|
Originally published In Press as doi:10.1074/jbc.M210291200 on November 27, 2002
J. Biol. Chem., Vol. 278, Issue 13, 11601-11611, March 28, 2003
A Novel Long Distance Base-pairing Interaction in Human
Immunodeficiency Virus Type 1 RNA Occludes the Gag Start Codon*
Truus E. M.
Abbink and
Ben
Berkhout
From the Department of Human Retrovirology, Academic Medical
Center, University of Amsterdam,
1100 DE Amsterdam, The Netherlands
Received for publication, October 8, 2002, and in revised form, November 21, 2002
 |
ABSTRACT |
The 5'-untranslated region (5'-UTR) is the most
conserved part of the HIV-1 RNA genome, and it contains regulatory
motifs that mediate various steps in the viral life cycle.
Previous work showed that the 5'-terminal 290 nucleotides of HIV-1 RNA
adopt two mutually exclusive secondary structures, long distance
interaction (LDI) and branched multiple hairpin (BMH). BMH has
multiple hairpins, including the dimer initiation signal (DIS) hairpin
that mediates RNA dimerization. LDI contains a long distance
base-pairing interaction that occludes the DIS region. Consequently,
the two conformations differ in their ability to form RNA dimers. In
this study, we have presented evidence that the full-length 5'-UTR also
adopts the LDI and BMH conformations. The downstream 290-352 region, including the Gag start codon, folds differently in the context of the
LDI and BMH structures. These nucleotides form an extended hairpin
structure in the LDI conformation, but the same sequences create a
novel long distance interaction with upstream U5 sequences in the BMH
conformation. The presence of this U5-AUG duplex was confirmed by
computer-assisted RNA structure prediction, biochemical analyses, and a
phylogenetic survey of different virus isolates. The U5-AUG
duplex may influence translation of the Gag protein because it occludes
the start codon of the Gag open reading frame.
 |
INTRODUCTION |
Human immunodeficiency virus type 1 (HIV-1)1 virions contain two
full-length positive-stranded RNA molecules as genome. The full-length
RNA not only serves as viral genome but also functions as an mRNA
to encode the Gag and Gag-Pol polyproteins. The highly structured
5'-UTR is the most conserved part of the HIV-1 genome and is involved
in several steps of the viral replication cycle (1). Distinct functions
have been assigned to individual sequence and/or structure motifs
(presented in different colors in Fig. 1A). The 5'-UTR
consists of an upstream repeat (R) region that recurs at the
3'-terminus of the HIV-1 genome and that comprises TAR and the
polyadenylation (poly(A)) signal. The well characterized TAR hairpin
mediates transcription activation by binding of the viral Tat protein
and the cellular protein, cyclin T (2-10). The poly(A) hairpin
inhibits premature polyadenylation of the nascent RNA by masking of the
AAUAAA polyadenylation signal (11, 12). The U5 region is located
downstream of the R region and contains two important signals for
reverse transcription, the primer activation signal (PAS) and
the primer binding site (PBS) (13, 14). Additional essential motifs are
located further downstream in the 5'-UTR. These include the RNA dimer
initiation signal (DIS), the major splice donor site (SD) that is
required for the generation of subgenomic mRNAs, the packaging
signal ( ) that is required for the assembly of infectious virus
particles, and a hairpin motif that includes the Gag start codon
(15-23).
The secondary structure of the HIV-1 5'-UTR has been studied
extensively, and a variety of structure models have been proposed (1,
18, 19). Recently, the 5'-UTR was shown to fold alternative secondary
structures (Fig. 1A) (24). The ground state conformation is
formed by a long distance
interaction of the poly(A) and DIS regions and is termed
LDI. The alternative, metastable conformation is a branched
structure with multiple hairpins and is termed
BMH. The two conformations differ in their ability to form RNA dimers. The DIS sequence is masked in the LDI conformation by long distance base pairing with upstream sequences, thus preventing dimer formation. In contrast, the DIS hairpin with the palindromic loop sequence is
folded in the BMH structure.
Thus, BMH RNA is able to engage in a kissing-loop interaction
with the DIS palindrome of a second RNA molecule, thereby forming loose
dimers (15, 25-30). Heat treatment or incubation with the HIV-1
nucleocapsid (NC) protein triggers the formation of a tight dimer with
extended inter-strand base pairing (15, 25, 28, 31). Interestingly, the
NC protein also mediates the switch from LDI to BMH (24). This RNA
switch mechanism may allow regulation and appropriate timing of the
different 5'-UTR functions. For instance, the HIV-1 genomic RNA should
be translated into the Gag and Gag-Pol proteins prior to RNA
dimerization and packaging into assembling virions.
The LDI and BMH structures have been studied in transcripts that
comprise the 5'-terminal 290 nucleotides (nts) of the HIV-1 leader RNA.
Because the SD site is located at nucleotide position 289, these
results suggest that both genomic and subgenomic HIV-1 mRNAs can
fold the LDI conformation. The 5'-UTR of the genomic HIV-1 RNA consists
of 335 nucleotides up to the AUG start codon of the Gag open reading
frame (ORF). In this work, we studied the folding of the downstream
leader region 290-368 that contains the SD and signals and part of
the Gag ORF. Computer-assisted folding and a phylogenetic survey of the
leader RNA of different primate lentiviruses revealed a novel long
distance interaction between U5 sequences and the Gag initiation codon:
the U5-AUG duplex. The proposed U5-AUG long distance interaction was
analyzed by mutational analysis, polyacrylamide gel electrophoresis,
and RNA structure probing. The U5-AUG long distance interaction is formed exclusively in the BMH structure and not in the alternative LDI
fold. The duplex is of particular interest because it occludes the AUG
start codon of the Gag ORF, and it therefore has the potential to be
involved in regulation of mRNA translation.
 |
EXPERIMENTAL PROCEDURES |
RNA Secondary Structure Prediction--
Computer-assisted RNA
secondary structure predictions were performed using the Mfold version
3.0 algorithm (32, 33) offered by the MBCMR Mfold server
(mfold.burnet.edu.au/). Standard settings were used for all folding
jobs (37 °C and 1.0 M NaCl, with a 5% suboptimality
range). Folding was performed with sequences comprising nucleotides
1-368 of the genomic RNA sequence of the wild-type (wt) and mutant
HIV-1 LAI RNA. Phylogenetic studies were based on MFold data obtained
with 500-nucleotide leader fragments of the primate lentiviral genomes.
Constructs--
For mutation of the HIV-1 leader RNA, we used
the plasmid Blue-5'LTR (34). This pBluescript-derived construct
contains the XbaI-ClaI fragment of the infectious
pLAI clone, including the 5'-LTR, the complete 5'-UTR, and part of the
Gag ORF ( 454/+376). Mutations were created by a standard PCR
mutagenesis protocol. For construction of the s1 mutation,
oligonucleotide primers TA007 (5'-CCC76AAGCTTGCCTTGAGTGCTTCAAGTAGTGTGCACCCATCTGTTGTGTGACTCT
GG130-3') and AD-GAG (complementary to position
442-462 of the HIV-1 genome) were used in a standard PCR reaction. For
the w1 and w2 mutations, we used the forward primers TA009
(5'-CCC76AAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGTTTGTCTGTTGTGTG
ACTCTGG130-3') and TA008
(5'-CCC76AAAGCTTGCCTTGAGTGCTTCAAGTAGTGTG
GAAAGTCTGTTGTGTGACTCTGG130-3'). The
mutated nucleotides are underlined, and the nucleotide positions of the
HIV-1 sequence are indicated in superscript. The sequence of the PCR
products was confirmed by sequencing. The mutant PCR products were
digested by HindIII and ClaI and cloned into the
Blue-5'LTR vector. The XbaI-ClaI fragments were subsequently cloned into pLAI-R37, a derivative of the full-length infectious clone pLAI (35). The mutant proviral constructs were designated pLAI-s1, -w1, and -w2. Transfection of the SupT1 cell line
was performed by electroporation, and CA-p24 levels were determined as
described previously (13, 36).
In Vitro Transcription and RNA Dimerization--
pLAI, pLAI-s1,
-w1, and -w2 plasmids were used as template in a PCR reaction with
primers T7-2 (corresponding to position 1-18 of the HIV-1 genome with
an upstream T7 RNA promoter sequence) and
R:A368-A347 (complementary to 368-347 of the
HIV-1 genome). The PCR products were ethanol-precipitated and used for
in vitro transcription by T7 RNA polymerase with
[ -32P]dCTP according to the manufacturer's protocol
(MEGAshortscript T7 transcription kit, Ambion, Inc.).
Transcription reactions were stopped by addition of
formamide-containing loading buffer and applied to 5% denaturing
polyacrylamide gels. Gel slices containing the radiolabeled transcript
were excised and soaked in TBE buffer (90 mM Tris borate, 2 mM EDTA) overnight at room temperature to elute the RNA.
The RNA was ethanol-precipitated and dissolved in water. Equal amounts
of RNA were heat-denatured and slowly renatured in the presence of
dimerization buffer L (40 mM NaCl, 0.1 mM
MgCl2, 10 mM Tris-HCl, pH 7.5). Aliquots were
analyzed on polyacrylamide gels in 0.25 × TBE (22.5 mM Tris borate, 0.5 mM EDTA) and 0.25 × TBM (22.5 mM Tris borate, 0.1 mM
MgCl2), either with a formamide-containing buffer or
non-denaturing loading buffer. Gels were dried and applied to a Storm
PhosphoImager. We used the computer program ImageQuant 5.0 (Amersham
Biosciences) to quantify the RNA signals. The dimerization yield was
determined by dividing the amount of dimer by the total amount of RNA
(dimer plus monomer).
RNA Structure Probing--
pLAI and pLAI-s1 plasmids were used
as templates in a PCR reaction with primers T7-2 and TA015
(complementary to 442-462 of HIV-1 genome). The PCR products were
ethanol-precipitated and used for in vitro
transcription with the Ambion MEGAshortscript T7 transcription kit.
Transcripts were DNase I-treated, phenol-extracted, ethanol-precipitated, and dissolved in water. The RNA samples were
heat-denatured, followed by addition of sodium cacodylate (pH 7.0) and
MgCl2 to a final concentration of 100 and 1 mM.
The RNA (10 µg) was treated at room temperature with 2 µl of
kethoxal for 10 min, with 1 µl of dimethylsulfate (DMS) for 5 min, or
mock-treated. The reactions were stopped by addition of 50 µg of
Escherichia coli tRNA. The RNA was ethanol-precipitated and
dissolved in 22 µl of water, and 4 µl was used in a primer
extension assay with 5'-end-labeled oligonucleotide primers. Antisense
primers reverse poly(A) 104/77 (complementary to 77-104 of the HIV-1
genome), cn3 (complementary to position 133-161), lys21 (complementary to 182-202), R:G290-G270 (complementary to
270-290), R:A368-A347, and TA015 were
end-labeled with [ -32P]ATP and T4 polynucleotide
kinase. The kinase was inactivated at 80 °C for 10 min.
For a primer extension reaction, 2 ng of the labeled probe was heat
annealed to the RNA in 83 mM Tris-HCl (pH 7.5) and 125 mM KCl. Avian myeloblastoma virus reverse transcriptase
(RT, 5 units) was added in RT buffer to yield a mixture with 3 mM MgCl2, 10 mM dithiothreitol, 10 µM dNTP, and 50 µg/ml actinomycin D. The reactions were
incubated at 37 °C for 1 h and stopped by the
addition of 200 mM NaOH and an additional incubation of 20 min. The samples were ethanol-precipitated, dissolved in formamide
loading buffer, and applied to 10% polyacrylamide sequencing gels.
The products were visualized by a Storm PhosphoImager.
 |
RESULTS |
Identification of the U5-AUG Long Distance
Interaction--
Previous work by Huthoff and Berkhout (24) showed
that the HIV leader RNA is able to form two mutually exclusive
secondary structures. In the ground state structure, the leader RNA
adopts the LDI conformation that is based on an interaction between the poly(A) and DIS regions. In the presence of the viral NC protein, the
LDI conformation switches to the BMH conformation that presents the
poly(A) and DIS hairpins. Studies thus far have focused on transcripts
that comprise the 5'-terminal 290 nucleotides of the HIV-1 leader RNA.
In this study, we have analyzed the RNA folding of the complete 5'-UTR.
Using the MFold computer program, we identified a novel long distance
interaction that includes the start codon of the Gag ORF. This
base-pairing possibility occurs between nucleotides 105-115 in the U5
region and 334-344 surrounding the AUG initiation codon and is termed
the U5-AUG duplex. These two sequence elements are marked in the linear
presentation of the 5'-UTR and the LDI and BMH structures (Fig.
1A). The duplex consists of 11 consecutive base pairs, including four G-U base pairs (Fig.
1B). The MFold results indicate that formation of the U5-AUG
duplex occurs exclusively in BMH-like structures and not in the LDI
conformation (results not shown).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 1.
Overview of the HIV-1 5'-UTR
organization and structure of the wild-type and mutant U5-AUG
duplex. A, top, organization of the genomic
5'-UTR with the regulatory motifs is indicated by colored
boxes. The two segments that form the long distance base-pairing
interaction (U5-AUG duplex) are indicated in red. The Gag
initiation codon is marked by an asterisk.
Middle, traditional secondary structure model of the genomic
5'-UTR that highlights the hairpin structures and the regulatory motifs
(1). Bottom, the alternative LDI and BMH structures
of the genomic 5'-UTR. The U5 and AUG segments are single-stranded in
the BMH fold and are now proposed to form the U5-AUG duplex.
B-D, base pairing of the wild-type and mutant U5-AUG
duplexes. Nucleotide positions are indicated. Mutated nucleotides are
indicated in bold. The thermodynamic stability is indicated
at the right ( G in
kcal/mole).
|
|
To test for the presence of the U5-AUG duplex, we designed mutants that
either strengthen or weaken the base pairing interaction (Fig.
1C). The duplex is stabilized in the s1 mutant by
substitution of three G-U base pairs by one G-C and two A-U base pairs.
The duplex is destabilized in the w1 and w2 mutants by replacing the central C-G base pairs either by U-G base pairs or by A-G mismatches, respectively. We first set out to determine the dimerization properties of the wt and mutant transcripts on a non-denaturing gel. Radiolabeled transcripts of the genomic RNA (nts 1-368) were synthesized in vitro, incubated at RNA dimerization conditions, and analyzed on
gel (Fig. 2A). RNA monomers
and dimers were detected for all transcripts in TBE and TBM gels. The
most noticeable observation is that the s1 transcript with the
stabilized U5-AUG duplex migrates faster in TBM gels than the wt
transcript. Formamide-denatured samples were included as control
(indicated above the lanes), and the remarkable migration of the s1
transcript is lost upon denaturation. The s1 dimer also migrates faster
than the wt dimer in the TBE gels, but the fast migrating s1 monomer is
observed as a diffuse band. Apparently, Mg2+ in the gel is
required to stabilize the U5-AUG duplex in s1 monomers. The results of
two experiments were quantified to calculate the level of RNA
dimerization for the wt and mutant transcripts (Fig. 2B).
The TBM gel shows both dimer types (loose and tight dimers), whereas
only tight dimers are detected on TBE gels. The small difference in
dimerization efficiencies in TBE versus TBM gels is
therefore likely because of the presence of loose dimers on the latter
gel type. The mutant transcripts s1, w1, and w2 dimerize more
efficiently than the wt transcript, independent of the presence of
Mg2+. Apparently, all mutations in the U5 motif result in
elevated levels of RNA dimerization, which may be because of their
destabilizing effect on the LDI conformation.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2.
Gel electrophoresis of wild-type and mutant
U5-AUG duplex transcripts. A, migration of wild-type,
s1, w1, and w2 transcripts on non-denaturing TBE or TBM gels. RNA
monomers (M) and dimers (D) are indicated on the
left. The presence of denaturing formamide (F) in
the loading buffer is indicated above the lanes.
Arrows indicate the unusually fast migrating monomer and
dimer of the s1 transcript. B, dimerization yields for the
wt and mutant transcripts. The results are the average of two
experiments, and the standard deviation is indicated. The dimerization
yield was determined on TBE and TBM gels.
|
|
To test whether the fast migration of the s1 transcript is caused by
stabilization of the U5-AUG interaction, we created a set of double
mutants (Fig. 1D). The downstream segment 334-343 of the
U5-AUG duplex was substituted by sequences that disrupt or weaken base
pairing. The three central C-G base pairs were opened in the AUG3
mutant, and nearly all base pairs were disrupted in the AUG10 mutant.
The destabilizing mutations were introduced both in the wt and s1
mutant transcripts. The wt and mutant transcripts were subjected to
non-denaturing gel electrophoresis (Fig.
3A). Most importantly, opening
of the U5-AUG duplex in the s1-AUG3 and s1-AUG10 mutants corrects the
unusual migration of the s1 transcript. The AUG3 and -10 mutations have
no effect on the migration of the wt transcript. These results confirm
that formation of the U5-AUG duplex in transcript s1 induces a
conformation in the HIV-1 leader RNA that migrates relatively fast
during gel electrophoresis. We also quantified the dimerization
efficiencies of this set of mutants (Fig. 3B). The wt
transcript shows a moderate increase in dimerization efficiency upon
introduction of the AUG3 or -10 mutations (from 30 to 34% dimers). The
s1 transcript shows increased dimerization (60% dimers), and this
effect is countered by the AUG3 or -10 mutations (47% dimers). Thus,
the increased dimerization efficiency of the s1 transcript is caused,
at least partially, by stabilization of the U5-AUG duplex in the BMH
context.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 3.
Gel electrophoresis of the U5-AUG double
mutant transcripts. A, migration of wild-type and
mutant transcripts on a non-denaturing TBM gel. See Fig. 2 legend for
further details. B, dimerization yields for the wild-type
and mutant transcripts. The dimerization yield for each transcript was
determined as in Fig. 2. The results of one representative experiment
were quantified.
|
|
New HIV-1 RNA Structure Models for the Full-length 5'-UTR--
We
next set out to determine the secondary structure of the wt and s1
mutant transcript (1-462) by RNA structure probing. Because the fast
migrating s1 structure was only visible in the presence of
Mg2+ (Fig. 2), the transcripts were heat-denatured and
refolded in the presence of Mg2+. The transcripts were
treated with limiting amounts of kethoxal or DMS and
subsequently used as template for reverse transcription with several
antisense DNA primers. The cDNA products were analyzed by
denaturing gel electrophoresis. The complete set of probing data is
listed in Table I. To facilitate the
discussion of this complex data set, we will first present the new
secondary structure models in Fig. 4. The
wt RNA is folded in the ground state LDI conformation, in which the
poly(A) and DIS regions (marked orange and pink)
are base paired in a long distance interaction that extends the stem of
the PBS domain. The downstream region 282-352 folds an extended
stem-loop structure with three internal loops and a GGAG loop (marked
yellow). The top of this extended hairpin is, in fact, the
previously described or SL3 hairpin that is required for viral RNA
packaging (37). We termed the extended hairpin E. The SD
site (marked gray) is located within an internal loop of
E. The Gag initiation codon (marked by an
asterisk) is located in the central internal loop and the
adjacent stem segment of E. The downstream Gag sequences
(nts 358-367) are possibly engaged in long distance base pairing with
nucleotides 60-67 in the R region directly downstream of TAR. This
interaction is termed the R-Gag duplex. In contrast, the s1 mutant RNA
folds the BMH structure that exposes both the poly(A) and DIS hairpins.
The downstream sequences in s1 RNA fold the SD hairpin and the short version of the hairpin, and the leader domain is closed by the U5-AUG duplex (105-115 pairs with 334-344).
View this table:
[in this window]
[in a new window]
|
Table I
Secondary structure probing of the wt and s1 mutant leader RNA
Reactivity of wt and s1 RNA to kethoxal (G-specific) and DMS (A- and
C-specific) were estimated and classified into five categories: +++ = highly reactive, ++ = reactive, + = moderately reactive, +/ = marginally reactive, = not reactive. The sequences that constitute
the U5-AUG duplex are indicated by outlined boxes and the Gag
initiation codon is indicated in bold. The sequence substitutions in
the s1 RNA are indicated in italics. s indicates reverse transcription
stops.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
The extended LDI and BMH structure models of
the complete HIV-1 5'-UTR. The models are based primarily on the
RNA structure probing data that are presented in detail in Table I and
Fig. 5. The regulatory motifs are marked in colors as in
Fig. 1A. The two segments of the U5-AUG duplex are presented
in a red-outlined box, and the Gag initiation codon is
marked by an asterisk. Overall, the percentage of
single-stranded nucleotides in the BMH conformation is similar to that
of the LDI conformation (39%).
|
|
The structures shown in Fig. 4 are consistent with the MFold analyses.
The LDI conformation with the extended PBS stem and the extended
E hairpin is the most stable structure adopted by the wt
RNA. The BMH folding with the multiple hairpins (poly(A), DIS, SD, and short ) and the novel U5-AUG duplex is the most stable structure adopted by s1 RNA. Apparently, the metastable BMH folding is
facilitated by stabilization of the U5-AUG interaction. We previously
demonstrated that the BMH fold can also be triggered by stabilization
of the poly(A) or the DIS hairpin (24). Few leader RNA motifs do not change their structure during the LDI to BMH switch: the TAR hairpin (nts 1-57, marked green), the upper primer activation
signal/primer binding site domain (nts 116-239, marked
lilac and blue), and the short hairpin (nts
305-331, marked yellow). The constitutive folding of
the TAR and PBS domains in the LDI and BMH structures was described
previously (24). Apparently, these structures fold autonomously,
suggesting that their biological function is independent of the LDI/BMH switch.
Structure Probing--
The structure probing data of the wt and s1
RNA are presented to highlight the differences between the LDI and BMH
structures. There are three regions that differ significantly in
accessibility to the single strand-specific reagents kethoxal and DMS
in the two transcripts. The first region is segment 105-115 of the
U5-AUG duplex in which the s1 mutations were introduced (Fig.
5A). G106 and
G108 are accessible to kethoxal in
the wt transcript, whereas G106 and A108 are
not sensitive to kethoxal and DMS in the s1 transcript. Apparently, these nucleotides are base-paired in the s1 transcript. Interestingly, the control primer extension reaction yields two major stop products on
the s1 RNA template at position U118 and U120
(marked s in Table I). Because the wt transcript has an
identical sequence, it is likely that the RT enzyme is stopped by a
structure that is specific for the s1 template. Apparently, the RT
enzyme stopped three and five nucleotides before reaching the U5-AUG duplex. The second region that shows differential s1-wt reactivity concerns the sequences flanking the Gag initiation codon (Fig. 5B). Purines 332-336 are exclusively accessible to kethoxal
and DMS in the wt transcript, indicating that these nucleotides are single-stranded. The third region that exhibits major probing differences is domain 235-242 (Fig. 5C). This sequence is
completely sensitive to kethoxal and DMS in the s1 transcript, whereas
it is only partially sensitive in the wt transcript. Together, these results support the folding of the U5-AUG interaction in the s1 mutant
transcript. As a result, nucleotides 240-242 become single-stranded exclusively in the BMH fold of the s1 transcript (Figs. 4 and 5C). These nucleotides are paired to nucleotides 113-115 in
the LDI conformation of the wt transcript.


View larger version (87K):
[in this window]
[in a new window]
|
Fig. 5.
RNA structure probing data for the wt and s1
transcripts. Each gel segment shows the primer extension products
of wt and s1 transcripts after mock treatment ( ) or treatment with
limiting amounts of the G-specific reagent kethoxal (K) and
the A/C-specific chemical DMS (D). The relevant parts of the
LDI and BMH structure are shown on the left and
right, respectively. Nucleotide positions that are discussed
in the text are indicated. The s1 mutations are indicated by
arrows. A, nts 92-124. B, nts
322-338. C, nts 209-241. D, nts 53-90.
E, nts 253-282.
|
|
The poly(A) and DIS regions also react differently in the wt and
s1 transcripts (Fig. 5D). All five A residues of the poly(A) signal 73AAUAAA78 are equally accessible to DMS
in the wt transcript, confirming that the poly(A) signal is
single-stranded as in the LDI structure. In contrast,
73AA74 is less exposed to DMS than
76AAA78 in the s1 transcript, indicating that
the poly(A) hairpin of the BMH conformation is formed. We previously
used this differential reactivity within the poly(A) signal to
differentiate between the LDI and BMH structures (24). Several
nucleotides in the DIS region (264 and 274-276) are more exposed in wt
RNA compared with s1 RNA, confirming the LDI fold of wt RNA (Fig.
5E). In contrast, A263 is exclusively
DMS-sensitive in the s1 transcript, consistent with the folding of the
DIS hairpin in the BMH structure. These combined results confirm that
the wt transcript adopts the LDI conformation as the ground state
structure and the s1 mutations force the RNA into the alternative BMH fold.
Slight differences in reactivity between the two transcripts are also
observed for positions 66-68, 274-305, and 356 (Table I). For
instance, G290 and G292 are more reactive and
G298 is less reactive in s1 RNA. These differences led to
the proposed folding of the SD hairpin in the BMH structure and the
E hairpin and R-Gag duplex in the LDI conformation (Fig.
4). The nucleotides in the bottom stem segment of E and
in the R-Gag duplex are moderately accessible to kethoxal/DMS (Table
I), suggesting that these RNA structures are metastable.
Phylogenetic Analysis of U5-AUG Duplex--
We have shown
that the s1 mutant folds the U5-AUG duplex as part of the BMH fold. The
U5-AUG interaction is not present in the LDI fold, which is the most
stable structure of the wt leader RNA. It proved difficult to formally
demonstrate that the U5-AUG duplex will be formed in the wt leader once
the RNA switches into the BMH structure because the LDI conformation is
strongly favored. We therefore performed an extensive phylogenetic
analysis of leader sequences of other lentiviruses to provide further
evidence for the U5-AUG interaction in the form of base pair
co-variations (Fig. 6). This survey
presents convincing evidence for the proposed long distance base
pairing. For instance, the closing base pair U-A is replaced by C-G in
the HIV-1 isolate from the N (new) group. The U5-AUG duplex is also
conserved in the more distantly related simian immunodeficiency viruses
(SIV) and HIV-2 lentiviruses. It is not surprising that the AUG start
codon is absolutely conserved, but we identified numerous sequence
changes in the nucleotides that flank the start codon. These changes
are compensated by complementary changes in the upstream U5 sequences.
For instance, the U5-AUG duplex in SIVl'Hoest shows five
co-variations, two of which affect the Gag ORF. Despite all sequence
variations, it is remarkable that the stability of the U5-AUG
interaction is kept within certain limits, ranging from 10 to 13 base
pairs. Because the U5-AUG duplex is present exclusively in the BMH
structure, major changes in its stability will have a direct impact on
the LDI-BMH equilibrium. This requirement may explain the conservation
of the U5-AUG duplex stability, exactly as was described for other
leader RNA structures such as the poly(A) hairpin (38, 39). In summary,
the phylogenetic data indicate that U5-AUG base pairing, but not the
actual nucleotide sequence, is conserved among primate lentiviruses.
The combined results support a function for this long distance
interaction in the viral replication cycle. To directly test
this, we performed replication experiments with the wt and w2-mutated
viruses. One representative replication curve in the SupT1 cell line is
shown in Fig. 7. This result indicates
that preventing the formation of the U5-AUG duplex leads to a
significant replication defect. Studies are ongoing to further analyze
these mutant viruses and select for phenotypic revertants.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 6.
Phylogenetic analysis of the U5-AUG duplex in
primate lentiviruses. The U5-AUG duplex is shown for different
HIV-1 subtypes, HIV-2, and all SIV lineages. Nucleotide positions are
indicated for each duplex. The HIV-1 LAI isolate is shown on
top as the prototype. Nucleotide changes in the other
HIV-SIV isolates are marked in bold when they conserve the
base-pairing potential. This includes semi-co-variations
(e.g. A-U to G-U) and true co-variations
(e.g. A-U to G-C).
Asterisks indicate the Gag initiation codon.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 7.
The w2-mutated virus has a significant
replication defect. The SupT1 cell line was transfected with 1 µg of the wt and w2 proviral construct. CA-p24 production was
measured in the culture medium at several days post-transfection.
|
|
 |
DISCUSSION |
We analyzed the secondary structure of the complete 5'-UTR
of the HIV-1 genomic RNA (nts 1-368). Previous studies on the
5'-terminal 290-nucleotide fragment indicate that the 5'-UTR is able to
adopt two mutually exclusive structures, LDI and BMH. This study
reveals that the complete 5'-UTR also folds these alternative
conformations. The 3'-terminal 290-368 segment contributes differently
to the LDI and BMH structures. In the context of the ground state LDI conformation, these sequences fold the well known hairpin, but in a
significantly extended form. This E hairpin includes the
SD signal and the Gag start codon. The internal loops of this
E hairpin are remarkably symmetrical and purine-rich;
only a single U and no C residues are present among the 29 single-stranded nucleotides. Different extended forms of the hairpin have been described (19, 37, 40-42). These alternative
conformations are not confirmed by our RNA structure probing results
with the full-length 5'-UTR. It is clear from our study that the lower
half of the E hairpin cannot be too rigid because it has
to melt to allow the formation of the SD hairpin and the U5-AUG duplex
in the BMH context. The LDI conformation of the complete 5'-UTR also
contains a long distance base-pairing interaction between sequences in
the Gag ORF and the R region immediately downstream of TAR (R-Gag
duplex). Studies are in progress to verify the presence of this duplex and its role in HIV-1 biology.
In the metastable BMH conformation, the lower part of E
is opened to allow the formation of the S.D. hairpin that flanks the short version of the hairpin. Furthermore, the downstream Gag sequences are also free to engage in alternative base pairing to form
the long distance interaction with upstream U5 sequences: the U5-AUG
duplex. In fact, formation of the U5-AUG duplex creates a base-pairing
partner for the single-stranded U5 region between the poly(A) hairpin
and the PBS domain that thus far could not be paired with other
sequences in the HIV-1 RNA genome. Former studies suggested that the
Gag initiation codon is located in the bottom stem of a bulged hairpin
(1, 43). This folding was based on Mfold and probing studies of
incomplete leader sequences that lack nucleotides 105-115 that are
necessary to form the U5-AUG interaction. The U5-AUG duplex closes a
domain with multiple hairpins (PBS, DIS, S.D., and ) that are
separated by a purine-rich ring structure with A9,
G7, C1, and U0. The bulges and
internal loops of several of the hairpin motifs (DIS, SD, and ) are
also purine-rich with A5, G4, C0,
and U0. The probing results of the complete 5'-UTR clearly
indicate that the multiple purines of the ring are single-stranded. An
extended format of the DIS hairpin has recently been proposed based on
nuclear magnetic resonance analysis of a small RNA fragment (44). Such
a DIS extension will, at least partially, close the ring structure that
we propose. However, the DIS extension is not confirmed by our probing
data, and the proposed base pairing is not supported by base pair
co-variations in different viral isolates. In fact, several isolates
including our LAI strain contain sequence variations that do not allow
this DIS extension. The function of the open purine ring will be tested
in future studies.
The U5-AUG duplex was analyzed by experimental and theoretical
approaches. The duplex was strengthened in the s1 variant by mutations
in the U5 domain. Probing experiments showed that s1 RNA folds the BMH
conformation with the U5-AUG duplex. The wt transcript folds the LDI
conformation that was originally discovered because it migrates fast on
non-denaturing gels compared with the BMH conformation (45).
Strikingly, the s1 transcript migrates even faster, suggesting that the
BMH structure is compacted by closing of the U5-AUG duplex. It will be
of interest to test whether this potentially compact RNA fold is
suitable for x-ray studies. Strengthening of the U5-AUG duplex shifts
the equilibrium from LDI to the BMH conformation. Previous work showed
that such a shift usually coincides with an increased RNA dimerization
capacity (24, 46, 47). Indeed, the s1 transcript dimerizes more
efficiently than wt RNA, and this effect was neutralized by mutations
in the Gag region that weaken the U5-AUG duplex.
Phylogenetic analyses of the 5'-UTR sequences of all known types of HIV
and SIV revealed that a similar U5-AUG duplex can be formed despite
considerable divergence in the sequence of the U5 and AUG segments.
Many base pair co-variations were observed, providing evidence for the
existence and biological importance of this structural motif. Because
the U5-AUG duplex occludes the Gag initiation codon, it is possible
that this interaction influences the translation of the Gag protein. It
has been shown that the HIV-1 5'-UTR can function as an internal
ribosomal entry site (IRES).2
Nevertheless, the 5'-UTR of different viral isolates exclude upstream
AUG triplets (1), which is consistent with a regular scanning mechanism
of translation. It is therefore possible that translation of the
genomic HIV-1 RNA proceeds both by scanning and by internal initiation.
The translational mode may differ with the stage of infection or on
spliced versus unspliced RNA. We previously speculated that
NC may shift the 5'-UTR conformation from LDI to BMH late in the
infection process. This could coincide with a switch in the mechanism
of translation, from scanning to internal initiation or vice
versa. In the former scenario, the BMH conformation and the U5-AUG
duplex may be important structures for the proposed IRES function.
Certain features of the BMH structure do in fact resemble the IRES
element of the pestiviral RNA genome, which was recently shown to be
critically dependent on clustered single-stranded adenosines within
this structured RNA motif (48). More strikingly, polypurine A-rich
sequences were also shown to exhibit IRES activity (49), and we
observed the abundance of single-stranded purines and especially
adenosines in the ring structure that is formed by closure of the
U5-AUG duplex. There is also accumulating evidence that unpaired
adenosine residues can dock into the minor groove of a receptor helix,
and this A-minor motif appears a very important element for the
acquisition of global RNA architecture (49). Thus, the destiny
of the HIV-1 genomic RNA: the ribosome or the virion (50) may be
regulated by structural changes in the leader RNA, similar to
mechanisms that have been described for the cauliflower mosaic virus
(51, 52). Translation studies are in progress to test these intriguing possibilities.
Another role for the U5-AUG duplex may reside in RNA packaging, because
this long distance interaction has a major impact on the structural
presentation of the leader RNA sequences that are involved in RNA
packaging. The U5-AUG duplex can form exclusively in the genomic HIV-1
RNA that includes the Gag region and not in the multiple subgenomic
forms of HIV-1 RNA. Thus, this structure may contribute to specific
packaging of the full-length genomic RNA into new virus particles.
Interestingly, previous work showed that deletion of the upstream
sequences of the U5-AUG duplex (nts 98-126) induces an RNA packaging
defect (53). Gag- and NC-binding sites on the HIV-1 RNA have been
mapped to a segment of ~120 nucleotides that includes the DIS, SD,
and hairpins and sequences of the Gag ORF (37, 43, 54-56). Most of
these studies used relatively small fragments of the 5'-UTR that cannot
fold the LDI conformation, and these RNAs will constitutively fold the
multiple hairpins of the alternative BMH structure. However, binding of
Gag/NC to the full-length 5'-UTR may depend on formation of the U5-AUG
duplex and the concomitant LDI to BMH switch. RNA packaging studies
with mutant viruses are severely hampered by the fact that the 5'-UTR encodes many overlapping regulatory signals that cannot be studied independently (57). For instance, alterations in the DIS region affect
RNA dimerization but also result in an RNA packaging defect (58-60).
Likewise, mutation of the Gag initiation codon in an HIV-1-based vector
was shown to result in very low levels of intracellular genomic RNA,
which consequently results in reduced RNA packaging (61). In general,
many indirect effects can be expected from mutations that influence the
overall folding of the HIV-1 5'-UTR, and such side effects do severely
complicate the description of discrete RNA motifs like the packaging
signal. In vitro studies with short RNA fragments will
certainly miss some of the important features of the HIV-1 5'-UTR
because the proper secondary and tertiary RNA structure is not formed.
 |
ACKNOWLEDGEMENTS |
We thank Hendrik Huthoff for critical reading
of the manuscript and Wim van Est for the artwork.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Human
Retrovirology, Academic Medical Center, University of Amsterdam, P.O.
Box 22700, 1100 DE Amsterdam, The Netherlands. Tel.:
31-20-5664822; Fax: 31-20-6916531; E-mail:
b.berkhout@amc.uva.nl; Web address: www.berkhoutlab.com.
Published, JBC Papers in Press, November 27, 2002, DOI 10.1074/jbc.M210291200
2
Brasey, A., Lopez-Lastra, M., Ohlmann, T.,
Beerens, N., Berkhout, B., Darlix, J., and Sonenberg, N. (2003)
J. Virol., in press.
 |
ABBREVIATIONS |
The abbreviations used are:
HIV-1, human
immunodeficiency virus type I;
5'-UTR, 5'-untranslated region;
nts, nucleotides;
LDI, long distance interaction;
BMH, branched multiple
hairpin;
DIS, dimer initiation signal;
R, repeat;
TAR, transactivation
region;
poly(A), polyadenylation;
PAS, primer activation signal;
PBS, primer binding site;
SD, splice donor;
NC, nucleocapsid;
ORF, open
reading frame;
DMS, dimethylsulfate;
RT, reverse transcriptase,
wt, wild-type;
SIV, simian immunodeficiency virus.
 |
REFERENCES |
| 1.
|
Berkhout, B.
(1996)
Progr. Nucleic Acid Res. Mol. Biol.
54,
1-34[Medline]
[Order article via Infotrieve]
|
| 2.
|
Puglisi, J. D.,
Tan, R.,
Calnan, B. J.,
Frankel, A. D.,
and Williamson, J. R.
(1992)
Science
257,
76-80[Abstract/Free Full Text]
|
| 3.
|
Aboul-ela, F.,
Karn, J.,
and Varani, G.
(1995)
J. Mol. Biol.
253,
313-332[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Aboul-ela, F.,
Karn, J.,
and Varani, G.
(1996)
Nucleic Acids Res.
24,
3974-3981[Abstract/Free Full Text]
|
| 5.
|
Ippolito, J. A.,
and Steitz, T. A.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9819-9824[Abstract/Free Full Text]
|
| 6.
|
Berkhout, B.
(1992)
Nucleic Acids Res.
20,
27-31[Abstract/Free Full Text]
|
| 7.
|
Klaver, B.,
and Berkhout, B.
(1994)
EMBO J.
13,
2650-2659[Medline]
[Order article via Infotrieve]
|
| 8.
|
Dingwall, C.,
Ernberg, I.,
Gait, M. J.,
Green, S. M.,
Heaphy, S.,
Karn, J.,
Lowe, A. D.,
Singh, M.,
Skinner, M. A.,
and Valerio, R.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
6925-6929[Abstract/Free Full Text]
|
| 9.
|
Wei, P.,
Garber, M. E.,
Fang, S.-M.,
Fisher, W. H.,
and Jones, K. A.
(1998)
Cell
92,
451-462[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Berkhout, B.,
Silverman, R. H.,
and Jeang, K. T.
(1989)
Cell
59,
273-282[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Klasens, B. I. F.,
Das, A. T.,
and Berkhout, B.
(1998)
Nucleic Acids Res.
26,
1870-1876[Abstract/Free Full Text]
|
| 12.
|
Klasens, B. I. F.,
Thiesen, M.,
Virtanen, A.,
and Berkhout, B.
(1999)
Nucleic Acids Res.
27,
446-454[Abstract/Free Full Text]
|
| 13.
|
Beerens, N.,
Groot, F.,
and Berkhout, B.
(2001)
J. Biol. Chem.
276,
31247-31256[Abstract/Free Full Text]
|
| 14.
|
Beerens, N.,
and Berkhout, B.
(2002)
J. Virol.
76,
2329-2339[Abstract/Free Full Text]
|
| 15.
|
Laughrea, M.,
and Jette, L.
(1994)
Biochemistry
33,
13464-13474[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Lever, A.,
Gottlinger, H.,
Haseltine, W.,
and Sodroski, J.
(1989)
J. Virol.
63,
4085-4087[Abstract/Free Full Text]
|
| 17.
|
Aldovini, A.,
and Young, R. A.
(1990)
J. Virol.
64,
1920-1926[Abstract/Free Full Text]
|
| 18.
|
Harrison, G. P.,
and Lever, A. M. L.
(1992)
J. Virol.
66,
4144-4153[Abstract/Free Full Text]
|
| 19.
|
Baudin, F.,
Marquet, R.,
Isel, C.,
Darlix, J. L.,
Ehresmann, B.,
and Ehresmann, C.
(1993)
J. Mol. Biol.
229,
382-397[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Clavel, F.,
and Orenstein, J. M.
(1990)
J. Virol.
64,
5230-5234[Abstract/Free Full Text]
|
| 21.
|
Purcell, D. F. J.,
and Martin, M. A.
(1993)
J. Virol.
67,
6365-6378[Abstract/Free Full Text]
|
| 22.
|
O'Reilly, M. M.,
McNally, M. T.,
and Beemon, K. L.
(1995)
Virology
213,
373-385[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Kerwood, D. J.,
Cavaluzzi, M. J.,
and Borer, P. N.
(2001)
Biochemistry
40,
14518-14529[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Huthoff, H.,
and Berkhout, B.
(2001)
RNA
7,
143-157[Abstract] (N. Y.)
|
| 25.
|
Skripkin, E.,
Paillart, J. C.,
Marquet, R.,
Ehresmann, B.,
and Ehresmann, C.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4945-4949[Abstract/Free Full Text]
|
| 26.
|
Paillart, J. C.,
Marquet, R.,
Skripkin, E.,
Ehresmann, B.,
and Ehresmann, C.
(1994)
J. Biol. Chem.
269,
27486-27493[Abstract/Free Full Text]
|
| 27.
|
Muriaux, D.,
Girard, P.-M.,
Bonnet-Mathoniere, B.,
and Paoletti, J.
(1995)
J. Biol. Chem.
270,
8209-8216[Abstract/Free Full Text]
|
| 28.
|
Clever, J. L.,
Wong, M. L.,
and Parslow, T. G.
(1996)
J. Virol.
70,
5902-5908[Abstract]
|
| 29.
|
Haddrick, M.,
Lear, A. L.,
Cann, A. J.,
and Heaphy, S.
(1996)
J. Mol. Biol.
259,
58-68[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Laughrea, M.,
and Jette, L.
(1996)
Biochemistry
35,
9366-9374[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Muriaux, D.,
Fosse, P.,
and Paoletti, J.
(1996)
Biochemistry
35,
5075-5082[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Mathews, D. H.,
Sabina, J.,
Zuker, M.,
and Turner, D. H.
(1999)
J. Mol. Biol.
288,
911-940[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Zuker, M.,
and Turner, D. H.
(1999)
in
Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide
(Barciszewski, J.
, and Clark, B. F. C., eds)
, pp. 11-43, Kluwer Academic Publishers, Dordrecht/Boston/London
|
| 34.
|
Klaver, B.,
and Berkhout, B.
(1994)
J. Virol.
68,
3830-3840[Abstract/Free Full Text]
|
| 35.
|
Berkhout, B.,
van Wamel, J.,
and Klaver, B.
(1995)
J. Mol. Biol.
252,
59-69[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Back, N. K. T.,
Nijhuis, M.,
Keulen, W.,
Boucher, C. A. B.,
Oude Essink, B. B.,
van Kuilenburg, A. B. P.,
Van Gennip, A. H.,
and Berkhout, B.
(1996)
EMBO J.
15,
4040-4049[Medline]
[Order article via Infotrieve]
|
| 37.
|
Zeffman, A.,
Hassard, S.,
Varani, G.,
and Lever, A.
(2000)
J. Mol. Biol.
297,
877-893[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Das, A. T.,
Klaver, B.,
Klasens, B. I. F.,
van Wamel, J. L. B.,
and Berkhout, B.
(1997)
J. Virol.
71,
2346-2356[Abstract]
|
| 39.
|
Berkhout, B.,
Klaver, B.,
and Das, A. T.
(1997)
Nucleic Acids Res.
25,
940-947[Abstract/Free Full Text]
|
| 40.
|
Hayashi, T.,
Shioda, T.,
Iwakura, Y.,
and Shibuta, H.
(1992)
Virology
188,
590-599[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Hayashi, T.,
Ueno, Y.,
and Okamoto, T.
(1993)
FEBS Lett.
327,
213-218[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Huynen, M. A.,
Perelson, A.,
Vieira, W. A.,
and Stadler, P. F.
(1996)
J. Comput. Biol.
3,
253-274[Medline]
[Order article via Infotrieve]
|
| 43.
|
Clever, J.,
Sassetti, C.,
and Parslow, T. G.
(1995)
J. Virol.
69,
2101-2109[Abstract]
|
| 44.
|
Greatorex, J.,
Gallego, J.,
Varani, G.,
and Lever, A.
(2002)
J. Mol. Biol.
322,
543[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Berkhout, B.,
and van Wamel, J. L. B.
(2000)
RNA (N. Y.)
6,
282-295
|
| 46.
|
Huthoff, H.,
and Berkhout, B.
(2001)
Nucleic Acids Res.
29,
2594-2600[Abstract/Free Full Text]
|
| 47.
|
Huthoff, H.,
and Berkhout, B.
(2002)
Biochemistry
41,
10439-10445[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Fletcher, S. P.,
and Jackson, R. J.
(2002)
J. Virol.
76,
5024-5033[Abstract/Free Full Text]
|
| 49.
|
Doherty, E. A.,
Batey, R. T.,
Masquida, B.,
and Doudna, J. A.
(2001)
Nat. Struct. Biol.
8,
339-343[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Butsch, M.,
and Boris-Lawrie, K.
(2002)
J. Virol.
76,
3089-3094[Free Full Text]
|
| 51.
|
Hemmings-Mieszczak, M.,
Steger, G.,
and Hohn, T.
(1998)
RNA (N. Y.)
4,
101-111
|
| 52.
|
Hemmings-Mieszczak, M.,
Steger, G.,
and Hohn, T.
(1997)
J. Mol. Biol.
267,
1075-1088[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Vicenzi, E.,
Dimitrov, D. S.,
Engelman, A.,
Migone, T.-S.,
Purcell, D. F. J.,
Leonard, J.,
Englund, G.,
and Martin, M. A.
(1994)
J. Virol.
68,
7879-7890[Abstract/Free Full Text]
|
| 54.
|
Damgaard, C. K.,
Dyhr-Mikkelsen, H.,
and Kjems, J.
(1998)
Nucleic Acids Res.
26,
3667-3676[Abstract/Free Full Text]
|
| 55.
|
Amarasinghe, G. K.,
Zhou, J.,
Miskimon, M.,
Chancellor, K. J.,
McDonald, J. A.,
Matthews, A. G.,
Miller, R. R.,
Rouse, M. D.,
and Summers, M. F.
(2001)
J. Mol. Biol.
314,
961-970[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Amarasinghe, G. K.,
De Guzman, R. N.,
Turner, R. B.,
Chancellor, K. J.,
Wu, Z. R.,
and Summers, M. F.
(2000)
J. Mol. Biol.
301,
491-511[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Berkhout, B.
(2000)
Adv. Pharmacol.
48,
29-73[Medline]
[Order article via Infotrieve]
|
| 58.
|
Berkhout, B.,
and van Wamel, J. L. B.
(1996)
J. Virol.
70,
6723-6732[Abstract/Free Full Text]
|
| 59.
|
Paillart, J.-C.,
Berthoux, L.,
Ottmann, M.,
Darlix, J.-L.,
Marquet, R.,
Ehresmann, B.,
and Ehresmann, C.
(1996)
J. Virol.
70,
8348-8354[Abstract]
|
| 60.
|
Clever, J. L.,
and Parslow, T. G.
(1997)
J. Virol.
71,
3407-3414[Abstract]
|
| 61.
|
Richardson, J. H.,
Child, L. A.,
and Lever, A. M. L.
(1993)
J. Virol.
67,
3997-4005[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Q. Wang, I. Barr, F. Guo, and C. Lee
Evidence of a novel RNA secondary structurein the coding region of HIV-1 pol gene
RNA,
December 1, 2008;
14(12):
2478 - 2488.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Kenyon, A. Ghazawi, W. K.S. Cheung, P. S. Phillip, T. A. Rizvi, and A. M.L. Lever
The secondary structure of the 5' end of the FIV genome reveals a long-range interaction between R/U5 and gag sequences, and a large, stable stem-loop
RNA,
December 1, 2008;
14(12):
2597 - 2608.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Vrolijk, M. Ooms, A. Harwig, A. T. Das, and B. Berkhout
Destabilization of the TAR hairpin affects the structure and function of the HIV-1 leader RNA
Nucleic Acids Res.,
August 1, 2008;
36(13):
4352 - 4363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. James and B. Sargueil
RNA secondary structure of the feline immunodeficiency virus 5'UTR and Gag coding region
Nucleic Acids Res.,
August 1, 2008;
36(14):
4653 - 4666.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. M. Abbink and B. Berkhout
RNA Structure Modulates Splicing Efficiency at the Human Immunodeficiency Virus Type 1 Major Splice Donor
J. Virol.,
March 15, 2008;
82(6):
3090 - 3098.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. T. Baig, J.-M. Lanchy, and J. S. Lodmell
HIV-2 RNA dimerization is regulated by intramolecular interactions in vitro
RNA,
August 1, 2007;
13(8):
1341 - 1354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-i. Sakuragi, S. Sakuragi, and T. Shioda
Minimal Region Sufficient for Genome Dimerization in the Human Immunodeficiency Virus Type 1 Virion and Its Potential Roles in the Early Stages of Viral Replication
J. Virol.,
August 1, 2007;
81(15):
7985 - 7992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, D. Cupac, T. E. M. Abbink, H. Huthoff, and B. Berkhout
The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation
Nucleic Acids Res.,
March 12, 2007;
35(5):
1649 - 1659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Bjarnadottir, B. Gudmundsson, J. Gudnason, and J. J. Jonsson
Encapsidation Determinants Located Downstream of the Major Splice Donor in the Maedi-Visna Virus Leader Region
J. Virol.,
December 1, 2006;
80(23):
11743 - 11755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Nikolaitchik, T. D. Rhodes, D. Ott, and W.-S. Hu
Effects of Mutations in the Human Immunodeficiency Virus Type 1 gag Gene on RNA Packaging and Recombination.
J. Virol.,
May 1, 2006;
80(10):
4691 - 4697.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Kasprzak, E. Bindewald, and B. A. Shapiro
Structural polymorphism of the HIV-1 leader region explored by computational methods
Nucleic Acids Res.,
December 20, 2005;
33(22):
7151 - 7163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Buxton, G. Tachedjian, and J. Mak
Analysis of the Contribution of Reverse Transcriptase and Integrase Proteins to Retroviral RNA Dimer Conformation
J. Virol.,
May 15, 2005;
79(10):
6338 - 6348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Roldan, O. U. Warren, R. S. Russell, C. Liang, and M. A. Wainberg
A HIV-1 Minimal Gag Protein Is Superior to Nucleocapsid at in Vitro Annealing and Exhibits Multimerization-induced Inhibition of Reverse Transcription
J. Biol. Chem.,
April 29, 2005;
280(17):
17488 - 17496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Paillart, M. Dettenhofer, X.-f. Yu, C. Ehresmann, B. Ehresmann, and R. Marquet
First Snapshots of the HIV-1 RNA Structure in Infected Cells and in Virions
J. Biol. Chem.,
November 12, 2004;
279(46):
48397 - 48403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Beriault, J.-F. Clement, K. Levesque, C. LeBel, X. Yong, B. Chabot, E. A. Cohen, A. W. Cochrane, W. F. C. Rigby, and A. J. Mouland
A Late Role for the Association of hnRNP A2 with the HIV-1 hnRNP A2 Response Elements in Genomic RNA, Gag, and Vpr Localization
J. Biol. Chem.,
October 15, 2004;
279(42):
44141 - 44153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, H. Huthoff, R. Russell, C. Liang, and B. Berkhout
A Riboswitch Regulates RNA Dimerization and Packaging in Human Immunodeficiency Virus Type 1 Virions
J. Virol.,
October 1, 2004;
78(19):
10814 - 10819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Roldan, R. S. Russell, B. Marchand, M. Gotte, C. Liang, and M. A. Wainberg
In Vitro Identification and Characterization of an Early Complex Linking HIV-1 Genomic RNA Recognition and Pr55Gag Multimerization
J. Biol. Chem.,
September 17, 2004;
279(38):
39886 - 39894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, K. Verhoef, E. Southern, H. Huthoff, and B. Berkhout
Probing alternative foldings of the HIV-1 leader RNA by antisense oligonucleotide scanning arrays
Nucleic Acids Res.,
February 3, 2004;
32(2):
819 - 827.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Russell, A. Roldan, M. Detorio, J. Hu, M. A. Wainberg, and C. Liang
Effects of a Single Amino Acid Substitution within the p2 Region of Human Immunodeficiency Virus Type 1 on Packaging of Spliced Viral RNA
J. Virol.,
December 15, 2003;
77(24):
12986 - 12995.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gallego, J. Greatorex, H. Zhang, B. Yang, S. Arunachalam, J. Fang, J. Seamons, S. Lea, R. J. Pomerantz, and A. M. L. Lever
Rev Binds Specifically to a Purine Loop in the SL1 Region of the HIV-1 Leader RNA
J. Biol. Chem.,
October 10, 2003;
278(41):
40385 - 40391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-M. LANCHY, J. D. IVANOVITCH, and J. S. LODMELL
A structural linkage between the dimerization and encapsidation signals in HIV-2 leader RNA
RNA,
August 1, 2003;
9(8):
1007 - 1018.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|