JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M211424200 on December 11, 2002

J. Biol. Chem., Vol. 278, Issue 13, 11167-11174, March 28, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/13/11167    most recent
M211424200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, W.
Right arrow Articles by Fields, A. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, W.
Right arrow Articles by Fields, A. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Role of Cyclooxygenase 2 in Protein Kinase C beta II-mediated Colon Carcinogenesis*

Wangsheng Yu, Nicole R. Murray, Capella Weems, Lu Chen, Huiping Guo, Richard Ethridge, Jeffrey D. Ceci, B. Mark Evers, E. Aubrey Thompson, and Alan P. FieldsDagger

From the Sealy Center for Cancer Cell Biology and the Departments of Pharmacology and Toxicology, Human Biological Chemistry and Genetics and Surgery, The University of Texas Medical Branch, Galveston, Texas 77555-1048

Received for publication, November 8, 2002, and in revised form, December 6, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Elevated expression of protein kinase C beta II (PKCbeta II) is an early promotive event in colon carcinogenesis (Gokmen-Polar, Y., Murray, N. R., Velasco, M. A., Gatalica, Z., and Fields, A. P. (2001) Cancer Res. 61, 1375-1381). Expression of PKCbeta II in the colon of transgenic mice leads to hyperproliferation and increased susceptibility to colon carcinogenesis due, at least in part, to repression of transforming growth factor beta type II receptor (TGF-beta RII) expression (Murray, N. R., Davidson, L. A., Chapkin, R. S., Gustafson, W. C., Schattenberg, D. G., and Fields, A. P. (1999) J. Cell Biol., 145, 699-711). Here we report that PKCbeta II induces the expression of cyclooxygenase type 2 (Cox-2) in rat intestinal epithelial (RIE) cells in vitro and in transgenic PKCbeta II mice in vivo. Cox-2 mRNA increases more than 10-fold with corresponding increases in Cox-2 protein and PGE2 production in RIE/PKCbeta II cells. PKCbeta II activates the Cox-2 promoter by 2- to 3-fold and stabilizes Cox-2 mRNA by at least 4-fold. The selective Cox-2 inhibitor Celecoxib restores expression of TGF-beta RII both in vitro and in vivo and restores TGFbeta -mediated transcription in RIE/PKCbeta II cells. Likewise, the omega -3 fatty acid eicosapentaenoic acid (EPA), which inhibits PKCbeta II activity and colon carcinogenesis, causes inhibition of Cox-2 protein expression, re-expression of TGF-beta RII, and restoration of TGF-beta 1-mediated transcription in RIE/PKCbeta II cells. Our data demonstrate that PKCbeta II promotes colon cancer, at least in part, through induction of Cox-2, suppression of TGF-beta signaling, and establishment of a TGF-beta -resistant, hyperproliferative state in the colonic epithelium. Our data define a procarcinogenic PKCbeta II right-arrow Cox-2 right-arrow TGF-beta signaling axis within the colonic epithelium, and provide a molecular mechanism by which dietary omega -3 fatty acids and nonsteroidal antiinflammatory agents such as Celecoxib suppress colon carcinogenesis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cancer has been described as a disease of aberrant signal transduction (1). Carcinogenesis is a multistep process characterized by progressive changes in the amounts or activity of proteins that regulate cellular proliferation, differentiation, and survival (1, 2). These changes can be mediated through both genetic and epigenetic mechanisms. Protein kinase C (PKC)1 is a family of ubiquitously expressed serine/threonine protein kinases whose members play central roles in cell proliferation, differentiation, and apoptosis (reviewed in Ref. 3). The discovery that PKC is a major cellular target for the tumor-promoting phorbol esters suggested a role for aberrant PKC signaling in tumor initiation and progression (4). However, the relative contribution of individual PKC isozymes to carcinogenesis is not well understood. Ultimately, the role of individual PKC isozymes in carcinogenesis will be understood through identification of downstream targets that participate in specific aspects of the transformed phenotype.

We have focused our recent efforts on deciphering the role of specific PKC isozymes in the development of colon cancer (5-7). We have shown that colon carcinogenesis is accompanied by changes in PKC isozyme expression, including a dramatic increase in the level of PKCbeta II expression (5). PKCbeta II protein levels are elevated in preneoplastic lesions in the colon, aberrant crypt foci, and are further elevated in colon tumors (5). To determine whether elevated PKCbeta II levels contribute to colon carcinogenesis, we developed transgenic PKCbeta II mice that express elevated PKCbeta II in the colonic epithelium to levels comparable with those observed in carcinogen-induced colon tumors (6, 7). These animals exhibit hyperproliferation of the colonic epithelium and enhanced susceptibility to carcinogen-induced carcinogenesis (6). We recently characterized the transforming growth factor beta  receptor type II (TGF-beta RII) as a target for PKCbeta II-mediated transcriptional repression in intestinal epithelial cells and in the colonic epithelium of transgenic PKCbeta II mice (7). PKCbeta II-induced inhibition of TGF-beta RII renders intestinal epithelial cells insensitive to growth inhibition by TGF-beta and accounts, at least in part, for the colonic hyperproliferation and increased sensitivity to colon carcinogenesis characteristic of transgenic PKCbeta II mice (6, 7). Our studies to date indicate that PKCbeta II plays a critical role in the early stages of colon carcinogenesis by inducing the loss of TGF-beta responsiveness, thereby imposing a hyperproliferative phenotype, two prominent characteristics of colon cancer. We reasoned that the cellular phenotype induced by PKCbeta II is mediated through changes in gene expression. Thus, we have initiated a genomic analysis to identify PKCbeta II target genes in rat intestinal epithelial (RIE-1) cells. Among the gene targets induced by PKCbeta II is the inducible form of cyclooxygenase, Cox-2. Cox-2 was originally cloned as a phorbol ester-inducible gene (8, 9), and it has been implicated in the etiology of colon cancer in rodents and humans (10-13). Our present data demonstrate that Cox-2 is a specific genomic target of PKCbeta II and that PKCbeta II-mediated repression of TGF-beta RII depends on Cox-2. Finally, we show that the chemopreventive omega -3 polyunsaturated fatty acid eicosapentaenoic acid (EPA), a known PKCbeta II inhibitor in vivo and in vitro (7), inhibits Cox-2 expression, induces TGF-beta RII expression, and restores TGF-beta responsiveness in RIE/PKCbeta II cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Cell Treatments-- RIE-1 cells and derivatives were grown in 5% fetal bovine serum in Dulbecco's modified Eagle's medium as previously described (14). HEK293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Mid-log-phase cultures were used for all experiments unless otherwise specified. Construction of RIE/PKCbeta II cells has been described elsewhere (7). RIE/PKCiota cells were produced by infection of RIE-1 cells with a retrovirus containing the full-length human PKCiota cDNA. RIE/H-Ras and RIE/Cox-2 cells were generous gifts of Drs. Hongmiao Sheng and Ray DuBois, Vanderbilt University (11). In some experiments, cells were incubated with the omega -3 fatty acid EPA (Cayman Biochemicals) at the concentrations and for the times indicated in the figure legends. In some cases, cells were incubated with 25 µM Celecoxib (UTMB Pharmacy) and/or 120 pM TGF-beta 1 (BD Biosciences) in the culture medium for the times indicated in the figure legends. EPA and Celecoxib were solubilized in dimethyl sulfoxide (Me2SO). A final Me2SO concentration of 0.1% was used for all treatments, and 0.1% Me2SO was used as a diluent control. The stability of the Cox-2 mRNA was determined in RIE-1 and RIE/PKCbeta II cells by treatment of cells with 25 µM 5,6-dichlorobenzimidazole riboside to inhibit RNA polymerase II. Total cellular RNA was isolated as described previously (14) at various times after dichlorobenzimidazole riboside exposure and subjected to real-time RT-PCR analysis for Cox-2 mRNA expression as described below.

Immunoblot Analysis-- For immunoblot analysis, cells were washed twice with ice-cold phosphate-buffered saline and lysed in protein lysis buffer consisting of 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Nonidet P-40, 0.1% SDS, and protease inhibitor mixture (Sigma) for 30 min on ice. After removing particulate matter by centrifugation at 10,000 × g for 20 min, aliqouts of total cellular protein (50 µg) were electrophoresed in 10% acrylamide Tris-glycine gels (Invitrogen) and electrophoretically transferred to polyvinylidene difluoride membrane (Bio-Rad). The membranes were incubated with 5% nonfat dried milk in 10 mM Tris-HCl pH 7.4, 150 mM NaCl, and 0.05% Tween 20 (TBST) overnight at 4 °C to block excess protein sites. Membranes were incubated with rabbit polyclonal antibodies against PKCbeta I (Santa Cruz; 1:2,000 dilution), PKCbeta II (Santa Cruz; 1:6,000 dilution), Cox-2 (Cayman; 1:1,000 dilution), TGF-beta RII (Santa Cruz; 1:1,000 dilution), or actin (Santa Cruz; 1:10,000 dilution) in TBST at room temperature for 3 h, after which the membranes were washed in TBST three times for 15 min each. The membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit antibody (Kirkegaard and Perry Laboratories,1:125,000 dilution) in TBST for 1 h at room temperature. The membranes were washed three times in TBST for 15 min each, and antigen-antibody complexes were detected using chemiluminescence (Amersham Biosciences) according to the manufacturer's instructions.

Treatment of Transgenic Mice with Celecoxib and Isolation of Colonic Epithelium-- Transgenic PKCbeta II mice expressing PKCbeta II in the colonic epithelium were characterized previously (6, 7). Transgenic PKCbeta II mice and nontransgenic littermates were administered 6 mg/kg Celecoxib by oral gavage twice daily for 3 days. As controls, some mice were administered an equivalent volume of diluent (0.5% carboxylmethylcellulose). Mice were terminated on the morning of the fourth day. The colonic epithelium was isolated by scraping and subjected to immunoblot analysis for TGF-beta RII expression as described previously (7).

Northern Blot Analysis-- Total RNA from RIE-1, RIE/PKCbeta II, and RIE/Cox-2 cells was isolated by the guanidinium-thiocyanate-phenol-chloroform method (15). Total RNA (10 µg) from each cell line was electrophoresed in 1% agarose gels containing 0.66 M formaldehyde and electrophoretically transferred to nitrocellulose membranes (Intermountain Scientific Corp). After incubation at 80 °C for 2 h, the membranes were prehybridized for 2h in a solution containing 50% formamide in 5× Denhardt's solution, 0.1% SDS, 5× SSPE (750 mM NaCl, 50 mM NaH2PO4 pH 7.4, 5 mM EDTA), and 100 µg/ml single-stranded sperm DNA and then hybridized overnight at 42 °C with a radiolabeled cDNA probe to the rat Cox-2 gene consisting of 0.81 kb of the rat Cox-2 cDNA excised from PCB7-cox2. The probe was labeled with [alpha -32P]dCTP (800 Ci/mM, PerkinElmer) by the random priming method (Amersham Biosciences). After hybridization, membranes were washed three times in 0.1× SSPE, 0.1% SDS for 20 min at 55 °C and exposed to Eastman Kodak X-Omat AR film at 80 °C. The intensity of the autoradiographic signal was quantified by a Lynx densitometer (Applied Imaging). To verify equivalency of RNA loading of individual samples, the blot was stripped of radioactivity and rehybridized with an 18S rRNA probe as described previously (14).

Determination of PGE2 Production-- PGE2 analysis was conducted on equal numbers of RIE-1, RIE/PKCbeta II, and RIE/Cox-2 cells cultured in 100-mm tissue culture plates in Dulbecco's modified Eagle's medium containing 5% fetal bovine serum for 2 days. Aliquots of culture medium (50 µl) were collected and subjected to a specific enzyme-linked immunosorbent assay for PGE2 (Amersham Biosciences) following the manufacturer's instructions. Culture medium was diluted or concentrated appropriately to achieve values within the linear range of the assay (50-6400 pg/ml). The range of the standard PGE2 curve was from 2.5 pg to 320 pg/well. Triplicate samples were analyzed in each experiment, and the results were expressed as pg of PGE2/ml of culture medium.

Analysis of Cox-2 Promoter and TGF-beta -dependent Transcriptional Activity-- Cox-2 promoter activity and TGF-beta transcriptional responses were assessed by transient transfection of RIE-1, RIE/PKCbeta II, or RIE/H-Ras cells with either a Cox-2 promoter or TGF-beta -responsive promoter construct linked to a luciferase reporter gene, respectively. Cox-2 promoter activity was determined using 4 kb of the mouse Cox-2 promoter cloned into the PGL3 reporter plasmid (16). TGF-beta transcriptional responses were assessed using the 3TP-Luc reporter as described previously (7). The appropriate expression vector was cotransfected with TK-pRL (Renilla luciferase transcribed from the HSV TK promoter) into 70-80% confluent RIE-1, RIE/PKCbeta II, or RIE/H-ras cell lines in 6-well plates using Tfx-50 (Promega) at a DNA:liposome ratio of 1:3 as described previously (7). Fresh medium was added 3 h after transfection, and cells were harvested after 24 h. Total cell extracts were prepared for dual-luciferase assay according to the manufacturer's instructions (Promega) using a Monolight 2010 Luminometer (Analytical Luminescence Laboratory). The activity of Renilla luciferase was used as an internal control. Results are expressed as the mean of triplicate determinations ± standard deviation.

Gene Microarray Analysis-- Gene-profiling analysis was performed on RIE-1 and RIE/PKCbeta II cells using RG-U34A Gene Chips® microarrays (Affymetrix). Total RNA (25 µg) was used for first-strand cDNA synthesis using a T7-(dT)24 oligomer (5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-dT24-3') and SuperScript II reverse transcriptase (Invitrogen). The cDNA was converted to double-stranded DNA by transcription in vitro. cRNAs were synthesized using bacteriophage T7 RNA polymerase in the presence of biotinylated nucleotides. Biotin-labeled target RNAs were fragmented to a mean size of 200 bases according to the manufacturer's protocol. Hybridization of the rat RG-U34A microarrays was performed at 45 °C for 16 h in 0.1 M 2-morpholinoethanesulfonic acid (MES) pH 6.6, 1 M NaCl, 0.02 M EDTA, and 0.01% Tween 20. Microarrays were washed using both nonstringent (1 M NaCl, 25 °C) and stringent (1 M NaCl, 50 °C) conditions prior to staining with phycoerythrin-labeled streptavidin (10 µg/ml final concentration). Data were collected using a Gene Array Scanner (Hewlett Packard) and analyzed using the Affymetrix Gene Chip Analysis Suite 5.0 software.

Real-time Reverse Transcriptase-Polymerase Chain Reaction Analysis of Gene Expression-- Real-time reverse transcriptase-polymerase chain reaction (real time RT-PCR) assays were used to determine gene expression using TaqMan technology on an Applied Biosystems 7000 sequence detection system. Applied Biosystems Assays-By-Design containing a 20× assay mix of primers and TaqMan MGB probes (FAMTM dye-labeled) were used for all target genes and the endogenous control, rat beta -actin. These assays were designed using primers that span exon-exon junctions so as not to detect genomic DNA. All primer and probe sequences were searched against the Celera data base to confirm specificity. The primer and probe sequences used were as follows: rat PAI1-probe spanning exon8 CCAACAGAGACAATCC, forward primer ACCGATCCTTTCTCTTTGTGGTT, reverse primer CATCAGCTGGCCCATGAAG; rat Cox-2-probe spanning exon8 CCCAGCAACCCGG, forward primer GAGTCATTCACCA-GACAGATTGCT, reverse primer GTACAGCGATTGGAACATTCCTT; human PKCbeta II-probe spanning the PKCbeta I/PKCbeta II alternative splice junction TCGCCCACAAGCT, forward primer AAACTTGAACGCAAAGAGATCCA, reverse primer ATCGGTCGAAGTTTTCAGCATT.

The efficiency of target amplification was validated using a reference amplification reaction. Absolute values of the slope of log input RNA amount versus Delta CT were <0.1 in all experiments. One-step RT-PCR reactions were performed on 20 ng of input RNA for both target genes and endogenous controls using the TaqMan one-step RT-PCR master mix reagent kit (Applied Biosystems). The cycling parameters were as follows: reverse transcription, 48 °C for 30 min; AmpliTaq activation, 95 °C for 10 min; denaturation, 95 °C for 15 s; and annealing/extension, 60 °C for 1 min for 40 cycles. Duplicate CT values were analyzed in Microsoft Excel using the comparative CT(Delta Delta CT) method as described by the manufacturer (Applied Biosystems).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our recent studies demonstrated that elevated expression of PKCbeta II in the colonic epithelium is an early, promotive event in colon carcinogenesis (5-7). To elucidate the molecular mechanisms by which PKCbeta II mediates increased colon carcinogenesis, we established a cell model system in which to explore PKCbeta II-mediated signaling. RIE-1 cells are immortalized but not transformed and consequently express abundant PKCbeta I but little or no detectable PKCBII protein (Fig. 1A). This pattern of expression of PKCbeta I and PKCbeta II is consistent with that observed in the colonic epithelium in vivo (5). To assess the cellular and genomic effects of PKCbeta II expression, we created the RIE/PKCbeta II cell line that expresses abundant human PKCbeta II (Fig. 1A). A real-time RT-PCR assay for human PKCbeta II mRNA demonstrated that RIE/PKCbeta II cells expressed human PKCbeta II mRNA at levels somewhat lower than those observed in human HEK293 cells, which express abundant endogenous PKCbeta II protein (Fig. 1B). We previously demonstrated that the growth rate of RIE/PKCbeta II cells is indistinguishable from that of RIE-1 cells (7), indicating that overexpression of PKCbeta II has no significant effect on proliferation or apoptosis of RIE-1 cells in culture. Similarly, no changes in gross cellular morphology were noted in RIE/PKCbeta II cells, nor were these cells able to form colonies in soft agar, indicating that expression of PKCbeta II is not sufficient to cause cellular transformation (data not shown).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Establishment of RIE cells expressing human PKCbeta II. RIE-1 cells were transfected with a retrovirus containing the full-length human PKCbeta II cDNA as described under "Experimental Procedures." A, immunoblot analysis of RIE-1, RIE/PKCbeta II, and HEK293 cells with antibodies to PKCbeta I, PKCbeta II, and actin. B, quantitative real time RT-PCR assay for human PKCbeta II mRNA in HEK293, RIE-1, and RIE/PKCbeta II cells. Results are expressed as relative PKCbeta II mRNA abundance and represent the mean of triplicate determinations ± S.E.

Affymetrix Gene Chips® were used to identify genes that are either induced or inhibited in RIE/PKCbeta II cells when compared with RIE-1 cells. Significance analysis of microarrays (17) was used to compare expression profiles of RNA extracted from control RIE-1 cells (n = 7) and RIE/PKCbeta II cells (n = 3). Among the probe sets whose expression changed by >2.0-fold in RIE/PKCbeta II cells was that encoding the inducible form of cyclooxygenase, Cox-2. Because Cox-2 expression can be induced by phorbol esters (8, 9), and because of the strong association between Cox-2 expression and colon cancer (10-13), we focused our analysis on this gene. We confirmed our microarray analysis using a quantitative real-time RT-PCR assay specific for Cox-2 mRNA (Fig. 2A). The mean signal intensities obtained from Cox-2 probe sets in microarrays from RIE-1 (n = 7) and RIE/PKCbeta II (n = 3) cells (gray bars) correlated well with the level of Cox-2 mRNA detected by real time RT-PCR (black bars), providing independent confirmation of elevated expression of Cox-2 RNA in RIE/PKCbeta II cells. Northern blot analysis indicated that Cox-2 mRNA expression was increased >10-fold in RIE/PKCbeta II cells when compared with RIE-1 cells (Fig. 2B), providing an independent confirmation of the microarray and real-time RT-PCR data. As a positive control, RIE/Cox2 cells, which express a Cox-2 transgene that is deleted of the 3'-untranslated region (18), was used to compare the abundance of Cox-2 mRNA in RIE/PKCbeta II cells expressing the endogenous, full-length Cox-2 transcript. The data in Fig. 2B indicate that Cox-2 mRNA is even more abundant in RIE/PKCbeta II cells than in RIE/Cox2 cells. Real-time RT-PCR analysis confirmed that RIE/PKCbeta II cells express 1.4-fold more PKCbeta II mRNA than RIE/Cox-2 cells. Taken together, these data provide conclusive evidence that Cox-2 mRNA is induced by PKCbeta II in RIE-1 cells.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   The Cox-2 gene is induced by PKCbeta II. A, total RNA from RIE-1 and RIE/PKCbeta II cells was subjected to microarray analysis using Affymetrix Gene Chips as described under "Experimental Procedures." Rat Cox-2 mRNA abundance was independently measured by real-time RT-PCR as described under "Experimental Procedures." Results are plotted as signal intensity ± S.D. B, Northern blot analysis for Cox-2 mRNA was performed on total RNA isolated from RIE-1, RIE/PKCbeta II, and RIE/Cox2 cells as described under "Experimental Procedures." An 18S RNA probe was used to assess RNA loading on the gel.

Immunoblot analysis was used to assess the level of Cox-2 protein expression in RIE-1, RIE/PKCbeta II, and RIE/Cox2 cells (Fig. 3A). Cox-2 protein was expressed at nearly undetectable levels in RIE-1 cells. In contrast, RIE/PKCbeta II cells expressed abundant Cox-2 protein comparable with the amount of Cox-2 protein expressed in RIE/Cox2 cells. To assess whether induction of Cox-2 expression is specific for PKCbeta II expression, we assayed Cox-2 protein levels in RIE/PKCiota cells, which were engineered to overexpress transgenic human PKCiota (Fig. 3B). RIE/PKCiota cells expressed very low levels of Cox-2 (which could be observed only after very long exposures of the immunoblots) comparable with those observed in RIE-1 cells. These results are consistent with our microarray analysis of RIE/PKCiota cells, which did not identify Cox-2 as a potential transcriptional target of PKCiota (data not shown). These results indicate that induction of Cox-2 is not a general response to the expression of any PKC isozyme, but rather is a specific response to PKCbeta II expression.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 3.   Cox-2 protein and enzyme activity is induced in RIE/PKCbeta II cells and in the colons of transgenic PKCbeta II mice. A, total cell lysates from RIE-1, RIE/PKCbeta II, and RIE/Cox2 cells were subjected to immunoblot analysis for PKCbeta II, Cox-2, and actin as described under "Experimental Procedures." B, total cell lysates from RIE-1 and RIE/PKCiota cells were subjected to immunoblot analysis for Cox-2 and actin. C, PGE2 levels from culture supernatants from RIE-1, RIE/PKCbeta II, and RIE/Cox2 cells were measured by enzyme-linked immunosorbent assay as described under "Experimental Procedures." Results are expressed as pg/ml PGE2 ± S.E. for three independent measurements. p-values were determined by Student's t test. D, lysates from colonic epithelium from transgenic PKCbeta II mice (6, 7) and nontransgenic littermates were subjected to immunoblot analysis for PKCbeta II, Cox-2, and actin as described under "Experimental Procedures."

To assess whether the Cox-2 protein expressed in RIE/PKCbeta II cells was functional, RIE-1, RIE/PKCbeta II, and RIE/Cox-2 cells were assayed for production of PGE2, a product of Cox-2 enzyme activity (Fig. 3C). Enzyme-linked immunosorbent assay analysis of culture supernatants demonstrated that RIE/PKCbeta II cells, like RIE/Cox2 cells, secreted 3- to 4-fold higher levels of PGE2 than RIE-1 cells. These results demonstrate that PKCbeta II induced the expression of active Cox-2 enzyme in RIE/PKCbeta II cells.

We next wished to determine whether Cox-2 is also a target for PKCbeta II regulation in the colonic epithelium in vivo. We have developed transgenic PCKbeta II mice overexpressing PKCbeta II in the colonic epithelium that exhibit an increased sensitivity to azoxymethane-mediated colon carcinogenesis (6, 7). Immunoblot analysis of colonic epithelium from nontransgenic and transgenic PKCbeta II mice demonstrate that transgenic PKCbeta II mice expressed significantly more PKCbeta II and Cox-2 protein than their nontransgenic littermates (Fig. 3D). These data demonstrate that Cox-2 is a significant genomic target of PKCbeta II both in RIE-1 cells in culture and in the colonic epithelium in vivo.

We next assessed the mechanism by which PKCbeta II leads to elevated Cox-2 mRNA levels in RIE-1 cells. For this purpose, a Cox-2 promoter/luciferase reporter gene was transiently cotransfected into RIE-1 cells along with a PKCbeta II expression vector to assess the effect of PKCbeta II on Cox-2 promoter activity (Fig. 4A). The activity of the Cox-2/luciferase reporter was increased by 2- to 3-fold in RIE-1 cells in which a PKCbeta II expression vector was simultaneously introduced. These experiments utilized a human Cox-2 promoter construct consisting of 4 kb of 5'-flanking sequence, but consistent results were also obtained using promoters containing 7 kb or 1.4 kb of 5'-flanking sequence (data not shown). To independently assess the effect of PKCbeta II expression on Cox-2 promoter activity, the Cox-2 promoter/luciferase reporter was transfected into RIE-1, RIE/PKCbeta II, and RIE/Ras cells, and the activity of the reporter was assessed by luciferase assay (Fig. 4B). RIE/Ras cells express an activated H-Ras allele previously shown to activate Cox-2 transcription (11, 19) and served as a positive control for activation of Cox-2 promoter activity. Consistent with the transient cotransfection data shown in Fig. 4A, the Cox-2 promoter was 2-3 times more active in RIE/PKCbeta II cells than in RIE-1 cells. As expected, the Cox-2 promoter was also more active, by about 5-fold, in RIE/Ras cells, which are known to express high levels of Cox-2 (11). These data demonstrate that PKCbeta II causes a 2- to 3-fold increase in Cox-2 promoter activity in RIE cells. Although this represents a significant and reproducible increase in Cox-2 promoter activity, the magnitude of the effect was clearly not sufficient to account for the dramatic increase in Cox-2 mRNA expression observed in RIE/PKCbeta II cells. Taken together, these data indicate that an additional mechanism(s) may be responsible for the effects of PKCbeta II on Cox-2 mRNA levels in RIE-1 cells.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4.   PKCbeta II induces Cox-2 gene transcription and stabilizes the Cox-2 mRNA. A, RIE-1 cells were transiently transfected with a luciferase reporter construct containing the Cox-2 promoter along with the indicated amount of a PKCbeta II expression vector. The activity of the Cox-2 promoter was determined by luciferase assay as described under "Experimental Procedures." B, RIE-1, RIE/PKCbeta II, and RIE/H-Ras cells were transiently transfected with the Cox-2 promoter construct, and promoter activity was assessed by luciferase assay as described in under "Experimental Procedures." Results in A and B are expressed as relative luciferase activity and represent the means from triplicate determinations ± S.E. C, RIE-1 and RIE/PKCbeta II cells were incubated with the RNA polymerase inhibitor dichlorobenzimidazole riboside. At the indicated times, cells were lysed, and the amount of Cox-2 mRNA was assessed by quantitative real-time-RT-PCR as described under "Experimental Procedures."

The Cox-2 gene is known to be regulated not only at the transcriptional level but also at the level of mRNA stability (20-22). Therefore, Cox-2 mRNA stability was compared in RIE-1 and RIE/PKCbeta II cells by measuring mRNA abundance by quantitative real-time RT-PCR as a function of time after addition of the nonspecific RNA polymerase II inhibitor dichlorobenzimidazole riboside (Fig. 4C). Cox-2 mRNA in RIE-1 cells was relatively unstable with an estimated t1/2 of degradation of ~12-16 min. In contrast, the apparent t1/2 of degradation of Cox-2 mRNA in RIE/PKCbeta II cells was greater than 50 min, indicating that PKCbeta II expression results in significant stabilization of Cox-2 mRNA. Thus, PKCbeta II-mediated elevation of Cox-2 mRNA levels result from a combined effect of PKCbeta II on Cox-2 gene transcription and Cox-2 mRNA stability.

We recently showed that PKCbeta II inhibits expression of TGF-beta RII both in the colonic epithelium of transgenic PKCbeta II mice and in RIE/PKCbeta II cells (7). Therefore, we assessed whether the effect of PKCbeta II on TGFbeta RII expression is mediated through Cox-2 activation (Fig. 5). RIE-1 cells expressed abundant TGFbeta RII protein as assessed by immunoblot analysis (Fig. 5A, lane 1), whereas RIE/PKCbeta II cells expressed significantly lower levels of TGFbeta RII protein (Fig. 5A, lane 2). Treatment of RIE/PKCbeta II cells with 25 µM Celecoxib for 0, 24, or 48 h led to a time-dependent increase in TGF-beta RII protein expression (Fig. 5A, lanes 3-5). We have also observed that treatment of RIE-1 cells with Celecoxib leads to increased TGF-beta RII protein expression, indicating that Cox-2 exerts a tonic suppressive effect on TGF-beta RII expression in RIE-1 cells that can be reversed by inhibition of the enzyme(data not shown).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.   PKCbeta II-mediated repression of TGF-beta RII expression depends on Cox-2. A, RIE-1 (lane 1) and RIE/PKCbeta II (lanes 2-5) cells were subjected to immunoblot analysis for TGF-beta RII and actin as described under "Experimental Procedures." RIE/PKCbeta II cells were incubated in the absence (lane 2) or presence (lanes 3-5) of 25 µM Celecoxib for 0 h (lane 3), 24 h (lane 4), or 48 h (lane 5) prior to lysis and immunoblot analysis. B, RIE/PKCbeta II cells were transiently transfected with a Cox-2 promoter construct and treated with either nothing, TGF-beta 1, Celecoxib, or both as indicated in the figure. Cox-2 promoter activity was measured by luciferase assay as described under "Experimental Procedures." Results are expressed as relative luciferase activity and represent the mean of three determinations ± S.E. p values were calculated by Student's t test. C, the abundance of endogenous PAI-1 mRNA was assessed by real-time RT-PCR analysis of RNA isolated from RIE/PKCBII cells treated with nothing, TGF-beta 1, or TGF-beta 1 and Celecoxib for 24 h or 48 h as indicated. Results are expressed as the mean of three independent determinations ± S.E. p values were calculated by Student's t test. D, transgenic PKCbeta II mice were treated with either vehicle or Celecoxib and isolated colonic epithelium was subjected to immunoblot analysis for TGFbeta RII and actin as described under "Experimental Procedures."

RIE/PKCbeta II cells exhibit a profound loss of TGF-beta -mediated transcriptional activity as a consequence of PKCbeta II-mediated repression of TGF-beta RII expression (7). We therefore assessed the ability of Celecoxib to restore TGF-beta -mediated transcriptional activity in RIE/PKCbeta II cells (Fig. 5, B and C). RIE/PKCbeta II cells were transiently transfected with a TGF-beta -reponsive luciferase reporter plasmid and then treated with either TGF-beta 1, Celecoxib, or both (Fig. 5B). RIE/PKCbeta II cells exhibited little or no transcriptional response to TGF-beta 1, consistent with our previous results (7). However, when these cells were treated with Celecoxib prior to exposure to TGF-beta 1, they exhibited a robust transcriptional response. Celecoxib treatment had no effect in the absence of TGF-beta 1, demonstrating that the observed transcriptional effects of Celecoxib are TGF-beta -dependent. Consistent with these results, the level of the mRNA for the endogenous TGF-beta 1-responsive gene, plasminogen activator inihibitor-1 (PAI-1) (23), was dramatically induced when RIE/PKCbeta II cells were treated with Celecoxib for 24 or 48 h prior to exposure to TGF-beta 1 (Fig. 5C).

To determine whether the PKCbeta II-mediated repression of TGF-beta RII expression is Cox-2-dependent in vivo, we assessed the effect of treating transgenic PKCbeta II mice with Celecoxib on TGF-beta RII expression in the colonic epithelium (Fig. 5D). Treatment of transgenic PKCbeta II mice with Celecoxib led to reexpression of TGF-beta RII as assessed by immunoblot analysis. Therefore, PKCbeta II-mediated repression of TGF-beta RII expression and TGF-beta -responsiveness are dependent on Cox-2 activity both in intestinal epithelial cells in vitro and in the colonic epithelium in vivo

Chemopreventive dietary omega -3 fatty acids such as EPA block Cox-2 induction in azoxymethane-treated mice (24). We and others have shown that azoxymethane induces colonic PKCbeta II expression (5, 25). We have found that a diet high in omega -3 fatty acids inhibits colonic PKCbeta II activity, induces TGF-beta RII expression, and blocks PKCbeta II-mediated colon carcinogenesis in transgenic PKCbeta II mice (7). These observations lead to the hypothesis that the chemopreventive effects of omega -3 fatty acids are mediated through inhibition of a PKCbeta II right-arrow Cox-2 right-arrow TGF-beta signaling pathway. To test this hypothesis, we treated RIE-1 and RIE/PKCbeta II cells with EPA, an omega -3 fatty acid found in fish oil, and measured TGF-beta RII and Cox-2 expression by immunoblot analysis (Fig. 6A). Treatment of RIE/PKCbeta II cells with EPA led to a dose-dependent increase in TGF-beta RII expression and a concomitant decrease in Cox-2 expression (Fig. 6A, left panel). This effect was dependent on PKCbeta II expression because no significant changes in either TGF-beta RII or Cox-2 expression were observed in RIE-1 cells treated with EPA (Fig. 6A, right panel). Quantitative analysis of these data revealed that Cox-2 expression was inhibited by >50% in RIE/PKCbeta II cells but was unaffected in RIE-1 cells (Fig. 6B). On the other hand, TGF-beta RII was induced in RIE/PKCbeta II cells but not in RIE-1 cells treated with EPA (Fig. 6C). These data are consistent with our recent observation that a diet high in omega -3 fatty acids induces TGF-beta RII expression in the colonic epithelium of transgenic PKCbeta II mice and blocks PKCbeta II-mediated colon carcinogenesis (7). They also establish a direct link between cancer-preventive dietary omega -3 fatty acids, PKCbeta II activity, Cox-2 expression, and TGF-beta signaling in vitro and in vivo.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   EPA inhibits Cox-2 expression and restores TGF-beta RII expression in RIE/PKCbeta II cells. A, RIE-1 and RIE/PKCbeta II cells were cultured in the presence of the indicated concentration of EPA for 48 h prior to harvest and immunoblot analysis for TGFbeta RII, Cox-2 and actin as described under "Experimental Procedures." B and C, quantitative analysis of the immunoblot analysis in A for Cox-2 (B) and TGFbeta RII (C) expression.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have focused our recent attention on the role of individual PKC isozymes in the development of colon cancer (5-7). We have found that PKCbeta II, which is expressed at very low levels in the proliferative zone of normal colonic epithelium, is rapidly induced in the colonic epithelium of azoxymethane-treated rodents and is abundantly expressed in both preneoplastic aberrant crypt foci and colon tumors that form following azoxymethane treatment (5). Transgenic PKCbeta II mice overexpressing PKCbeta II in the colonic epithelium exhibit hyperproliferation and increased susceptibility to azoxymethane-induced colon carcinogenesis (6, 7), demonstrating that PKCbeta II plays a critical promotive role in colon carcinogenesis.

We also recently demonstrated that PKCbeta II is an important cellular target for the cancer-preventive activity of dietary omega -3 fatty acids (7). Diets high in omega -3 fatty acids have been shown to block colon carcinogenesis in rodent models (7, 26-29), and epidemiologic studies indicate that omega -3 fatty acids have chemopreventive effects against colon cancer in humans (30-33). We found that omega -3 fatty acids, which are abundant in dietary fish oils, inhibit colonic PKCbeta II activity and suppress the hyperproliferative and cancer-prone phenotype of transgenic PKCbeta II mice (7). In those studies, we also established that the TGF-beta RII gene is a target for repression by PKCbeta II (7).

The present studies were initiated in an effort to further elucidate the molecular mechanism(s) by which PKCbeta II promotes colon carcinogenesis. The data presented herein identify the Cox-2 gene as a prominent target for PKCbeta II-mediated regulation in intestinal epithelial cells in vitro and the colonic epithelium in vivo. PKCbeta II causes induction of Cox-2 expression by at least two distinct mechanisms. First, PKCbeta II leads to a modest, 2- to 3-fold induction of Cox-2 gene transcription. However, the more dramatic effect of PKCbeta II on Cox-2 gene expression appears to be through stabilization of Cox-2 mRNA. The half-life of Cox-2 mRNA in RIE/PKCbeta II cells is more than 50 min. This represents a significant stabilization of the Cox-2 mRNA, which exhibits a half-life of 12-16 min in RIE-1 cells. Taken together, these two actions of PKCbeta II provide a plausible mechanism by which PKCbeta II leads to the dramatic increase in Cox-2 mRNA, protein, and activity levels observed in RIE/PKCbeta II cells.

There is abundant evidence that both Cox-2 and PKCbeta II are involved in colon carcinogenesis, and several interesting parallels exist between these two genes. First, the Cox-2 gene was originally described as an immediate early gene that is induced by either serum or phorbol ester stimulation of quiescent cells (8, 9), suggesting a connection between Cox-2 gene regulation and PKC signaling. Second, both Cox-2 and PKCbeta II are elevated in the colonic epithelium of rodents exposed to the colon carcinogen azoxymethane and in aberrant cryptic foci and colon tumors that develop in azoxymethane-treated animals (5, 34, 35), indicating that these genes are involved in early events in the carcinogenic process.

The data presented here provide the first direct mechanistic link between elevated PKCbeta II and Cox-2 expression during colon carcinogenesis. Based on our current and previously published data, we propose a model for how PKCbeta II and Cox-2 promote colon cancer (Fig. 7). In this model, the tissue-selective carcinogen azoxymethane induces PKCbeta II expression in the colonic epithelium, an event that has been well documented by our group and others (5, 25). Our current data show that PKCbeta II induces Cox-2 expression in intestinal epithelial cells in vitro and in the colonic epithelium in vivo. We have also demonstrated that PKCbeta II leads to repression of TGF-beta RII expression and TGF-beta 1 signaling in RIE cells and to a loss of TGF-beta RII expression in the colonic epithelium of transgenic PKCbeta II mice (7). In the present study, we demonstrate that PKCbeta II-mediated repression of TGF-beta RII expression and signaling can be reversed by the Cox-2 inhibitor Celecoxib, indicating that PKCbeta II mediates its effects on TGF-beta signaling through Cox-2. These data are consistent with the recent association between elevated Cox-2 expression and loss of TGF-beta 1 responsiveness and TGF-beta RII expression in RIE cell variants selected for loss of TGF-beta 1 responses (36).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   A proposed model for a procarcinogenic PKCbeta II/Cox-2/TGF-beta RII signaling pathway.

The effects of Cox-2 in intestinal epithelial cells and in colon tumors are thought to be mediated through production of prostaglandins, particularly PGE2 (37). PGE2 in turn signals through binding to specific PGE2 receptors, of which there are four well characterized members, termed EP 1-4 (reviewed in Ref. 38). The EPs are members of the G-protein-coupled receptor family whose downstream effectors include adenylate cyclase and phosphatidylinositol-phospholipase Cbeta (38). Accumulating evidence demonstrates that EP1 plays a pivotal role in colon carcinogenesis (39-41). Specifically, two different pharmacologic inhibitors selective for EP1 have been shown to inhibit formation of preneoplastic aberrant cryptic foci in azoxymethane-treated mice and of intestinal polyps in APCmin mice (39-41). Furthermore, mice that are nullizygous for EP1 exhibit suppressed colon carcinogenesis (39).

It is well documented that EP1 signals through activation of PI-PLC and generation of the second messengers diacylglycerol and inositol trisphosphate, which in turn lead to intracellular calcium mobilization and PKC activation (38). Based on these observations, and our present data, it is attractive to suggest that PGE2-mediated activation of EP1 leads to activation of PKCbeta II, a classical PKC isozyme, generating an autocrine positive-feedback loop. In this model, activated PKCbeta II in turn causes repression of TGF-beta RII function by an as-yet-unidentified mechanism. It should be noted, however, that the role of EPs in colon cancer development appears to be complex. In this regard, both EP2 (42) and EP4 (43) have also been implicated in colon carcinogenesis, indicating that PGE2 can activate multiple signaling pathways in the colonic epithelium. The complex role of EPs, as well as other possible Cox-2 products, in PKCbeta II-mediated effects in intestinal epithelial cells will require further experimentation.

In recent studies, we demonstrated that the chemopreventive effects of dietary omega -3 fatty acids are mediated, at least in part, through inhibition of PKCbeta II activity in the colonic epithelium (7). Furthermore, we demonstrated that omega -3 fatty acids can block the hyperproliferation and enhanced colon carcinogenesis exhibited by transgenic PKCbeta II mice through inhibition of colonic PKCbeta II activity (7). In this study we show that omega -3 fatty acids inhibit Cox-2 expression and induce TGF-beta RII by a mechanism that depends on PKCbeta II expression. These data are consistent with the model proposed in Fig. 7, because there is abundant evidence that dietary omega -3 fatty acids prevent azoxymethane-induced elevation of Cox-2 expression in the colonic epithelium (24). omega -3 fatty acids such as EPA have been shown in some cell systems to inhibit Cox-2 activity (44, 45). However, our data indicate that EPA does not induce TGF-beta RII expression in RIE/PKCbeta II cells through inhibiton of Cox-2 for the following reasons. First, both RIE-1 and RIE/PKCbeta II cells express active Cox-2 enzyme (Fig. 3C). Despite that fact, EPA induces TGF-beta RII expression in RIE/PKCbeta II cells, but not in RIE-1 cells (Fig. 6). Treatment of RIE-1 cells with Celecoxib however, leads to elevated expression of TGF-beta RII in both RIE-1 and RIE/PKCbeta II cells. If EPA were acting through inhibition of Cox-2 activity, it should induce TGF-beta RII expresion in both cell lines. Therefore, it is unlikely that the effects of EPA on TGF-beta RII expression in RIE/PKCbeta II cells are caused by Cox-2 inhibition.

The accumulating evidence that PKCbeta II and Cox-2 expression and activity can be regulated in a similar fashion by dietary components that modulate colon cancer risk further suggests a mechanistic link between these two cancer-promoting genes. Our model is attractive in that it reconciles many seemingly disparate observations in the literature regarding the role of PKCbeta II, Cox-2, and TGF-beta signaling in colon carcinogenesis. Furthermore, it provides a paradigm within which to understand the mechanism(s) by which dietary compounds can modulate colon cancer risk. We are currently using our transgenic cell and animal models to explore the mechanism(s) by which azoxymethane and dietary factors such as EPA regulate PKCbeta II expression and activity and to assess whether PKCbeta II expression is required for Cox-2 gene induction and colon carcinogenesis in vivo.

In summary, we have shown that PKCbeta II induces Cox-2 expression both in vitro and in vivo. Cox-2 is intimately linked to the development of colon cancer, and our studies provide a molecular mechanism by which induction of PKCbeta II expression during azoxymethane-induced carcinogenesis, or overexpression of PKCbeta II in transgenic mice, predisposes mice to colon cancer. The elucidation of a PKCbeta II right-arrow Cox-2 right-arrow TGF-beta signaling axis, which is operative in both intestinal epithelial cells in culture, and the colonic epithelium in vivo, provides an important mechanistic link that can explain how changes in PKCbeta II expression promotes colon carcinogenesis and how dietary lipids and nonsteroidal antiinflammatory drugs can modulate colon cancer risk.

    ACKNOWLEDGEMENTS

We thank the members of the Fields laboratory for helpful discussions.

    FOOTNOTES

* This work was supported by grants from the National Cancer Institute (to A. P. F.) (CA81436 and CA56869).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: The Sealy Center for Cancer Cell Biology, The University of Texas Medical Branch, 301 University Blvd., MRB 9.104, Galveston, TX 77555-1048; Tel.: 409-747-1935; Fax: 409-747-1938; E-mail: afields@utmb.edu.

Published, JBC Papers in Press, December 11, 2002, DOI 10.1074/jbc.M211424200

    ABBREVIATIONS

The abbreviations used are: PKC, protein kinase C; TGF-beta RII, transforming growth factor beta type II receptor; Cox-2, cyclooxygenase type 2; RIE, rat intestinal epithelial; PG, prostaglandin; EPA, eicosapentaenoic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Weinstein, I. B. (1991) Environ. Health Perspect. 93, 175-179[Medline] [Order article via Infotrieve]
2. Fearon, E. R., and Vogelstein, B. (1990) Cell 61, 759-767[CrossRef][Medline] [Order article via Infotrieve]
3. Murray, N. R., Thompson, L. J., and Fields, A. P. (1997) in Molecular Biology Intelligence Unit (Parker, P. J. , and Dekker, L., eds) , pp. 97-120, R. G. Landes Press, Austin, TX
4. Castagna, M., Takai, Y., Kaibuchi, K., Sano, K., Kikkawa, U., and Nishizuka, Y. (1982) J. Biol. Chem. 257, 7847-7851[Abstract/Free Full Text]
5. Gokmen-Polar, Y., Murray, N. R., Velasco, M. A., Gatalica, Z., and Fields, A. P. (2001) Cancer Res. 61, 1375-1381[Abstract/Free Full Text]
6. Murray, N. R., Davidson, L. A., Chapkin, R. S., Gustafson, W. C., Schattenberg, D. G., and Fields, A. P. (1999) J. Cell Biol. 145, 699-711[Abstract/Free Full Text]
7. Murray, N. R., Weems, C., Chen, L., Leon, J., Yu, W., Davidson, L. A., Jamieson, L., Chapkin, R. S., Thompson, E. A., and Fields, A. P. (2002) J. Cell Biol. 157, 915-920[Abstract/Free Full Text]
8. Hla, T., and Neilson, K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7384-7388[Abstract/Free Full Text]
9. Jones, D. A., Carlton, D. P., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1993) J. Biol. Chem. 268, 9049-9054[Abstract/Free Full Text]
10. Kutchera, W., Jones, D. A., Matsunami, N., Groden, J., McIntyre, T. M., Zimmerman, G. A., White, R. L., and Prescott, S. M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 4816-4820[Abstract/Free Full Text]
11. Sheng, G. G., Shao, J., Sheng, H., Hooton, E. B., Isakson, P. C., Morrow, J. D., Coffey, R. J., DuBois, R. N., and Beauchamp, R. D. (1997) Gastroenterology 113, 1883-1891[CrossRef][Medline] [Order article via Infotrieve]
12. Kargman, S. L., O'Neill, G. P., Vickers, P. J., Evans, J. F., Mancini, J. A., and Jothy, S. (1995) Cancer Res. 55, 2556-2559[Abstract/Free Full Text]
13. Oshima, M., Dinchuk, J. E., Kargman, S. L., Oshima, H., Hancock, B., Kwong, E., Trzaskos, J. M., Evans, J. F., and Taketo, M. M. (1996) Cell 87, 803-809[CrossRef][Medline] [Order article via Infotrieve]
14. Ko, T. C., Yu, W., Sakai, T., Sheng, H. M., Shao, J., Beauchamp, R. D., and Thompson, E. A. (1998) Oncogene 16, 3445-3454[CrossRef][Medline] [Order article via Infotrieve]
15. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
16. Inoue, H., Nanayama, T., Hara, S., Yokoyama, C., and Tanabe, T. (1994) FEBS Lett. 350, 51-54[CrossRef][Medline] [Order article via Infotrieve]
17. Tusher, V., Tibshirami, R., and Chu, C. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 5116-5121[Abstract/Free Full Text]
18. O'Mahony, C. A., Beauchamp, R. D., Albo, D., Tsujii, M., Sheng, H. M., Shao, J., Dubois, R. N., and Berger, D. H. (1999) Surgery 126, 364-370[Medline] [Order article via Infotrieve]
19. Sheng, H., Williams, C. S., Shao, J., Liang, P., DuBois, R. N., and Beauchamp, R. D. (1998) J. Biol. Chem. 273, 22120-22127[Abstract/Free Full Text]
20. Zhang, Z., Sheng, H., Shao, J., Beauchamp, R. D., and DuBois, R. N. (2000) Neoplasia 2, 523-530[CrossRef][Medline] [Order article via Infotrieve]
21. Sheng, H., Shao, J., Dixon, D. A., Williams, C. S., Prescott, S. M., DuBois, R. N., and Beauchamp, R. D. (2000) J. Biol. Chem. 275, 6628-8835[Abstract/Free Full Text]
22. Monick, M. M., Robeff, P. K., Butler, N. S., Flaherty, D. M., Carter, A. B., Peterson, M. W., and Hunninghake, G. W. (2002) J. Biol. Chem. 277, 32992-33000[Abstract/Free Full Text]
23. Gerwin, B. I., Keski-Oja, J., Seddon, M., Lechner, J. F., and Harris, C. C. (1990) Am. J Physiol. 259, L262-L269[Abstract/Free Full Text]
24. Singh, J., Hamid, R., and Reddy, B. S. (1997) Cancer Res. 57, 3465-3470[Free Full Text]
25. Wali, R. K., Frawley, B. P., Jr., Hartmann, S., Roy, H. K., Khare, S., Scaglione-Sewell, B. A., Earnest, D. L., Sitrin, M. D., Brasitus, T. A., and Bissonnette, M. (1995) Cancer Res. 55, 5257-5264[Abstract/Free Full&