 |
INTRODUCTION |
Glucose-6-phosphatase catalyzes the final step in the
glycogenolytic and gluconeogenic pathways, the hydrolysis of
glucose-6-phosphate (G6P)1 to
glucose and inorganic phosphate (1-4). Glucose-6-phosphatase activity
is predominantly detected in liver and kidney (1-4), but is also
present in the small intestine (5), pancreatic islets (6), and brain
(7). The enzyme is located in the endoplasmic reticulum (ER) membrane
and is thought to exist as a multicomponent system consisting of a
catalytic subunit in addition to specific transporters for G6P,
glucose, and inorganic phosphate (1-4). To date the
glucose-6-phosphatase catalytic subunit (G6Pase) (8) and the G6P
transporter (9) are the only components of the system that have been
identified. Recently, several novel genes encoding putative glucose
transporters have been identified, but whether any of these
transporters are localized to the ER is currently unknown (10). A
promising candidate appears to be GLUT9, which, like G6Pase, is
predominantly expressed in liver and kidney (11). Moreover, although
GLUT9 does not contain a carboxyl-terminal di-lysine ER retention
motif, it does contain a weak amino-terminal di-arginine ER retention
motif (12).
In vivo studies in liver and in situ studies in
liver-derived cell lines or in primary hepatocytes have shown that
G6Pase gene expression is stimulated by glucose, glucocorticoids, cAMP, fatty acids, leptin, and
3-adrenergic receptor agonists,
whereas expression is inhibited by tumor necrosis factor
,
interleukin-6, and insulin (see Ref. 13 for individual citations).
Insulin inhibits basal as well as glucose-, glucocorticoid-, cAMP-, and fatty acid-stimulated G6Pase gene expression. In HepG2 cells, the
effect of insulin on basal mouse and human G6Pase gene transcription is
mediated through a multi-component insulin response unit, which consists of two regions, designated regions A and B (14-16). In the
mouse G6Pase promoter, region A is located between
231 and
199,
whereas region B is located between
198 and
158. Region B contains
an insulin response sequence (IRS), because it can confer an inhibitory
effect of insulin on the expression of a heterologous fusion gene (14,
15). In contrast, region A acts as an accessory element to enhance the
effect of insulin on G6Pase expression mediated through region B. The
accessory factor that binds region A has been identified as hepatocyte
nuclear factor-1 (HNF-1) (15).
Multiple distinct IRSs have been identified through which insulin can
stimulate gene transcription, but only two inhibitory IRSs have been
well characterized (17). One of these inhibitory IRSs was identified
through studies on the glucagon promoter (18, 19), whereas the other
was first identified through studies on the phosphoenolpyruvate
carboxykinase (PEPCK) promoter (20, 21). This PEPCK IRS has the
sequence TGTTTTG (21, 22); similar elements were subsequently
identified that mediate inhibitory effects of insulin on transcription
of the genes encoding insulin-like growth factor-binding protein-1
(IGFBP-1) (23), tyrosine aminotransferase (24), and G6Pase (14). The
IGFBP-1 promoter has two of these motifs arranged as an inverted
palindrome (23), whereas inspection of the region B sequence in the
G6Pase promoter reveals that it has three of these motifs arranged in
tandem (14). A comparison of the sequences of the IRS motifs from these
genes suggests that the consensus sequence of this element is
T(G/A)TTT(T/G)(G/T), which we refer to as the PEPCK-like IRS (25). The
identity of the insulin response factor (IRF) that binds this motif and
mediates the action of insulin has been elusive. Candidates have
included C/EBP (26, 27), HNF-3 (22, 28), and HMG I/Y (29). However, detailed mutagenesis studies revealed that the effect of insulin on
gene transcription mediated through this element does not correlate with the binding of any of these factors. More recently, substantial attention has focused on the potential role of the winged
helix/forkhead transcription factor FKHR (FOXO1a) and its orthologs,
FKHRL1 (FOXO3a) and AFX (FOXO4a), as the elusive IRF.
FKHR and its orthologs emerged as candidates for the IRF indirectly
from genetic experiments in Caenorhabditis elegans that identified a homologous transcription factor, Daf-16, as the target of
an insulin-like metabolic signaling pathway (30, 31). Subsequently, it
was shown that FKHR can bind the PEPCK, IGFBP-1, and G6Pase IRSs
in vitro (16, 32-34). In addition, FKHR was shown to
stimulate PEPCK, IGFBP-1, and G6Pase fusion gene expression (32, 34, 35). It has been proposed that insulin inhibits FKHR-, FKHRL1-, and
AFX-mediated transcriptional activation through the
phosphatidylinositol 3-kinase-dependent activation of PKB,
which leads to the phosphorylation and nuclear exclusion of these
factors (33, 36-42).
Although these studies support the hypothesis that FKHR and its
orthologs are the insulin response factors that bind the PEPCK-like IRS
motif and mediate the inhibitory effect of insulin on gene transcription through this element, other results are not consistent with this model. Thus, there are several studies that suggest PKB
either is not required or is not sufficient for insulin-regulated PEPCK
and G6Pase gene expression (43-45). In addition, a detailed base-by-base analysis of the PEPCK IRS indicated that the effect of
insulin mediated through this element on heterologous gene transcription does not correlate with FKHRL1 binding (46). Because many
of the reported studies on FKHR, FKHRL1, and AFX have involved overexpression of wild-type or mutated forms of these proteins, one
concern is that these factors are simply displacing the endogenous IRF.
Therefore, the experiments described in this report were specifically
designed to assess what role, if any, endogenous transcriptional
activators, such as FKHR, play in the repression of basal G6Pase gene
transcription by insulin. Our results, derived from fusion gene
analyses, are consistent with a model in which insulin inhibits basal
G6Pase gene transcription by inhibiting the function of a
transcriptional activator, such as FKHR. Moreover, chromatin
immunoprecipitation (ChIP) assays demonstrate that FKHR does bind the
G6Pase promoter in situ and that insulin inhibits this
binding. However, our experiments also revealed that the three G6Pase
IRSs are functionally distinct. Thus, detailed gel retardation analyses
show that FKHR binds IRS 1 with high affinity and IRS 2 with low
affinity but that it does not bind IRS 3. Moreover, mutational analyses
demonstrate that, in the context of the G6Pase promoter, only IRS 1 and
2, but not IRS 3, are required for the insulin response. Surprisingly,
IRS 1 and IRS 2 are equally important for the insulin response despite
their very different affinities for FKHR. Moreover, IRS 3, as well as
IRS 1 and IRS 2, can confer an inhibitory effect of insulin on the
expression of a heterologous fusion gene. These observations suggest
that a transcription factor other than FKHR, or its orthologs, can also
mediate an insulin response through the T(G/A)TTTT motif.
 |
EXPERIMENTAL PROCEDURES |
Materials--
[
-32P]dATP (>3000 Ci
mmol
1) was obtained from PerkinElmer Life
Sciences. Specific antisera to FKHR (sc-11350) and rabbit IgG (sc-2027) were obtained from Santa Cruz Biotechnology, Inc.
Plasmid Construction--
The generation of mouse
G6Pase-chloramphenicol acetyltransferase (CAT) fusion genes, containing
promoter sequences located between
231 and +66,
198 and +66, and
158 and +66, relative to the transcription start site, has been
described (14, 15) as has the use of a three-step PCR strategy (47) to
introduce single point mutations into all three of the region B IRS
motifs (15). The resulting construct, designated
751 region B
SDM (15), was generated within the context of the
751 to +66
G6Pase promoter fragment. A truncated version of this construct,
designated
231 TM, was generated within the context of the
231 to
+66 G6Pase promoter fragment using PCR. The same three-step PCR
strategy (47) was used to introduce various point mutations into the individual region B IRS motifs all within the context of the
231 to
+66 G6Pase promoter fragment. The constructs generated contained either
mutations in the individual IRS motifs (designated
231 IRS 1 SDM,
231 IRS 2 SDM, and
231 IRS 3 SDM), mutations in two of the three
IRS motifs (designated
231 IRS 1 + 2 SDM), mutations that switched
the sequence of IRS 3 to that of IRS 1 (designated
231 IRS 1:2:1), or
mutations that switched the sequence of both IRS 1 and IRS 2 to that of
IRS 3 (designated
231 IRS 3:3:3). All promoter fragments generated by
PCR were completely sequenced, using the U. S. Biochemical Corp.
Sequenase kit, to verify the absence of polymerase errors.
The plasmid TKC-VI contains the herpes simplex virus thymidine kinase
(TK) promoter ligated to the CAT reporter gene (22, 48). The TK
promoter sequence extends from
480 to +51 and contains a
BamHI site located between positions
40 and
35. Various
double-stranded oligonucleotides representing the G6Pase promoter
sequence between
197 and
159 or G6Pase IRS 1 (GATCACCTGTTTTT) or
G6Pase IRS 3 (GATCACCTATTTTA) were synthesized with
BamHI-compatible ends and cloned, as a single copy in same
orientation as found in the G6Pase gene, or as multiple copies, into
BamHI-cleaved TKC-VI by standard techniques (14, 49). The
CAT reporter gene was then replaced with the more sensitive firefly
luciferase reporter by re-isolating the various TKC-VI promoter
constructs, as BamHI-XhoI fragments, from the
plasmids described above and ligating them into the pGL3-Mod vector.
This vector is based on the pGL3 Basic firefly luciferase vector
(Promega, Madison, WI) but contains a modified polylinker (50).
The generation of human IGFBP-1-chloramphenicol acetyltransferase
fusion genes, containing promoter sequences located between
1205 and
+68,
132 and +68, and
103 and +68, relative to the transcription
start site, has been described (51), as has the generation of a
site-directed mutation of both IGFBP-1 IRS motifs in the context of the
1205 to +68 promoter fragment (52). The construction of a human
pcDNA3-FKHR expression vector has also been previously described
(32). All plasmid constructs were purified by centrifugation through
cesium chloride gradients (49).
Cell Culture and Transient Transfection--
Rat H4IIE hepatoma
cells were grown in Dulbecco's modified Eagle's medium containing
2.5% (v/v) fetal calf serum and 2.5% (v/v) newborn calf serum. Human
HepG2 hepatoma cells were grown in the same media supplemented with 5%
(v/v) Nu serum IV (Becton Dickinson). H4IIE and HepG2 cells were
transiently transfected in suspension with the plasmids indicated in
the figure legends using the calcium phosphate-DNA co-precipitation
method as previously described (22, 26, 50). In experiments using HepG2
cells, an expression vector encoding the insulin receptor, courtesy of Dr. Jonathan Whittaker, was co-transfected with the reporter gene construct.
CAT,
-Galactosidase, and Luciferase Assays--
CAT and
-galactosidase assays were performed exactly as previously described
(14). Luciferase assays were performed using the Promega
Dual-Luciferase Reporter Assay System according to the instructions
from the manufacturer . For comparisons of basal gene expression, basal
CAT activity directed by the various fusion gene constructs was
corrected for the
-galactosidase activity in the same samples.
Because insulin stimulates Rous sarcoma virus-
-galactosidase expression in HepG2 cells and SV40-Renilla luciferase
expression in H4IIE cells (data not shown), for comparisons of the
effect of insulin on fusion gene expression, CAT or firefly luciferase activity from control and insulin-treated cells was corrected for the
protein concentration in the cell lysate, as measured by the Pierce BCA
assay. Each construct was analyzed in duplicate or in quadruplicate in
multiple transfections, as specified in the figure legends, using
several independent plasmid preparations.
Gel Retardation Assay--
A plasmid encoding a glutathione
S-transferase (GST)-FKHR fusion protein (32) was transformed
into Escherichia coli (XL1-Blue). This plasmid was derived
from the pGEX-5X-3 vector (Amersham Biosciences) such that fusion gene
expression can be induced by
isopropyl-1-thio-
-D-galactopyranoside (IPTG) (32).
Bacteria were grown to an A600 of ~0.7 in LB
supplemented with 200 µg/ml ampicillin, and GST-FKHR expression was
induced by incubation with 1 mM IPTG for 2 h at
37 °C. Bacteria were pelleted by centrifugation; resuspended in 50 mM HEPES, pH 7.5, 200 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride; and lysed by sonication. Complementary oligonucleotides representing the wild type G6Pase region
B sequence between
196 and
155 (Table I) were synthesized with
BamHI-compatible ends, gel-purified, annealed, and then
labeled with [
-32P]dATP by using the Klenow fragment
of E. coli DNA polymerase I to a specific activity of ~2.5
µCi/pmol (49). Labeled oligonucleotide (~7 fmol) was incubated with
bacterial lysate (~12 µg) in a reaction volume of 20 µl
containing, at final concentrations, 25 mM HEPES, pH 7.5, 100 mM NaCl, 2 mM dithiothreitol, 5% glycerol
(v/v), 1 mg/ml bovine serum albumin, and 20 ng of
poly(dG-dC)·poly(dG-dC). For competition experiments, unlabeled
competitor DNA was mixed with the labeled oligomer at the indicated
molar excess prior to the addition of bacterial extract. After
incubation for 10 min on ice, the reactants were loaded onto a 6%
polyacrylamide gel and electrophoresed at 4 °C for 120 min at 190 V
in 0.5× TBE (49). Following electrophoresis the gels were dried and
exposed to Kodak XAR5 film, and binding was analyzed by
autoradiography. Data were quantitated through the use of a Packard
Instant Imager.
Chromatin Immunoprecipitation Assays--
ChIP assays were
performed using a modification of published procedures (53-55) as
previously described (56). For experiments using HepG2 cells, primers
were designed to amplify the human G6Pase promoter (5' to 3';
304GTAGACTCTGTCCTGTGTCTCTGGCCTG
277
and
49GGTCAACCCAGCCCTGATCTTTGGACTC
76) and
exon 5 (5' to 3';
686AATGCCAGCCTCAAGAAATATTTTCTC712 and
861AGGCTGGCAAAGGGTGTGGTGTCAATG835). These
numbers are based on the human G6Pase cDNA and promoter sequence
reported by Lei et al. (8) and Schmoll et al.
(57), respectively. The human G6Pase promoter and exon 5 were amplified using the Qiagen Master Mix and the following reaction conditions: (i)
promoter (95 °C, 30 s, 68 °C, 30 s
(
1 °C/cycle × 4), 72 °C, 30 s and then 95 °C,
30 s, 64 °C, 30 s, 72 °C, 30 s for 25 cycles followed by 72 °C, 5 min); and (ii) exon 5 (95 °C, 30 s,
57 °C, 30 s, 72 °C, 30 s for 29 cycles followed by
72 °C, 5 min). For experiments using H4IIE cells, primers were
designed to amplify the rat G6Pase promoter (5' to 3';
307CAGACTCTGCCCTGAGCCTCTGGCCTG
281
and
35CCCTGGATTCAGTCTGTAGGTCAACCTAGC
64) and
exon 5 (5' to 3'; 723GTTTGGTTTCGCACTTGGAT742
and 940GCAGTTCTCCTTTGCAGCTC921). These
numbers are based on a combination of the rat G6Pase cDNA and gene
sequence reported by Haber et al. (58) and Argaud et
al. (59), respectively. The rat G6Pase promoter and exon 5 were
amplified using the Qiagen Master Mix and the following reaction
conditions: (i) promoter (95 °C, 30 s, 70 °C, 30 s
(
1 °C/cycle × 4), 72 °C, 30 s and then 95 °C,
30 s, 66 °C, 30 s, 72 °C, 30 s for 25 cycles
followed by 72 °C, 5 min) (ii) exon 5 (95 °C, 30 s,
51 °C, 30 s (
1 °C/cycle × 4), 72 °C, 30 s
and then 95 °C, 30 s, 47 °C, 30 s, 72 °C, 30 s
for 25 cycles followed by 72 °C, 5 min). PCR products were
visualized by electrophoresis on 2% agarose gels containing ethidium bromide.
Statistical Analyses--
The transfection data were analyzed
for differences from the control values, as specified in the figure
legends. Statistical comparisons were calculated using either a paired
Student's t test or an unpaired Student's t
test, as indicated. The level of significance was p < 0.05 (two-sided test).
 |
RESULTS |
The G6Pase Promoter Contains Three IRSs That Can Each Confer an
Inhibitory Effect of Insulin on the Expression of a Heterologous Fusion
Gene--
We have previously shown that an oligonucleotide
representing region B of the G6Pase promoter can confer an inhibitory
effect of insulin on the expression of a heterologous fusion gene (14, 15). Region B contains three elements, designated IRS 1, IRS 2, and IRS
3, that closely match the PEPCK-like IRS consensus sequence (Fig.
1A; Ref. 14). However, these
IRSs are not identical and only the sequence representing IRS 2 had
been shown to independently mediate an inhibitory effect of insulin on
the expression of a heterologous fusion gene (22); it had not
previously been determined whether the same was true for IRS 1 and IRS
3. This is an important caveat because the proposed consensus sequence
for the PEPCK-like IRS is only based on a comparison of IRS motifs in
various insulin-regulated genes, rather than a precise base-by-base
analysis of this element. Thus, we sought to determine whether IRS 1 and 3 could independently confer an effect of insulin on the expression
of a heterologous herpes simplex virus TK-luciferase fusion gene (Fig.
1A). Double-stranded oligonucleotides representing IRS 1 and
3 were synthesized and ligated in triplicate into the TK promoter, and
the effect of insulin on the expression of the resulting fusion genes
was analyzed by transient transfection of the liver-derived rat H4IIE
cell line (Fig. 1B).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 1.
The G6Pase promoter contains three IRSs that
can each confer an inhibitory effect of insulin on the expression of a
heterologous fusion gene. Panel A, model of the
TK-pGL3 vector. The TK promoter sequence extends from 480 to +51 and
contains a BamHI site located between positions 40 and
35 into which oligonucleotides representing the WT or mutated G6Pase
promoter sequence located between 197 and 159, or individual IRS
motifs, were ligated in the same orientation as that in the G6Pase
promoter. The mutated G6Pase promoter sequence contained point
mutations, shown in lowercase letters, in the
three IRS motifs and was designated TM for triple mutant.
Panel B, H4IIE cells were transiently
transfected, as described under "Experimental Procedures," with
either the basic TK-pGL3 vector or constructs in which single copies of
the oligonucleotides representing the wild-type (WT) or
mutated (TM) mouse G6Pase promoter sequence from 197 to
159, shown in panel A, or three copies of the
individual IRS 1 or IRS 3 motifs, had been ligated. Following
transfection, cells were incubated for 18-20 h in serum-free medium in
the presence or absence of 10 nM insulin. The cells were
then harvested and luciferase activity and protein concentration
assayed as described under "Experimental Procedures." Results are
presented as the ratio of luciferase activities, corrected for the
protein concentration in the cell lysate, in insulin-treated
versus control cells and are expressed as percentage of
control. Results represent the mean ± S.E. of three experiments,
in which each construct was assayed in duplicate. *, p < 0.05 versus TK-pGL3 control vector.
|
|
We have previously shown that insulin has little effect on reporter
gene expression directed by the native TK promoter, whereas ligation of
an oligonucleotide representing the wild-type (WT) G6Pase region B
sequence between
197 and
159 into the TK promoter confers an
insulin-dependent inhibition of fusion gene expression (Fig. 1B; Ref. 14). In contrast, when an oligonucleotide
representing this region B sequence, but containing point mutations in
each putative IRS motif (Fig. 1A; TM), is ligated
into the TK promoter, it does not confer an
insulin-dependent inhibition of reporter gene expression
(Fig. 1B; Ref. 14). Fig. 1B shows that, when three copies of IRS 1 or 3 were ligated into the TK promoter, they
conferred an insulin-dependent inhibition of luciferase
expression (Fig. 1B). Single copies of IRS 1 and IRS 3 each
mediated an inhibitory effect of insulin on luciferase expression as
well, albeit to a smaller degree than three copies (data not shown).
These results suggest that G6Pase IRS 1, IRS 2, and IRS 3 can
individually be defined as IRSs.
Disruption of the IGFBP-1 IRSs Results in a Significant Decrease in
Basal Fusion Gene Expression, but Disruption of the G6Pase IRSs Does
Not--
Results from a number of studies suggest that, when
overexpressed, FKHR can mediate insulin repression of IGFBP-1 and
G6Pase gene transcription through their PEPCK-like IRS motifs (32, 34,
38, 60). In addition, we have previously shown that recombinant FKHR
can bind an oligonucleotide representing the wild-type G6Pase region B
sequence, but not an oligonucleotide containing point mutations in each
of the three region B IRS motifs (Fig. 1A; Ref. 16). Because
the ability of FKHR to bind these oligonucleotides in vitro
correlates with their ability to mediate an insulin effect in
situ (Fig. 1B), this suggests that FKHR, even at
endogenous levels, may function as an IRF. To further investigate
whether endogenous levels of FKHR mediate the inhibitory effect of
insulin on G6Pase, and also IGFBP-1 gene expression, the effects of
deleting/mutating the G6Pase and IGFBP-1 IRSs on basal fusion gene
expression were investigated. We reasoned that if insulin represses
G6Pase and IGFBP-1 gene expression simply by inhibiting FKHR
transactivation, as proposed (see Introduction), then we would predict
that deletions/mutations that prevent FKHR binding should result in a
decrease in basal gene expression.
We first sought to determine whether deletion of both IGFBP-1 IRSs
results in a decrease in basal IGFBP-1 gene expression. To address this
question, liver-derived human HepG2 cells were transiently transfected
with an IGFBP-1-CAT fusion gene containing promoter sequence located
between
132 and +68, which includes both IGFBP-1 IRS motifs, or an
IGFBP-1-CAT fusion gene containing promoter sequence located between
103 and +68, in which both IRS motifs have been deleted (Fig.
2A). Deletion of the IGFBP-1 IRSs resulted in a significant decrease in basal fusion gene expression (Fig. 2A). Next, HepG2 cells were transiently transfected
with an IGFBP-1-CAT fusion gene containing promoter sequence located between
1205 and +68 or a fusion gene, designated
1205 DM,
containing the same promoter sequence but with both IRS motifs mutated
(Fig. 2A). The mutations introduced into the IGFBP-1
promoter have been previously shown to disrupt FKHR binding to the
IGFBP-1 IRSs in vitro (32). Fig. 2A shows that
mutation of the two IGFBP-1 IRS motifs resulted in a significant
decrease in basal fusion gene expression. The results of these
experiments, in which the IGFBP-1 IRS motifs have been deleted or
mutated, are consistent with the proposed model for the role of FKHR as
an activator of basal IGFBP-1 gene transcription that is disabled by
insulin signaling.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Disruption of the IGFBP-1 IRSs results in a
significant decrease in basal fusion gene expression, but disruption of
the G6Pase IRSs does not. HepG2 cells were transiently
co-transfected, as described under "Experimental Procedures," with
various IGFBP-1-CAT (panel A) or G6Pase-CAT
(panel B) fusion genes (15 µg) and expression
vectors encoding either the insulin receptor (5 µg) or
-galactosidase (2.5 µg). The G6Pase and IGFBP-1 fusion genes
contained either distinct lengths of WT promoter sequence, as indicated
by the 5' deletion end points, or site-directed mutations of the two
IGFBP-1 IRS motifs, designated DM for double mutant, or the
three G6Pase IRS motifs, designated TM, for triple mutant.
Following transfection cells were incubated for 18-20 h in serum-free
medium. The cells were then harvested, and CAT and -galactosidase
activity were assayed as described under "Experimental Procedures."
Results are presented as the ratio of CAT: -galactosidase activity
relative to the value obtained with the 132, 1205 WT, 198, or
231 WT fusion genes as shown. Results represent the mean ± S.E.
of 3 (panel A) or 10 (panel
B) experiments, each using independent preparations of each
plasmid construct, in which each construct was assayed in
quadruplicate. *, p < 0.05. Schematic representations
of the locations of the IRSs in the IGFBP-1 and G6Pase promoters are
shown.
|
|
Similar experiments were then performed to investigate the effect of
deleting/mutating the G6Pase IRSs on basal fusion gene expression.
HepG2 cells were transiently transfected with a G6Pase-CAT fusion gene
containing promoter sequence located between
198 and +66, which
includes all three IRS motifs, or a G6Pase-CAT fusion gene containing
promoter sequence located between
158 and +66, in which all three IRS
motifs have been deleted (Fig. 2B). Surprisingly, deletion
of the G6Pase IRSs resulted in a significant increase in basal fusion
gene expression (Fig. 2B). Next, HepG2 cells were
transiently transfected with a G6Pase-CAT fusion gene containing
promoter sequence located between
231 and +66 or a fusion gene,
designated
231 TM, containing the same promoter sequence but with all
three IRS motifs mutated (Fig. 2B). The mutations introduced
into the G6Pase promoter have been previously shown to disrupt FKHR
binding to the G6Pase IRSs in vitro (16). Fig. 2B
shows that mutation of the three G6Pase IRS motifs did not result in a
significant change in basal fusion gene expression. The results of
these experiments, in which the G6Pase IRS motifs have been deleted or
mutated, did not appear to be consistent with the proposed model for
the role of FKHR in the insulin-dependent inhibition of
G6Pase gene transcription. Therefore, the molecular basis for these
observations were investigated further.
FKHR Activates G6Pase-CAT Fusion Gene Expression--
We
hypothesized that one possible explanation for the unexpected absence
of a decrease in basal G6Pase fusion gene expression upon
deletion/mutation of the three IRSs in region B was that a
transcriptional activator, such as FKHR, does not bind region B
in situ. To address this possibility, we determined whether overexpression of FKHR could stimulate G6Pase fusion gene expression. Thus, although FKHR is expressed in HepG2 cells (34) and overexpression of FKHR stimulates both endogenous G6Pase (61) and G6Pase fusion gene
(34) expression in H4IIE cells, FKHR has not previously been shown to
stimulate G6Pase gene expression in HepG2 cells. This is an important
distinction because the hormonal regulation of fusion gene expression
can differ markedly in these two cell types (62).
To determine whether FKHR can stimulate G6Pase fusion gene expression
in HepG2 cells, a G6Pase-CAT fusion gene, containing promoter sequence
located between
751 and +66, was co-transfected with either a control
expression vector or the same vector encoding FKHR. At the maximum
amount assayed (1 µg), the control expression vector had no effect on
basal G6Pase-CAT fusion gene expression (data not shown). In contrast,
overexpression of FKHR in HepG2 cells stimulated G6Pase-CAT fusion gene
expression in a concentration-dependent fashion (Fig.
3A), but insulin was able to
repress both basal and FKHR-stimulated G6Pase-CAT fusion gene
expression to the same degree (Fig. 3B). To determine
whether the stimulation of G6Pase-CAT fusion gene expression by FKHR
was mediated through region B, HepG2 cells were transiently transfected
with a G6Pase-CAT fusion gene containing a promoter sequence located
between
231 and +66 or the fusion gene described above, designated
231 TM, that contains the same promoter sequence but with all three
IRS motifs mutated (Fig. 3C). This G6Pase promoter sequence
between
231 and +66 is the shortest sequence that contains both
regions A and B, and confers a maximal repression of basal G6Pase-CAT
fusion gene transcription by insulin (15). Fig. 3C shows
that mutation of the three G6Pase IRS motifs, which disrupts FKHR
binding to the G6Pase IRSs in vitro (16), also abolished the
stimulatory effect of FKHR on fusion gene expression. This result
demonstrates that the stimulatory effect of FKHR on G6Pase fusion gene
expression is mediated through region B and provides evidence that FKHR
can bind region B in situ when overexpressed.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
FKHR activates G6Pase-CAT fusion gene
expression through the IRS motifs and binds the G6Pase promoter
in situ. Panels A and
B, HepG2 cells were transiently co-transfected, as described
under "Experimental Procedures," with a G6Pase-CAT fusion gene (15 µg), containing promoter sequence located between 751 and +66, and
expression vectors encoding either the insulin receptor (5 µg) or
-galactosidase (2.5 µg), and also various amounts of either a
pcDNA3 expression vector encoding FKHR or the empty pcDNA3
vector control. Following transfection, cells were incubated for 18-20
h in serum-free medium in the absence (A) or presence
(B) of 100 nM insulin. The cells were then
harvested, and CAT activity, -galactosidase activity, and protein
concentration were assayed as described under "Experimental
Procedures." In panel A, results are presented
as the ratio of CAT: -galactosidase activity relative to the value
obtained in the absence of FKHR. Results represent the mean ± S.E. of three experiments, in which each point in the dose-response
curve was assayed in quadruplicate. At the maximum amount assayed (1 µg), the empty pcDNA3 vector had no effect on basal G6Pase-CAT
fusion gene expression (data not shown). In panel
B, results are presented as the ratio of CAT activities,
corrected for the protein concentration in the cell lysate, in
insulin-treated versus control cells, expressed as percent
control, and represent the mean ± S.E. of three experiments, in
which each point in the dose response curve was assayed in duplicate.
Panel C, HepG2 cells were transiently
co-transfected with either the pCDNA3 expression vector encoding
FKHR or the empty vector control (1.0 µg) and G6Pase-CAT fusion genes
(15 µg), containing either the WT promoter sequence located between
231 and +66, or the same sequence but with point mutations (Fig.
1A) in each of the three IRS motifs ( 231 TM). Expression
vectors encoding either the insulin receptor (5 µg) or
-galactosidase (2.5 µg) were also included. Results are presented
as the ratio of CAT: -galactosidase activity relative to the value
obtained with the 231 WT fusion gene in the absence of FKHR. Results
represent the mean ± S.E. of three experiments, in which each
experimental condition was assayed in quadruplicate. *,
p < 0.05. Panels D and
E, FKHR binding to the G6Pase promoter was analyzed in
situ in control or insulin-treated HepG2 and H4IIE cells using the
ChIP assay as described under "Experimental Procedures." Chromatin
from formaldehyde-treated HepG2 or H4IIE cells was immunoprecipitated
using anti-FKHR antibodies or, as a control, using IgG. The presence of
the G6Pase promoter (D) and exon 5 (E) in the
chromatin preparation prior to immunoprecipitation (input) and in the
immunoprecipitates was then assayed using PCR as described under
"Experimental Procedures." MW, molecular weight.
Representative experiments are shown. The data in panel
E were obtained using chromatin isolated from
formaldehyde-treated HepG2 cells incubated in the absence of
insulin.
|
|
To determine whether endogenous FKHR is also bound to the endogenous
G6Pase promoter in the absence of insulin, ChIP assays (53, 63) were
performed. Fragmented chromatin from formaldehyde-cross-linked HepG2 or
H4IIE cells was subjected to immunoprecipitation with an FKHR antibody,
and the presence of the G6Pase promoter in the immunoprecipitates was
then analyzed by PCR using primers representing the proximal G6Pase
promoter sequence. As can be seen from Fig. 3D, in the basal
state, the G6Pase promoter is enriched in the FKHR-immunoprecipitate
compared with the IgG control. In contrast, this enrichment was
abolished when this analysis was repeated using cells that were
pretreated with insulin for 15 min (Fig. 3D). The same
results were obtained when these analyses were performed using HepG2 or
H4IIE cells (Fig. 3D). These data are consistent with the
proposed model of insulin action on FKHR in that insulin stimulates the
phosphorylation and nuclear exclusion of FKHR within 15 min of insulin
treatment (36, 37, 40).
To test the specificity of the antibody-chromatin interactions, these
immunoprecipitates were also analyzed for the presence of exon 5 of the
G6Pase gene (8, 59) using PCR primers that represent G6Pase exon 5 coding sequence. Approximately 10.1 kbp of genomic DNA separates exon 5 and the human G6Pase promoter (8, 50) and FKHR would not be predicted
to associate with exon 5. As expected, no enrichment of human G6Pase
exon 5 was detected in the FKHR immunoprecipitate compared with the IgG
control (Fig. 3E). The absence of a signal in the
experimental lanes cannot be explained by the lack of chromatin
containing human G6Pase exon 5 sequence in the starting material, as a
signal of the expected size can be seen in the chromatin input prior to
immunoprecipitation. The same result was obtained when this analysis
was repeated using H4IIE cells (data not shown). Together, these
results demonstrate that FKHR binds to the G6Pase promoter inside
intact HepG2 and H4IIE cells and that insulin disrupts this association.
FKHR Binds G6Pase IRS 1 and IRS 2, but It Does Not Bind IRS
3--
Based on these results, we sought to develop an alternate
hypothesis to explain the unexpected absence of a decrease in basal G6Pase fusion gene expression upon deletion/mutation of the three IRSs
in region B (see above). Although the three IRSs in region B can each
mediate an inhibitory effect of insulin on fusion gene expression (Fig.
1B), slight sequence variations exist between the individual
motifs (Fig. 1A) and these differences are conserved, with
the exception of a single base pair, in the rat and human G6Pase
promoters (14). This suggests that these sequence variations may have
some functional significance. Interestingly, there are more than 100 members of the winged helix/forkhead transcription factor family (64),
many of which, like FKHR, bind A/T-rich sequences (65). We therefore
hypothesized that the different IRS motifs within region B may bind
distinct members of the winged helix/forkhead transcription factor
family. Furthermore, if correct, a model could be envisaged in which a
transcriptional activator, potentially FKHR, and a transcriptional
repressor bind the individual IRS motifs within region B, such that no
net change in basal G6Pase fusion gene expression is detected upon
deletion/mutation of these three motifs.
To begin to explore this alternate model, we first investigated
the ability of FKHR to bind the individual region B IRS motifs using
the gel retardation assay (Fig. 4). When
a labeled double-stranded oligonucleotide, designated G6P IRS WT,
representing the wild-type G6Pase region B promoter sequence from
196
to
155 (Table I), was incubated with a
crude extract prepared from bacterial cells expressing a GST-FKHR
fusion protein, a single IPTG-induced protein-DNA complex was detected
(Fig. 4A, arrow). The G6P IRS WT oligonucleotide competed effectively for the binding of the induced protein-DNA complex
(Fig. 4, A-C), whereas an oligonucleotide designated G6P IRS TM, which contains point mutations in all three of the individual IRS motifs (Table I), failed to compete with the labeled probe for
protein binding (Fig. 4, A-C). These results demonstrate
that this is a specific protein-DNA interaction.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
FKHR binds G6Pase IRS 1 and IRS 2, but it
does not bind IRS 3 in vitro. Panel
A, a labeled probe, designated G6P IRS WT (Table I),
representing the wild-type sequence of the three G6Pase IRS motifs, was
incubated in the absence ( ) or presence of a 100-fold molar excess of
various unlabeled competitor DNAs, the sequences of which are shown in
Table I. Bacterial extract from either control ( ) or IPTG-treated (+)
cells transformed with a plasmid encoding a GST-FKHR fusion protein was
then added and protein binding analyzed using the gel retardation assay
as described under "Experimental Procedures." The specific
IPTG-induced protein-DNA complex is indicated by the arrow.
In the representative autoradiograph shown, only the retarded complexes
are visible and not the free probe, which was present in excess.
Panels B and C, gel retardation
experiments were performed as described in panel
A except that a variable molar excess unlabeled competitor
DNAs was used as shown and data were quantitated using a Packard
Instant Imager. Results represent the mean ± S.E. of at least
three experiments.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Sequences of the sense strands of oligonucleotides used in these
studies
These oligonucleotides were all used in gel retardation analyses (Figs.
4 and 6) except for G6P IRS 3:3:3 and G6P IRS 1:2:1. The latter are
shown to illustrate the mutations introduced into the G6Pase-CAT fusion
gene constructs of the same name (Figs. 5, 7, and 8). All nucleotide
positions are numbered relative to the transcription start site at +1
of the mouse G6Pase gene. The IRSs are boxed, and mutations introduced
into the IRSs are shown in lowercase
letters.
|
|
Competition experiments, in which a variable molar excess of unlabeled
DNA was incubated with the labeled probe, were used to determine which
of the three IRS motifs bind FKHR. The unlabeled competitors contained
point mutations in the IRS motifs, either individually or in
combination (Table I). A representative autoradiograph is shown in Fig.
4A, whereas panels B and C
show quantified data from multiple experiments. Fig. 4B
shows the results of competition experiments using oligonucleotides in
which only one IRS motif was left intact. Overall, these experiments
indicate that FKHR binds IRS 1 with high affinity and IRS 2 with low
affinity, but that it does not bind IRS 3. Thus, an oligonucleotide
containing point mutations in IRS 2 and 3, designated G6P IRS 2 + 3 SDM, competed effectively against the G6P IRS WT probe for FKHR binding (Fig. 4B), indicating that FKHR can bind IRS 1. In contrast,
an oligonucleotide containing point mutations in IRS 1 and 2, designated G6P IRS 1 + 2 SDM, did not compete for FKHR binding (Fig.
4B), indicating that FKHR cannot bind IRS 3. An
oligonucleotide containing point mutations in IRS 1 and 3, designated
G6P IRS 1 + 3 SDM, competed against the labeled probe for FKHR binding,
but not as well as the unlabeled G6P IRS WT or G6P IRS 2 + 3 SDM
oligonucleotides (Fig. 4B). This suggests that FKHR can bind
IRS 2, but that it does so with a lower affinity than it binds IRS 1.
Fig. 4C shows the results of competition experiments using
oligonucleotides in which only one IRS motif was mutated. The results of these experiments are consistent with the conclusion that FKHR binds
IRS 1 with high affinity and IRS 2 with low affinity, but that it does
not bind IRS 3 (Fig. 4C). Thus, an oligonucleotide containing a point mutation in IRS 1, designated G6P IRS 1 SDM, competed poorly against the G6P IRS WT probe for FKHR binding (Fig.
4C), indicating that FKHR does bind IRS 1. This result also reveals that FKHR can bind IRS 2 with a low affinity, given that it
does not bind IRS 3 (see above). In contrast, an oligonucleotide containing a point mutation in IRS 3, designated G6P IRS 3 SDM, competed as well as the unlabeled G6P IRS WT oligonucleotide for FKHR
binding (Fig. 4C), indicating that IRS 3 is not required for
FKHR binding to the G6P IRS WT probe. An oligonucleotide containing a
point mutation in IRS 2, designated G6P IRS 2 SDM, competed against the
labeled probe for FKHR binding but not as well as the unlabeled G6P IRS
WT oligonucleotide (Fig. 4C), indicating that FKHR does bind
IRS 2. The fact that the G6P IRS 2 SDM oligonucleotide competes much
more effectively than the G6P IRS 1 SDM oligonucleotide for FKHR
binding is again consistent with the conclusion that FKHR binds IRS 1 with higher affinity than IRS 2 (Fig. 4C).
The conclusions reached through these in vitro FKHR binding
analyses are supported by experiments in which HepG2 cells were co-transfected with G6Pase-CAT fusion genes containing the same IRS
mutations as described above (Table I), along with either a control
expression vector or the same vector encoding FKHR. These mutations
were all generated in the context of the
231 to +66 G6Pase-CAT fusion
gene, which again contains both regions A and B, and therefore mediates
a maximal repression of basal G6Pase-CAT fusion gene expression by
insulin (15). FKHR induced expression of the wild-type
231 G6Pase-CAT
fusion gene, but it did not induce expression of the
231 TM fusion
gene in which all three IRS motifs have been mutated (Figs.
3C and 5). Mutation of IRS 1 or IRS 2, or both together,
reduced the stimulatory effect of FKHR on G6Pase-CAT fusion gene
expression, whereas mutation of IRS 3 did not (Fig.
5). These results are consistent with the observation that FKHR can bind both IRS 1 and IRS 2, but that it cannot
bind IRS 3 (Fig. 4). Mutation of all three IRSs together had a more
deleterious effect on the induction of G6Pase-CAT fusion gene
expression by FKHR than mutation of either IRS 1 or IRS 2 alone (Fig.
5).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
The stimulation of G6Pase-CAT fusion gene
expression by FKHR requires IRS 1 and IRS 2, but not IRS 3. HepG2
cells were transiently transfected, as described under "Experimental
Procedures," with various G6Pase-CAT fusion genes (15 µg), and
expression vectors encoding the insulin receptor (5 µg) and
-galactosidase (2.5 µg) and also either a pcDNA3 expression
vector encoding FKHR or the empty pcDNA3 vector control (1.0 µg).
The G6Pase-CAT fusion genes contained either the WT promoter sequence
located between 231 and +66, or the same sequence but containing
various mutations in the G6Pase IRS motifs, as shown in Table I.
Following transfection, cells were incubated for 18-20 h in serum-free
medium. The cells were then harvested, and CAT activity and
-galactosidase activity were assayed. Results are presented as the
ratio of CAT: -galactosidase activity relative to the value obtained
in the absence of FKHR and are expressed as -fold induction. Results
represent the mean ± S.E. of three experiments, in which each
construct was assayed in duplicate. *, p < 0.05 versus 231 WT; **, p < 0.05 versus 231 TM.
|
|
The relative location of the individual IRS motifs does not appear to
be significant with respect to transactivation by FKHR. Thus, a
G6Pase-CAT fusion gene, designated
231 IRS 3:3:3, was generated in
which the sequence of IRS 1 and 2 were switched to that of IRS 3. Although this fusion gene contains three consecutive IRS 3 elements
(Table I), its expression was still not induced by FKHR overexpression
(Fig. 5), suggesting that IRS 3 cannot bind FKHR even when
multimerized. These results indicate that IRS 3 is neither necessary
nor sufficient to mediate FKHR transactivation in the context of the
G6Pase promoter. In contrast, when the sequence of IRS 3 is switched to
that of IRS 1 (Table I), to create a construct designated
231 IRS
1:2:1, the induction of fusion gene expression by FKHR was enhanced
(Fig. 5), consistent with enhanced FKHR binding. In summary, results
from these FKHR overexpression studies are consistent with the in
vitro FKHR binding studies (Fig. 4), because the ability of FKHR
to bind IRS 1, 2, and 3 in vitro corresponds with its
ability to activate G6Pase-CAT fusion gene expression through these
motifs in situ (Fig. 5). Overall, these results indicate
that the single base pair variations between the three region B IRS
motifs (Fig. 1A) affect FKHR binding affinity. Most
significantly, the fact that the region B IRS 3 motif can mediate an
inhibitory effect of insulin on the expression of a heterologous fusion
gene (Fig. 1), but cannot bind FKHR (Fig. 4), indicates the existence
of an insulin response factor other than FKHR that can regulate gene
expression through the PEPCK-like IRS motif.
One possible caveat to this conclusion is that the configuration of the
triple IRS 3 element that was used in the heterologous fusion gene
experiment (Fig. 1) might bind FKHR even though, in the context of the
region B sequence, IRS 3 does not. This would then explain the ability
of IRS 3 to mediate an insulin response in a heterologous context. To
address this possibility, a labeled double-stranded oligonucleotide,
designated TK IRS 3:3:3, representing the sequence of the triple IRS 3 motifs in the IRS 3 TK-pGL3 fusion gene (Fig. 1, Table I), was
incubated with a crude extract prepared from bacterial cells expressing
a GST-FKHR fusion protein. No IPTG-induced protein-DNA complex was
detected (Fig. 6). In contrast, a single
IPTG-induced protein-DNA complex was detected when the G6P IRS WT
oligonucleotide (Table I) was used as the labeled probe (Fig. 6,
arrow). The unlabeled G6P IRS WT oligonucleotide competed
effectively for the binding of the induced protein-DNA complex (Fig.
6), whereas the TK IRS 3:3:3 oligonucleotide did not. These results
demonstrate that FKHR cannot bind the multimerized IRS 3 element, which
mediates an insulin effect on the TK-pGL3 heterologous fusion gene
(Fig. 1).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 6.
FKHR does not bind a multimerized IRS 3 motif. Labeled probes, designated G6P IRS WT or TK IRS 3:3:3
(Table I), representing the wild-type sequence of the three G6Pase IRS
motifs or the sequence of the three IRS 3 motifs in the heterologous
IRS 3 TK-pGL3 fusion gene (Fig. 1), respectively, were incubated in the
absence ( ) or presence of a 100- or 500-fold molar excess of the
unlabeled competitor DNAs shown. Bacterial extract from either control
( ) or IPTG-treated (+) cells transformed with a plasmid encoding a
GST-FKHR fusion protein was then added and protein binding analyzed
using the gel retardation assay as described under "Experimental
Procedures." The specific IPTG-induced protein-DNA complex is
indicated by the arrow. A representative autoradiograph is
shown.
|
|
G6Pase IRS 1, IRS 2, and IRS 3 Are Functionally Distinct Elements
in the Context of the G6Pase Promoter--
The observation that the
different IRS motifs within region B bind FKHR with distinct affinities
is consistent with the proposed hypothesis that the different IRS
motifs within region B bind distinct members of the winged
helix/forkhead transcription factor family. Unfortunately, the
identification of PEPCK-like IRS-binding proteins using liver/hepatoma
nuclear extracts and gel retardation analyses been largely unsuccessful
(17); even FKHR binding cannot be detected using this approach. Indeed,
the potential significance of FKHR in insulin-regulated gene
expression only became apparent through genetic studies in
C. elegans. Gel retardation experiments using G6Pase region B also fail to identify candidate factors binding
the individual IRS motifs (data not shown). Nevertheless, the
observation that the different IRS motifs within region B bind FKHR
with distinct affinities suggests that these motifs may be functionally distinct.
To explore this possibility, the same fusion gene constructs described
above were transiently transfected into HepG2 cells and the effect of
mutating the individual IRS motifs on basal G6Pase-CAT fusion gene
expression was investigated (Fig. 7). As shown in Figs. 2B and 7, basal expression of the wild-type
231 G6Pase-CAT fusion gene is similar to that of the
231 TM fusion gene in which all three IRS motifs have been mutated. Similarly, mutation of IRS 2 had little effect on basal G6Pase-CAT fusion gene
expression (Fig. 7). However, when IRS 1 was mutated, there was a
statistically significant decrease in basal fusion gene expression,
indicating that a transcriptional activator may bind this site (Fig.
7). No further reduction in basal fusion gene expression was detected
if IRS 2 was mutated in combination with mutation of IRS 1 (Fig. 7). In
contrast, when IRS 3 was mutated, there was a significant increase in
basal
231 G6Pase-CAT fusion gene expression, suggesting that a
transcriptional repressor may bind this site (Fig. 7).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
G6Pase IRS 1, IRS 2, and IRS 3 are
functionally distinct elements in the context of the G6Pase
promoter. HepG2 cells were transiently transfected exactly as
described in Fig. 5 and with the same G6Pase-CAT fusion gene
constructs, except that the expression vector encoding FKHR and the
empty pcDNA3 vector control were omitted. Following transfection,
cells were incubated for 18-24 h in serum-free medium. The cells were
then harvested, and CAT activity and -galactosidase activity were
assayed. Results are presented as the ratio of CAT: -galactosidase
activity relative to the value obtained with the 231 WT fusion gene.
Results represent the mean ± S.E. of at least six experiments, in
which each construct was assayed in duplicate. *, p < 0.05 versus 231 WT; **, p < 0.05 versus 231 IRS 1 SDM.
|
|
To further this analysis we examined the effect of switching the
sequence of IRS 1 and 2 to that of IRS 3 (Table I). The G6Pase-CAT
fusion gene containing this mutation, designated
231 IRS 3:3:3, would
be predicted to bind three repressor molecules. Fig. 7 shows that basal
CAT expression directed by this fusion gene was decreased relative to
that directed by the wild type G6Pase promoter. Moreover, the magnitude
of this decrease in basal fusion gene expression was greater than that
observed upon mutation of IRS 1 (Fig. 7). This observation is
consistent with a gain of repressor binding to IRS 1 and IRS 2 in the
231 IRS 3:3:3 construct, in conjunction with loss of activator
binding to IRS 1 (Fig. 7). We also examined the effect of switching the
sequence of IRS 3 to that of IRS 1 (Table I). The G6Pase-CAT fusion
gene containing this mutation, designated
231 IRS 1:2:1, would be predicted to bind two activator molecules. Fig. 7 shows that basal CAT
expression directed by this fusion gene was increased relative to that
directed by the wild type G6Pase promoter. However, this increase in
basal fusion gene expression was no different from that observed upon
mutation of IRS 3, suggesting that the loss of repressor binding to IRS
3, rather than the gain of activator binding, can explain this result
(Fig. 7). In contrast, this same mutation did enhance the stimulation
of G6Pase-CAT fusion gene expression by overexpressed levels of FKHR
(Fig. 5), suggesting that the effects of these mutations are dependent
upon the relative abundance of activator/repressor proteins within the cell.
In summary, these observations suggest that the three IRS motifs within
region B are functionally distinct, consistent with the observation
that they bind FKHR with differing affinities. Furthermore, the
observations that IRS 1 binds a transcriptional activator, potentially
FKHR, and that IRS 3 binds an (unidentified) transcriptional repressor
can explain why no net change in basal G6Pase fusion gene expression is
detected when these motifs are deleted/mutated in combination (Fig. 2).
G6Pase IRS 3 Is Neither Necessary nor Sufficient for the Repression
of G6Pase Fusion Gene Expression by Insulin--
Because the three IRS
motifs within region B are functionally distinct with respect to the
regulation of basal G6Pase-CAT fusion gene expression, we next
investigated the relative contribution of these motifs to the
inhibition of basal G6Pase-CAT fusion gene expression by insulin. The
same fusion gene constructs described above were transiently
transfected into HepG2 cells and the effect of mutating the individual
IRS motifs on the repression of basal G6Pase-CAT fusion gene expression
by insulin was investigated (Fig. 8). As
shown in Fig. 8, insulin repressed basal expression of the wild-type
231 G6Pase-CAT fusion gene, but had almost no effect on the
expression of the
231 TM G6Pase-CAT fusion gene in which all three
IRS motifs have been mutated. Mutation of IRS 1 or IRS 2 partially
impaired the repression of basal G6Pase-CAT fusion gene expression by
insulin, whereas mutation of IRS 1 and IRS 2 together almost completely
abolished the insulin response (Fig. 8). This suggests that both IRS 1 and IRS 2 are required for the full effect of insulin on basal
G6Pase-CAT fusion gene expression and that IRS 3 is not sufficient for
an insulin response. Surprisingly, when IRS 3 was mutated, the
repression of basal
231 G6Pase-CAT fusion gene expression by insulin
was not impaired, suggesting that IRS 3 is also not required for the
insulin response (Fig. 8). To further investigate this observation, we
examined the effect of switching the sequence of IRS 1 and 2 to that of IRS 3 (Table I). Basal expression of the G6Pase-CAT fusion gene containing this mutation, designated
231 IRS 3:3:3, was not repressed by insulin (Fig. 8). This suggests that, even when multimerized, IRS 3 is not able to mediate an effect of insulin on G6Pase-CAT fusion gene
expression (Fig. 8), although it can mediate an effect of insulin on
the expression of a heterologous fusion gene (Fig. 1B).
Finally, we also examined the effect of switching the sequence of IRS 3 to that of IRS 1 (Table I). Insulin repressed the basal expression of
the G6Pase-CAT fusion gene containing this mutation, designated
231
IRS 1:2:1, although the effect of insulin was not enhanced relative to
that seen with the wild-type
231 G6Pase-CAT fusion gene. In summary,
these observations suggest that the three IRS motifs within region B
are functionally distinct with respect to their effect on both basal
(Fig. 7) and insulin-regulated (Fig. 8) G6Pase-CAT fusion gene
expression.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
G6Pase IRS 3 is neither sufficient nor is it
required for the repression of G6Pase fusion gene expression by
insulin. HepG2 cells were transiently transfected exactly as
described in Fig. 5 and with the same G6Pase-CAT fusion gene constructs
except that the expression vector encoding FKHR and the empty
pcDNA3 vector control were omitted. Following transfection the
cells were incubated for 18-20 h in serum-free medium in the presence
or absence of 100 nM insulin. The cells were then
harvested, and CAT activity and the protein concentrations of the cell
lysates were assayed. Results are presented as the ratio of CAT
activities, corrected for the protein concentration in the cell lysate,
in insulin-treated versus control cells, expressed as
percentage of control, and represent the mean ± S.E. of nine
experiments, in which each construct was assayed in duplicate. *,
p < 0.05 versus 231 WT; **,
p < 0.05 versus 231 IRS 1 SDM or 231
IRS 2 SDM.
|
|
 |
DISCUSSION |
In both poorly controlled type I diabetics and in type II
diabetics, the ability of insulin to stimulate peripheral glucose utilization and to repress hepatic glucose production (HGP) is reduced
as a consequence of insulin resistance. The elevated HGP results from
an increased rate of gluconeogenesis (66, 67), and evidence suggests
that this can be explained in part by increased expression of key
gluconeogenic enzymes, such as G6Pase (68, 69). Clearly a better
understanding of the mechanism by which insulin inhibits G6Pase gene
transcription has the potential to reveal novel therapeutic targets for
treatment of this increased HGP. In particular, identification of the
insulin response factor(s) that mediates the inhibitory effect of
insulin on G6Pase and PEPCK gene transcription through the PEPCK-like
IRS motifs is of major interest.
Substantial attention has recently focused on the potential role of the
winged helix/forkhead transcription factor FKHR and its orthologs,
FKHRL1 and AFX, as the elusive IRF. Moreover, a signaling pathway has
been proposed in which insulin inhibits FKHR-, FKHRL1-, and
AFX-mediated transcriptional activation through the
phosphatidylinositol 3-kinase-dependent activation of PKB, which then leads to the phosphorylation and nuclear exclusion of these
factors (33, 36-42).
There are several studies that support the involvement of this pathway
in the regulation of G6Pase gene expression by insulin. Thus, FKHR
binds region B in the G6Pase promoter, which contains three PEPCK-like
IRS motifs (16, 34), and overexpression of FKHR stimulates G6Pase
fusion gene expression through these elements in both H4IIE (34) and
HepG2 (Fig. 3, A-C) cells. Moreover, overexpression of
constitutively active PKB mimics the inhibitory effect of insulin on
G6Pase fusion gene expression, an effect that is mediated through the
G6Pase PEPCK-like IRS motifs and is blocked by overexpression of a
PKB-insensitive FKHR mutant (34). Similarly, disruption of FKHR
expression or overexpression of a non-insulin-sensitive FKHR mutant
alters G6Pase gene expression in vivo in a manner consistent
with the hypothesis that FKHR directly regulates expression of this
gene (70). Finally, expression of FKHR in kidney cells, in which G6Pase
gene expression is normally refractory to insulin action, confers
insulin-regulated G6Pase gene expression (71). This latter study
demonstrates that FKHR can function as an IRF through the PEPCK-like
IRS motif. However, a concern with the interpretation of studies in
which wild-type or mutated forms of FKHR have been overexpressed in
liver cells, in which insulin regulates endogenous G6Pase gene
expression, is that FKHR is simply displacing the endogenous IRF. To
avoid this complication, the experiments described in this report were specifically designed to assess what role, if any, endogenous transcriptional activators, such as FKHR, play in the repression of
basal G6Pase and IGFBP-1 gene transcription by insulin. ChIP assays
demonstrate that FKHR does bind the G6Pase promoter in situ
and that insulin inhibits this binding (Fig. 3D). Moreover, mutations in G6Pase IRS 1 and IRS 2, which prevent FKHR binding (Fig.
4), also block the inhibitory effect of insulin (Fig. 8). However, this
correlation is not perfect because mutations in IRS 1 and IRS 2 are
equally deleterious to the insulin response (Fig. 8), whereas binding
analyses indicate that FKHR binds IRS 1 with much higher affinity than
it binds IRS 2 (Fig. 4). This suggests that either (i) other factors
bound to the G6Pase promoter influence the binding affinity of FKHR to
IRS 1 and IRS 2 in situ or (ii) another factor(s) exists
that functions as an IRF, besides FKHR and its orthologs, which have
almost identical binding specificities (72). The former idea is not
consistent with the observation that mutation of IRS 1, although not
IRS 2, reduces basal G6Pase fusion gene expression (Fig. 7). In
contrast, the existence of IRFs, other than FKHR and its orthologs, is
supported by the studies of Hall and colleagues (46), who demonstrated
that the binding of FKHRL1 to the PEPCK IRS only correlates with the
effect of insulin mediated through that element when FKHRL1 is
overexpressed. Thus, when FKHRL1 is overexpressed, there is a direct
correlation between the ability of mutant IRSs to bind FKHRL1 and their
ability to mediate an inhibitory effect of insulin on heterologous
fusion gene transcription. However, when FKHRL1 is not overexpressed, there is a dissociation between FKHRL1 binding and insulin action through this element (46). These studies suggest that endogenous levels
of FKHR family members likely do not function as the true IRF in this
context, but when FKHRL1 is overexpressed, it can disrupt the activity
of the true IRF and mediate an effect of insulin through the PEPCK-like
IRS. Similarly, the fact that the G6Pase IRS 3 sequence can mediate an
insulin re