![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 13, 11676-11685, March 28, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Departments of
Received for publication, September 18, 2002, and in revised form, January 12, 2003
The transcriptional activity of estrogen
receptor- The eukaryotic genome is compacted with histone and other proteins
to form chromatin, which consists of repeating units of nucleosome (1,
2). Formation of nucleosomes and higher order chromatin structures can
render the DNA inaccessible to transcription factors and complexes. For
transcription factors to access DNA, the repressive chromatin structure
needs to be remodeled. Dynamic alterations in the chromatin structure
can facilitate or suppress the access of the transcription factors to
nucleosomal DNA, leading to transcriptional regulation. One way to
achieve this is through alterations in chromatin remodeling factors or
in the acetylation state of nucleosomal histones (3-5). Acetylation of
core histones occurs at lysine residues on the N-terminal tails of the
histones, thus neutralizing the positive charge of the histone tails
and decreasing their affinity for DNA. Hyperacetylated chromatin is generally associated with transcription activation, whereas
hypoacetylated chromatin is associated with transcription repression
(3-6).
A number of recent studies have raised the possibility of a close
connection between HDACs1 and
cancer. Because HDAC-mediated deacetylation of nucleosomal histones is
known to be associated with transcriptional repression of some genes,
it is being proposed that the deregulation of recruitment of
HDAC-containing repressor complex to specific target promoters could
serve as a potential mechanism by which these enzymes contribute to
tumorigenesis. For example, MTA1
(metastasis-associated protein 1) represses estrogen receptor- To better understand the cellular functions of MTA1 in breast cancer
cells, we performed a yeast two-hybrid screen to clone MTA1-interacting
proteins. One of several isolates was identified as MAT1
(ménage á trois
1). MAT1 was originally discovered as an integral component
of the cyclin-dependent kinase (CDK7)-activating kinase
(CAK), a complex consisting of catalytic subunit CDK7, regulatory
subunit cyclin H, and MAT1 (13). The MAT1 protein consists of three
major motifs: the N-terminal RING finger region, the central
coiled-coil region, and the C-terminal cyclin-like region (13-16). The
functions of MAT1 are mediated by interactions of these motifs with
distinct protein-protein interactions. For example, the RING finger
domain is linked with general transcription factor TFIIH-mediated
transcription (17), the coiled-coil domain in making contact with TFIIH
via XPB and XPD helicase subunits (18), and the cyclin-like
region in the formation of trimeric CDK7-cyclin H-MAT1 complex
(19). MAT1 facilitates the formation of the ternary CAK complex by
assembling and stabilizing the interactions between the CDK7 and cyclin
H without involving the activating phosphorylation in the T-loop of
human CDK7 (20). MAT1 has been also shown to determine the substrate
specificity of CAK, because recruitment of MAT1 to the CDK7/cyclin H as
a part of TFIIH preferentially targets the RNA polymerase II large
subunit over CDK2 (21). In addition, MAT1 as a part of CDK7-cyclin
H-MAT1 complex within the context of TFIIH enhances the phosphorylation
of several in vitro substrates, including the POU domain of
octamer transcription factor (22), tumor suppressor p53, and pRB
proteins (23, 24), retinoic acid receptor- Here, we show that MTA1 directly binds to the MAT1 and represses
CAK-mediated stimulation of ERE transcription and that MAT1 interacts
with ER in a ligand-independent manner. In addition, MAT1 is frequently
up-regulated in human breast tumors. These findings reveal a novel
connection among MTA1, MAT1, and cancer and discovered the existence of
regulatory interactions between MTA1 and CAK in breast cancer cells.
Cell Cultures and Reagents--
MCF-7, MDA-MB-231, T47-D,
MDA-MB-453, BT-474, and ZR-75 human breast cancer cells (7, 28) were
maintained in Dulbecco's modified Eagle's medium supplemented with
10% fetal calf serum. The following antibodies were used: anti-MAT1,
anti-MTA1, anti-cyclin H, anti-CDK7, and anti-HDAC1 (Santa Cruz
Biotechnology, Santa Cruz, CA), anti-T7 (Novagen, Milwaukee, WI),
anti-HER-2 (NeoMarkers, Fremont, CA), anti-vinculin (Sigma), anti-ER
(Upstate Biotechnology, Lake Placid, NY), and anti-mouse horseradish
peroxidase conjugate (Amersham Biosciences). Alexa 546-labeled goat
anti-rabbit and Alexa 488-labeled goat anti-mouse secondary antibodies
and the DNA-intercalating fluorescent dye ToPro3 were purchased from
Molecular Probes (Eugene, OR).
Plasmid Construction and Two-hybrid Library Screening--
The
full-length MTA1 (1-715 amino acids) (7) was digested with
BamHI and XbaI (blunt end) and ligated to the
pGBKT7 vector that expresses protein fused to amino acids 1-147 of the
GAL4-DNA binding domain at BamHI and PstI
(blunt end) (Clontech). MTA1 baits were constructed
by deleting 1-254 amino acids from the N terminus of MTA1 by cutting
and self-ligating with NcoI. The remaining 255-715 amino
acids of the C terminus of MTA1 was used as bait. This bait was used to
screen a human mammary gland cDNA library fused to the Gal4
activation domain (Clontech) according to the
manufacturer's instructions. A total of 2 × 106
clones were screened. The positive clones were isolated and sequenced at the University of Texas M. D. Anderson Cancer Center Core
sequencing facility. The positive clones were also verified by
one-on-one transformations and selection on agar plates lacking
adenine, histidine, tryptophan, and leucine and also by
Deletion Constructs of MTA1 and MAT1--
Nine MTA1 deletion
constructs were generated to map the binding site(s) of MTA1 with MAT1
by PCR-based procedure. Starting from the N-terminal region, the
constructs were named N1-MTA1 to N9-MTA1. All of the forward (F)
primers including the ATG start codon primer contain an
EcoRI site and all of the reverse (R) primers including the
stop codon (TAG) primer contain a SalI site. The ATG start
codon primer is 5'-GCCGCCGGAATTCACATGGCCGCCAACA-3'and the stop codon
(TAG) primer was 5'-AGGTGGGGGTCGACCCTAGTCCTCCCG-3'. The construction of
N1-MTA1 through N7-MTA1 used the ATG start codon primer plus N1R,
5'-ACTCGAATGTCGACTTTATCTGCCA-3'; N2R,
5'-AGCTGCTGCAGTCGACGGCCCGTGCGA-3'; N3R,
5'-AGGCCCGGCCGTCGACAGGGCTCTGGCCCGG-3'; N4R,
5'-ACTGCGGTGTCGACCTGGCCTCTCTCCA-3'; N5R,
5'-ACCGAAGCACGTCGACCAGCGGCTT-3'; and N6R,
5'-TCAGGCGCACGTCGACGGGGTAGGACT-3', respectively. The N7-MTA1 was
constructed by using N7F, 5'-ACCTTCGGAATTCCCCTGGACTGCA-3', and N3R primers. For the construction of N8-MTA1 (422-715 amino acids)
and N9-MTA1 (542-715 amino acids), we used stop codon primer and N8F,
5'-TGATGGAGGAATTCCAGGACCAAAC-3', and N9F,
5'-GAAGCCGTGCGAATTCATCTTGAGA-3', respectively. All of the PCR products
were run into 0.8% agarose gel, purified by Geneclean or Mermaid (Bio
101, Inc., Vista, CA), cut with EcoR1 plus SalI,
and ligated to pGEX-5X vector at EcoR1 and XhoI
site. After confirming the sequences, these constructs were cut at
EcoRI and NotI site and ligated with
pcDNA3.1A vector at EcoR1 and NotI site for
the T7 tag protein (29). The sequence of N10-MTA1 deletion construct
(amino acids 212-715) has been described previously (28).
A similar PCR-based procedure was used to generate eight deletion
constructs of MAT1. Four of five deletion constructs were made for MAT1
using either start codon primer 5'-GGGAATTCCCATGGACGATCAGGGT-3' or stop
codon primer 5'-CTTATGTCGACTTAA CTGGGCTGCCA-3'. The following constructs were made by PCR with start codon primer plus 189R (1-189
amino acids), 5'-GCAGAGCAACAGCGGCCGCAGAAC TCTCCAGCTCAT-3'; 114R (1-114
amino acids), 5'-TCTTTTTGGTGGCGGCCGCATCCACATTGTTG-3'; 66R (1-66 amino
acids), 5'-CAACCTCCTTGGCGGCCGCGGGATCTTCAAAGA-3'; and using stop codon
primer plus 189F (189-309 amino acids),
5'-GATGAGCTGGGAATTCCTGATCTCCCTGTTGCT-3'. The amino acids 114-189
construct was made using the primers 114F, 5'-ACTTGACCAACAGAATTCATTTGGACAACACCA-3', and 189R. After Geneclean, the
PCR products were digested with either EcoR1 and
SalI or EcoR1 and NotI and ligated to
a pcDNA 3.1A vector at either EcoRI and XhoI
or EcoRI and NotI.
Transfection, Cell Extracts, and
Immunoprecipitation--
Transfection was performed with a FuGENE 6 kit (Roche Molecular Biochemicals) according to the manufacturer's
instructions. The cells were lysed with RIPA buffer supplemented with
100 mM NaF, 2 mM NaVO5, 1×
protease mixture (Roche Molecular Biochemicals) on ice for 15 min. Cell
lysates containing equal protein were immunoprecipitated with the
desired antibody and analyzed by SDS-PAGE (28, 29).
CAK Phosphorylation of ER--
The effect of MTA1 on CAK
phosphorylation of ER was determined according to Chen et
al. (27). Briefly, MCF-7 cells stably expressing either pcDNA
or T7-MTA1 were transfected with CDK7 and MAT1 and labeled with
[32P]orthophosphoric acid. The cell lysates were
immunoprecipitated with an anti-ER antibody, and the status of
phosphorylated ER was analyzed by autoradiography.
Chromatin Immunoprecipitation (ChIP) Assay--
Approximately
106 cells were treated with cross-linked histones to DNA.
The ChIP assay was performed as described (7). After immunoprecipitation with corresponding antibodies, the eluted DNA was
amplified by PCR using the primers GAATTAGCTTAGGCCTAGACGGAATG (forward)
and AGGATTTGCTGATAGACAGAGACGAC (reverse) for pS2 promoter around the
ERE site.
Tissue Samples and Western Blotting--
Mouse tissue samples
were collected and snap frozen in liquid nitrogen as described
previously (7, 30). Human breast tissue samples were obtained from the
University of Texas M. D. Anderson Breast Tumor Core Pathology
Laboratory maintained by Aysegul A. Sahin (31, 32). Thawed tissue
samples were homogenized in Triton X-100 lysis buffer (20 mM HEPES, 150 mM NaCl, 1% Triton X-100, 0.1%
deoxycholate (v/w), 2 mM EDTA, 2 mM
NaVO5, and protease inhibitor mixture), and equal amounts
of protein were analyzed by Western blotting. The protein vinculin was
used routinely as a loading control.
In Vitro Transcription, Translation, and GST Pull-down
Assays--
In vitro transcription and translation of the
test proteins were performed by using the TNT transcription-translation
system (Promega). One microgram of desired DNA in pCDNA 3.1 vector
(Invitrogen) was translated in the presence of
[35S]methionine in a reaction volume of 50 µl by using
the T7-TNT reaction mixture. The reaction mixture was diluted to 1 ml
with Nonidet P-40 lysis buffer, and an aliquot (250 µl) was used for each GST pull-down assay. Two µl of the translated reaction mixture was verified by SDS-PAGE and autoradiography. The GST pull-down assays
were performed by incubating equal amounts of GST or GST fusion protein
immobilized to glutathione-Sepharose beads (Amersham Biosciences) with
in vitro translated 35S-labeled test protein.
The mixtures were incubated for 2 h at 4 °C and washed six
times with Nonidet P-40 lysis buffer. The bound proteins were eluted
with 2× SDS buffer, separated by SDS-PAGE, and visualized by
fluorography (32).
Immunofluorescence and Confocal Imaging--
The cells were
plated on glass coverslips in 6-well culture plates. When the cells
were ~50% confluent, they were serum-starved for 36 h.
Alternatively, 30% confluent cells were maintained in phenol red-free
medium supplemented with 5% charcoal-striped fetal calf serum for
72 h and treated with Immunohistochemistry--
For immunohistochemical detection of
MAT1, the sections were deparaffinized with xylene and rehydrated using
graded ethanol (30). The sections were incubated in 0.3%
H2O2 and methanol for 30 min to inactivate
endogenous peroxidase. The sections were then boiled for 10 min in 0.01 M citrate buffer and cooled for 30 min at room temperature
to expose antigenic epitopes. The sections were sequentially biotin-
and protein-blocked and incubated with primary antibody overnight at
room temperature followed by biotinylated secondary antibody,
streptavidin-biotin complex, amplification reagent, and
streptavidin-peroxidase complex (DAKO Corporation, Carpinteria, CA),
and then developed with DAB-H2O2 and
counterstained with Mayer's hematoxylin. Anti-MAT1 antibody (Santa
Cruz Biotechnology, Santa Cruz, CA) was used at a dilution of
1:100.
Statistical Analysis--
Statistical analysis was done using
Student's t test. The values are considered statistically
significant if p < 0.05.
Identification of MAT1 as a MTA1-interacting Protein--
To
better understand the functions of MTA1 in breast tumor cells, a yeast
two-hybrid screening of the mammary gland cDNA expression library
was performed using the MTA1 C-terminal amino acids 255-715 as bait.
This bait contains several binding motifs (DNA-binding domain, GATA
domain, and SH2 and SH3 binding domains). As a negative control, we
used a recently identified MTA1s variant that lacks protein-binding
motifs as bait (28). Yeast cells expressing the Gal4 fusion protein
were transformed with the above bait. Screening of 2 × 106 transformants resulted in the isolation of several
positive clones. By sequencing of the positive clones, we identified
several clones that encoded cDNA of MAT1 (GenBankTM
accession number X92669), an integral component of the CAK complex
(33). The specificity of the MTA1-MAT1 interactions was verified by
one-on-one transformation (Fig.
1A). Interaction was further
confirmed by the growth of the transformed colonies in medium lacking
adenosine, histidine, tryptophan, and leucine and development of blue
coloration in MAT1 Interacts with MTA1 in Vitro--
To confirm the interaction
between MAT1 and MTA1, we next examined the ability of in
vitro translated MAT1 protein to bind with GST-MTA1 in
vitro. MAT1 interacted efficiently with GST-MTA1 but not with GST
alone in GST pull-down assays (Fig. 1B, left panel). Conversely, in vitro translated MTA1 protein
also specifically interacted with GST-MAT1 (Fig. 1B,
right panel).
MAT1 Interacts with MTA1 in Vivo--
To confirm the MAT1
interaction with MTA1 in vivo, MCF-7 cells were
cotransfected with the equal amounts of c-Myc-tagged MTA1 and T7-tagged
MAT1. Immunoprecipitation of cell lysates with an anti-T7 antibody was
followed by immunoblotting with anti-c-Myc antibody. As illustrated in
Fig. 1C, cotransfection with T7-MTA1 but not pCDNA
coimmunoprecipitated c-Myc-MTA1. To further demonstrate the existence
of the noticed interaction between MAT1 and MTA1 in vivo, we
used MCF-7 breast cancer cells stably expressing T7-tagged MTA1 or
pCDNA (7). Immunoprecipitation of the endogenous MAT1 with an
anti-MAT1 monoclonal antibody was followed by immunoblotting with the
anti-T7 monoclonal antibody. The results showed specific interaction
between the endogenous MAT1 and T7-MTA1 in MCF7/MTA1 cells but not in
MCF7/pCDNA cells (Fig. 1D). Next, we used T47D breast
cancer cells that express both MAT1 as well as MTA1 to demonstrate the
interaction between the endogenous MAT1 and MTA1. Immunoprecipitation
of lysate from exponentially growing cells with anti-MTA1 antibody was
followed by Western blotting with anti-MAT1 antibody. The results show
that endogenous MTA1 and endogenous MAT1 do interact with each other
(Fig. 1E).
To explore the spatial relationship between MTA1 and MAT1 and further
validate their interactions in vivo, we utilized
immunofluorescence and confocal scanning microscopy. MCF-7 cells were
transiently transfected with Myc-tagged MTA1 and stained using
antibodies against c-Myc antibody to detect c-Myc-MTA1
(green) or anti-MAT1 antibody to detect the endogenous MAT1
(red), and DNA was counterstained with the DNA dye Tropo3
(blue). Areas of colocalization of the red and green signals
show yellow fluorescence (Fig. 1F). In nontransfected cells,
MAT1 protein was spread diffusely in the cytoplasm and absent from the
nucleus (Fig. 1F). This result is in agreement with
previous reports on the subcellular distribution of MAT1 (33).
Transfected MTA1 was concentrated in the nucleus, as expected (7).
Importantly, MAT1 was also concentrated in the nucleus selectively in
Myc-MTA1 transfected cells, where it colocalized with Myc-MTA1 (Fig.
1F, right panel). Together, these observations suggested that MAT1 could interact with Myc-MTA1 under physiological conditions, suggesting the possible influence of MTA1 on the functions of MAT1 in breast cancer cells.
MAT1 Expression Pattern--
To explore the significance of MAT1
in breast tissues, we examined MAT1 protein expression levels in normal
mouse tissues and human breast cancer cell lines. MAT1 protein was
easily detectable in both ER-positive (MCF7, ZR75 and T47D) and
ER-negative (MDA-MB231, MDA-MB453 and BT474) cell lines (Fig.
2A). As shown in Fig.
2B, various levels of MAT1 protein were present in many
mouse tissues, with the highest level in the thyroid and mammary glands
of pregnant mice (Fig. 2C). To explore the significance of
MAT1 in human breast tumors, we investigated whether MAT1 protein
expression was altered in paired normal human breast epithelium and
breast carcinoma biopsy samples. As shown in Fig.
3A, MAT1 expression was
elevated in 8 tumors of 12 as compared with the adjacent normal tissue, which showed either or no expression of MAT1. In 6 of the
MAT1-overexpressing tumors, there was also up-regulation of MTA1. The
blots were reprobed for vinculin as a loading control. Densitometric
scanning of MAT1 and MTA1 protein bands suggested the existence of
statistically significant up-regulation of both proteins in breast
tumors as compared with adjacent normal appearing tissues (Fig.
3B). To validate these results, we immunostained
paraffin-embedded paired tissue specimens with an anti-MAT1 monoclonal
antibody. Two representative examples in Fig. 3C demonstrate
an intense MAT1 nuclear staining in tumor tissue, and normal tissue
showed no positive staining.
Mapping of MAT1- and MTA1-interacting Domains--
Next, we
defined the minimal region of MTA1 required for its interaction with
MAT1. MTA1 has several important domains involved in protein-protein
interactions, DNA binding, and signaling (Fig. 4A). Several C-terminal MTA1
deletion constructs were generated and expressed as
35S-labeled proteins and then subjected to GST pull-down
assays with the GST-MAT1 fusion proteins. The results suggest that
amino acids 1-164 of MTA1, which contain the bromo-domain, and
389-441 amino acids representing the GATA domain constitute the
binding regions for MAT1 (Fig. 4B). To define the binding
region or regions of MAT1 that are important for MTA1 interaction, we
generated MAT1 encompassing different regions such as N-terminal RING
finger region, the central coiled-coil region, and the C-terminal
cyclin-like box (Fig. 5A). The
results of the GST pull-down assays indicated that MAT1 uses amino
acids 1-66 (representing the ring finger domain) to interact with MTA1
efficiently (Fig. 5B). These findings demonstrated that MAT1
binds to the C-terminal 389-441 amino acids GATA domain and N-terminal
1-164 amino acids bromo-domain of MTA1, whereas MTA1 binds to the
N-terminal ring finger domain of the MAT1.
MAT1 Interacts with ER--
Because repressed MTA1 has been shown
to shown to repress the transactivation functions of ER (7), we
hypothesized that MAT1 might physically interact with ER and influence
its function. To explore this possibility, we examined the binding
ability of in vitro translated MAT1 protein and with the
GST-AF1 and AF2 domains of ER in GST pull-down assays. As shown in Fig.
6A, MAT1 protein effectively
interacted with the GST-AF2 (ligand-binding domain of ER) but not with
GST alone or GST-AF1, and this binding was further increased
significantly in the presence of estrogen. To confirm these results, we
performed GST pull-down assays using various deletion mutants of ER
representing domains of ER and showed that MAT1 interacts with the
ligand-binding region of ER (Fig. 6B).
To determine whether MAT1 and ER would colocalize in vivo,
we examined the immunolocalization of these proteins by confocal microscopy. MCF-7 cells were grown in estrogen-free medium for 72 h and then were treated with E2 (10 MTA1 Interacts with CAK Complex Components--
The CAK complex is
composed of CDK7, cyclin H, and MAT1. To demonstrate the endogenous
interaction of MTA1 with the components of CAK complex, cell lysates
from exponentially growing MCF-7/T7-MTA1 and MCF-7/pcDNA cells (7)
were immunoprecipitated with antibodies against cyclin H, CDK7, and
MAT1. As shown in Fig. 7, MTA1 could be
detected in complexes consisting of cyclin H, CDK7, and MAT1 only in
MCF-7/T7-MTA1 and not in vector-transfected MCF-7 cells. Interestingly,
both ER and HDAC2 were also present in the CAK1-MTA1 complex,
suggesting a potential role for MTA1 in modifying (i.e. repressing) the effect of CAK on the transactivation functions of
ER.
MAT1 Associates with the ERE-responsive Promoters in Vivo--
To
directly demonstrate the potential importance of MTA1-MAT1 interaction
in ERE transcription, we used the ChIP assay to analyze whether T7-MTA1
or MAT1 associates with the endogenous ERE-containing promoters.
MCF-7/ pcDNA and MCF-7/T7-MTA1 cells were treated with E2 in the
presence or absence of ICI 182780 for 30 min and processed to
formaldehyde cross-link and to sonicated chromatin for
immunoprecipitation with specific antibodies against T7 or MAT1.
T7-MTA1 or MAT1-bound genomic DNA fragments were analyzed by
quantitative PCR using primers spanning the ERE elements present in the
promoter of the pS2 sequence. The results indicated that E2 treatment
triggered a significant increase in the amount of pS2 target gene
promoter chromatin associated with T7-MTA1 or MAT1 (Fig.
8). Because both MAT1 and MTA1 interacted
effectively with the ER target gene chromatin, these findings raised
the possibility that MTA1 might influences the status of ER
transactivation by MAT1 as a part of CAK complex. In brief, these
findings from Figs. 6 and 8 strongly support the notion that MTA1 might
influence the regulation of ER transactivation function by
CAK1-associated mechanisms.
MTA1 Inhibits CAK Stimulation of ER
Transactivation--
To assess the potential significance of noticed
MTA1-MAT1 interactions, we next examined the effect of MTA1 on the
ability of CAK to ER transactivation function in MCF-7 cells. Previous reports have shown that coexpression of all three components but not
individual subunits of CAK1 stimulate transcriptional activity of ER in
HeLa cells (27). Consistent with these observations, we observed a
significant stimulation of ERE-dependent transcription by
CAK1 in MCF-7 cells (Fig. 9A).
Interestingly, MTA1 expression blocked the ability of CAK1 to
ER-mediated ERE transactivation. Because MTA1 interacts with HDAC2 (7)
and because HDAC2 could be detected in MTA1/CAK1 (Fig. 7) in breast
cancer cells, we reasoned that HDAC inhibition by TSA might relieve the
inhibitory effect of MTA1 on CAK1. Indeed, TSA treatment of cells was
accompanied by a considerable derepression by MTA1. These findings
suggested that MTA1 might inhibit CAK-induced transactivation function
of ER by recruiting HDAC.
To further understand the role of MTA1 in the functions of CAK, we next
examined the effect of MTA1 deregulation on the CAK activity as
determined by its ability to phosphorylate ER in vivo. MCF-7
expressing pcDNA or MTA1 cotransfected with MAT1 and CDK7 were
labeled with [32P]orthophosphoric acid. The cell lysates
were immunoprecipitated with an anti-ER antibody and analyzed by
autoradiography. As expected from the previous work by Chen et
al. (27), CAK expression in MCF7/pcDNA cells was accompanied
by increased phosphorylation of ER (compare lane 3 with
lane 1), which could be further increased by estrogen
treatment (Fig. 9B, compare lane 4 with
lanes 3 and 2). Interesting, the CAK failed to
phosphorylate ER in MCF7/MTA1 cells in both the absence and the
presence of estrogen stimulation (Fig. 9B). These results
suggested that MTA1 deregulation could also impair the ability of CAK
to phosphorylate ER.
In the present study, we have identified MAT1, an essential
component of CAK complex with functions in cell cycle control and
transcription, as a MTA1-interacting protein using the yeast two-hybrid
screening. We show that MTA1 interacts with MAT1 both in
vitro and in vivo and that MTA1 could be detected in a
complex consisting of CAK components ER and HDAC in breast cancer
cells. In an attempt to understand the significance of these
biochemical interactions, we followed an earlier finding showing that
the CAK complex enhances the ER transactivation function (27) and demonstrated that estrogen stimulation of breast cancer cells promotes
rapid nuclear translocation of MAT1 and its association with the
endogenous ER. Using recombinant proteins, we further demonstrated that
MAT1 directly interacts with the AF2 domain of ER under basal as well
as E2-inducible conditions. In the context of MTA1, we show that both
MTA1 and MAT1 associate with the ER target gene pS2 promoter chromatin
and that MTA1 inhibits CAK-induced stimulation of transactivation
function of ER. The functional significance of these findings is
derived from the observations that MAT1 acts as the assembly and
targeting factor of CAK, which regulates transcription including
transactivation property of ER (27). Because MTA1 expression is
deregulated in human breast tumors (28), it is possible that MTA1
up-regulation might suppress CAK regulation of the transactivation
activity of ER and, subsequently, leads to loss of ER responses, which
is generally associated with the progression of breast cancer to more
invasive phenotypes. Additional studies are needed to address these
evolving issues.
Inhibition of CAK stimulation of ER transactivation by MTA1 was
presumably due in part to the recruitment of HDAC to the MTA1-CAK complex, because inhibition could be partially relieved by the HDAC
inhibitor TSA. Also the CAK complex in breast cancer cells with
deregulated MTA1 contained HDAC2 (Fig. 7). For the first time, these
results show that CAK complex interacts with an
HDAC-interacting corepressor MTA1. Because both CAK and MTA1 are known
to target ER (7, 27), the findings presented here have revealed the existence of novel regulatory interactions between MTA1 and CAK and
presented a novel control mechanism for ER transactivation functions in
breast cancer cells. Chen et al. (27) have earlier shown
that ER phosphorylation was induced by CDK7 and MAT1 in presence of
estrogen. Our results are in agreement with that finding. Moreover, in
the present study we have also demonstrated that phosphorylation of ER
could be inhibited as a result of MTA1 overexpression both in presence
and absence of the ligand. This illustrates the potential existence of
an additional mechanism of MTA1-induced inhibition of CAK activity.
That the expression of MTA1 and MAT1 could be detected in
ER-negative breast cancer cells and tissues other than the mammary gland (7) (Fig. 2) is important because it suggests that MTA1 might
also influence the functions of MAT1 and/or the CAK complex in cellular
functions other than ER transactivation. Because MAT1 modulation of CAK
activity regulates cell cycle progression through G1 (24),
the effect of MTA1 on these events in ER-negative breast cancer cells
remains to be investigated in the future studies.
The finding that the ER coactivator MAT1 as a part of the CAK complex
interacts with MTA1, an ER corepressor, is surprising, because it
raises the possibility that the final outcome of the ER transactivation
function is influenced by complex protein-protein interactions rather
than by isolated interaction with one class of proteins. It has been
proposed that different HDAC complexes might be recruited for simple
deacetylation of dynamically regulated ER target gene promoters. The
associated nonenzymatic activities may play a role in determining the
nature of the repression. From our results, it appears that MTA1 has
inhibitory activity against MAT1/CAK-mediated interaction/stimulation
of ER transactivation. Because MTA1 exhibited an overall corepressor
function in the presence of CAK and E2 stimulation, these findings
suggested an additional mechanism of MTA1 suppression of ER
transactivation in breast cancer cells.
In summary, the present study identified MAT1 as a target of
corepressor MTA1 and provided new evidence to suggest that the transactivation functions of ER are influenced by the regulatory interactions between CAK and MTA1. Our findings are in agreement with
emerging models suggesting the existence of corepressor and coactivators are in the same complex. This model suggests that MTA1 and
MAT1 might transmodulate the functions of ER and that any potential
deregulation of MTA1 is likely to contribute to the functional
inactivation of the ER pathway, presumably by recruitment of MTA1 to
the ER target promoter chromatin.
*
This work was supported in part by National Institutes of
Health Grant CA84456 and by Susan G. Komen Foundation Grant BCRT 2000835.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
These authors contributed equally to this study.
Published, JBC Papers in Press, January 13, 2003, DOI 10.1074/jbc.M209570200
The abbreviations used are:
HDAC, histone
deacetylase;
MTA1, metastasis-associated protein 1;
ER, estrogen
receptor-
MTA1 Interacts with MAT1, a Cyclin-dependent
Kinase-activating Kinase Complex Ring Finger Factor, and
Regulates Estrogen Receptor Transactivation Functions*
§,
§,
,
,
,
, and
Molecular and Cellular
Oncology and ¶ Pathology, The University of Texas M. D. Anderson
Cancer Center, Houston, Texas 77030
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
is controlled by coregulators. MTA1
(metastasis-associated protein
1) represses estrogen receptor-
-driven transcription by
recruiting histone deacetylases (HDACs) to the estrogen response
element containing target gene chromatin in breast cancer cells. Using a yeast two-hybrid screen with the MTA1 C-terminal domain as bait, we
identified MAT1 (ménage á trois 1) as an MTA1-binding protein. MAT1 is an
assembly/targeting factor for cyclin-dependent
kinase-activating kinase (CAK), which has been shown to functionally
interact with general transcriptional factor TFIIH, a known inducer of
ER transactivation. We show that estrogen signaling promotes nuclear
translocation of MAT1 and that MTA1 interacts with MAT1 both in
vitro and in vivo. MAT1 binds to the C-terminal
389-441 amino acids GATA domain and N-terminal 1-164 amino acids
bromo-domain of MTA1, whereas MTA1 binds to the N-terminal ring finger
domain of the MAT1. In addition, MAT1 interacts with the activation
function 2 domain of ER and colocalizes with ER in activated cells.
MTA1 deregulation in breast cancer cells led to its interactions with
the CAK complex components, ER, and HDAC2. Accordingly, MTA1 inhibited
CAK stimulation of ER transactivation that was partially relieved by
HDAC inhibitor trichostatin A, suggesting that MTA1 might
inhibit CAK-induced transactivation function of ER by recruiting HDAC.
Furthermore, MTA1 overexpression inhibited the ability of CAK complex
to phosphorylate ER. Together, these findings identified MAT1 as a
target of MTA1 and provided new evidence to suggest that the
transactivation functions of ER might be influenced by the regulatory
interactions between CAK and MTA1 in breast cancer cells.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
(ER)-driven
transcription by recruiting HDAC to the ER response element
(ERE)-containing target gene chromatin in breast cancer cells (7). The
NuRD-70 polypeptide of nucleosome remodeling/HDAC complex is identical
to that of the MTA1 (8-11). The MTA1 gene was initially identified by
differential expression in rat mammary adenocarcinoma metastatic cells,
and its expression has been shown to correlate well with the metastatic potential of several human cell lines and tumors (12).
(25, 26), and estrogen
receptor-
(27). In addition, MAT1 also binds to XPB and XPD
helicases subunits of TFIIH that recruit CAK complex to the core TFIIH
(27). These observations suggest that MAT1 as a part of CAK in
conjunction with multi-enzymatic protein complex TFIIH participates in
several fundamental aspects of the transcription regulation. Because
RING finger and coiled-coil motifs are generally involved in
protein-protein interactions, MAT1 could potentially interact with
other cellular regulatory proteins.
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase assay (28).
-estradiol (10
9
M) for 30 min with or without pretreatment with the
anti-estrogen ICI 182780 (10
8 M) for 1 h. The cells were rinsed in phosphate-buffered saline, fixed in cold
100% methanol for 10 min, and processed for immunofluorescent localization of MAT1 and Myc-tagged MTA1 or ER. The DNA was visualized by counterstaining with ToPro3. Fluorescent labeling was visualized using a Zeiss LSM 510 microscope and a 40× objective (32).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-galactosidase assay, whereas the cotransfection with
the control GBK vector did not do so (Fig. 1A). Subsequent
studies were undertaken to understand the significance of MTA1
interactions with MAT1 in breast cancer cells.

View larger version (43K):
[in a new window]
Fig. 1.
Identification of MAT1 as an MTA1-binding
protein. A, yeast cells were cotransfected with
GAD-MAT1 and GBD control vector, or GBD-MTA1 (amino acids 1-715) or
GBD-ctMTA1 (amino acids 255-715), or GBD-ntMAT1 (amino acids 1-173).
Cotransformants were plated on selection plates lacking leucine and
tryptophan (
LT) (middle panel) or lacking
adenine, histidine, leucine, and tryptophan (
AHLT)
(bottom panel). Growth was recorded after 72 h. For
-galactosidase assay, filter lift assays were performed. A
blue color indicates the specific interaction of two
proteins (top panel). B, MAT1 interaction in the
GST pull-down assays. In vitro translated
35S-labeled MAT1 protein was incubated with either MTA1-GST
or GST (left panel), or in vitro translated
35S-labeled MTA1 protein were incubated with either
MAT1-GST or GST (right panel) and analyzed by
SDS-PAGE and autoradiography. C, MCF-7 cells were
cotransfected with Myc-MTA1 and T7-MAT1 or by T7-MAT1 and the pCMV
vector. The cells were lysed after 36 h, immunoprecipitated with
anti-T7 monoclonal antibody, resolved on 10% SDS-PAGE, and
immunoblotted with anti-T7 and anti-Myc antibody. D,
in vitro interaction between T7-MTA1 and MAT1.
MCF-7/pCDNA and MCF-7/MTA1-T7 cells grown in 10% serum were lysed,
and lysates containing equal amount of protein were immunoprecipitated
with an anti-MAT1 monoclonal antibody and immunoblotted with antibodies
against T7 and MAT1. E, endogenous MTA1 interacts with
endogenous MAT1. Total protein from T47D cells was immunoprecipitated
with anti-MTA1 antibody and immunoblotted with antibodies against
either MAT1 or MTA1. F, MTA1 colocalizes with MAT1. MCF-7
cells were transiently transfected with c-Myc-MTA1, and fixed in
methanol and immunofluorescently stained for c-Myc tag
(green) and MAT1 (red) and counterstained for
nuclear DNA (blue). Areas of colocalization of the
red and green signals show yellow
fluorescence (×40 magnification). C-ter, C-terminal;
N-ter, N-terminal; IP, immunoprecipitation;
Fl, full length; W, Western
blot.

View larger version (46K):
[in a new window]
Fig. 2.
MAT1 expression in different cells
and normal mouse tissues. A, MTA1 expression in human
breast cancer cells. B, MAT1 expression in normal mouse
tissues was detected by immunoblotting with the indicated antibodies.
C, MTA1 expression during the different stages of murine
mammary gland development. V, virgin; P,
pregnancy; L, lactation; PW, post-weaning.
Numbers represent days.

View larger version (90K):
[in a new window]
Fig. 3.
MAT1 expression in human breast tumors.
A, paired breast tumors (T) and adjacent normal
(N) tissue were analyzed by immunoblotting with the
indicated antibodies. B, densitometric quantitation of MTA1
and MAT1 signals. C, representative immunohistochemical
staining for MAT1 in tissues from normal and tumor sections. The tumor
section shows both nuclear and cytoplasmic staining.

View larger version (29K):
[in a new window]
Fig. 4.
Mapping of MTA1 interaction domains of MAT1.
A, schematic representations of MAT1 constructs.
N1, amino acids 1-164; N2, amino acids 1-226;
N3, amino acids 1-387; N4, amino acids 1-441;
N5, amino acids 1-535; N6, amino acids 1-630;
N7, amino acids 227-388; N8, amino acids
442-703; N9, amino acids 542-703; and N10,
amino acids 212-715. B, GST pull-down assays using
35S-labeled in vitro translated MAT1
polypeptides and GST-MTA1 proteins.

View larger version (25K):
[in a new window]
Fig. 5.
Mapping of MAT1 interaction domains of MTA1.
A, schematic representations of MAT1 constructs representing
amino acids 1-189, 1-114, 1-66, 66-309, 189-309, 229-309, and
114-189. B, GST pull-down assays using
35S-labeled in vitro translated MAT1
polypeptides and GST-MTA1 protein.

View larger version (78K):
[in a new window]
Fig. 6.
MAT1 interaction with ER. A, GST
pull-down assay involving in vitro translated
35S-MAT1 was incubated with GST-AF1 or GST-AF2 or GST in
the presence and absence of E2. B, GST fusion proteins from
five functional domains of ER were incubated with in vitro
translated 35S-MAT1 and analyzed by SDS-PAGE and
autoradiography. C, MAT1 and ER colocalize following
estradiol treatment. MCF-7 cells were grown in phenol red-free medium
supplemented with 3% charcoal-stripped serum for 72 hours and then
treated with E2 for 30 min. The cells were fixed in methanol and
immunofluorescently stained for MAT1 (green) and estrogen
receptor (red). Areas of colocalization of the
red and green signals show yellow
fluorescence. Control cells, MAT1, and ER were diffusely localized in
the cytoplasm. E2-treated cells, MAT1, and ER show strong
colocalization at the nuclear periphery and in specific intranuclear
regions (×40 magnification).
9 M) for
30 min. In hormone-depleted cells, both MAT1 (endogenous) and ER were
diffusely localized in the cytoplasm and absent from the nucleus (Fig.
6C, top panels). However, after E2 treatment, there was a rapid movement of both proteins to the nuclear periphery, concentration in specific nuclear regions, and also diffuse
localization in the nucleus (Fig. 6C, middle
panels). Pretreatment of cells with the pure anti-estrogen
compound ICI 182780 completely blocked this dramatic estrogen effect on
MAT1 and ER intracellular localization (Fig. 6C,
bottom panels), confirming the ER-mediated nature of the
noticed nuclear colocalization of MAT1 and ER.

View larger version (25K):
[in a new window]
Fig. 7.
MTA1 interacts with CAK components and
ER. Lysates from MCF-7/pCDNA and MCF-7/T7-MTA1 cells (7) were
immunoprecipitated with antibodies against cyclin H, CDK-7, or MAT1 and
immunoblotted with the indicated antibodies. IP,
immunoprecipitation; W, Western blot.

View larger version (23K):
[in a new window]
Fig. 8.
MAT1 interacts with ER target gene chromatin.
A, MCF-7/T7-MTA1 cells (7) treated with estrogen
(10
9 M) for 3-6 h. Then cells were
cross-linked and processed for ChIP assay by using anti-MAT antibody,
and PCR was performed. B, MCF-7/pCDNA and MCF-7/T7-MTA1
cells were treated either with estrogen for 3-6 h or with ICI
(10
7 M) for 1 h and then with estrogen
for 3-6 h. Subsequently, the cells were processed for ChIP assay by
using anti-MAT antibody or anti-T7 antibody, and PCR was performed.
IP, immunoprecipitation.

View larger version (21K):
[in a new window]
Fig. 9.
MTA1 inhibits CAK-mediated ER
transactivation. A, MCF7 cells were cotransfected with 0.25 µg of ERE-luciferase reporter, 0.5 µg of MAT1, 0.5 µg of MTA1,
0.5 µg of CDK7, and 0.5 µg of cyclin H with or without estrogen or
TSA stimulation. After 36 h, the cells were lysed, and luciferase
activity was measured (n = 3). The activity was
normalized with
-galactosidase activity. B, stable clones
overexpressing pcDNA or MTA1 were transfected with vector alone or
CDK7, cyclin H and MAT1. The cells were maintained in phosphate-free
medium before adding [32P]orthophosphosphoric acid to the
medium. After 36 h of transfection, the cells were either treated
with ethanol or estradiol (10
9 M, 2 h).
Subsequently cells were lysed and immunoprecipitated with anti-estrogen
receptor antibody, resolved on a 8% SDS-PAGE, and taken for
autoradiography.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
FOOTNOTES
To whom correspondence should be addressed: Dept. of Molecular
and Cellular Oncology-108, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030.
![]()
ABBREVIATIONS
;
MAT1, ménage á trois 1;
CAK, cyclin-dependent kinase-activating kinase;
ERE, estrogen
response element;
E2, 17-
-estradiol;
AF, activation function;
CDK, cyclin-dependent kinase;
ChIP, chromatin
immunoprecipitation;
GST, glutathione S-transferase;
TSA, trichostatin A.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Berger, S. L.
(2002)
Curr. Opin. Genet. Dev.
12,
142-148[CrossRef][Medline]
[Order article via Infotrieve]
2.
Owen-Hughes, T.,
and Workman, J. L.
(1994)
Crit. Rev. Eukaryotic Gene Expression
4,
403-441[Medline]
[Order article via Infotrieve]
3.
Owen-Hughes, T.,
Utley, R. T.,
Cote, J.,
Peterson, C. L.,
and Workman, J. L.
(1996)
Science
273,
513-516[Abstract]
4.
Paranjape, S. M.,
Kamakaka, R. T.,
and Kadonaga, J. T.
(1994)
Annu. Rev. Biochem.
63,
265-297[CrossRef][Medline]
[Order article via Infotrieve]
5.
Brownell, J. E.,
Zhou, J.,
Ranalli, T.,
Kobayashi, R.,
Edmondson, D. G.,
Roth, S. Y.,
and Allis, C. D.
(1996)
Cell
84,
843-851[CrossRef][Medline]
[Order article via Infotrieve]
6.
Lomvardas, S.,
and Thanos, D.
(2002)
Mol. Cell
9,
209-211[CrossRef][Medline]
[Order article via Infotrieve]
7.
Mazumdar, A.,
Wang, R. A.,
Mishra, S. K.,
Adam, L.,
Bagheri-Yarmand, R.,
Mandal, M.,
Vadlamudi, R. K.,
and Kumar, R.
(2001)
Nat. Cell Biol.
3,
30-37[CrossRef][Medline]
[Order article via Infotrieve]
8.
Hassig, C. A.,
Fleischer, T. C.,
Billin, A. N.,
Schreiber, S. L.,
and Ayer, D. E.
(1997)
Cell
89,
341-347[CrossRef][Medline]
[Order article via Infotrieve]
9.
Laherty, C. D.,
Yang, W.-M.,
Sun, J.-M.,
Davie, J. R.,
Seto, E.,
and Eisenman, R. N.
(1997)
Cell
89,
349-356[CrossRef][Medline]
[Order article via Infotrieve]
10.
Xue, Y.,
Wong, J.,
Moreno, G. T.,
Young, M. K.,
Cote, J.,
and Wang, W.
(1998)
Mol. Cell
2,
851-861[CrossRef][Medline]
[Order article via Infotrieve]
11.
Zhang, Y.,
Ng, H. H.,
Erdjument-Bromage, H.,
Tempst, P.,
Bird, A.,
and Reinberg, D.
(1999)
Genes Dev.
13,
1924-1935 12.
Toh, Y.,
Pencil, S. D.,
and Nicolson, G. L.
(1994)
J. Biol. Chem.
269,
22958-22963 13.
Tassan, J. P.,
Jaquenoud, M.,
Fry, A. M.,
Frutiger, S.,
Hughes, G. J.,
and Nigg, E. A.
(1995)
EMBO J.
14,
5608-5617[Medline]
[Order article via Infotrieve]
14.
Morgan, D. O.
(1997)
Annu. Rev. Cell Dev. Biol.
13,
261-291[CrossRef][Medline]
[Order article via Infotrieve]
15.
Nigg, E. A.
(1996)
Curr. Opin. Cell Biol.
8,
312-317[CrossRef][Medline]
[Order article via Infotrieve]
16.
Reardon, J. T.,
Ge, H.,
Gibbs, E.,
Sancar, A.,
Hurwitz, J.,
and Pan, Z. Q.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
6482-6487 17.
Busso, D.,
Keriel, A.,
Sandrock, B.,
Poterszman, A.,
Gileadi, O.,
and Egly, J. M.
(2000)
J. Biol. Chem.
275,
22815-22823 18.
Reardon, J. T.,
Ge, H.,
Gibbs, E.,
Sancar, A.,
Hurwitz, J.,
and Pan, Z. Q.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
6482-6487 19.
Devault, A.,
Martinez, A. M.,
Fesquest, D.,
Labbe, J. C.,
Morin, N.,
Tassan, J. P.,
Nigg, E. A.,
Cavadore, J. C.,
and Doree, M.
(1995)
EMBO J.
14,
5027-5036[Medline]
[Order article via Infotrieve]
20.
Larochelle, S.,
Chen, J.,
Knights, R.,
Pandur, J.,
Morcillo, P.,
Erdjument-Bromage, H.,
Tempst, P.,
Suter, B.,
and Fisher, R. P.
(2001)
EMBO J.
20,
3749-3759[CrossRef][Medline]
[Order article via Infotrieve]
21.
Rossignol, M.,
Kolb-Cheynel, I.,
and Egly, J. M.
(1997)
EMBO J.
16,
1628-1637[CrossRef][Medline]
[Order article via Infotrieve]
22.
Inamoto, S.,
Segil, N.,
Pan, Z. Q.,
Kimura, M.,
and Roeder, R. G.
(1997)
J. Biol. Chem.
272,
29852-29858 23.
Ko, L. J.,
Shieh, S. Y.,
Chen, X.,
Jayaraman, L.,
Tamai, K.,
Taya, Y.,
Prives, C.,
and Pan, Z. Q.
(1997)
Mol. Cell. Biol.
17,
7220-7229[Abstract]
24.
Wu, L.,
Chen, P.,
Shum, C. H.,
Chen, C.,
Barsky, L. W.,
Weinberg, K. I.,
Jong, A.,
and Triche, T. J.
(2001)
Mol. Cell. Biol.
21,
260-270 25.
Rochette-Egly, C.,
Adam, S.,
Rossignol, M.,
Egly, J. M.,
and Chambon, P.
(1997)
Cell
90,
97-107[CrossRef][Medline]
[Order article via Infotrieve]
26.
Bastien, J.,
Adam-Stitah, S.,
Riedl, T.,
Egly, J. M.,
Chambon, P.,
and Rochette-Egly, C.
(2000)
J. Biol. Chem.
275,
21896-21904 27.
Chen, D.,
Riedl, T.,
Washbrook, E.,
Pace, P. E.,
Coombes, R. C.,
Egly, J.-M.,
and Ali, S.
(2000)
Mol. Cell
6,
127-137[CrossRef][Medline]
[Order article via Infotrieve]
28.
Kumar, R.,
Wang, R.-A.,
Mazumdar, A.,
Talukder, A. H.,
Mandal, M.,
Yang, Z.,
Bagheri-Yarmand, R.,
Sahin, A.,
Hortobagyi, G.,
Adam, L.,
Barnes, C. J.,
and Vadlamudi, R. K.
(2002)
Nature
418,
654-657[CrossRef][Medline]
[Order article via Infotrieve]
29.
Li, F.,
Adam, L.,
Vadlamudi, R. K.,
Zhou, H.,
Sen, S.,
Chernoff, J.,
Mandal, M.,
and Kumar, R.
(2002)
EMBO Reports
3,
767-773[CrossRef][Medline]
[Order article via Infotrieve]
30.
Wang, R-A.,
Mazumdar, A.,
Vadlamudi, R. K.,
and Kumar, R.
(2002)
EMBO J.
21,
5437-5447[CrossRef][Medline]
[Order article via Infotrieve].
31.
Vadlamudi, R. K.,
Wang, R. W.,
Mazumdar, A.,
Kim, Y. S.,
Shin, J,
Sahin, A.,
and Kumar, R.
(2001)
J. Biol. Chem.
276,
38272-38279 32.
Barnes, C. J.,
Li, F.,
Mandal, M.,
Yang, Z.,
Sahin, A. A.,
and Kumar, R.
(2002)
Cancer Res.
62,
1251-1255 33.
Korsisaari, N.,
and Makela, T. P.
(2000)
J. Biol. Chem.
275,
34837-34840
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
R. Bagheri-Yarmand, S. Balasenthil, A. E. Gururaj, A. H. Talukder, Y.-H. Wang, J. H. Lee, Y. S. Kim, X. Zhang, D. M. Jones, L. J. Medeiros, et al. Metastasis-Associated Protein 1 Transgenic Mice: A New Model of Spontaneous B-Cell Lymphomas Cancer Res., August 1, 2007; 67(15): 7062 - 7067. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Manavathi and R. Kumar Metastasis Tumor Antigens, an Emerging Family of Multifaceted Master Coregulators J. Biol. Chem., January 19, 2007; 282(3): 1529 - 1533. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moisan, C. Larochelle, B. Guillemette, and L. Gaudreau BRCA1 Can Modulate RNA Polymerase II Carboxy-Terminal Domain Phosphorylation Levels Mol. Cell. Biol., August 15, 2004; 24(16): 6947 - 6956. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Talukder, A. Gururaj, S. K. Mishra, R. K. Vadlamudi, and R. Kumar Metastasis-Associated Protein 1 Interacts with NRIF3, an Estrogen-Inducible Nuclear Receptor Coregulator Mol. Cell. Biol., August 1, 2004; 24(15): 6581 - 6591. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bagheri-Yarmand, A. H. Talukder, R.-A. Wang, R. K. Vadlamudi, and R. Kumar Metastasis-associated protein 1 deregulation causes inappropriate mammary gland development and tumorigenesis Development, July 15, 2004; 131(14): 3469 - 3479. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||