Originally published In Press as doi:10.1074/jbc.M207970200 on January 29, 2003
J. Biol. Chem., Vol. 278, Issue 14, 12046-12054, April 4, 2003
Calcitonin Receptor-stimulating Peptide, a New Member of the
Calcitonin Gene-related Peptide Family
ITS ISOLATION FROM PORCINE BRAIN, STRUCTURE, TISSUE
DISTRIBUTION, AND BIOLOGICAL ACTIVITY*
Takeshi
Katafuchi,
Katsuro
Kikumoto,
Kazumasa
Hamano,
Kenji
Kangawa,
Hisayuki
Matsuo, and
Naoto
Minamino
From the National Cardiovascular Center Research Institute, 5-7-1 Fujishirodai, Suita 565-8565, Osaka, Japan
Received for publication, August 5, 2002, and in revised form, December 20, 2002
 |
ABSTRACT |
We isolated a novel biologically active peptide,
designated calcitonin receptor-stimulating peptide (CRSP), from the
acid extract of the porcine brain by monitoring cAMP production in the
porcine kidney cell line LLC-PK1. Determination of
the amino acid sequence and cDNA analysis encoding a CRSP precursor
showed that this peptide has ~60% identity in the amino acid
sequence with human calcitonin gene-related peptide type-
(
CGRP),
type-
(
CGRP), and porcine CGRP. Northern blot analysis and
radioimmunoassay demonstrated that CRSP is expressed mainly in the
thyroid gland and the central nervous system, in which the calcitonin
receptor was abundantly expressed. Synthetic CRSP elicited a potent
stimulatory effect on the cAMP production in LLC-PK1 cells.
Although it shows significant sequence similarity with CGRPs, this
peptide did not elicit cAMP elevation in cells that endogenously
expressed a CGRP receptor or an adrenomedullin receptor or were
transfected with either of these recombinant receptors. Administration
of CRSP into anesthetized rats did not alter the blood pressure but
induced a transient decrease in the plasma calcium concentration. In
fact, this peptide potently increased the intracellular cAMP
concentration in COS-7 cells that expressed the recombinant calcitonin
receptor. These unique properties indicate that CRSP is not a porcine
counterpart of
CGRP and probably elicits its biological effects via
the calcitonin receptor.
 |
INTRODUCTION |
Isolation and sequence determination of new biologically active
peptides have greatly advanced our understanding of the communication between cells and tissues. Various biologically active peptides, such
as natriuretic peptides (1-3) and neuromedins (4), were isolated by
monitoring smooth muscle contraction and relaxation. This strategy was
useful, but relatively large amounts of tissue extracts were required
to monitor the biological activities. Another strategy involving the
measurement of intracellular second messenger levels has often been
adopted in recent purification studies, and two methods have been
successful to date. The first method is to monitor the second messenger
levels in intact cultured cells obtained from a particular organ.
Pituitary adenylate cyclase-activating peptide and adrenomedullin
(AM)1 were identified by
monitoring the adenylyl cyclase activity in the anterior pituitary
cells (5) and platelets (6), respectively. The second method is to
monitor the second messenger levels in cells expressing a particular
orphan receptor. Orexins and ghrelin were purified by monitoring a
transient intracellular calcium elevation in HEK293 cells expressing
OX1R or OX2R receptor (7) and growth hormone
secretagogue receptor (8), respectively.
We employed the first method to screen new biologically active peptides
and measured cAMP production in LLC-PK1 cells, a cell line
prepared from porcine kidney epithelial cells, because this cell line
is known to express several peptide receptors that stimulate adenylyl
cyclase activity (9). Vasopressin, for example, strongly stimulates
adenylyl cyclase activity in LLC-PK1 cells (10). Among
three isotypes of the vasopressin receptor, members of the G-protein-coupled receptor family (11, 12), V2 receptor
expressing in LLC-PK1 cells (10, 13) as well as in the
kidney is coupled to adenylyl cyclase (13, 14) and participates in
physiological events such as anti-diuresis. Calcitonin (CT) also
potently increases the cAMP production in LLC-PK1 cells
(15). CT is secreted mainly from the thyroid gland and is involved in
calcium resorption in the bone (16, 17) as well as calcium reabsorption
in the kidney (18). The CT receptor is also a member of the
G-protein-coupled receptor family, and its cDNA clone was first
isolated from a cDNA library constructed from LLC-PK1
cells (19).
Although CT receptor is expressed in the central nervous system (CNS),
expression of CT has not been identified in the CNS (20, 21). The CT in
the systemic circulation secreted from the thyroid gland is not
considered to be incorporated into the CNS beyond the blood brain
barrier. Although some investigators report that brain extracts contain
biologically active CT-like materials (22-24), the existence of a
cognate ligand to CT receptor in the CNS remains controversial. This
was another reason we chose LLC-PK1 cells to screen
biologically active peptides by monitoring the adenylyl cyclase activity.
In this paper, we report the isolation and structural determination of
a novel biologically active peptide from porcine brain extract by
monitoring the cAMP production in LLC-PK1 cells. Although the purified peptide showed higher sequence homology to CGRP, this
peptide bound to CT receptor with a higher affinity and stimulated cAMP
production at a potency 350-fold greater than CT. Thus, we designated
this peptide as calcitonin receptor-stimulating peptide (CRSP). The
findings obtained in this study strongly suggest that CRSP is a
candidate for the unidentified ligand to CT receptor in the CNS and may
participate in physiological events by activating the central as well
as peripheral CT receptor.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
LLC-PK1, Hs68, Swiss 3T3, and
COS-7 cells (ATCC) were cultured in Dulbecco's modified Eagle's
medium (DMEM) containing 10% fetal bovine serum supplemented with 100 µg/ml penicillin and 100 units/ml streptomycin in a humidified
atmosphere of 95% air, 5% CO2 at 37 °C.
Measurement of Intracellular cAMP Production--
Cells were
harvested and cultured on 48-well plates for 2 days. The cells were
washed twice with DMEM/Hepes (20 mM, pH 7.4) containing 0.5 mM 3-isobutyl-1-methyl xanthine (Sigma) and 0.05% bovine
serum albumin (BSA) and incubated in the same medium for 30 min at
37 °C. The incubation medium was then replaced with 150 µl of
medium in which the sample of interest was dissolved and further
incubated at 37 °C for another 30 min. Aliquots (100 µl) of the
incubation media were succinylated, evaporated, and then submitted to
radioimmunoassay (RIA) for cAMP as reported previously (6).
Isolation of CRSP--
Approximately 20 kg of porcine brain was
minced and boiled for 10 min in 2 volumes (v/w) of water to inactivate
the intrinsic proteases. After cooling, glacial CH3COOH was
added to a final concentration of 1 M, and the boiled
tissue was homogenized with a Polytron homogenizer. The homogenate was
centrifuged at 17,700 × g for 25 min, and the
supernatant was condensed with a Pellicon cassette (PLAC No. 000-05,
Millipore). The condensate was subjected to acetone precipitation
(final concentration = 66%), and the resulting supernatant was
evaporated. The resulting solution was divided into four equal volumes,
and each was loaded onto a LC-SORB SPW-C-ODS column (1.5 liter, Chemco,
Osaka, Japan). After washing with 0.5 M
CH3COOH, the materials that had adsorbed on the column were
eluted with H2O:CH3CN:trifluoroacetic acid at
40:60:0.1 (v/v). The column eluates were pooled and lyophilized. The
dried materials were dissolved in 1 M CH3COOH
and subjected to batch chromatography on an SP-Sephadex C-25 column
(H+-form, 3 × 28 cm; Amersham Biosciences).
Successive elutions with 1 M CH3COOH, 2 M pyridine, and 2 M pyridine acetate (pH 5.0)
yielded three respective fractions of SP-I, SP-II, and SP-III. After
lyophilization, the SP-III fraction was separated by gel filtration on
a Sephadex G-50 column (fine, 75 × 1450 mm). Fractions corresponding
to a relative molecular mass (Mr) of
1000-5000 were collected and subjected to a second gel
filtration on a Sephadex G-25 column (fine, 75 × 1500 mm). Fractions
containing peptides of Mr 3000 were pooled and
subjected to carboxymethyl (CM) ion exchange chromatography (CM-52, 24 × 450 mm; Whatman) eluting with a linear gradient elution of
HCOONH4 (pH 6.5) from 10 mM to 1 M
in the presence of 10% CH3CN. The fractions eliciting
cAMP-producing activity were pooled and re-purified by CM ion exchange
high performance liquid chromatography (HPLC) (TSKgel CM-2SW, 7.8 × 300 mm; Tosoh, Japan), eluting with a linear gradient elution of
HCOONH4 (pH 3.8) from 10 mM to 1 M
in the presence of 10% CH3CN. The biologically active
fractions were then separated by reverse phase HPLC on a
C18 column (218TP54, 4.6 × 250 mm; Vydac), and the
peptide was finally purified on a diphenyl column (219TP5215, 2.1 × 150 mm; Vydac) using a linear gradient elution of CH3CN
from 10 to 60% in 0.1% trifluoroacetic acid. The amino acid sequence
was analyzed with a Procise cLC protein sequencer (492, Applied
Biosystems). After the gel filtration step, aliquots (1/2000) of
all fractions in the course of purification were lyophilized, dissolved
in 200 µl of incubation medium for the cAMP assay, and submitted to
the cAMP assay using LLC-PK1 cells.
Molecular Cloning and Determination of cDNA Sequence of
CRSP--
Both the N and C termini of CRSP were chosen to synthesize
degenerated primers, and the PCR reaction was performed with those primers on porcine genomic DNA. The amplified DNA fragment was sequenced and radiolabeled as a probe for screening. Porcine
hypothalamus cDNA was synthesized from 3 µg of
poly(A)+ RNA using a Timesaver cDNA synthesis kit
(Amersham Biosciences), inserted into
ZAP II
bacteriophage vector (Stratagene), and packaged in vitro using Giga Pack Gold III packaging extract
(Stratagene). Approximately 105 plaques were screened by
the standard protocol. The hybridization buffer contained 50%
formamide, 6× SSC (1× SSC = 0.15 M NaCl and 0.015 M sodium citrate), 5× Denhardt's solution, 0.5%
SDS, and 106 cpm/ml of the radiolabeled probe. After
hybridization at 42 °C for 16 h, the filters were washed twice
with 2× SSC containing 0.1% SDS for 5 min at room temperature and
washed twice with 0.2× SSC containing 0.1% SDS at 65 °C for 1 h. The filters were exposed to RX-U films (Fuji, Tokyo, Japan), and 12 positive clones were obtained. The isolated positive clones were
rescued as pBluescript SK
using Escherichia
coli strain SOLR and helper phage. DNA sequences of these clones
were determined by the dideoxynucleotide chain termination method using
a DNA sequencer (373A, Applied Biosystems).
Peptide Synthesis--
Synthetic CRSP, CRSP-(24-38),
Tyr-CRSP-(24-38), and Cys-CRSP-(24-38) were prepared by solid phase
techniques using N-(9-fluorenyl)methoxycarbonyl chemistry
using a peptide synthesizer (431A, Applied Biosystems). An
intramolecular disulfide linkage was formed by the action of K3[Fe(CN)6]. Porcine CGRP was prepared by the
American Peptide Company. Synthetic peptides were purified by reverse
phase HPLC and ion exchange HPLC, and correct synthesis was confirmed
by amino acid analysis and sequencing. Salmon and porcine CT were purchased from Peninsula. Human AM was kindly donated by Shionogi & Co.
(Osaka, Japan).
Generation of Antisera--
All experimental procedures were
approved by the local animal experiments and care committee. Rabbit
antibodies were raised to a peptide sequence
(CRSNLLPTKMGFKVFG-NH2) that corresponds to residues 24-38
of CRSP (CRSP-(24-38)) to which an N-terminal cysteine was added to
facilitate cross-linking to maleimide-activated keyhole limpet
hemocyanin (Pierce). New Zealand White rabbits (Japan SLC, Hamamatsu,
Japan) were immunized by injecting 1 mg of the peptide-keyhole limpet
hemocyanin antigen conjugate in complete Freund's adjuvant, and
antibody production was boosted by 5 additional injections of the
antigen in complete Freund's adjuvant at 3-week intervals.
Northern Blot Analysis--
A CRSP probe was prepared by a PCR
reaction performed on 1 ng of full-length CRSP cDNA using KOD plus
polymerase and primers (CTCTCTGAGGAGGAATCACG and GAGTTCAGAGTCATAGTAACC)
for 30 cycles (each cycle consisted of 15 s at 94 °C, 15 s
at 55 °C, and 1 min at 72 °C). Total RNAs (30 µg) obtained from
various tissues were separated on a 1.0% agarose gel containing 2.2 M formaldehyde, 20 mM Mops (pH 7.0), 8 mM CH3COONa, and 1 mM EDTA. After
electrophoresis, the RNAs were transferred to a Hybond XL nylon
membrane (Amersham Biosciences) and baked at 80 °C for 2 h. The
filter was prehybridized in Ultrahyb hybridization solution (Ambion)
for 2 h at 37 °C and then hybridized at 42 °C for 16 h
with the 32P-labeled CRSP cDNA probe. The filter was
washed twice with 2× SSC containing 0.1% SDS at room temperature and
twice with 0.1× SSC containing 0.1% SDS at 65 °C for 1 h and
exposed to RX-U film at
80 °C for 10 days with an intensifying screen.
RIA for CRSP--
N-Tyr-CRSP-(24-38) was radioiodinated by the
lactoperoxidase method, and the monoiodinated peptide was purified by
reverse phase HPLC. Approximately 1 g of porcine tissue was minced
and boiled for 10 min in 5 ml of water. After cooling, water and
glacial CH3COOH were added to a final volume and
concentration of 10 ml and 1 M, respectively, and the
boiled tissues were homogenized with a Polytron homogenizer. The
homogenate was then centrifuged, and the resulting supernatant was
lyophilized and dissolved in the same volume of RIA buffer (50 mM sodium phosphate (pH 7.4) containing 80 mM
NaCl, 25 mM EDTA, 0.05% NaN3, 0.5% BSA
treated with N-ethylmaleimide, and 0.5% Triton X-100).
Standard CRSP-(24-38) or sample dissolved in 100 µl of RIA buffer
was incubated with 100 µl each of monoiodinated N-Tyr-CRSP-(24-38)
(18,000 cpm) and anti-CRSP antiserum at 4 °C for 48 h. Then 100 µl of 1%
-immunoglobulin and 500 µl of 23% polyethylene glycol
6000 solution were added to the reaction tubes, and the mixture was
incubated on ice for 15 min. After centrifugation at 2,000 × g for 15 min, the supernatant was aspirated, and the
radioactivity in the pellet was counted with a
counter (ARC-1000,
Aloka, Tokyo, Japan). Aliquots of all the reserved fractions at each
purification step were lyophilized, dissolved in the RIA buffer for
CRSP, and submitted to RIA for CRSP to evaluate the recovery yield.
Mass Spectrometry--
Mass spectra were measured using a single
quadrupole mass spectrometer equipped with an electrospray ionization
(ESI) source (SSQ 7000, Finnigan). Peptides (10 pmol) were dissolved in
a mobile solvent (water:methanol = 50:50, 1% acetic acid) and
infused using a syringe pump (5 µl/min) coupled directly to the
ionization source via a fused silica capillary. Spectra were measured
in a multi-channel acquisition mode in the mass range
m/z 300-2000 with scan durations of 3.5 s.
Measurement of Blood Pressure--
Eight-week-old male
Sprague-Dawley rats were purchased from Japan SLC. All study protocols
were approved by the local animal experiments and care committee. All
animals were provided free access to tap water and standard chow. The
rats were anesthetized by an intraperitoneal injection of
thiobutabarbital sodium salt (60 mg/kg; Wako, Osaka, Japan).
Rectal temperature was monitored and maintained at 37 ± 1 °C
during the entire experimental procedure, and a tracheotomy was
performed to aid spontaneous breathing. The mean arterial blood
pressure and heart rate were monitored through the right carotid artery
using a PE 50 catheter connected to a pressure transducer (model P231D,
Gould) and a polygraph (7758 B System, Hewlett-Packard), and the left
jugular vein was cannulated using a PE 10 catheter for the bolus
administration of peptides or vehicle. The rats were left for at least
30 min after surgery to allow for equilibration. Then 100 µl of
saline containing the peptide and 0.1% BSA (n = 3) or
the same amount of saline containing 0.1% BSA alone as a vehicle
(n = 4) was injected through the left jugular vein.
Mean arterial blood pressure and heart rate were measured 15 min before
and 0, 2, 5, 10, and 30 min after the administration.
Measurement of Plasma Calcium Concentration--
The rats were
anesthetized as described above. The right carotid artery was
cannulated using a PE 50 catheter for blood collection and for the
bolus administration of peptides (16 nmol/kg) or vehicle. The rats were
left for at least 30 min after surgery to allow for equilibration. Then
porcine CRSP, salmon CT, or porcine CT dissolved in 100 µl of saline
containing 0.1% BSA (n = 4) or vehicle (n = 4) was injected through the right carotid artery.
Arterial blood (125 µl) was collected in heparinized syringes 15 min
before and 15, 30, 60, and 180 min after administration, and the blood volume was replaced with saline (200 µl) on each occasion.
Blood samples were analyzed for ionized calcium with an automatic
analyzer (ABL 555, Radiometer, Copenhagen, Denmark) immediately after
the blood was drawn. At the same time, arterial blood gas parameters
(PaO2, PaCO2, and pH) and hematocrit levels
were measured.
Expression of CT Receptor--
A partial cDNA clone of
porcine CT receptor was amplified by PCR with porcine hypothalamus
cDNA. Full-length porcine CT receptor was isolated from a porcine
hypothalamus cDNA library synthesized as described above. The
full-length clone was ligated into pcDNA 3.1 expression vector
(Promega). The CT receptor cDNA ligated into pcDNA (pcDNA/CTR)
was transfected into COS-7 cells with LipofectAMINE Plus (Invitrogen)
according to the manufacturer's protocol. The transfected cells were
used for cAMP assay and competitive binding experiments 24 h after transfection.
Co-expression of Receptor and Receptor Activity-modifying Protein
(RAMP) cDNA--
Porcine CT receptor, calcitonin-like receptor (CL
receptor), and three isoforms of RAMP (RAMP1, -2, and -3) cDNAs
encoding their complete open reading frames were isolated from porcine lung and hypothalamus cDNA libraries and ligated into pcDNA 3.1 expression vector (Promega) as described previously (25, 31). All
combinations of the two cDNAs of one of the two receptors and one
of the three RAMPs and insert-free vector (cDNA ratio 1:4) were
co-transfected into COS-7 cells with LipofectAMINE Plus. The
transfected cells were then used for cAMP assay.
Competitive Binding Experiments--
COS-7 cells were plated in
48-well plates for transfection of pcDNA/CTR.
125I-Labeled porcine CT was prepared by the
lactoperoxidase method described above. The pcDNA/CTR-transfected
cells were washed twice with DMEM/Hepes (20 mM, pH 7.4) and
incubated with a binding medium (DMEM supplemented with 20 mM Hepes (pH 7.4), 0.05% BSA, and 0.01% Triton X-100)
containing 100,000 cpm of 125I-labeled porcine CT in the
absence or presence of unlabeled peptides at concentrations ranging
from 10 pM to 10 µM. After incubation for
1 h at room temperature, the cells were washed once with the ice-cold DMEM and lysed and suspended with 0.5 M NaOH. The
radioactivity in the lysate was counted with a
counter
(ARC-1000).
Statistical Analysis--
Statistical analysis was performed by
using one way analysis of variance with repeated measurements combined
with multiple comparison (Scheffe's F test). These analyses were
carried out using SPSS for Windows, Version 6.0.1 (SPSS Inc.). The data
are expressed as the mean ± S.E.
 |
RESULTS |
Isolation of CRSP--
Crude basic peptides (SP-III fraction)
extracted from porcine brain were first subjected to Sephadex G-50 gel
filtration to remove any remaining proteins. The peptide fraction thus
obtained was next separated by Sephadex G-25 gel filtration, and each
fraction was assayed by monitoring the cAMP production in
LLC-PK1 cells. Elevation of cAMP production in
LLC-PK1 cells was detected in the fractions corresponding
to Mr 2000-4000. These fractions were pooled
and separated by CM-52 cation exchange chromatography, and an aliquot
of each fraction was subjected to the cAMP production assay in
LLC-PK1 cells (Fig.
1a). At least five major peaks
of stimulatory activity in the cAMP production assay were observed. Among them peaks 1 and 2 were identified as CGRP (peak 2) and its
methionine sulfoxide form (peak 1). Although one peptide was purified
from peak 3 and found to have an N-terminal sequence identical to that
of CGRP, we could not completely determined the structure of this
peptide.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Purification of CRSP from porcine brain
extracts. a, ion exchange chromatography of peptides
that stimulated cAMP production in LLC-PK1 cells. Sample,
basic peptide fraction of Mr 3000 obtained from
SP-III fraction by successive Sephadex G-50 and G-25 gel filtrations.
Column, CM-52 (24 × 450 mm, Whatman). Fraction size, 20 ml/tube.
Flow rate, 35 ml/h. The solvent system was a linear gradient elution
from A:B = 100:0 to A:B = 50:50, where A is 10 mM
HCOONH4 (pH 6.5):CH3CN = 90:10 and B is 1 M HCOONH4 (pH 6.5):CH3CN = 90:10 (v/v). b, reverse phase HPLC of peptides that
stimulated cAMP production in LLC-PK1 cells. Sample,
biologically active fraction obtained from peak 5 in a by
CM-2SW HPLC. Column, C18 (4.6 × 250 mm, Vydac). Flow
rate, 1.0 ml/min. Solvent system, linear gradient elution from A:B = 100:0 to A:B = 0:100 (60 min), where A is
H2O:CH3CN:trifluoroacetic acid = 90:10:0.1
and B is H2O:CH3CN:trifluoroacetic acid = 40:60:0.1 (v/v). c, final purification of CRSP. Sample,
biologically active fraction obtained by C18 reverse phase
HPLC, indicated by the arrow in b. Column, diphenyl
(2.1 × 150 mm, Vydac). Flow rate, 0.2 ml/min. The solvent system
is the same as that in b.
|
|
Peaks 4 and 5 showed different chromatographic behavior from those of
known biologically active peptides, and peak 5 was used for the present
isolation of CRSP. The biologically active fractions corresponding to
peak 5 were further subjected to CM ion exchange HPLC on a TSKgel
CM-2SW column, and only one fraction elicited significant biological
activity (data not shown). We next applied the biologically active
fraction to reverse phase HPLC on a C18 column, and a
single minute peak with absorbance at 210 nm showed compatible
cAMP-increasing activity (Fig. 1b, arrow). Final
purification was performed by another reverse phase HPLC on a diphenyl
column, and the peptide was purified to a homogenous state (Fig.
1c). The yield of each purification step was retrospectively
determined by RIA for CRSP and is summarized in Table
I. At the CM-52 ion exchange
chromatography step, the purification yield was greatly reduced. This
reduction was probably due to the long term storage of these
fractions.
Amino Acid Sequence of CRSP--
Intact and tryptic fragments of
the peptide purified from peak 5 were subjected to N-terminal sequence
analysis using a protein sequencer (Fig.
2, arrows). Based on the
sequence analysis data, its amino acid sequence was deduced up to the
37th residue (Fig. 2), except for the 2nd and 7th residues. The
molecular mass of this peptide was estimated to be 4042.0 daltons (Da)
from the sequence, assuming that two unidentified residues were
cysteines forming an intramolecular disulfide bond. To determine the
precise molecular mass of CRSP, the purified peptide was analyzed with an ESI mass spectrometer, and its molecular mass was determined to be
4130.6 ± 0.7 Da. The difference between the molecular mass estimated from the peptide sequence and that determined by mass spectrometry was assumed to be due to oxygens from two methionine sulfoxides (16.0 Da × 2) and a C-terminal glycine amide (57.0 Da), which were hard to identify by protein sequencing.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide and deduced amino acid sequences
of porcine CRSP precursor. Nucleotide and amino acid numbers are
shown on the right. Mature amino acid sequence of CRSP is
boxed. Arrows indicate the amino acid sequence
determined by a protein sequencer. The donor glycine of the C-terminal
amide is shaded, and the terminal codon is marked with
asterisk. Putative prohormone convertase cleavage sites are
double-underlined. Signal sequence (italics) was
predicted by PSORT II, a computer program that predicts protein
localization sites in animal cells (26).
|
|
To determine the cDNA sequence of a precursor for CRSP, we
synthesized degenerated primers corresponding to the N and C termini of
the sequence, and a PCR reaction was performed with porcine genomic
DNA. An amplified fragment was radiolabeled for screening of a
hypothalamus cDNA library, and 12 positive clones were obtained out
of 105 clones. Fig. 2 shows the nucleotide and deduced
amino acid sequences of a CRSP precursor. Analysis of the amino acid
sequence of the precursor for CRSP showed that it had typical features
of a secretory precursor protein for a biologically active peptide
including a signal sequence (Fig. 2, italics), dibasic
cleavage sites (double-underlined), and a cleavage/amidation
site (gray box). This cDNA sequence supported the
existence of glycine amide at the C-terminal of CRSP.
We next chemically synthesized CRSP based on the sequence and structure
(C-terminal amidation and intramolecular disulfide linkage) thus
determined. Synthetic CRSP or its methionine sulfoxide form elicits
chromatographic and mass spectrometric behavior quite similar to that
of the native peptide.
Both mature and prepro-CRSP sequences were utilized in a BLAST search
of the DDBJ/GenBankTM/EBI protein database, and this
peptide and its precursor were found to show sequence similarity with
CGRP and its related peptides (Fig. 3).
To further find out a corresponding peptide and its precursor in other
species, we searched the EST database and identified one candidate gene
in horse in addition to horse CGRP. The candidate gene had 77%
identity with porcine CRSP, and the amino acid sequence from the C
terminus was highly conserved (see "Discussion"). In human and
mouse, no corresponding gene has been identified that has significant
similarity with CRSP except for
- and
CGRP and amylin in both
databases.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
Alignment of the amino acid sequences of
porcine CRSP and its related peptides. The amino acid sequence of
porcine CRSP (pCRSP) is compared with equine CGRP-I
(eCGRPI), porcine CGRP (pCGRP), equine CGRP-II
(eCGRPII), human CGRP (h CGRP),
human CGRP (h CGRP), human amylin
(hAmylin), porcine CT (pCT), and human
adrenomedullin (hAM). Identical residues to CRSP are
boxed. Two cysteines in the N-terminal region of CRSP form
an intramolecular disulfide linkage.
|
|
Tissue Distribution of CRSP--
Messenger RNA levels for CRSP in
various porcine tissues were estimated by Northern blot analysis (Fig.
4). Approximately 1.0 kilobase of CRSP
mRNA was detected predominantly in the CNS, particularly in the
hypothalamus and pons/medulla oblongata, but a faint band was observed
in the spinal cord, where CGRP was abundantly expressed (24). Another
strong band was detected in the thyroid gland, although no band was
observed in other peripheral tissues.

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 4.
Northern blot analysis of CRSP mRNA.
Total RNA (30 µg) isolated from various porcine tissues was
electrophoresed on a 1.0% agarose gel under denaturing conditions,
transferred to a nylon membrane, and probed with a
32P-labeled DNA probe. The arrow indicates
~1.0 kilobase.
|
|
To measure the concentrations of CRSP in various tissues, we raised a
polyclonal antibody against CRSP-(24-38). Both CRSP-(24-38) and
CRSP-(1-38) elicited comparable affinity to this antibody. Half-maximal inhibition of radioiodinated ligand binding to the antibody by these peptides was observed at 10 fmol/tube, and no significant cross-reactivity was observed with porcine CT and CGRP
(<0.001%). Table II shows the
concentrations of immunoreactive (IR) CRSP in porcine tissues. The
posterior pituitary was found to contain the highest concentration of
IR-CRSP (96 ± 15 pmol/g wet weight). IR-CRSP was also abundant in
the CNS, particularly in the midbrain, thalamus and hypothalamus (> 3.0 pmol/g wet weight). In the peripheral tissues, the thyroid gland
contained an extremely high concentration of IR-CRSP (68 ± 39 pmol/g wet weight), but other peripheral tissues contained low levels
of IR-CRSP (<0.5 pmol/g wet weight).
Effects of CRSP on cAMP Production in Various Cells--
We next
measured the effects of CRSP on cAMP production in LLC-PK1
cells along with porcine CT, porcine CGRP, and human AM (Fig.
5a). This cell line was
reported to express both CT receptor and vasopressin V2
receptors that elevate the cAMP production (13, 14, 19). CRSP
stimulated the production of cAMP in LLC-PK1 cells in a
dose-dependent manner and more potently than any other
peptides. To examine the effect of CRSP on other cultured cells, this
peptide was administered to Hs68 and Swiss 3T3 fibroblasts, in which
cAMP production was reported to be stimulated predominantly by CGRP and
AM, respectively (27). Although CGRP and AM increased cAMP
concentration in Hs68 and Swiss 3T3 cells, CRSP did not alter the cAMP
level in either cell line (Figs. 5, b and c).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
Dose-response elevation of cAMP concentration
in the culture medium of various cells. LLC-PK1
(a), Hs68 (b), and Swiss 3T3 (c) cells
were stimulated with the indicated concentrations of CRSP (closed
circle), porcine CT (open square), porcine CGRP
(open circle), and human AM (open triangle). Each
point represents the mean ± S.E. of three separate
determinations.
|
|
Systemic Pharmacological Effects of CRSP--
Because CRSP shares
structural similarity with CGRP, CRSP was expected to elicit a
vasodilatory effect comparable with that of CGRP. CRSP was injected
into anesthetized rats up to 16 nmol/kg, and the blood pressure was
measured. However, no significant decrease in the blood pressure was
observed by bolus administration of CRSP. In the same system, CGRP
induced a potent depressor effect (Fig.
6a).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of CRSP and its related peptides on
rat blood pressure and plasma calcium concentration. a,
effect of CRSP (closed circle), porcine CT (open
square), and porcine CGRP (open circle) on the rat mean
arterial blood pressure. b, effect of CRSP (closed
circle), porcine CT (open square), salmon CT
(closed square), and porcine CGRP (open circle)
on the rat plasma calcium concentration. Each rat was injected with 16 nmol/kg each peptide or saline at 0 min. All values are expressed as
mean ± S.E. (n = 4). **, p < 0.01 compared with time = 5 min (a) or time = 0 min (b).
|
|
We next examined the effects of CRSP on the plasma calcium levels and
compared them to those of salmon and porcine CT (Fig. 6b).
Bolus administration of CRSP to anesthetized rats at a dose of 16 nmol/kg resulted in a significant decrease in the plasma calcium level.
The plasma calcium-reducing effect of CRSP was detectable up to 1 h and almost diminished 3 h after injection. On the other hand,
injection of salmon or porcine CT caused a sustained reduction in the
plasma calcium level even 3 h after injection.
Effects of CRSP and Its Related Peptides on Recombinant CT
Receptor--
Porcine CT receptor was transiently expressed in COS-7
cells, and we evaluated the effect of CRSP and its related peptides on
these cells. In Fig. 7a, a
dose-dependent production of cAMP was observed by
stimulation of CRSP, salmon CT, porcine CT, porcine CGRP, and human AM.
The production of cAMP was most strongly enhanced with salmon CT (a
median effective dose (ED50) = 0.03 nM),
which is known to stimulate mammalian CT receptor more potently than the respective endogenous CT. On the other hand, CRSP stimulated the CT
receptor (ED50 = 0.20 nM) with a potency more
than 350 times higher than that of porcine CT (ED50 = 71 nM), although its effect was weaker than that of salmon CT.
None of these peptides stimulated the cAMP production in
mock-transfected COS-7 cells (data not shown).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7.
Effects of CRSP and its related
peptides on the expression system of CT receptor alone, or CT receptor
or CL receptor with RAMPs. a,
dose-dependent stimulation of adenylyl cyclase activity via
porcine CT receptor. COS-7 cells expressing porcine CT receptor were
stimulated with the indicated concentrations of CRSP (closed
circle), salmon CT (closed square), porcine CT
(open square), porcine CGRP (open circle), and
human AM (open triangle). b, effect of CRSP on
cAMP production via porcine CT receptor or CL receptor in the presence
or absence of RAMPs. COS-7 cells were co-transfected with CT receptor
or CL receptor cDNA and one of RAMP1, -2, -3 cDNA or pcDNA.
The cells were stimulated with 100 nM of CRSP.
c, inhibition of 125I-labeled porcine CT binding
to the CT receptor by unlabeled peptides. Binding of
125I-labeled porcine CT to porcine CT receptor expressed in
COS-7 cells was measured in competition against unlabeled CRSP
(closed circle), salmon CT (closed square), and
porcine CT (open square) at the indicated concentrations.
COS-7 cells were transfected with cDNAs using LipofectAMINE Plus,
cultured for 24 h, and then used for the experiments. Each point
represents the mean ± S.E. of three (a and
b) and four (c) separate determinations.
|
|
To investigate the binding activity of CRSP to CT receptor,
125I-labeled porcine CT and 10 pM to 10 µM CRSP, salmon CT, or porcine CT as a competitor were
incubated with COS-7 cells that transiently expressed the CT receptor
(Fig. 7c). The binding of 125I-labeled porcine
CT to CT receptor in the COS-7 cells was abolished by the addition of
an excess amount of each peptide. The median inhibition concentration
(IC50) of CRSP in this binding assay system was found to be
1.3 nM, which was ~2-fold greater than that of salmon CT
(0.61 nM).
Effect of CRSP on CT Receptor or CL Receptor with or without
Co-transfection of RAMP--
A recent report revealed that AM and CGRP
receptors are composed of CL receptor and RAMPs with a single
transmembrane domain protein, although CL receptor belongs to the
family B of G-protein-coupled receptors. The CGRP receptor consisted of
CL receptor and RAMP1, whereas the AM receptor consisted of CL receptor
and RAMP2 or RAMP3 (28). High affinity amylin receptor was also shown
to be constituted by co-expression of CT receptor and RAMPs (29, 30).
On the basis of these findings, CT receptor or CL receptor was
expressed in COS-7 cells with one of the RAMPs or a blank expression
vector and stimulated with 100 nM CRSP, porcine CT, CGRP,
or human AM to examine through which receptor-RAMP complex CRSP can
stimulate cAMP production. Porcine CT stimulated the cAMP production
more than 10-fold in the COS-7 cells expressing CT receptor with or
without RAMP but not in those expressing CL receptor (data not shown).
Porcine CGRP or human AM stimulated the cAMP production ~5-fold in
the COS-7 cells expressing CL receptor with RAMP1, -2, or -3, respectively (data not shown). These results were compatible with those
reported previously (25). On the other hand, ~10-fold enhancement of
the cAMP production was observed by stimulation of CRSP in the COS-7
cells expressing CT receptor with or without RAMPs, whereas this
peptide did not alter the cAMP level in the COS-7 cells expressing CL
receptor with or without RAMPs (Fig. 7b).
 |
DISCUSSION |
In the present study, we isolated a novel peptide, CRSP, from a
porcine brain extract by monitoring the cAMP production in LLC-PK1 cells. Amino acid sequence analysis and molecular
cloning of CRSP and its precursor protein showed that this peptide
shows significant sequence similarity to CGRP. CGRP is a potent
vasodilatory peptide, and two isoforms have to date been reported in
humans and rodents (31-34). CGRP type-
was generated from
tissue-specific alternative splicing of mRNA transcribed from the
CT gene (32). On the other hand,
CGRP gene encodes a CT-like
sequence that is not transcribed into mRNA (34). Both genes have
striking sequence similarity to each other. Because one form of CGRP
corresponding to
CGRP has been identified in the pig, we first
considered that CRSP was a porcine counterpart of the
CGRP. However,
this peptide has a distinct structure, function, and distribution
compared with those of
- and
CGRP as described below. Compared
with the amino acid sequence of porcine CGRP, this peptide has 90%
identity in the 10-amino acid sequence from the N terminus, and two
cysteines that are deduced to form an intramolecular disulfide bond are conserved. On the other hand, only 40% identity between CRSP and CGRP
was observed in the 10-amino acid sequence from the C terminus. In
contrast, the amino acid sequences of human and porcine
CGRPs are highly conserved throughout the molecule (Fig.
3). CRSP stimulated cAMP production in LLC-PK1 cells about
300-fold more potently than porcine CGRP (Fig. 5a). CRSP
also stimulated the cAMP production in COS-7 cells expressing
recombinant CT receptor in a manner similar to that in
LLC-PK1 cells. On the other hand, this peptide did not
augment the cAMP production at all in either Hs68 or Swiss 3T3
cells, in which it was stimulated by CGRP and adrenomedullin. Both
- and
CGRP are reported to be abundantly expressed in the rat
spinal cord (24). On the other hand, Northern blot analysis data shows
that CRSP is expressed predominantly in the hypothalamus and poorly in
the spinal cord (Fig. 4). Although CRSP has structural similarity to
CGRP, several lines of evidence listed above indicate that CRSP has
characteristics distinct from those of CGRP and elicits its effects via
the CT receptor. Thus, we designated this peptide as calcitonin
receptor-stimulating peptide (CRSP).
By searching CRSP or related peptides in the EST database, one
candidate peptide, named CGRP-I, was found in horse. In horse, another
peptide named CGRP-II has been identified, which has 97, 87, and 89%
identity with porcine and human
- and
CGRP, respectively, and
this peptide is considered to be a counterpart of CGRP. The equine
CGRP-I gene encodes a peptide having 77% identity with porcine CRSP,
which is ~10% higher than that with porcine CGRP (67%). In
particular, the sequence identity between equine CGRP-I and porcine
CRSP is 80% in the 10-amino acid sequence from the C terminus, whereas
that between equine CGRP-I and porcine CGRP is only 30%. The high
identity in the N-terminal region and low identity in the C-terminal
region is one of the features that differentiates CRSP from CGRP as
described above. Because no corresponding gene has so far been found in
humans and rodents by database searching, the peptides having high
identity with CRSP might be limited to species evolutionarily close to
pig. Further biochemical and pharmacological analyses using synthetic
equine CGRP-I should be performed to determine whether it actually
elicits CRSP-like effects.
CGRP, CT, AM, and amylin, belonging to the CT and CGRP superfamily, are
widely distributed in the CNS as well as in the peripheral tissues and
induce multiple biological effects, including vasodilation, calcium
resorption in bone, and reduction in nutrient intake (31). However,
their receptor systems are more complex than other biologically active
peptides. Recent studies have verified that the functional AM receptor
and CGRP receptor consist of two membrane proteins, CL receptor, and
one of three RAMPs (30). CGRP is considered to stimulate cAMP
production via a CL receptor-RAMP1 complex (30), whereas AM is shown to
increase the intracellular signal via a CL receptor-RAMP2 or a CL
receptor-RAMP3 complex (28). Furthermore, later studies showed that the
expression of RAMP3 facilitated amylin to bind and activate CT receptor
(29, 30). Although CRSP was found to stimulate CT receptor, these
previous data indicated that the CRSP receptor should be characterized
in detail in endogenous as well as recombinant systems. As shown in
Fig. 5, CGRP and AM predominantly stimulated cAMP production in Hs68
and Swiss 3T3 cells, respectively, but CRSP did not alter the cAMP
concentration in either of these cell lines. As clearly shown in Fig.
7b, CRSP did not stimulate cAMP production at all via
porcine CL receptor in the presence or absence of porcine RAMPs in the
COS-7 cell expression system. These findings demonstrate that CRSP does
not stimulate endogenous and recombinant AM/CGRP receptors, although this peptide has high structural similarity to CGRP. However, CRSP
stimulated cAMP production in the COS-7 cells expressing the
recombinant CT receptor more potently than porcine CT (Fig. 7a), and co-expression of RAMPs did not alter the cAMP
production level induced by CRSP stimulation (Fig. 7b).
Binding of 125I-labeled porcine CT to the COS-7 cells
expressing the recombinant CT receptor was prominently displaced by
CRSP (Fig. 7c). The evidence described above indicate that
both CRSP and CT can stimulate the CT receptor, although a detailed
analysis of ligand-receptor interaction is required to understand how
two structurally distinct peptides can bind to the same receptor.
Bolus injection of CRSP into rats transiently reduced the plasma
calcium concentration, although its effect was weaker than that of
salmon and porcine CT (Fig. 6). At least two mechanisms have been
elucidated for the plasma calcium reduction. 1) CT receptor is
abundantly expressed on osteoclast cells (35). Treatment of resorbing
bones with CT increases loss of the ruffled border of the osteoclast
cells and decreases the release of lysosomal enzymes from them, which
results in a reduction in the plasma calcium level (16, 17). 2) Renal
tubular epithelia express CT receptor. The excretion of plasma calcium
through the kidney is stimulated by CT by inhibiting renal tubular
calcium reabsorption (18). As both osteoclast and renal epithelial
cells express CT receptor, CRSP is deduced to activate CT receptor on
these cells and decrease the plasma calcium concentration. In contrast to the potent effects of CRSP on cAMP production on LLC-PK1
cells and COS-7 cells expressing CT receptor, the plasma
calcium-reducing activity of CRSP is much weaker than that of porcine
CT. The difference in the biological potency of CRSP in the in
vivo and in vitro system may indicate the presence of
unidentified physiological effects and mechanisms distinct from those
of CT.
The CT receptor is also expressed in the CNS at a high level (36) in
addition to the peripheral system. Although CT receptor in the CNS has
been recognized to be involved in the regulation of appetite (37),
gastric acid secretion (38), and analgesic effect (39), endogenous
ligands for the CT receptor in the brain remain unidentified. In fact,
CT is mainly synthesized and secreted from the thyroid gland but is
almost undetectable in the CNS. The CT secreted from the thyroid and
circulating in the blood is not considered to be incorporated into the
CNS beyond the blood brain barrier. Several attempts have been made to
identify an endogenous ligand that stimulates cAMP production via CT
receptor in the CNS. Fischer et al. (22) reported that human
calcitonin- and C-terminal adjacent peptide-like immunoreactivities
were found in extracts of the human periventricular mesencephalic
region. Sexton and Hilton (23) detect salmon CT-like immunoreactivity in rat brain using an anti-salmon CT antibody. This finding was supported by CT bioassays including cAMP production and receptor binding to culture cells and brain membranes. In 1998, these authors reported the successful purification of brain CT-like peptide with a
molecular mass of 3267 Da, which was N-terminally blocked but had a
unique 6-amino acid sequence of EKSQSP in the molecule (24).
Unfortunately, no subsequent study has been reported for this peptide.
In our study, the structure of CRSP was determined by direct analysis
of the peptide purified from porcine brain extracts, and the sequence
of prepro-CRSP was deduced from cDNA cloning and analysis. The
CT-like biological activity was confirmed by the data showing that
synthetic CRSP stimulated cAMP production via recombinant CT receptor
and reduced the rat plasma calcium concentration by bolus
administration. These findings suggest that this peptide with low amino
acid sequence similarity with CT is a cognate ligand for CT receptor in
the CNS, although it is necessary to examine whether a unique CRSP
receptor that is more specific than CT receptor is present or not.
Identification of CRSP in other species as well as the elucidation of
its physiological effects and expression profiles in the CNS and
peripheral system will clarify the relationship between CRSP and the
previously reported CT-like peptide.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Kitamura and Prof. Eto
of Miyazaki Medical College for donation of antiserum against cAMP,
Drs. Magota and Okamoto of Suntory Institute for Biochemical
Research for discussion, and M. Nakatani and M. Higuchi of this
institute for technical assistance.
 |
FOOTNOTES |
*
This work was supported in part by research grants from the
Ministry of Education, Culture, Sports, Science, and Technology (Special Coordination Funds for the Promotion of Science and Technology and grant-in-aid for Scientific Research on Priority Areas (B), Scientific Research (C), and Encouragement of Young Scientists), the
Ministry of Health, Labor, and Welfare, and the Organization for
Pharmaceutical Safety and Research of Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB094586.
To whom correspondence should be addressed. Tel.: 81-6-6833-5012 (ext. 2507); Fax: 81-6-6835-5349; E-mail: minamino@ri.ncvc.go.jp.
Published, JBC Papers in Press, January 29, 2003, DOI 10.1074/jbc.M207970200
 |
ABBREVIATIONS |
The abbreviations used are:
AM, adrenomedullin;
CRSP, calcitonin receptor-stimulating peptide;
CGRP, calcitonin
gene-related peptide;
CGRP, CGRP type-
;
CGRP, CGRP type-
;
CT, calcitonin;
CL receptor, calcitonin-like receptor;
RAMP, receptor
activity-modifying protein;
DMEM, Dulbecco's modified Eagle's medium;
HPLC, high performance liquid chromatography;
ESI, electrospray
ionization;
CNS, central nervous system;
IR, immunoreactive;
BSA, bovine serum albumin;
RIA, radioimmunoassay;
CM, carboxymethyl;
Mops, 4-morpholinepropanesulfonic acid.
 |
REFERENCES |
| 1.
|
Kangawa, K.,
and Matsuo, H.
(1984)
Biochem. Biophys. Res. Commun.
118,
131-139[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Sudoh, T.,
Kangawa, K.,
Minamino, N.,
and Matsuo, H.
(1988)
Nature
332,
78-81[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Sudoh, T.,
Minamino, N.,
Kangawa, K.,
and Matsuo, H.
(1990)
Biochem. Biophys. Res. Commun.
168,
863-870[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Minamino, N.,
Sudoh, T.,
Kangawa, K.,
and Matsuo, H.
(1985)
Peptides
6,
245-248, Supple. 3
|
| 5.
|
Miyata, A.,
Arimura, A.,
Dahl, R. R.,
Minamino, N.,
Uehara, A.,
Jiang, L.,
Culler, M. D.,
and Coy, D. H.
(1989)
Biochem. Biophys. Res. Commun.
164,
567-574[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Kitamura, K.,
Kangawa, K.,
Kawamoto, M.,
Ichiki, Y.,
Nakamura, S.,
Matsuo, H.,
and Eto, T.
(1993)
Biochem. Biophys. Res. Commun.
192,
553-560[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Sakurai, T.,
Amemiya, A.,
Ishii, M.,
Matsuzaki, I.,
Chemelli, R. M.,
Tanaka, H.,
Williams, S. C.,
Richardson, J. A.,
Kozlowski, G. P.,
Wilson, S.,
Arch, J. R.,
Buckingham, R. E.,
Haynes, A. C.,
Carr, S. A.,
Annan, R. S.,
McNulty, D. E.,
Liu, W. S.,
Terrett, J. A.,
Elshourbagy, N. A.,
Bergsma, D. J.,
and Yanagisawa, M.
(1998)
Cell
92,
573-585[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Kojima, M.,
Hosoda, H.,
Date, Y.,
Nakazato, M.,
Matsuo, H.,
and Kangawa, K.
(1999)
Nature
402,
656-660[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Hull, R. N.,
Cherry, W. R.,
and Weaver, G. W.
(1976)
In Vitro
12,
670-677[Medline]
[Order article via Infotrieve]
|
| 10.
|
Gorbulev, V.,
Buchner, H.,
Akhundova, A.,
and Fahrenholz, F.
(1993)
Eur. J. Biochem.
215,
1-7[Medline]
[Order article via Infotrieve]
|
| 11.
|
Morel, A.,
O'Carroll, A. M.,
Brownstein, M. J.,
and Lolait, S. J.
(1992)
Nature
356,
523-526[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Sugimoto, T.,
Saito, M.,
Mochizuki, S.,
Watanabe, Y.,
Hashimoto, S.,
and Kawashima, H.
(1994)
J. Biol. Chem.
269,
27088-27092[Abstract/Free Full Text]
|
| 13.
|
Birnbaumer, M.,
Seibold, A.,
Gilbert, S.,
Ishido, M.,
Barberis, C.,
Antaramian, A.,
Brabet, P.,
and Rosenthal, W.
(1992)
Nature
357,
333-335[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Lolait, S. J.,
O'Carroll, A. M.,
McBride, O. W.,
Konig, M.,
Morel, A.,
and Brownstein, M. J.
(1992)
Nature
357,
336-339[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Wohlwend, A.,
Vassalli, J. D.,
Bertrand, D.,
and Orci, L.
(1986)
J. Cell. Physiol.
128,
71-75[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Friedman, J.,
and Raisz, L. G.
(1965)
Science
150,
1465-1467[Abstract/Free Full Text]
|
| 17.
|
Aliapoulios, M. A.,
Goldhaber, P.,
and Munson, P. L.
(1966)
Science
151,
330-331[Abstract/Free Full Text]
|
| 18.
|
Friedman, P. A.,
and Gesek, F. A.
(1993)
Am. J. Physiol.
264,
F181-F198[Abstract/Free Full Text]
|
| 19.
|
Lin, H. Y.,
Harris, T. L.,
Flannery, M. S.,
Aruffo, A.,
Kaji, E. H.,
Gorn, A.,
Kolakowski, L. F., Jr.,
Lodish, H. F.,
and Goldring, S. R.
(1991)
Science
254,
1022-1024[Abstract/Free Full Text]
|
| 20.
|
Rosenfeld, M. G.,
Mermod, J. J.,
Amara, S. G.,
Swanson, L. W.,
Sawchenko, P. E.,
Rivier, J.,
Vale, W. W.,
and Evans, R. M.
(1983)
Nature
304,
129-135[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Hoppener, J. W.,
Steenbergh, P. H.,
Moonen, P. J.,
Wagenaar, S. S.,
Jansz, H. S.,
and Lips, C. J.
(1986)
Mol. Cell. Endocrinol.
47,
125-130[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Fischer, J. A.,
Tobler, P. H.,
Henke, H.,
and Tschopp, F. A.
(1983)
J. Clin. Endocrinol. Metab.
57,
1314-1316[Abstract]
|
| 23.
|
Sexton, P. M.,
and Hilton, J. M.
(1992)
Brain Res.
596,
279-284[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Hilton, J. M.,
Mitchelhill, K. I.,
Pozvek, G.,
Dowton, M.,
Quiza, M.,
and Sexton, P. M.
(1998)
Endocrinology
139,
982-992[Abstract/Free Full Text]
|
| 25.
| Kikumoto, K., Katafuchi, T., and Minamino, N. Hypertens.
Res., in press
|
| 26.
|
Nakai, K.,
and Horton, P.
(1999)
Trends Biochem. Sci.
24,
34-35[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Isumi, Y.,
Minamino, N.,
Katafuchi, T.,
Yoshioka, M.,
Tsuji, T.,
Kangawa, K.,
and Matsuo, H.
(1998)
Endocrinology
139,
2552-2563[Abstract/Free Full Text]
|
| 28.
|
McLatchie, L. M.,
Fraser, N. J.,
Main, M. J.,
Wise, A.,
Brown, J.,
Thompson, N.,
Solari, R.,
Lee, M. G.,
and Foord, S. M.
(1998)
Nature
393,
333-339[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Muff, R.,
Buhlmann, N.,
Fischer, J. A.,
and Born, W.
(1999)
Endocrinology
140,
2924-2927[Abstract/Free Full Text]
|
| 30.
|
Christopoulos, G,
Perry, K. J.,
Morfis, M.,
Tilakaratne, N.,
Gao, Y.,
Fraser, N. J.,
Main, M. J.,
Foord, S. M.,
and Sexton, P. M.
(1999)
Mol. Pharmacol.
56,
235-242[Abstract/Free Full Text]
|
| 31.
|
Poyner, D., R.,
Sexton, P. M.,
Marshall, I.,
Smith, D. M.,
Quirion, R.,
Born, W.,
Muff, R.,
Fischer, J. A.,
and Foord, S. M.
(2002)
Pharmacol. Rev.
54,
233-246[Abstract/Free Full Text]
|
| 32.
|
Amara, S. G.,
Jonas, V.,
Rosenfeld, M. G.,
Ong, E. S.,
and Evans, R. M.
(1982)
Nature
298,
240-244[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Amara, S. G.,
Arriza, J. L.,
Leff, S. E.,
Swanson, L. W.,
Evans, R. M.,
and Rosenfeld, M. G.
(1985)
Science
229,
1094-1097[Abstract/Free Full Text]
|
| 34.
|
Steenbergh, P. H.,
Hoppener, J. W.,
Zandberg, J.,
Lips, C. J.,
and Jansz, H. S.
(1985)
FEBS Lett.
183,
403-407[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Ikegame, M.,
Rakopoulos, M.,
Zhou, H.,
Houssami, S.,
Martin, T. J.,
Moseley, J. M.,
and Findlay, D. M.
(1995)
J. Bone Miner. Res.
10,
59-65[Medline]
[Order article via Infotrieve]
|
| 36.
|
Hilton, J. M.,
Chai, S. Y.,
and Sexton, P. M.
(1995)
Neuroscience
69,
1223-1237[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Freed, W. J.,
Perlow, M. J.,
and Wyatt, R. J.
(1979)
Science
206,
850-852[Abstract/Free Full Text]
|
| 38.
|
Morley, J. E.,
Levine, A. S.,
and Silvis, S. E.
(1981)
Science
214,
671-673[Abstract/Free Full Text]
|
| 39.
|
Montemurro, L.,
Schiraldi, G.,
Fraioli, P.,
Tosi, G.,
Riboldi, A.,
and Rizzato, G.
(1991)
Calcif. Tissue Int.
49,
71-76[Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg