) or apocytochrome c (0.4 µM)
was added where indicated and the release of entrapped calcein was
monitored following the increase of fluorescence at 520 nm.
|
|
To test whether RGS4 membrane insertion perturbs the phospholipid
bilayer, the ability of RGS4 to release calcein encased in phospholipid
vesicles was measured. Under initial conditions, 200 mM
calcein was enclosed inside the phospholipid vesicles, which causes
calcein to self-quench. The injection of membrane-penetrating proteins
causes the dye to leak out of the vesicle, leading to a gradual
increase of fluorescence intensity. We used apocytochrome c
as a positive control to induce calcein leakage from the phospholipid vesicles (Fig. 3B and Ref. 40). In contrast (Fig.
3B), no calcein release was observed upon incubation with
RGS4, indicating that RGS4 did not disrupt the integrity of the
phospholipid bilayer. By combining the data obtained using 5- and
12-doxyl-DPC, and the failure of RGS4 to trigger leakage of entrapped
calcein from vesicles, we propose that RGS4 can only insert into one
leaflet of the phospholipid bilayer adjacent to the membrane surface. It has been reported that the inner leaflet of the plasma membrane of
eukaryotic cells is composed of 30% anionic and 70% neutral phospholipids (41). Our results indicate that anionic phospholipids play essential roles in RGS4 insertion into the model membrane. Although RGS4 has a higher affinity for PA than to PS (Fig. 1), PS is
the primary anionic phospholipid contained in the inner leaflet of the
plasma membrane and may be one of the major binding sites tethering
RGS4 to the plasma membrane in vivo.
PA Inhibits RGS4 GAP Activity--
Growing evidence supports that
the phospholipid environment of certain proteins can regulate their
functions (42). Because RGS proteins are thought to act at the inner
surface of biological membranes, it is reasonable to hypothesize that
certain cell membrane phospholipids may influence the interaction
between RGS proteins and their G
targets. Therefore, we tested the
effects of different anionic phospholipid vesicles on GAP activity of
RGS4 (Fig. 4A). Using 80 nM RGS4, PA showed the greatest inhibitory activity with maximal inhibition exceeding 90% and an IC50 of ~4
µM (Fig. 4A). A 45% inhibition of GAP
activity of RGS4 was observed in the presence of 4 µM PA
(molar ratio of lipid:RGS4, 50:1), whereas 10 µM (molar ratio of 125:1) inhibited its GAP activity more than 90% (Fig. 4B). Other anionic phospholipids, PS and PG, could only
weakly inhibit GAP activity of RGS4 (Fig. 4A) with maximal
inhibition of less than 50% and a much lower potency (IC50 > 30 µM). Even at concentrations of up to 50 µM, neutral phospholipids (PC and PE) never inhibited GAP
activity of RGS4 by more than 10%, thus they are considered
essentially inactive. None of the phospholipids tested affected the
intrinsic GTPase activity of G
i1 (data not shown). The
GAP assays shown in Fig. 4 used G
i1-GTP as a substrate, but similar results were obtained in experiments using
G
z-GTP (data not shown). These data show that, although
RGS4 can bind to anionic phospholipids and insert into membranes
without great preference (Fig. 2), PA may play a distinctive and
important role in regulating RGS4 function.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
PA inhibits RGS4 GAP activity in single
turnover assay. A, RGS4 was incubated with different
phospholipids for 30 min at 4 °C. The final RGS4 concentration in
the assay was 0.08 µM and the phospholipid concentration
varied from 2 to 30 µM. The first-order hydrolysis rate
constant (khydrol) was determined in the
presence (control) and absence of RGS4 (basal) and the
difference was defined as GAP activity. The 100% GAP activity was
equal to 1.2-1.5 min 1 in different experiments. These
values are averages of three experiments with less than 10% standard
error. B, RGS4 (2 µM) was incubated with
100-250 µM PA vesicles for 30 min at 4 °C. 2-µl
aliquots were withdrawn and measured for GAP activity using
G i1-GTP as substrate. The final RGS4 and
G i1-GTP concentrations in the assay were 80 and 150 nM. The final concentration of PA shown was 4 (open
triangles) or 10 µM (filled triangles).
Control reactions contained neither RGS4 nor lipid (open
circles) or no lipid (filled circles).
|
|
To further characterize the effect of PA on RGS4 activity, we performed
receptor-mediated, steady-state GTP hydrolysis assays. These assays are
presumably more physiological by monitoring RGS4-mediated enhancement
of agonist-stimulated, steady-state GTPase activity in proteoliposomes
reconstituted with receptor and heterotrimeric G proteins. PE/CHS/PS
(60:10:20) were used for our reconstituted proteoliposomes because the
binding of RGS4 through anionic phospholipids appears to be necessary
for efficient GAP activity (12). To evaluate the effects of different
phospholipids on RGS4 GAP activity, the remaining 10 mol % was PC, PS,
PG, or PA. The agonist-stimulated GTPase activity of unilamellar
phospholipid vesicles containing m1 AChR and heterotrimeric
G
q was measured in the presence of increasing
concentrations of RGS4 (Fig. 5). When
agonist-bound receptor drives GDP/GTP exchange in these vesicles,
hydrolysis of Gq-bound GTP becomes rate-limiting and a GAP
increases steady-state hydrolysis until the overall reaction again
approaches the rate of receptor-catalyzed GDP/GTP exchange (43, 44). In
m1 AChR-Gq vesicles (PE/CHS/PS, 60:10:30), 50 nM RGS4 increases agonist-stimulated GTPase activity about
40-fold with an EC50 ~1.5 nM (Fig.
5A). Partial replacement of PS by PA (PE/CHS/PS/PA,
60:10:20:10) inhibited RGS4 GAP activity by about 4-fold
(EC50 ~ 7 nM). This data is consistent with
RGS/phospholipid binding values shown in Fig. 1B. In
contrast, 10 mol % of PG (PE/CHS/PS/PG, 60:10:20:10) or PC
(PE/CHS/PS/PC, 60:10:20:10) exhibited no effect or slightly increased
RGS4 GAP activity (Fig. 5B). Further decrease of PS (<15%)
dramatically decreased both the efficiency of reconstitution and
receptor-stimulated GTP
S binding of Gq, presumably
because PS is essential for both the association of G proteins with
membranes and the coupling between receptor and Gq (24,
44). It should be noted that RGS4 binding to all three proteoliposomes
was virtually identical and almost 100% under the conditions used for
GAP assay. The maximal GTPase activity was also similar for each
vesicle composition, presumably because GDP/GTP exchange became
rate-limiting (44). These results further support the idea that PA may
play an important role in the regulation of RGS4-G
interaction.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
PA inhibits RGS4-stimulated GTP hydrolysis of
m1 AChR-Gq vesicles. A, m1
AChR-Gq vesicles (1.3 nM Gq and
0.35 nM m1 AchR reconstituted in PE/PS/CHS (60:30:10,
circles), or 1.0 nM Gq and 0.3 nM m1 AchR reconstituted in PE/PS/PA/CHS (60:20:10:10,
triangles); 6 µM final lipid concentration)
were mixed with RGS4 (0.1-100 nM) and the mixture was
preincubated at 30 °C for 30 min prior to assay.
Carbachol-stimulated GTPase activity was assayed as described under
"Experimental Procedures." For reference, GTPase activity in the
absence of RGS4 was 60 fmol/min in PE/PS/CHS (60:30:10) vesicles, and
48 fmol/min in vesicles composed of PE/PS/PA/CHS (60:20:10:10).
B, 1 nM RGS4 was incubated with 6 µM m1 AChR-Gq vesicles (PE/PS/CHS (60:30:10),
PE/PS/PC/CHS (60:20:10:10), PE/PS/PG/CHS (60:20:10:10) or PE/PS/PA/CHS
(60:20:10:10)) at 30 °C for 30 min prior to assay.
Carbachol-stimulated GTPase activity was assayed as described under
"Experimental Procedures." PE/PS/PG/CHS (60:20:10:10) vesicles
contained 1.3 nM Gq and 0.3 nM m1
AchR. PE/PS/PC/CHS (60:20:10:10) vesicles contained 1.0 nM
Gq and 0.28 nM m1AchR and the other vesicles
were as described in A.
|
|
The N Terminus of RGS4 Is Required for PA Binding and
Inhibition--
The first 57 amino acids of RGS4 are essential for its
localization to membranes (8, 11-13). To determine the importance of
this region for interactions with PA, we generated both deletion (missing amino acids 1-57) and single point mutants of RGS4. All the
RGS4 mutants used in our study reacted with anti-RGS4 C terminus goat
polyclonal antibody with relatively equal affinity in an ELISA (data
not shown). Therefore any differences that may be observed between
proteins in the phospholipid-binding assay would be because of their
differential binding to phospholipids and not because of a variation in
their binding to the primary antibody. The RGS4 N-terminal truncation
mutant
57RGS4 did not bind to PA (Fig.
6A). This agrees well with
previous studies showing that the N terminus of RGS4 is required for
membrane binding (12, 13). Furthermore, removing the first 57 amino
acids resulted in the loss of the PA-conferred inhibitory effect on
RGS4 GAP activity in a solution-based, single-turnover GTP hydrolysis
assay (Fig. 6B). These results suggest that residues between
1 and 57 play an important role in both association of RGS4 with PA and PA-conferred inhibition of GAP activity of RGS4. Based on this result,
we generated a series of mutations at the N terminus of RGS4. One RGS4
mutant, K20E (Lys20
Glu) proved to be interesting. The
protein-lipid binding assays indicated that this mutation did not have
any significant effects on the initial binding of RGS4 to PA vesicles
(Fig. 6A). Both wild type RGS4 and K20E mutant have similar
dissociation constants for PA vesicles (Kd ~ 25 nM). K20E was also as effective as wild type RGS4 in the
single-turnover GAP assay in the absence of PA vesicles (Fig.
6B). However, unlike wild type RGS4, PA did not inhibit GAP
activity of RGS4K20E (Fig. 6B, molar ratio 100:1, lipid:RGS4). Although the RGS domain alone can function as a GAP, the
N-terminal domain of RGS4 is required for efficient interaction with
G
(11, 12). Our data strengthens the argument for allosteric interactions between the N terminus and the RGS domain of RGS4 because
Lys20 lies far from the RGS domain based on its primary
structure.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
Mutation at Lys20 of RGS4 blocked
PA-induced conformational changes of the RGS domain and diminished
PA-mediated inhibition of its GAP activity without affecting PA-RGS4
interaction. A, binding of wild type RGS4 or its
mutants to PA as determined by ELISA. Each well of an ELISA plate was
coated with 10 µg of PA and blocked using bovine serum albumin. Then,
the wells were incubated with increasing amounts of RGS4 or its mutants
as indicated in the figure. The bound proteins were analyzed using an
antibody to the C terminus of RGS4. B, the values of
khydrol (min 1) of RGS4 and its
mutants in the presence and absence of PA. 2 µM RGS4 or
its mutants were preincubated with 200 µM PA vesicles or
buffer as a control for 30 min at 4 °C before initiation of the
reaction, the molar ratios of PA vesicles to proteins were 100:1. GAP
activity was assayed as in Fig. 4. Values shown are averages of three
experiments ± S.D. C, acrylamide quenching of
intrinsic fluorescence of RGS4 and mutants in the presence and absence
of PA vesicles. The concentrations of RGS4 and its mutants were 1.4 µM, and the molar ratios of PA to proteins were all
100:1. Excitation wavelength, 295 nm; emission wavelength, 340 nm.
F0 and F represent the fluorescence
intensities of RGS4 and its mutants without and with the
quencher.
|
|
PA Induces a Conformational Change in the Hydrophilic Domain of
RGS4--
The interaction of RGS4 with phospholipid vesicles changes
its intrinsic fluorescence, most likely reflecting a conformational change of the protein (12). RGS4 has two Trp residues; one is at the
59th (Trp59) position and the other is the 92nd
(Trp92) in the RGS domain. According to the crystal
structure, Trp59 is almost completely buried among helices
1, 2, 3, and 9, whereas Trp92 is relatively exposed to the
hydrophilic environment opposite the site of G
binding (5).
Acrylamide is a neutral, efficient quencher of tryptophan fluorescence
that is very sensitive to the surface exposure of Trp residues in
proteins and has been used extensively to probe the conformational
change in the hydrophilic region of proteins (32, 45). To further
investigate the mechanism of PA-mediated inhibition of RGS4 GAP
activity, acrylamide was used to determine whether there are
conformational alterations around Trp residues upon RGS4 insertion into
PA liposomes. As shown in Fig. 6C, the Stern-Volmer
quenching constant (KSV) for RGS4 in the absence
of phospholipids is about 13.9 M
1. Upon its
insertion into PA vesicles, the value of KSV was
dramatically decreased to 3.5 M
1 indicating
that Trp residues were much less accessible to acrylamide. In contrast,
PC vesicles exhibited almost no effect on acrylamide fluorescence
quenching (data not shown). When RGS4 was incubated with vesicles
containing PA and PC (PA, 20 mol %), the value of KSV was almost identical to those obtained in
the presence of PA alone (data not shown). This implies that 20% PA
content in the vesicles is sufficient to induce conformational changes
in the hydrophilic regions of RGS4.
In a recent study, it is speculated that phospholipid-induced RGS4
conformational changes occur in the RGS domain, in proximity to
Trp92 (12). We generated a RGS4W59A mutant
(Trp59
Ala) that contains only one Trp
(Trp92) in the RGS domain. This mutant protein behaved
comparably with the wild type RGS4 in both binding to phospholipid
membrane and as a GAP (Fig. 6). The results shown in Fig. 6C
indicate that acrylamide-induced quenching in the RGS4W59A mutant
(Trp59
Ala) was comparable with wild type RGS4. This
result supports the previous assumption (12) that the conformational
change observed in wild type RGS4 was donated by the Trp92
residue in the RGS domain. After RGS4 and this mutant were incubated with PA vesicles, a sharp decrease in the fluorescence quenching by
acrylamide was observed (Fig. 6C, KSV
decreased by 70-80%), and was accompanied by a remarkable inhibition
of its GAP activity (Fig. 6B). In contrast, PA vesicles only
slightly decreased the acrylamide-induced quenching of K20E
fluorescence (Fig. 6C, KSV decreased
by approximately 10-15%) and did not affect RGS4 GAP activity at the
same condition. These data indicate that the K20E mutant could not
assume the more compact conformation around the Trp92
residue achieved by the wild type RGS4 and W59A mutant in the presence
of PA vesicles.
From results presented here, it is clear that anionic phospholipid PA
can inhibit GAP activity of RGS4. PA has been shown to modulate a large
number of enzyme activities (e.g. phospholipase C, protein
kinases, cyclic AMP-phosphodiesterase, Ras GTPase-activating protein,
protein-tyrosine phosphatase (21, 29, 46, 47)), yet few reports have
come up with a definitive physiological role for PA. Our results show
that PA strongly inhibits GAP activity of RGS4 in both single-turnover
and reconstitution vesicle assays. Replacement of PS by PA (10 mol %)
in m1 AChR-Gq vesicles markedly inhibited RGS4 GAP activity
by more than 70% with a 4-fold increase of EC50 during
receptor-stimulated, steady-state GTP hydrolysis. In contrast, PS, PG,
or PC had no such inhibitory effect. Based on these data and previous
reports (14), we speculate that the RGS4/G
interaction is influenced
by the phospholipid microenvironment surrounding these proteins. We
also propose that PA acts as a positive regulator of G
-mediated
signaling pathways by inhibiting RGS proteins. An example of PA being
both generated by and acting on Gq-mediated signaling is
shown in Fig. 7. In resting cells, PA
only constitutes a minor portion of the total phospholipid pool, but
there has been intense interest in the role of PA as a phospholipid
second messenger. PA is generated principally from two mechanisms: the
action of PLD on phosphatidylcholine (16) and directly converting
diacylglycerol by DGK to PA (17, 18). In response to G protein receptor
stimulation (as is shown for Gq-mediated signaling pathways
in Fig. 7), both PLD and DGK are activated (48-51). PLD may be
activated directly by G
q or by the downstream activation
of protein kinase C. PLD and/or DGK activation will increase the local
concentration of PA, which can consequently block RGS4 GAP activity and
therefore acts as a positive feedback regulator in Gq
signaling. Thus, RGS4 may represent a novel PA effector and PA may be
important in regulating the output of Gq signaling in
vivo.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 7.
A model of RGS4 regulation by the anionic
phospholipid PA. Agonist-induced stimulation of G-protein-coupled
receptors enhances GTP binding to G subunits. PLD may be activated
by either G q or protein kinase C (PKC). PA is
produced by both PLD and DGK as described in the text. We propose that
RGS4 inserts into PA-containing membranes via its N terminus, leading
to the potent inhibition of GAP activity. Thus, PA may act as a
positive modulator for the output of Gq signaling.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. Elliott M. Ross and Dr. Susanne
Mumby for helpful discussion and comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by grants from the National Natural
Science Foundation of China and the Chinese Academy of Sciences (to
F. Y.), Wang Kuancheng Education Award from the Chinese Academy of
Sciences and an American Heart Association Scientist Development grant
(to Y. T.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. Tel.:
86-10-64888514; Fax: 86-10-64872026; E-mail:
yangfy@sun5.ibp.ac.cn.
Published, JBC Papers in Press, January 21, 2003, DOI 10.1074/jbc.M212606200
 |
ABBREVIATIONS |
The abbreviations used are:
RGS, regulator of
G-protein signaling;
GAP, GTPase-activating proteins;
m1 AChR, muscarinic acetylcholine receptor;
G-protein, guanine
nucleotide-binding protein;
PC, phosphatidylcholine;
PE, phosphatidylethanolamine;
PS, phosphatidylserine;
PA, phosphatidic
acid;
PG, phosphatidylglycerol;
CHS, cholesteryl hemisuccinate;
DPC, 1-palmitoyl-2-stearoyl-(5-doxyl)-sn-glycero-3-phosphocholine;
SUVs, small unilamellar vesicles;
GTP
S, guanosine
5'-O-(3-thiotriphosphate);
mN, millinewton;
PLD, phospholipase D;
DGK, diacylglycerol kinase;
dansyl, 5-dimethylaminonaphthalene-1-sulfonyl;
Pipes, 1,4-piperazinediethanesulfonic acid;
ELISA, enzyme-linked immunosorbent
assay.
 |
REFERENCES |
| 1.
|
Gilman, A. G.
(1987)
Annu. Rev. Biochem.
56,
615-649[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Zheng, B.,
Ma, Y. C.,
Ostrom, R. S.,
Lavoie, C.,
Gill, G. N.,
Insel, P. A.,
Huang, X. Y.,
and Farquhar, M. G.
(2001)
Science
294,
1939-1942[Abstract/Free Full Text]
|
| 3.
|
Ross, E. M.,
and Wilkie, T. M.
(2000)
Annu. Rev. Biochem.
69,
795-827[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Popov, S., Yu, K.,
Kozasa, T.,
and Wilkie, T. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7216-7220[Abstract/Free Full Text]
|
| 5.
|
Tesmer, J. J.,
Berman, D. M.,
Gilman, A. G.,
and Sprang, S. R.
(1997)
Cell
89,
251-261[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
De Vries, L.,
Zheng, B.,
Fischer, T.,
Elenko, E.,
and Farquhar, M. G.
(2000)
Annu. Rev. Pharmacol. Toxicol.
40,
235-271[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Wang, J.,
Ducret, A.,
Tu, Y. P.,
Kozasa, T.,
Aebesold, R.,
and Ross, E. M.
(1998)
J. Biol. Chem.
273,
26014-26025[Abstract/Free Full Text]
|
| 8.
|
Srinivasa, S. P.,
Bernstein, L. S.,
Blumer, K. J.,
and Linder, M. E.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5584-5589[Abstract/Free Full Text]
|
| 9.
|
Chen, C.,
Seow, K. T.,
Guo, K.,
Yaw, L. P.,
and Lin, S. C.
(1999)
J. Biol. Chem.
274,
19799-19806[Abstract/Free Full Text]
|
| 10.
|
Heximer, S. P.,
Lim, H.,
Bernard, J. L.,
and Blumber, K. J.
(2001)
J. Biol. Chem.
276,
14195-14203[Abstract/Free Full Text]
|
| 11.
|
Zeng, W.,
Xu, X.,
Popov, S.,
Mukhopadhyay, S.,
Chidiac, P.,
Swistok, J.,
Danho, W.,
Yagaloff, K. A.,
Fisher, S. L.,
Ross, E. M.,
Muallem, S.,
and Wilkie, T. M.
(1998)
J. Biol. Chem.
273,
34687-34690[Abstract/Free Full Text]
|
| 12.
|
Tu, Y. P.,
Woodson, J.,
and Ross, E. M.
(2001)
J. Biol. Chem.
276,
20160-20166[Abstract/Free Full Text]
|
| 13.
|
Bernstein, L. S.,
Grillo, A. A.,
Loranger, S. S.,
and Linder, M. E.
(2000)
J. Biol. Chem.
275,
18520-18526[Abstract/Free Full Text]
|
| 14.
|
Popov, S. G.,
Krishna, U. M.,
Falck, J. R.,
and Wilkie, T. M.
(2000)
J. Biol. Chem.
275,
18962-18968[Abstract/Free Full Text]
|
| 15.
|
Ishii, M.,
Inanobe, A.,
and Kurachi, Y.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
4325-4330[Abstract/Free Full Text]
|
| 16.
|
Exton, J. H.
(1998)
Biochim. Biophys. Acta
1436,
105-115[Medline]
[Order article via Infotrieve]
|
| 17.
|
Hodgkin, M. N.,
Pettitt, T. R.,
Martin, A.,
Michell, R. H.,
Pemberton, A. J.,
and Wakelam, M. J.
(1998)
Trends Biochem. Sci.
23,
200-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Topham, M. K.,
and Prescott, S. M.
(1999)
J. Biol. Chem.
274,
11447-11450[Free Full Text]
|
| 19.
|
Fahimi-Vahid, M.,
Gosau, N.,
Michalek, C.,
Han, L.,
Jakobs, K. H.,
Schmidt, M.,
Roberts, N.,
Avkiran, M.,
and Wieland, T.
(2002)
J. Mol. Cell Cardiol.
34,
441-453[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Van Blitterswijk, W. J.,
and Houssa, B.
(1999)
Chem. Phys. Lipids
98,
95-108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
English, D. Y.,
Cui, Y.,
and Siddiqui, R. A.
(1996)
Chem. Phys. Lipids
80,
117-132[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Biddlecome, G. H.,
Berstein, G.,
and Ross, E. M.
(1996)
J. Biol. Chem.
271,
7999-8007[Abstract/Free Full Text]
|
| 23.
|
Kozasa, T.,
and Gilman, A. G.
(1995)
J. Biol. Chem.
270,
1734-1741[Abstract/Free Full Text]
|
| 24.
|
Parker, E. M.,
Kameyama, K.,
Higashijima, T.,
and Ross, E. M.
(1991)
J. Biol. Chem.
266,
519-527[Abstract/Free Full Text]
|
| 25.
|
Rietveld, A.,
Jordi, W.,
and de Kruijff, B.
(1986)
J. Biol. Chem.
261,
3846-3856[Abstract/Free Full Text]
|
| 26.
|
Rouser, G.,
Fleischer, S.,
and Yamamoto, A.
(1970)
Lipids
5,
494-496[Medline]
[Order article via Infotrieve]
|
| 27.
|
Chatterjee, T. K.,
and Fisher, R. A.
(2000)
J. Biol. Chem.
275,
24013-24021[Abstract/Free Full Text]
|
| 28.
|
Bazzi, M. D.,
and Nelsestuen, G. L.
(1990)
Biochemistry
29,
7624-7630[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Ghosh, S.,
Strum, J. C.,
Sciorra, V. A.,
Daniel, L.,
and Bell, R. M.
(1996)
J. Biol. Chem.
271,
8472-8480[Abstract/Free Full Text]
|
| 30.
|
Han, X. H.,
Sui, S. F.,
and Yang, F. Y.
(1996)
Thin Solid Films
284/285,
789-792[CrossRef]
|
| 31.
|
Allen, T. M.,
and Cleland, L. G.
(1980)
Biochim. Biophys. Acta
597,
418-426[Medline]
[Order article via Infotrieve]
|
| 32.
|
Eftink, M. R.,
and Ghiron, C. A.
(1981)
Anal. Biochem.
114,
199-227[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Wang, J.,
Tu, Y. P.,
Mukhopadhyay, S.,
Chidiac, P.,
Biddlecome, G. H.,
and Ross, E. M.
(1999)
in
G Proteins: Techniques of Analysis
(Manning, D. R., ed)
, pp. 123-151, CRC Press, Boca Raton, FL
|
| 34.
|
Tu, Y. P.,
Wang, J.,
and Ross, E. M.
(1997)
Science
278,
1132-1135[Abstract/Free Full Text]
|
| 35.
|
Newton, A. C.,
and Koshland, D. E., Jr.
(1989)
J. Biol. Chem.
264,
14909-14915[Abstract/Free Full Text]
|
| 36.
|
Shai, Y.
(1999)
Biochim. Biophys. Acta
1462,
55-70[Medline]
[Order article via Infotrieve]
|
| 37.
|
Brockman, H.
(1999)
Curr. Opin. Struct. Biol.
9,
438-443[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
MacDonald, R. C.
(1996)
in
Vesicles
(Rosoff, M., ed)
, pp. 3-48, Marcel Dekker, New York
|
| 39.
|
Chattopadhyay, A.,
and London, E.
(1987)
Biochemistry
26,
39-45[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Miao, Q.,
Han, X. H.,
and Yang, F. Y.
(2001)
Biochem. J.
354,
681-688[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Gennis, R. B.
(1988)
Biomembranes: Molecular Structure and Function
, p. 21, Springer, New York
|
| 42.
|
Quest, A. F. G.,
Bloomenthal, J.,
Bardes, E. S. G.,
and Bell, R. M.
(1992)
J. Biol. Chem.
267,
10193-10197[Abstract/Free Full Text]
|
| 43.
|
Posner, B. A.,
Mukhopadhyay, S.,
Tesmer, J. J.,
Gilman, A. G.,
and Ross, E. M.
(1999)
Biochemistry
38,
7773-7779[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Mukhopadhyay, S.,
and Ross, E. M.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
9539-9544[Abstract/Free Full Text]
|
| 45.
|
Lakowicz, J. R.
(1983)
Principles of Fluorescence Spectroscopy
, Plenum Press, New York
|
| 46.
|
Cui, Y.,
and English, D.
(1997)
Cell Signalling
9,
257-263[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Kishikawa, K.,
Chalfant, C. E.,
Perry, D. K.,
Bielawska, A.,
and Hannun, Y. A.
(1999)
J. Biol. Chem.
274,
21335-21341[Abstract/Free Full Text]
|
| 48.
|
Exton, J. H.
(1997)
Physiol. Rev.
77,
303-320[Abstract/Free Full Text]
|
| 49.
|
Singer, W. D.,
Brown, H. A.,
and Sternweis, P. C.
(1997)
Annu. Rev. Biochem.
66,
475-509[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Liscovitch, M.,
Czarny, M.,
Fiucci, G.,
and Tang, X.
(2000)
Biochem. J.
345,
401-415
|
| 51.
|
Plonk, S. G.,
Park, S.-K.,
and Exton, J. H.
(1998)
J. Biol. Chem.
273,
4823-4826[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
