JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M207970200 on January 29, 2003

J. Biol. Chem., Vol. 278, Issue 14, 12046-12054, April 4, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/14/12046    most recent
M207970200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katafuchi, T.
Right arrow Articles by Minamino, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katafuchi, T.
Right arrow Articles by Minamino, N.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Calcitonin Receptor-stimulating Peptide, a New Member of the Calcitonin Gene-related Peptide Family

ITS ISOLATION FROM PORCINE BRAIN, STRUCTURE, TISSUE DISTRIBUTION, AND BIOLOGICAL ACTIVITY*

Takeshi Katafuchi, Katsuro Kikumoto, Kazumasa Hamano, Kenji Kangawa, Hisayuki Matsuo, and Naoto MinaminoDagger

From the National Cardiovascular Center Research Institute, 5-7-1 Fujishirodai, Suita 565-8565, Osaka, Japan

Received for publication, August 5, 2002, and in revised form, December 20, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We isolated a novel biologically active peptide, designated calcitonin receptor-stimulating peptide (CRSP), from the acid extract of the porcine brain by monitoring cAMP production in the porcine kidney cell line LLC-PK1. Determination of the amino acid sequence and cDNA analysis encoding a CRSP precursor showed that this peptide has ~60% identity in the amino acid sequence with human calcitonin gene-related peptide type-alpha (alpha CGRP), type-beta (beta CGRP), and porcine CGRP. Northern blot analysis and radioimmunoassay demonstrated that CRSP is expressed mainly in the thyroid gland and the central nervous system, in which the calcitonin receptor was abundantly expressed. Synthetic CRSP elicited a potent stimulatory effect on the cAMP production in LLC-PK1 cells. Although it shows significant sequence similarity with CGRPs, this peptide did not elicit cAMP elevation in cells that endogenously expressed a CGRP receptor or an adrenomedullin receptor or were transfected with either of these recombinant receptors. Administration of CRSP into anesthetized rats did not alter the blood pressure but induced a transient decrease in the plasma calcium concentration. In fact, this peptide potently increased the intracellular cAMP concentration in COS-7 cells that expressed the recombinant calcitonin receptor. These unique properties indicate that CRSP is not a porcine counterpart of beta CGRP and probably elicits its biological effects via the calcitonin receptor.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation and sequence determination of new biologically active peptides have greatly advanced our understanding of the communication between cells and tissues. Various biologically active peptides, such as natriuretic peptides (1-3) and neuromedins (4), were isolated by monitoring smooth muscle contraction and relaxation. This strategy was useful, but relatively large amounts of tissue extracts were required to monitor the biological activities. Another strategy involving the measurement of intracellular second messenger levels has often been adopted in recent purification studies, and two methods have been successful to date. The first method is to monitor the second messenger levels in intact cultured cells obtained from a particular organ. Pituitary adenylate cyclase-activating peptide and adrenomedullin (AM)1 were identified by monitoring the adenylyl cyclase activity in the anterior pituitary cells (5) and platelets (6), respectively. The second method is to monitor the second messenger levels in cells expressing a particular orphan receptor. Orexins and ghrelin were purified by monitoring a transient intracellular calcium elevation in HEK293 cells expressing OX1R or OX2R receptor (7) and growth hormone secretagogue receptor (8), respectively.

We employed the first method to screen new biologically active peptides and measured cAMP production in LLC-PK1 cells, a cell line prepared from porcine kidney epithelial cells, because this cell line is known to express several peptide receptors that stimulate adenylyl cyclase activity (9). Vasopressin, for example, strongly stimulates adenylyl cyclase activity in LLC-PK1 cells (10). Among three isotypes of the vasopressin receptor, members of the G-protein-coupled receptor family (11, 12), V2 receptor expressing in LLC-PK1 cells (10, 13) as well as in the kidney is coupled to adenylyl cyclase (13, 14) and participates in physiological events such as anti-diuresis. Calcitonin (CT) also potently increases the cAMP production in LLC-PK1 cells (15). CT is secreted mainly from the thyroid gland and is involved in calcium resorption in the bone (16, 17) as well as calcium reabsorption in the kidney (18). The CT receptor is also a member of the G-protein-coupled receptor family, and its cDNA clone was first isolated from a cDNA library constructed from LLC-PK1 cells (19).

Although CT receptor is expressed in the central nervous system (CNS), expression of CT has not been identified in the CNS (20, 21). The CT in the systemic circulation secreted from the thyroid gland is not considered to be incorporated into the CNS beyond the blood brain barrier. Although some investigators report that brain extracts contain biologically active CT-like materials (22-24), the existence of a cognate ligand to CT receptor in the CNS remains controversial. This was another reason we chose LLC-PK1 cells to screen biologically active peptides by monitoring the adenylyl cyclase activity.

In this paper, we report the isolation and structural determination of a novel biologically active peptide from porcine brain extract by monitoring the cAMP production in LLC-PK1 cells. Although the purified peptide showed higher sequence homology to CGRP, this peptide bound to CT receptor with a higher affinity and stimulated cAMP production at a potency 350-fold greater than CT. Thus, we designated this peptide as calcitonin receptor-stimulating peptide (CRSP). The findings obtained in this study strongly suggest that CRSP is a candidate for the unidentified ligand to CT receptor in the CNS and may participate in physiological events by activating the central as well as peripheral CT receptor.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- LLC-PK1, Hs68, Swiss 3T3, and COS-7 cells (ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum supplemented with 100 µg/ml penicillin and 100 units/ml streptomycin in a humidified atmosphere of 95% air, 5% CO2 at 37 °C.

Measurement of Intracellular cAMP Production-- Cells were harvested and cultured on 48-well plates for 2 days. The cells were washed twice with DMEM/Hepes (20 mM, pH 7.4) containing 0.5 mM 3-isobutyl-1-methyl xanthine (Sigma) and 0.05% bovine serum albumin (BSA) and incubated in the same medium for 30 min at 37 °C. The incubation medium was then replaced with 150 µl of medium in which the sample of interest was dissolved and further incubated at 37 °C for another 30 min. Aliquots (100 µl) of the incubation media were succinylated, evaporated, and then submitted to radioimmunoassay (RIA) for cAMP as reported previously (6).

Isolation of CRSP-- Approximately 20 kg of porcine brain was minced and boiled for 10 min in 2 volumes (v/w) of water to inactivate the intrinsic proteases. After cooling, glacial CH3COOH was added to a final concentration of 1 M, and the boiled tissue was homogenized with a Polytron homogenizer. The homogenate was centrifuged at 17,700 × g for 25 min, and the supernatant was condensed with a Pellicon cassette (PLAC No. 000-05, Millipore). The condensate was subjected to acetone precipitation (final concentration = 66%), and the resulting supernatant was evaporated. The resulting solution was divided into four equal volumes, and each was loaded onto a LC-SORB SPW-C-ODS column (1.5 liter, Chemco, Osaka, Japan). After washing with 0.5 M CH3COOH, the materials that had adsorbed on the column were eluted with H2O:CH3CN:trifluoroacetic acid at 40:60:0.1 (v/v). The column eluates were pooled and lyophilized. The dried materials were dissolved in 1 M CH3COOH and subjected to batch chromatography on an SP-Sephadex C-25 column (H+-form, 3 × 28 cm; Amersham Biosciences). Successive elutions with M CH3COOH, 2 M pyridine, and 2 M pyridine acetate (pH 5.0) yielded three respective fractions of SP-I, SP-II, and SP-III. After lyophilization, the SP-III fraction was separated by gel filtration on a Sephadex G-50 column (fine, 75 × 1450 mm). Fractions corresponding to a relative molecular mass (Mr) of 1000-5000 were collected and subjected to a second gel filtration on a Sephadex G-25 column (fine, 75 × 1500 mm). Fractions containing peptides of Mr 3000 were pooled and subjected to carboxymethyl (CM) ion exchange chromatography (CM-52, 24 × 450 mm; Whatman) eluting with a linear gradient elution of HCOONH4 (pH 6.5) from 10 mM to 1 M in the presence of 10% CH3CN. The fractions eliciting cAMP-producing activity were pooled and re-purified by CM ion exchange high performance liquid chromatography (HPLC) (TSKgel CM-2SW, 7.8 × 300 mm; Tosoh, Japan), eluting with a linear gradient elution of HCOONH4 (pH 3.8) from 10 mM to 1 M in the presence of 10% CH3CN. The biologically active fractions were then separated by reverse phase HPLC on a C18 column (218TP54, 4.6 × 250 mm; Vydac), and the peptide was finally purified on a diphenyl column (219TP5215, 2.1 × 150 mm; Vydac) using a linear gradient elution of CH3CN from 10 to 60% in 0.1% trifluoroacetic acid. The amino acid sequence was analyzed with a Procise cLC protein sequencer (492, Applied Biosystems). After the gel filtration step, aliquots (1/2000) of all fractions in the course of purification were lyophilized, dissolved in 200 µl of incubation medium for the cAMP assay, and submitted to the cAMP assay using LLC-PK1 cells.

Molecular Cloning and Determination of cDNA Sequence of CRSP-- Both the N and C termini of CRSP were chosen to synthesize degenerated primers, and the PCR reaction was performed with those primers on porcine genomic DNA. The amplified DNA fragment was sequenced and radiolabeled as a probe for screening. Porcine hypothalamus cDNA was synthesized from 3 µg of poly(A)+ RNA using a Timesaver cDNA synthesis kit (Amersham Biosciences), inserted into lambda ZAP II bacteriophage vector (Stratagene), and packaged in vitro using Giga Pack Gold III packaging extract (Stratagene). Approximately 105 plaques were screened by the standard protocol. The hybridization buffer contained 50% formamide, 6× SSC (1× SSC = 0.15 M NaCl and 0.015 M sodium citrate), 5× Denhardt's solution, 0.5% SDS, and 106 cpm/ml of the radiolabeled probe. After hybridization at 42 °C for 16 h, the filters were washed twice with 2× SSC containing 0.1% SDS for 5 min at room temperature and washed twice with 0.2× SSC containing 0.1% SDS at 65 °C for 1 h. The filters were exposed to RX-U films (Fuji, Tokyo, Japan), and 12 positive clones were obtained. The isolated positive clones were rescued as pBluescript SK- using Escherichia coli strain SOLR and helper phage. DNA sequences of these clones were determined by the dideoxynucleotide chain termination method using a DNA sequencer (373A, Applied Biosystems).

Peptide Synthesis-- Synthetic CRSP, CRSP-(24-38), Tyr-CRSP-(24-38), and Cys-CRSP-(24-38) were prepared by solid phase techniques using N-(9-fluorenyl)methoxycarbonyl chemistry using a peptide synthesizer (431A, Applied Biosystems). An intramolecular disulfide linkage was formed by the action of K3[Fe(CN)6]. Porcine CGRP was prepared by the American Peptide Company. Synthetic peptides were purified by reverse phase HPLC and ion exchange HPLC, and correct synthesis was confirmed by amino acid analysis and sequencing. Salmon and porcine CT were purchased from Peninsula. Human AM was kindly donated by Shionogi & Co. (Osaka, Japan).

Generation of Antisera-- All experimental procedures were approved by the local animal experiments and care committee. Rabbit antibodies were raised to a peptide sequence (CRSNLLPTKMGFKVFG-NH2) that corresponds to residues 24-38 of CRSP (CRSP-(24-38)) to which an N-terminal cysteine was added to facilitate cross-linking to maleimide-activated keyhole limpet hemocyanin (Pierce). New Zealand White rabbits (Japan SLC, Hamamatsu, Japan) were immunized by injecting 1 mg of the peptide-keyhole limpet hemocyanin antigen conjugate in complete Freund's adjuvant, and antibody production was boosted by 5 additional injections of the antigen in complete Freund's adjuvant at 3-week intervals.

Northern Blot Analysis-- A CRSP probe was prepared by a PCR reaction performed on 1 ng of full-length CRSP cDNA using KOD plus polymerase and primers (CTCTCTGAGGAGGAATCACG and GAGTTCAGAGTCATAGTAACC) for 30 cycles (each cycle consisted of 15 s at 94 °C, 15 s at 55 °C, and 1 min at 72 °C). Total RNAs (30 µg) obtained from various tissues were separated on a 1.0% agarose gel containing 2.2 M formaldehyde, 20 mM Mops (pH 7.0), 8 mM CH3COONa, and 1 mM EDTA. After electrophoresis, the RNAs were transferred to a Hybond XL nylon membrane (Amersham Biosciences) and baked at 80 °C for 2 h. The filter was prehybridized in Ultrahyb hybridization solution (Ambion) for 2 h at 37 °C and then hybridized at 42 °C for 16 h with the 32P-labeled CRSP cDNA probe. The filter was washed twice with 2× SSC containing 0.1% SDS at room temperature and twice with 0.1× SSC containing 0.1% SDS at 65 °C for 1 h and exposed to RX-U film at -80 °C for 10 days with an intensifying screen.

RIA for CRSP-- N-Tyr-CRSP-(24-38) was radioiodinated by the lactoperoxidase method, and the monoiodinated peptide was purified by reverse phase HPLC. Approximately 1 g of porcine tissue was minced and boiled for 10 min in 5 ml of water. After cooling, water and glacial CH3COOH were added to a final volume and concentration of 10 ml and 1 M, respectively, and the boiled tissues were homogenized with a Polytron homogenizer. The homogenate was then centrifuged, and the resulting supernatant was lyophilized and dissolved in the same volume of RIA buffer (50 mM sodium phosphate (pH 7.4) containing 80 mM NaCl, 25 mM EDTA, 0.05% NaN3, 0.5% BSA treated with N-ethylmaleimide, and 0.5% Triton X-100). Standard CRSP-(24-38) or sample dissolved in 100 µl of RIA buffer was incubated with 100 µl each of monoiodinated N-Tyr-CRSP-(24-38) (18,000 cpm) and anti-CRSP antiserum at 4 °C for 48 h. Then 100 µl of 1% gamma -immunoglobulin and 500 µl of 23% polyethylene glycol 6000 solution were added to the reaction tubes, and the mixture was incubated on ice for 15 min. After centrifugation at 2,000 × g for 15 min, the supernatant was aspirated, and the radioactivity in the pellet was counted with a gamma  counter (ARC-1000, Aloka, Tokyo, Japan). Aliquots of all the reserved fractions at each purification step were lyophilized, dissolved in the RIA buffer for CRSP, and submitted to RIA for CRSP to evaluate the recovery yield.

Mass Spectrometry-- Mass spectra were measured using a single quadrupole mass spectrometer equipped with an electrospray ionization (ESI) source (SSQ 7000, Finnigan). Peptides (10 pmol) were dissolved in a mobile solvent (water:methanol = 50:50, 1% acetic acid) and infused using a syringe pump (5 µl/min) coupled directly to the ionization source via a fused silica capillary. Spectra were measured in a multi-channel acquisition mode in the mass range m/z 300-2000 with scan durations of 3.5 s.

Measurement of Blood Pressure-- Eight-week-old male Sprague-Dawley rats were purchased from Japan SLC. All study protocols were approved by the local animal experiments and care committee. All animals were provided free access to tap water and standard chow. The rats were anesthetized by an intraperitoneal injection of thiobutabarbital sodium salt (60 mg/kg; Wako, Osaka, Japan). Rectal temperature was monitored and maintained at 37 ± 1 °C during the entire experimental procedure, and a tracheotomy was performed to aid spontaneous breathing. The mean arterial blood pressure and heart rate were monitored through the right carotid artery using a PE 50 catheter connected to a pressure transducer (model P231D, Gould) and a polygraph (7758 B System, Hewlett-Packard), and the left jugular vein was cannulated using a PE 10 catheter for the bolus administration of peptides or vehicle. The rats were left for at least 30 min after surgery to allow for equilibration. Then 100 µl of saline containing the peptide and 0.1% BSA (n = 3) or the same amount of saline containing 0.1% BSA alone as a vehicle (n = 4) was injected through the left jugular vein. Mean arterial blood pressure and heart rate were measured 15 min before and 0, 2, 5, 10, and 30 min after the administration.

Measurement of Plasma Calcium Concentration-- The rats were anesthetized as described above. The right carotid artery was cannulated using a PE 50 catheter for blood collection and for the bolus administration of peptides (16 nmol/kg) or vehicle. The rats were left for at least 30 min after surgery to allow for equilibration. Then porcine CRSP, salmon CT, or porcine CT dissolved in 100 µl of saline containing 0.1% BSA (n = 4) or vehicle (n = 4) was injected through the right carotid artery. Arterial blood (125 µl) was collected in heparinized syringes 15 min before and 15, 30, 60, and 180 min after administration, and the blood volume was replaced with saline (200 µl) on each occasion.

Blood samples were analyzed for ionized calcium with an automatic analyzer (ABL 555, Radiometer, Copenhagen, Denmark) immediately after the blood was drawn. At the same time, arterial blood gas parameters (PaO2, PaCO2, and pH) and hematocrit levels were measured.

Expression of CT Receptor-- A partial cDNA clone of porcine CT receptor was amplified by PCR with porcine hypothalamus cDNA. Full-length porcine CT receptor was isolated from a porcine hypothalamus cDNA library synthesized as described above. The full-length clone was ligated into pcDNA 3.1 expression vector (Promega). The CT receptor cDNA ligated into pcDNA (pcDNA/CTR) was transfected into COS-7 cells with LipofectAMINE Plus (Invitrogen) according to the manufacturer's protocol. The transfected cells were used for cAMP assay and competitive binding experiments 24 h after transfection.

Co-expression of Receptor and Receptor Activity-modifying Protein (RAMP) cDNA-- Porcine CT receptor, calcitonin-like receptor (CL receptor), and three isoforms of RAMP (RAMP1, -2, and -3) cDNAs encoding their complete open reading frames were isolated from porcine lung and hypothalamus cDNA libraries and ligated into pcDNA 3.1 expression vector (Promega) as described previously (25, 31). All combinations of the two cDNAs of one of the two receptors and one of the three RAMPs and insert-free vector (cDNA ratio 1:4) were co-transfected into COS-7 cells with LipofectAMINE Plus. The transfected cells were then used for cAMP assay.

Competitive Binding Experiments-- COS-7 cells were plated in 48-well plates for transfection of pcDNA/CTR. 125I-Labeled porcine CT was prepared by the lactoperoxidase method described above. The pcDNA/CTR-transfected cells were washed twice with DMEM/Hepes (20 mM, pH 7.4) and incubated with a binding medium (DMEM supplemented with 20 mM Hepes (pH 7.4), 0.05% BSA, and 0.01% Triton X-100) containing 100,000 cpm of 125I-labeled porcine CT in the absence or presence of unlabeled peptides at concentrations ranging from 10 pM to 10 µM. After incubation for 1 h at room temperature, the cells were washed once with the ice-cold DMEM and lysed and suspended with 0.5 M NaOH. The radioactivity in the lysate was counted with a gamma  counter (ARC-1000).

Statistical Analysis-- Statistical analysis was performed by using one way analysis of variance with repeated measurements combined with multiple comparison (Scheffe's F test). These analyses were carried out using SPSS for Windows, Version 6.0.1 (SPSS Inc.). The data are expressed as the mean ± S.E.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isolation of CRSP-- Crude basic peptides (SP-III fraction) extracted from porcine brain were first subjected to Sephadex G-50 gel filtration to remove any remaining proteins. The peptide fraction thus obtained was next separated by Sephadex G-25 gel filtration, and each fraction was assayed by monitoring the cAMP production in LLC-PK1 cells. Elevation of cAMP production in LLC-PK1 cells was detected in the fractions corresponding to Mr 2000-4000. These fractions were pooled and separated by CM-52 cation exchange chromatography, and an aliquot of each fraction was subjected to the cAMP production assay in LLC-PK1 cells (Fig. 1a). At least five major peaks of stimulatory activity in the cAMP production assay were observed. Among them peaks 1 and 2 were identified as CGRP (peak 2) and its methionine sulfoxide form (peak 1). Although one peptide was purified from peak 3 and found to have an N-terminal sequence identical to that of CGRP, we could not completely determined the structure of this peptide.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1.   Purification of CRSP from porcine brain extracts. a, ion exchange chromatography of peptides that stimulated cAMP production in LLC-PK1 cells. Sample, basic peptide fraction of Mr 3000 obtained from SP-III fraction by successive Sephadex G-50 and G-25 gel filtrations. Column, CM-52 (24 × 450 mm, Whatman). Fraction size, 20 ml/tube. Flow rate, 35 ml/h. The solvent system was a linear gradient elution from A:B = 100:0 to A:B = 50:50, where A is 10 mM HCOONH4 (pH 6.5):CH3CN = 90:10 and B is 1 M HCOONH4 (pH 6.5):CH3CN = 90:10 (v/v). b, reverse phase HPLC of peptides that stimulated cAMP production in LLC-PK1 cells. Sample, biologically active fraction obtained from peak 5 in a by CM-2SW HPLC. Column, C18 (4.6 × 250 mm, Vydac). Flow rate, 1.0 ml/min. Solvent system, linear gradient elution from A:B = 100:0 to A:B = 0:100 (60 min), where A is H2O:CH3CN:trifluoroacetic acid = 90:10:0.1 and B is H2O:CH3CN:trifluoroacetic acid = 40:60:0.1 (v/v). c, final purification of CRSP. Sample, biologically active fraction obtained by C18 reverse phase HPLC, indicated by the arrow in b. Column, diphenyl (2.1 × 150 mm, Vydac). Flow rate, 0.2 ml/min. The solvent system is the same as that in b.

Peaks 4 and 5 showed different chromatographic behavior from those of known biologically active peptides, and peak 5 was used for the present isolation of CRSP. The biologically active fractions corresponding to peak 5 were further subjected to CM ion exchange HPLC on a TSKgel CM-2SW column, and only one fraction elicited significant biological activity (data not shown). We next applied the biologically active fraction to reverse phase HPLC on a C18 column, and a single minute peak with absorbance at 210 nm showed compatible cAMP-increasing activity (Fig. 1b, arrow). Final purification was performed by another reverse phase HPLC on a diphenyl column, and the peptide was purified to a homogenous state (Fig. 1c). The yield of each purification step was retrospectively determined by RIA for CRSP and is summarized in Table I. At the CM-52 ion exchange chromatography step, the purification yield was greatly reduced. This reduction was probably due to the long term storage of these fractions.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Purification yield of CRSP at each step

Amino Acid Sequence of CRSP-- Intact and tryptic fragments of the peptide purified from peak 5 were subjected to N-terminal sequence analysis using a protein sequencer (Fig. 2, arrows). Based on the sequence analysis data, its amino acid sequence was deduced up to the 37th residue (Fig. 2), except for the 2nd and 7th residues. The molecular mass of this peptide was estimated to be 4042.0 daltons (Da) from the sequence, assuming that two unidentified residues were cysteines forming an intramolecular disulfide bond. To determine the precise molecular mass of CRSP, the purified peptide was analyzed with an ESI mass spectrometer, and its molecular mass was determined to be 4130.6 ± 0.7 Da. The difference between the molecular mass estimated from the peptide sequence and that determined by mass spectrometry was assumed to be due to oxygens from two methionine sulfoxides (16.0 Da × 2) and a C-terminal glycine amide (57.0 Da), which were hard to identify by protein sequencing.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2.   Nucleotide and deduced amino acid sequences of porcine CRSP precursor. Nucleotide and amino acid numbers are shown on the right. Mature amino acid sequence of CRSP is boxed. Arrows indicate the amino acid sequence determined by a protein sequencer. The donor glycine of the C-terminal amide is shaded, and the terminal codon is marked with asterisk. Putative prohormone convertase cleavage sites are double-underlined. Signal sequence (italics) was predicted by PSORT II, a computer program that predicts protein localization sites in animal cells (26).

To determine the cDNA sequence of a precursor for CRSP, we synthesized degenerated primers corresponding to the N and C termini of the sequence, and a PCR reaction was performed with porcine genomic DNA. An amplified fragment was radiolabeled for screening of a hypothalamus cDNA library, and 12 positive clones were obtained out of 105 clones. Fig. 2 shows the nucleotide and deduced amino acid sequences of a CRSP precursor. Analysis of the amino acid sequence of the precursor for CRSP showed that it had typical features of a secretory precursor protein for a biologically active peptide including a signal sequence (Fig. 2, italics), dibasic cleavage sites (double-underlined), and a cleavage/amidation site (gray box). This cDNA sequence supported the existence of glycine amide at the C-terminal of CRSP.

We next chemically synthesized CRSP based on the sequence and structure (C-terminal amidation and intramolecular disulfide linkage) thus determined. Synthetic CRSP or its methionine sulfoxide form elicits chromatographic and mass spectrometric behavior quite similar to that of the native peptide.

Both mature and prepro-CRSP sequences were utilized in a BLAST search of the DDBJ/GenBankTM/EBI protein database, and this peptide and its precursor were found to show sequence similarity with CGRP and its related peptides (Fig. 3). To further find out a corresponding peptide and its precursor in other species, we searched the EST database and identified one candidate gene in horse in addition to horse CGRP. The candidate gene had 77% identity with porcine CRSP, and the amino acid sequence from the C terminus was highly conserved (see "Discussion"). In human and mouse, no corresponding gene has been identified that has significant similarity with CRSP except for alpha - and beta CGRP and amylin in both databases.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3.   Alignment of the amino acid sequences of porcine CRSP and its related peptides. The amino acid sequence of porcine CRSP (pCRSP) is compared with equine CGRP-I (eCGRPI), porcine CGRP (pCGRP), equine CGRP-II (eCGRPII), human alpha CGRP (halpha CGRP), human beta CGRP (hbeta CGRP), human amylin (hAmylin), porcine CT (pCT), and human adrenomedullin (hAM). Identical residues to CRSP are boxed. Two cysteines in the N-terminal region of CRSP form an intramolecular disulfide linkage.

Tissue Distribution of CRSP-- Messenger RNA levels for CRSP in various porcine tissues were estimated by Northern blot analysis (Fig. 4). Approximately 1.0 kilobase of CRSP mRNA was detected predominantly in the CNS, particularly in the hypothalamus and pons/medulla oblongata, but a faint band was observed in the spinal cord, where CGRP was abundantly expressed (24). Another strong band was detected in the thyroid gland, although no band was observed in other peripheral tissues.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot analysis of CRSP mRNA. Total RNA (30 µg) isolated from various porcine tissues was electrophoresed on a 1.0% agarose gel under denaturing conditions, transferred to a nylon membrane, and probed with a 32P-labeled DNA probe. The arrow indicates ~1.0 kilobase.

To measure the concentrations of CRSP in various tissues, we raised a polyclonal antibody against CRSP-(24-38). Both CRSP-(24-38) and CRSP-(1-38) elicited comparable affinity to this antibody. Half-maximal inhibition of radioiodinated ligand binding to the antibody by these peptides was observed at 10 fmol/tube, and no significant cross-reactivity was observed with porcine CT and CGRP (<0.001%). Table II shows the concentrations of immunoreactive (IR) CRSP in porcine tissues. The posterior pituitary was found to contain the highest concentration of IR-CRSP (96 ± 15 pmol/g wet weight). IR-CRSP was also abundant in the CNS, particularly in the midbrain, thalamus and hypothalamus (> 3.0 pmol/g wet weight). In the peripheral tissues, the thyroid gland contained an extremely high concentration of IR-CRSP (68 ± 39 pmol/g wet weight), but other peripheral tissues contained low levels of IR-CRSP (<0.5 pmol/g wet weight).


                              
View this table:
[in this window]
[in a new window]
 
Table II
Distribution of IR-CRSP in porcine tissues
Each value represents mean ± S.E. (n = 3).

Effects of CRSP on cAMP Production in Various Cells-- We next measured the effects of CRSP on cAMP production in LLC-PK1 cells along with porcine CT, porcine CGRP, and human AM (Fig. 5a). This cell line was reported to express both CT receptor and vasopressin V2 receptors that elevate the cAMP production (13, 14, 19). CRSP stimulated the production of cAMP in LLC-PK1 cells in a dose-dependent manner and more potently than any other peptides. To examine the effect of CRSP on other cultured cells, this peptide was administered to Hs68 and Swiss 3T3 fibroblasts, in which cAMP production was reported to be stimulated predominantly by CGRP and AM, respectively (27). Although CGRP and AM increased cAMP concentration in Hs68 and Swiss 3T3 cells, CRSP did not alter the cAMP level in either cell line (Figs. 5, b and c).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5.   Dose-response elevation of cAMP concentration in the culture medium of various cells. LLC-PK1 (a), Hs68 (b), and Swiss 3T3 (c) cells were stimulated with the indicated concentrations of CRSP (closed circle), porcine CT (open square), porcine CGRP (open circle), and human AM (open triangle). Each point represents the mean ± S.E. of three separate determinations.

Systemic Pharmacological Effects of CRSP-- Because CRSP shares structural similarity with CGRP, CRSP was expected to elicit a vasodilatory effect comparable with that of CGRP. CRSP was injected into anesthetized rats up to 16 nmol/kg, and the blood pressure was measured. However, no significant decrease in the blood pressure was observed by bolus administration of CRSP. In the same system, CGRP induced a potent depressor effect (Fig. 6a).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of CRSP and its related peptides on rat blood pressure and plasma calcium concentration. a, effect of CRSP (closed circle), porcine CT (open square), and porcine CGRP (open circle) on the rat mean arterial blood pressure. b, effect of CRSP (closed circle), porcine CT (open square), salmon CT (closed square), and porcine CGRP (open circle) on the rat plasma calcium concentration. Each rat was injected with 16 nmol/kg each peptide or saline at 0 min. All values are expressed as mean ± S.E. (n = 4). **, p < 0.01 compared with time = -5 min (a) or time = 0 min (b).

We next examined the effects of CRSP on the plasma calcium levels and compared them to those of salmon and porcine CT (Fig. 6b). Bolus administration of CRSP to anesthetized rats at a dose of 16 nmol/kg resulted in a significant decrease in the plasma calcium level. The plasma calcium-reducing effect of CRSP was detectable up to 1 h and almost diminished 3 h after injection. On the other hand, injection of salmon or porcine CT caused a sustained reduction in the plasma calcium level even 3 h after injection.

Effects of CRSP and Its Related Peptides on Recombinant CT Receptor-- Porcine CT receptor was transiently expressed in COS-7 cells, and we evaluated the effect of CRSP and its related peptides on these cells. In Fig. 7a, a dose-dependent production of cAMP was observed by stimulation of CRSP, salmon CT, porcine CT, porcine CGRP, and human AM. The production of cAMP was most strongly enhanced with salmon CT (a median effective dose (ED50) = 0.03 nM), which is known to stimulate mammalian CT receptor more potently than the respective endogenous CT. On the other hand, CRSP stimulated the CT receptor (ED50 = 0.20 nM) with a potency more than 350 times higher than that of porcine CT (ED50 = 71 nM), although its effect was weaker than that of salmon CT. None of these peptides stimulated the cAMP production in mock-transfected COS-7 cells (data not shown).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7.   Effects of CRSP and its related peptides on the expression system of CT receptor alone, or CT receptor or CL receptor with RAMPs. a, dose-dependent stimulation of adenylyl cyclase activity via porcine CT receptor. COS-7 cells expressing porcine CT receptor were stimulated with the indicated concentrations of CRSP (closed circle), salmon CT (closed square), porcine CT (open square), porcine CGRP (open circle), and human AM (open triangle). b, effect of CRSP on cAMP production via porcine CT receptor or CL receptor in the presence or absence of RAMPs. COS-7 cells were co-transfected with CT receptor or CL receptor cDNA and one of RAMP1, -2, -3 cDNA or pcDNA. The cells were stimulated with 100 nM of CRSP. c, inhibition of 125I-labeled porcine CT binding to the CT receptor by unlabeled peptides. Binding of 125I-labeled porcine CT to porcine CT receptor expressed in COS-7 cells was measured in competition against unlabeled CRSP (closed circle), salmon CT (closed square), and porcine CT (open square) at the indicated concentrations. COS-7 cells were transfected with cDNAs using LipofectAMINE Plus, cultured for 24 h, and then used for the experiments. Each point represents the mean ± S.E. of three (a and b) and four (c) separate determinations.

To investigate the binding activity of CRSP to CT receptor, 125I-labeled porcine CT and 10 pM to 10 µM CRSP, salmon CT, or porcine CT as a competitor were incubated with COS-7 cells that transiently expressed the CT receptor (Fig. 7c). The binding of 125I-labeled porcine CT to CT receptor in the COS-7 cells was abolished by the addition of an excess amount of each peptide. The median inhibition concentration (IC50) of CRSP in this binding assay system was found to be 1.3 nM, which was ~2-fold greater than that of salmon CT (0.61 nM).

Effect of CRSP on CT Receptor or CL Receptor with or without Co-transfection of RAMP-- A recent report revealed that AM and CGRP receptors are composed of CL receptor and RAMPs with a single transmembrane domain protein, although CL receptor belongs to the family B of G-protein-coupled receptors. The CGRP receptor consisted of CL receptor and RAMP1, whereas the AM receptor consisted of CL receptor and RAMP2 or RAMP3 (28). High affinity amylin receptor was also shown to be constituted by co-expression of CT receptor and RAMPs (29, 30). On the basis of these findings, CT receptor or CL receptor was expressed in COS-7 cells with one of the RAMPs or a blank expression vector and stimulated with 100 nM CRSP, porcine CT, CGRP, or human AM to examine through which receptor-RAMP complex CRSP can stimulate cAMP production. Porcine CT stimulated the cAMP production more than 10-fold in the COS-7 cells expressing CT receptor with or without RAMP but not in those expressing CL receptor (data not shown). Porcine CGRP or human AM stimulated the cAMP production ~5-fold in the COS-7 cells expressing CL receptor with RAMP1, -2, or -3, respectively (data not shown). These results were compatible with those reported previously (25). On the other hand, ~10-fold enhancement of the cAMP production was observed by stimulation of CRSP in the COS-7 cells expressing CT receptor with or without RAMPs, whereas this peptide did not alter the cAMP level in the COS-7 cells expressing CL receptor with or without RAMPs (Fig. 7b).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In the present study, we isolated a novel peptide, CRSP, from a porcine brain extract by monitoring the cAMP production in LLC-PK1 cells. Amino acid sequence analysis and molecular cloning of CRSP and its precursor protein showed that this peptide shows significant sequence similarity to CGRP. CGRP is a potent vasodilatory peptide, and two isoforms have to date been reported in humans and rodents (31-34). CGRP type-alpha was generated from tissue-specific alternative splicing of mRNA transcribed from the CT gene (32). On the other hand, beta CGRP gene encodes a CT-like sequence that is not transcribed into mRNA (34). Both genes have striking sequence similarity to each other. Because one form of CGRP corresponding to alpha CGRP has been identified in the pig, we first considered that CRSP was a porcine counterpart of the beta CGRP. However, this peptide has a distinct structure, function, and distribution compared with those of alpha - and beta CGRP as described below. Compared with the amino acid sequence of porcine CGRP, this peptide has 90% identity in the 10-amino acid sequence from the N terminus, and two cysteines that are deduced to form an intramolecular disulfide bond are conserved. On the other hand, only 40% identity between CRSP and CGRP was observed in the 10-amino acid sequence from the C terminus. In contrast, the amino acid sequences of human and porcine CGRPs are highly conserved throughout the molecule (Fig. 3). CRSP stimulated cAMP production in LLC-PK1 cells about 300-fold more potently than porcine CGRP (Fig. 5a). CRSP also stimulated the cAMP production in COS-7 cells expressing recombinant CT receptor in a manner similar to that in LLC-PK1 cells. On the other hand, this peptide did not augment the cAMP production at all in either Hs68 or Swiss 3T3 cells, in which it was stimulated by CGRP and adrenomedullin. Both alpha - and beta CGRP are reported to be abundantly expressed in the rat spinal cord (24). On the other hand, Northern blot analysis data shows that CRSP is expressed predominantly in the hypothalamus and poorly in the spinal cord (Fig. 4). Although CRSP has structural similarity to CGRP, several lines of evidence listed above indicate that CRSP has characteristics distinct from those of CGRP and elicits its effects via the CT receptor. Thus, we designated this peptide as calcitonin receptor-stimulating peptide (CRSP).

By searching CRSP or related peptides in the EST database, one candidate peptide, named CGRP-I, was found in horse. In horse, another peptide named CGRP-II has been identified, which has 97, 87, and 89% identity with porcine and human alpha - and beta CGRP, respectively, and this peptide is considered to be a counterpart of CGRP. The equine CGRP-I gene encodes a peptide having 77% identity with porcine CRSP, which is ~10% higher than that with porcine CGRP (67%). In particular, the sequence identity between equine CGRP-I and porcine CRSP is 80% in the 10-amino acid sequence from the C terminus, whereas that between equine CGRP-I and porcine CGRP is only 30%. The high identity in the N-terminal region and low identity in the C-terminal region is one of the features that differentiates CRSP from CGRP as described above. Because no corresponding gene has so far been found in humans and rodents by database searching, the peptides having high identity with CRSP might be limited to species evolutionarily close to pig. Further biochemical and pharmacological analyses using synthetic equine CGRP-I should be performed to determine whether it actually elicits CRSP-like effects.

CGRP, CT, AM, and amylin, belonging to the CT and CGRP superfamily, are widely distributed in the CNS as well as in the peripheral tissues and induce multiple biological effects, including vasodilation, calcium resorption in bone, and reduction in nutrient intake (31). However, their receptor systems are more complex than other biologically active peptides. Recent studies have verified that the functional AM receptor and CGRP receptor consist of two membrane proteins, CL receptor, and one of three RAMPs (30). CGRP is considered to stimulate cAMP production via a CL receptor-RAMP1 complex (30), whereas AM is shown to increase the intracellular signal via a CL receptor-RAMP2 or a CL receptor-RAMP3 complex (28). Furthermore, later studies showed that the expression of RAMP3 facilitated amylin to bind and activate CT receptor (29, 30). Although CRSP was found to stimulate CT receptor, these previous data indicated that the CRSP receptor should be characterized in detail in endogenous as well as recombinant systems. As shown in Fig. 5, CGRP and AM predominantly stimulated cAMP production in Hs68 and Swiss 3T3 cells, respectively, but CRSP did not alter the cAMP concentration in either of these cell lines. As clearly shown in Fig. 7b, CRSP did not stimulate cAMP production at all via porcine CL receptor in the presence or absence of porcine RAMPs in the COS-7 cell expression system. These findings demonstrate that CRSP does not stimulate endogenous and recombinant AM/CGRP receptors, although this peptide has high structural similarity to CGRP. However, CRSP stimulated cAMP production in the COS-7 cells expressing the recombinant CT receptor more potently than porcine CT (Fig. 7a), and co-expression of RAMPs did not alter the cAMP production level induced by CRSP stimulation (Fig. 7b). Binding of 125I-labeled porcine CT to the COS-7 cells expressing the recombinant CT receptor was prominently displaced by CRSP (Fig. 7c). The evidence described above indicate that both CRSP and CT can stimulate the CT receptor, although a detailed analysis of ligand-receptor interaction is required to understand how two structurally distinct peptides can bind to the same receptor.

Bolus injection of CRSP into rats transiently reduced the plasma calcium concentration, although its effect was weaker than that of salmon and porcine CT (Fig. 6). At least two mechanisms have been elucidated for the plasma calcium reduction. 1) CT receptor is abundantly expressed on osteoclast cells (35). Treatment of resorbing bones with CT increases loss of the ruffled border of the osteoclast cells and decreases the release of lysosomal enzymes from them, which results in a reduction in the plasma calcium level (16, 17). 2) Renal tubular epithelia express CT receptor. The excretion of plasma calcium through the kidney is stimulated by CT by inhibiting renal tubular calcium reabsorption (18). As both osteoclast and renal epithelial cells express CT receptor, CRSP is deduced to activate CT receptor on these cells and decrease the plasma calcium concentration. In contrast to the potent effects of CRSP on cAMP production on LLC-PK1 cells and COS-7 cells expressing CT receptor, the plasma calcium-reducing activity of CRSP is much weaker than that of porcine CT. The difference in the biological potency of CRSP in the in vivo and in vitro system may indicate the presence of unidentified physiological effects and mechanisms distinct from those of CT.

The CT receptor is also expressed in the CNS at a high level (36) in addition to the peripheral system. Although CT receptor in the CNS has been recognized to be involved in the regulation of appetite (37), gastric acid secretion (38), and analgesic effect (39), endogenous ligands for the CT receptor in the brain remain unidentified. In fact, CT is mainly synthesized and secreted from the thyroid gland but is almost undetectable in the CNS. The CT secreted from the thyroid and circulating in the blood is not considered to be incorporated into the CNS beyond the blood brain barrier. Several attempts have been made to identify an endogenous ligand that stimulates cAMP production via CT receptor in the CNS. Fischer et al. (22) reported that human calcitonin- and C-terminal adjacent peptide-like immunoreactivities were found in extracts of the human periventricular mesencephalic region. Sexton and Hilton (23) detect salmon CT-like immunoreactivity in rat brain using an anti-salmon CT antibody. This finding was supported by CT bioassays including cAMP production and receptor binding to culture cells and brain membranes. In 1998, these authors reported the successful purification of brain CT-like peptide with a molecular mass of 3267 Da, which was N-terminally blocked but had a unique 6-amino acid sequence of EKSQSP in the molecule (24). Unfortunately, no subsequent study has been reported for this peptide. In our study, the structure of CRSP was determined by direct analysis of the peptide purified from porcine brain extracts, and the sequence of prepro-CRSP was deduced from cDNA cloning and analysis. The CT-like biological activity was confirmed by the data showing that synthetic CRSP stimulated cAMP production via recombinant CT receptor and reduced the rat plasma calcium concentration by bolus administration. These findings suggest that this peptide with low amino acid sequence similarity with CT is a cognate ligand for CT receptor in the CNS, although it is necessary to examine whether a unique CRSP receptor that is more specific than CT receptor is present or not. Identification of CRSP in other species as well as the elucidation of its physiological effects and expression profiles in the CNS and peripheral system will clarify the relationship between CRSP and the previously reported CT-like peptide.

    ACKNOWLEDGEMENTS

We are grateful to Dr. Kitamura and Prof. Eto of Miyazaki Medical College for donation of antiserum against cAMP, Drs. Magota and Okamoto of Suntory Institute for Biochemical Research for discussion, and M. Nakatani and M. Higuchi of this institute for technical assistance.

    FOOTNOTES

* This work was supported in part by research grants from the Ministry of Education, Culture, Sports, Science, and Technology (Special Coordination Funds for the Promotion of Science and Technology and grant-in-aid for Scientific Research on Priority Areas (B), Scientific Research (C), and Encouragement of Young Scientists), the Ministry of Health, Labor, and Welfare, and the Organization for Pharmaceutical Safety and Research of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB094586.

Dagger To whom correspondence should be addressed. Tel.: 81-6-6833-5012 (ext. 2507); Fax: 81-6-6835-5349; E-mail: minamino@ri.ncvc.go.jp.

Published, JBC Papers in Press, January 29, 2003, DOI 10.1074/jbc.M207970200

    ABBREVIATIONS

The abbreviations used are: AM, adrenomedullin; CRSP, calcitonin receptor-stimulating peptide; CGRP, calcitonin gene-related peptide; alpha CGRP, CGRP type-alpha ; beta CGRP, CGRP type-beta ; CT, calcitonin; CL receptor, calcitonin-like receptor; RAMP, receptor activity-modifying protein; DMEM, Dulbecco's modified Eagle's medium; HPLC, high performance liquid chromatography; ESI, electrospray ionization; CNS, central nervous system; IR, immunoreactive; BSA, bovine serum albumin; RIA, radioimmunoassay; CM, carboxymethyl; Mops, 4-morpholinepropanesulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kangawa, K., and Matsuo, H. (1984) Biochem. Biophys. Res. Commun. 118, 131-139[CrossRef][Medline] [Order article via Infotrieve]
2. Sudoh, T., Kangawa, K., Minamino, N., and Matsuo, H. (1988) Nature 332, 78-81[CrossRef][Medline] [Order article via Infotrieve]
3. Sudoh, T., Minamino, N., Kangawa, K., and Matsuo, H. (1990) Biochem. Biophys. Res. Commun. 168, 863-870[CrossRef][Medline] [Order article via Infotrieve]
4. Minamino, N., Sudoh, T., Kangawa, K., and Matsuo, H. (1985) Peptides 6, 245-248, Supple. 3
5. Miyata, A., Arimura, A., Dahl, R. R., Minamino, N., Uehara, A., Jiang, L., Culler, M. D., and Coy, D. H. (1989) Biochem. Biophys. Res. Commun. 164, 567-574[CrossRef][Medline] [Order article via Infotrieve]
6. Kitamura, K., Kangawa, K., Kawamoto, M., Ichiki, Y., Nakamura, S., Matsuo, H., and Eto, T. (1993) Biochem. Biophys. Res. Commun. 192, 553-560[CrossRef][Medline] [Order article via Infotrieve]
7. Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R. M., Tanaka, H., Williams, S. C., Richardson, J. A., Kozlowski, G. P., Wilson, S., Arch, J. R., Buckingham, R. E., Haynes, A. C., Carr, S. A., Annan, R. S., McNulty, D. E., Liu, W. S., Terrett, J. A., Elshourbagy, N. A., Bergsma, D. J., and Yanagisawa, M. (1998) Cell 92, 573-585[CrossRef][Medline] [Order article via Infotrieve]
8. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., and Kangawa, K. (1999) Nature 402, 656-660[CrossRef][Medline] [Order article via Infotrieve]
9. Hull, R. N., Cherry, W. R., and Weaver, G. W. (1976) In Vitro 12, 670-677[Medline] [Order article via Infotrieve]
10. Gorbulev, V., Buchner, H., Akhundova, A., and Fahrenholz, F. (1993) Eur. J. Biochem. 215, 1-7[Medline] [Order article via Infotrieve]
11. Morel, A., O'Carroll, A. M., Brownstein, M. J., and Lolait, S. J. (1992) Nature 356, 523-526[CrossRef][Medline] [Order article via Infotrieve]
12. Sugimoto, T., Saito, M., Mochizuki, S., Watanabe, Y., Hashimoto, S., and Kawashima, H. (1994) J. Biol. Chem. 269, 27088-27092[Abstract/Free Full Text]
13. Birnbaumer, M., Seibold, A., Gilbert, S., Ishido, M., Barberis, C., Antaramian, A., Brabet, P., and Rosenthal, W. (1992) Nature 357, 333-335[CrossRef][Medline] [Order article via Infotrieve]
14. Lolait, S. J., O'Carroll, A. M., McBride, O. W., Konig, M., Morel, A., and Brownstein, M. J. (1992) Nature 357, 336-339[CrossRef][Medline] [Order article via Infotrieve]
15. Wohlwend, A., Vassalli, J. D., Bertrand, D., and Orci, L. (1986) J. Cell. Physiol. 128, 71-75[CrossRef][Medline] [Order article via Infotrieve]
16. Friedman, J., and Raisz, L. G. (1965) Science 150, 1465-1467[Abstract/Free Full Text]
17. Aliapoulios, M. A., Goldhaber, P., and Munson, P. L. (1966) Science 151, 330-331[Abstract/Free Full Text]
18. Friedman, P. A., and Gesek, F. A. (1993) Am. J. Physiol. 264, F181-F198[Abstract/Free Full Text]
19. Lin, H. Y., Harris, T. L., Flannery, M. S., Aruffo, A., Kaji, E. H., Gorn, A., Kolakowski, L. F., Jr., Lodish, H. F., and Goldring, S. R. (1991) Science 254, 1022-1024[Abstract/Free Full Text]
20. Rosenfeld, M. G., Mermod, J. J., Amara, S. G., Swanson, L. W., Sawchenko, P. E., Rivier, J., Vale, W. W., and Evans, R. M. (1983) Nature 304, 129-135[CrossRef][Medline] [Order article via Infotrieve]
21. Hoppener, J. W., Steenbergh, P. H., Moonen, P. J., Wagenaar, S. S., Jansz, H. S., and Lips, C. J. (1986) Mol. Cell. Endocrinol. 47, 125-130[CrossRef][Medline] [Order article via Infotrieve]
22. Fischer, J. A., Tobler, P. H., Henke, H., and Tschopp, F. A. (1983) J. Clin. Endocrinol. Metab. 57, 1314-1316[Abstract]
23. Sexton, P. M., and Hilton, J. M. (1992) Brain Res. 596, 279-284[CrossRef][Medline] [Order article via Infotrieve]
24. Hilton, J. M., Mitchelhill, K. I., Pozvek, G., Dowton, M., Quiza, M., and Sexton, P. M. (1998) Endocrinology 139, 982-992[Abstract/Free Full Text]
25. Kikumoto, K., Katafuchi, T., and Minamino, N. Hypertens. Res., in press
26. Nakai, K., and Horton, P. (1999) Trends Biochem. Sci. 24, 34-35[CrossRef][Medline] [Order article via Infotrieve]
27. Isumi, Y., Minamino, N., Katafuchi, T., Yoshioka, M., Tsuji, T., Kangawa, K., and Matsuo, H. (1998) Endocrinology 139, 2552-2563[Abstract/Free Full Text]
28. McLatchie, L. M., Fraser, N. J., Main, M. J., Wise, A., Brown, J., Thompson, N., Solari, R., Lee, M. G., and Foord, S. M. (1998) Nature 393, 333-339[CrossRef][Medline] [Order article via Infotrieve]
29. Muff, R., Buhlmann, N., Fischer, J. A., and Born, W. (1999) Endocrinology 140, 2924-2927[Abstract/Free Full Text]
30. Christopoulos, G, Perry, K. J., Morfis, M., Tilakaratne, N., Gao, Y., Fraser, N. J., Main, M. J., Foord, S. M., and Sexton, P. M. (1999) Mol. Pharmacol. 56, 235-242[Abstract/Free Full Text]
31. Poyner, D., R., Sexton, P. M., Marshall, I., Smith, D. M., Quirion, R., Born, W., Muff, R., Fischer, J. A., and Foord, S. M. (2002) Pharmacol. Rev. 54, 233-246[Abstract/Free Full Text]
32. Amara, S. G., Jonas, V., Rosenfeld, M. G., Ong, E. S., and Evans, R. M. (1982) Nature 298, 240-244[CrossRef][Medline] [Order article via Infotrieve]
33. Amara, S. G., Arriza, J. L., Leff, S. E., Swanson, L. W., Evans, R. M., and Rosenfeld, M. G. (1985) Science 229, 1094-1097[Abstract/Free Full Text]
34. Steenbergh, P. H., Hoppener, J. W., Zandberg, J., Lips, C. J., and Jansz, H. S. (1985) FEBS Lett. 183, 403-407[CrossRef][Medline] [Order article via Infotrieve]
35. Ikegame, M., Rakopoulos, M., Zhou, H., Houssami, S., Martin, T. J., Moseley, J. M., and Findlay, D. M. (1995) J. Bone Miner. Res. 10, 59-65[Medline] [Order article via Infotrieve]
36. Hilton, J. M., Chai, S. Y., and Sexton, P. M. (1995) Neuroscience 69, 1223-1237[CrossRef][Medline] [Order article via Infotrieve]
37. Freed, W. J., Perlow, M. J., and Wyatt, R. J. (1979) Science 206, 850-852[Abstract/Free Full Text]
38. Morley, J. E., Levine, A. S., and Silvis, S. E. (1981) Science 214, 671-673[Abstract/Free Full Text]
39. Montemurro, L., Schiraldi, G., Fraioli, P., Tosi, G., Riboldi, A., and Rizzato, G. (1991) Calcif. Tissue Int. 49, 71-76[Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg