|
Originally published In Press as doi:10.1074/jbc.M208691200 on January 30, 2003
J. Biol. Chem., Vol. 278, Issue 14, 12546-12553, April 4, 2003
Interaction of L2 with -Actin Directs Intracellular Transport
of Papillomavirus and Infection*
Rongcun
Yang ,
William H.
Yutzy IV ,
Raphael P.
Viscidi§, and
Richard B. S.
Roden ¶
From the Departments of Pathology,
§ Pediatrics, and ¶ Gynecology and Obstetrics, The
Johns Hopkins School of Medicine, Baltimore, Maryland 21205
Received for publication, August 23, 2002, and in revised form, January 23, 2003
 |
ABSTRACT |
Viruses that replicate in the nucleus, including
the primary causative agent of cervical cancer, human papillomavirus
type 16 (HPV16), must first cross the cytoplasm. We compared the uptake of HPV16 virus-like particles (VLPs) either with or without the minor
capsid protein L2. Whereas VLPs containing only the major capsid
protein L1 were diffusely distributed within the cytoplasm even 6 h post-infection, VLPs comprising both L1 and L2 exhibited a radial
distribution in the cytoplasm and accumulated in the perinuclear region
of BPHE-1 cells within 2 h. L2 of HPV16 or bovine papillomavirus
was shown to bind to a 43-kDa cellular protein that was subsequently
identified as -actin by matrix-assisted laser desorption ionization
time-of-flight analysis. A conserved domain comprising residues 25-45
of HPV16 L2 was sufficient for interaction with -actin. HPV16 L2
residues 25-45 fused to green fluorescent protein, but not green
fluorescent protein alone, colocalized with actin and caused
cell retraction and disruption of the microfilament network. Finally,
wild-type L2, but not L2 with residues 25-45 deleted, facilitated
HPV16 pseudovirion infection. Thus, binding of -actin by L2 residues
25-45 facilitates transport of HPV16 across the cytoplasm during
infection, and blockade of this novel interaction may be useful for prophylaxis.
 |
INTRODUCTION |
Passive diffusion of molecules within the cytoplasm is limited by
molecular crowding and does not provide targeting to a particular subcellular domain (1). Thus, many intracellular pathogens subvert
existing transport mechanisms and cytoskeletal components, both to
efficiently reach their site of replication and also for the exit of
their progeny (2). The cytoskeleton is highly dynamic, and its role in
locomotion is regulated by a plethora of actin- and tubulin-binding
proteins, kinases, and phosphatases of multiple signaling cascades.
Changes in tyrosine phosphorylation of actin regulatory proteins induce
the condensation of actin "comet" tails behind endosomes (3), as
well as the bacteria Listeria, Shigella, and
Rickettsia (4) and viruses including vaccinia, baculovirus, and SV40, for propulsion through the cytoplasm (5, 6). Other viruses
employ cellular motors such as dyneins and kinesins for transport along
microtubules. A single virus type can employ several intracellular
transport mechanisms. Indeed, vaccinia particles are driven along
microtubules by kinesin, whereupon actin tails take over propulsion (7,
8).
Compelling epidemiologic and molecular virologic studies demonstrate
that infection with an oncogenic type human papillomavirus (HPV),1 typified by HPV16, is
a necessary cause of cervical cancer (9). In the absence of effective
screening programs, cervical cancer is a leading cause of cancer death
in women (10). Furthermore, oncogenic HPV infection is also strongly
associated with vulval, anal, and penile cancers, some non-melanoma
skin cancers, and esophageal and salivary cancers (11). An
understanding of the infectious process is critical to rational
development of approaches for prevention of HPV-related cancers.
Although several cellular molecules, including heparan sulfate
glycosaminoglycans (12), 6 integrin (13), and CD16 (14),
have been implicated as cell-surface receptors for papillomavirus,
little else is known about cellular proteins that mediate cytoplasmic
transport of papillomavirus and delivery of the viral genome to the nucleus.
The papillomavirus capsid comprises the major capsid protein L1
arranged as 72 pentamers, or capsomers, in a T=7d icosahedral surface lattice (15, 16) and a minor capsid protein, L2 (17), one
molecule of which may be located at each vertex (18). Overexpression of
L1 alone is sufficient to form empty capsids, termed virus-like particles (VLPs) (19). L1 VLPs bind to cell surfaces and compete with
bovine papillomavirus type 1 (BPV1) infection in vitro (20). However, both L1 and L2 are necessary for efficient production of
papillomavirus and infection (21-23). Recent studies by Kawana et al. (24, 25) suggest that residues 108-120 of L2 are
displayed upon the virion exterior and bind to the cell surface,
resulting in internalization. Furthermore, anti-L2 antiserum
neutralizes papillomavirus without preventing virion binding to the
cell surface (26). We recently demonstrated that L2 plays a critical
role in infection, but is not required for interaction of
papillomavirus particles with the cell surface (23). Taken together,
the data suggest that L1 mediates the initial binding of virions to the cell surface, whereas L2 provides later functions critical for infection.
 |
EXPERIMENTAL PROCEDURES |
Preparation of Papillomavirus VLPs and L2--
VLPs containing
L1 and L2, only L1, or L1 and L2 lacking residues 25-45 were generated
by infection of Sf9 with recombinant baculoviruses and purified
as previously reported (27). The HPV16 L2 25-45 deletion mutant was
prepared by two rounds of PCR using oligonucleotides
CGCGGATCCATGCGACACAAACGTTCTGC and
CCCATACTTCCATATTGTAACTGTTTGCATGTTTTATAAAG or
TCCCCCCGGGCTAGGCAGCCAAAGAGAC and
CTTTATAAAAACATGCAAACAGTTACAATATGGAAGTATGGG, followed
by just the outside primers. The quantity and quality of VLP
preparations were analyzed by SDS-PAGE and electron microscopy, respectively. His6-tagged BPV1 L2 fusion proteins were
prepared as previously described (26). For generation of glutathione S-transferase (GST)-tagged L2-green fluorescent protein
(GFP) fusion proteins, L2 oligonucleotides with EcoRI and
SalI overhangs were directly synthesized (HPV16
L2-(13-31),
AATTCGCATCGGCTACCCAACTTTATAAAACATGCAAACAGGCAGGTACATGTCCACCTGACGG and
TCGACCGTCAGGTGGACATGTACCTGCCTGTTTGCATGTTTTATAAAGTTGGGTAGCCGATGCG; HPV16
L2-(25-45),
AATTCGCAGGTACATGTCCACCTGACATTATACCTAAGGTTGAAGGCAAAACTATTGCTGAT CAAATAGG
and
TCGACCTATTTGATCAGCAATAGTTTTGCCTTCAACCTTAGGTATAATGTCAGGTGGACATGTACCTGCG; HPV16 L2-(61-81),
AATTCGGAACAGGGTCGGGTACAGGCGGACGCACTGGGTATATTCCATTGGGAACAAGGCCTCCCACAGG and
TCGACCTGTGGGAGGCCTTGTTCCCAATGGAATATACCCAGTGCGTCCGCCTGTACCCGACCCTGTTCCG; and HPV16 L2-(108-126),
AATTCTTAGTGGAAGAAACTAGTTTTATTGATGCTGGTGCACCAACATCTGTACCTTCCATCGG and
TCGACCGATGGAAGGTACAGATGTTGGTGCACCAGCATCAATAAAACTAGTTTCTTCCACTAAG) or
amplified by PCR using HPV16 L2-(1-128) (primers
GCAGAATTCATGCGACACAAACGTTCTGCA and GCAGGTCGACTGGGGGAATGGAAGGTAC) and
HPV16 L2-(299-333) (primers GCAGAATTCACTGGCATTAGGTACAGT and
GCAGGTCGACTTCTTCTGCAGGATCAATAGT). Expression of the recombinant
GST-tagged proteins in Escherichia coli BL21 and their
purification on a GSTrapTM FF column (Amersham Biosciences)
were performed according to the manufacturer's instructions.
Metabolic Labeling and Immunoprecipitation--
Cells were grown
overnight in Dulbecco's modified Eagle's medium and 10% fetal calf
serum containing 35S-radiolabeled methionine and cysteine
(0.2 mCi/ml) and harvested in ice-cold buffer A (10 mM
HEPES (pH 7), 1 mM EDTA, 0.1 mM EGTA, 10 mM KCl, 1 mM dithiothreitol, and 20 mM n-octyl -D-glucopyranoside with Complete® protease inhibitor mixture (Roche Molecular
Biochemicals)). The nuclei were removed by centrifugation at
12,000 × g for 15 min at 4 °C, and the lysate was
precleared with 100 µl of protein G-Sepharose and 20 µg/ml isotypic
control antibody for 2 h at 4 °C. After addition of
His6- or GFP-tagged fusion protein, immunoprecipitation was
performed with anti-His5 or anti-GFP monoclonal antibody, respectively, and protein G-Sepharose for 16 h at 4 °C with
slow agitation. The immunoprecipitates were washed six times with
ice-cold lysis buffer and resolved by 10% SDS-PAGE. After treating
with 50% (v/v) methanol and 10% (v/v) acetic acid and then
AmplifyTM (Amersham Biosciences) for 30 min, the gel was
dried under vacuum at 60-80 °C, and the incorporated
35S was visualized by autoradiography.
43-kDa Protein Purification and Identification--
GST-HPV16
L2-(1-128)-GFP was bound to a GSTrap FF column, and detergent
extracts of 109 SiHa cells in buffer A were passed over the
column. After extensive washing, the column was eluted with 50 mM Tris-HCl and 10 mM reduced glutathione at pH
8.0. Eluates were analyzed by SDS-PAGE and silver staining. The 43-kDa
protein band was excised and digested with TPCK-treated sequencing
grade trypsin (Worthington) as previously described (28). The masses of
the resulting peptides were measured by matrix-assisted laser
desorption ionization time-of-flight (MALDI-TOF) analysis on a Voyager
DE STR apparatus (Applied Biosystems, Foster City, CA). Positive ion
mass spectra were analyzed using Data Explorer (Version 3.5). Mass
accuracy was better than 100 ppm. -Actin was identified by using the
monoisotopic masses acquired from the 43-kDa protein to search the NCBI
Non-redundant Database using the MS-Fit search engine on the Protein
Prospector Web site.2
Flow Cytometric Analysis of L2-GFP Binding--
After fixation
for 5 min in 3.7% paraformaldehyde and phosphate-buffered saline
(PBS), cells were permeabilized with 1% (v/v) Triton X-100 for 20 min.
The cells were incubated with the L2-GFP fusion protein for 1 h at
room temperature, washed, and then analyzed by flow cytometry (FACScan,
BD Biosciences).
Transfection--
The HPV16 L2-(25-45) fragment was subcloned
between the EcoRI and SalI restriction sites of
pEGFP-C2 (Clontech). The constructs were then
transfected into COS-7 cells using LipofectAMINE 2000 (Invitrogen)
according to the recommended protocol. Three days after transfection,
the cells were stained with rhodamine-phalloidin (Molecular Probes,
Inc.) and examined by confocal fluorescence microscopy (UltraView
confocal imaging system, PerkinElmer Life Sciences).
Indirect Immunofluorescence, Rhodamine-Phalloidin Staining, and
Confocal Microscopy--
BPHE-1 cells were incubated with VLPs for
1 h at 4 °C in Dulbecco's PBS and then washed with
medium at 37 °C. At the time points indicated, the cells were washed
with PBS, fixed with 3.7% formaldehyde solution for 10 min,
permeabilized with 0.1% (v/v) Triton X-100 in PBS for 5 min, and
blocked with PBS containing 1% bovine serum albumin for 30 min.
Monoclonal antibody H16.V5 was used at 1:100 dilution for detection of
HPV16 L1, and fluorescein isothiocyanate-conjugated goat anti-mouse IgG
(Sigma) was added at 5 µg/ml for 20 min at 4 °C. Actin was stained
with rhodamine-phalloidin. Samples were examined by confocal
fluorescence microscopy using a Nikon Eclipse TE 200 inverted
microscope equipped with a ×40 plan fluor or ×60 or ×100 plan
apochromatic objective lens with a corresponding 1-, 0.8-, or 0.45-µm
optical z-slice. Twelve bit images were merged and analyzed
with the UltraView acquisition software, RGB mode.
Electron Microscopy--
HPV16 VLPs were bound to BPHE-1 cells
for 1 h at 4 °C. The cells were washed; shifted to 37 °C for
15 min; and then fixed in 2% glutaraldehyde, 0.05 M sodium
cacodylate, and 3 mM CaCl2 (pH 7.4) for 30 min
at room temperature with gentle rocking. After fixation in 0.5%
OsO4 and 0.8% potassium ferrocyanide in buffer for 15 min
on ice, the cells were dehydrated with a graded series of ethanol and
embedded in Eponate 12 (Ted Pella, Inc.) overnight. Samples were
treated with 0.15% tannic acid for 1 min, rinsed, and then stained en
bloc in uranyl acetate for 2 h in the dark. The sections were cut
and examined with a Phillips CM120 transmission electron microscope
operating at 80 kV.
Generation and Infectivity of HPV16 Pseudovirions--
HPV16
pseudovirions were generated, and their infectivity was assayed as
described previously (22). The HPV16 L2 25-45 deletion mutant was
prepared as described for the generation of HPV16 particles. The
resulting DNA was inserted into the BamHI and
XmaI restriction sites of pSFV4.2.
 |
RESULTS |
L2 Facilitates Perinuclear Trafficking--
To further define the
role of L2 in the infectious process, we compared the binding, uptake,
and intracellular transport of HPV16 VLPs containing both L1 and L2
(L1/L2 VLPs) with VLPs comprising only L1 (L1 VLPs) (27) in the
permissive cell line BPHE-1 (29). HPV16 VLPs were incubated with BPHE-1
cells for 1 h at 4 °C and visualized by indirect
immunofluorescence. As we previously demonstrated (20), VLPs comprising
L1 and L2 or only L1 bound to cell surfaces with a similar pattern and
degree (data not shown). Upon shifting to 37 °C for 15 min to
initiate synchronized uptake, the cells were fixed, sectioned, and
examined by transmission electron microscopy. No differences were noted
in the cellular ultrastructure of plasma membrane-associated L1 VLPs
(Fig. 1, A1 and A2)
or L1/L2 VLPs (B1 and B2) or their engulfment by
invagination of the plasma membrane (A2 and B2).
At 30 min and 1, 2, and 6 h after shifting the BPHE-1 cells to
37 °C, the VLPs were localized (Fig.
2) by indirect immunofluorescence using
the HPV16 L1-specific, conformationally dependent, neutralizing
monoclonal antibody H16.V5 (30, 31). Interestingly, L1/L2 VLPs aligned
along distinct radial tracks across the cytoplasm and within ~2 h at
37 °C arrived in the perinuclear region (Fig. 2, A1-A3).
However, L1 VLPs were not aligned along such radial tracks. Rather, L1
VLPs remained widely distributed throughout the whole cell and showed a
less clear-cut tropism toward the nucleus during this 6-h time course
(Fig. 2, B1-B3). These differences in the uptake of L1/L2
and L1 VLPs suggest that L2 contributes to the transport of virions
across the cytoplasm.

View larger version (123K):
[in this window]
[in a new window]
|
Fig. 1.
Ultrastructural analysis of L1/L2 and L1 VLP
uptake into BPHE-1 cells. HPV16 VLPs were bound to BPHE-1 cells
for 1 h at 4 °C. The cells were washed; shifted to 37 °C for
15 min (A1, A2, B1, and B2)
or 30 min (B3-B5); and then fixed in 2% glutaraldehyde,
0.05 M sodium cacodylate, and 3 mM
CaCl2 (pH 7.4) for 30 min at room temperature with gentle
rocking. After fixation in 0.5% OsO4 and 0.8% potassium
ferrocyanide in buffer for 15 min on ice, the cells were dehydrated
with a graded series of ethanol and embedded in Eponate 12 overnight.
Samples were treated with 0.15% tannic acid for 1 min, rinsed, and
then stained en bloc in uranyl acetate for 2 h in the dark. The
sections were cut and examined with a Phillips CM120 transmission
electron microscope operating at 80 kV. A1 and
A2, binding and engulfment of L1 VLPs; B1 and
B2, binding and engulfment of L1/L2 VLPs; B3,
L1/L2 VLPs bound to the surface of BPHE-1 cells (arrow 1),
particles within a vesicle that exhibits pinching (arrow 2),
and particles free in the cytoplasm (arrow 3);
B4, fine filaments radiating from L1/L2 VLPs in the
cytoplasm; B5, a fine filament emanating from L1/L2 VLPs
toward a microtubule (arrow 1) and a microtubule
(arrow 2).
|
|

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 2.
L2 promotes rapid transport
across the cytoplasm and radial distribution of VLPs.
Subconfluent BPHE-1 cells were incubated with 10 µg of HPV16
VLPs comprising L1/L2 (A panels), L1 alone (B
panels), or L1 and L2 lacking residues 25-45 (C
panels) for 1 h at 4 °C and then shifted to 37 °C for
various times. The cells were fixed at 30 min (A1-C1),
1 h (A2-C2), and 2 h (A3-C3),
respectively, with 3.7% formaldehyde solution for 10 min,
permeabilized with 0.1% (v/v) Triton X-100 in PBS for 5 min, and
blocked with PBS containing 1% bovine serum albumin for 30 min. Murine
monoclonal antibody H16.V5 was used at 1:100 dilution for detection of
HPV16 L1, and fluorescein isothiocyanate-conjugated goat anti-mouse IgG
(green) was added at 5 µg/ml for 20 min at 4 °C. Actin
was stained with rhodamine-phalloidin (red). Samples were
examined by confocal fluorescence microscopy (UltraView confocal
imaging system). D, cytochalasin B at 10 µM
depolymerizes actin and prevents the uptake of L1/L2 VLPs into cells;
E, actins in a normal BPHE-1 cell; F, localization of
-tubulin (red) and L1 VLPs (green) at 2 h
after shifting to physiologic temperature.
|
|
Because the cytoskeleton provides a framework for intracellular
transport and L1/L2 VLPs exhibited a radial distribution (Fig. 2,
A1 and A2) during transit to the perinuclear
region, we determined the subcellular localization of cytoskeletal
components during VLP uptake. Furthermore, Liu et al. (32)
observed an interaction between L1 and tubulin, as well as blockade of
particle uptake by the microtubule-depolymerizing agent nocodazole.
Thus, we examined the relative localization of HPV16 L1 VLPs and
tubulin by immunofluorescent staining. However, limited overlap of L1
VLP and tubulin signals was noted 2 h after uptake (Fig.
2F). Cytochalasin B both disrupted the microfilament network
by depolymerizing actin (Fig. 2, compare D and E)
and inhibited uptake of HPV16 L1 (data not shown) and L1/L2 (Fig.
2D) VLPs, consistent with previous studies (33). Therefore,
we compared the localization of actin (using rhodamine-phalloidin) and
VLPs during their uptake. Upon their initial uptake, the VLPs colocalized with cortical actin at the periphery of the cell. At later
time points, the radially distributed L1/L2 VLPs colocalized with actin
filaments (Fig. 2A2), whereas little overlap was observed for L1 VLPs and actin (compare A and B panels).
Thus, actin polymerization is critical early in VLP uptake, and the
particles colocalize with actin microfilaments while traversing the
cytoplasm. Although other viruses, including the structurally related
SV40, induce the formation of actin comet tails (34), this phenomenon
was not observed during HPV16 VLP uptake, suggesting a different mode of transport.
Residues 25-45 of L2 Bind -Actin--
BPV1 is frequently
exploited in virologic studies because, unlike HPVs (35), BPV can be
readily prepared in milligram quantities, and its infectivity can be
readily assayed in vitro (36). To identify cellular
"targeting molecule(s)" recognized by L2, we generated in E. coli six His6-tagged polypeptides spanning residues 1-88, 45-173, 130-257, 216-340, 300-425, and 384-469 that
together encompass the entire open reading frame of BPV1 L2 (26). These polypeptides were each incubated with
[35S]methionine/cysteine-radiolabeled SiHa cell lysates
(data not shown) or HeLa cell lysates and immunoprecipitated with a
monoclonal antibody specific for their tag. BPV1 L2 residues 1-88
co-immunoprecipitated with a cellular protein of ~43 kDa, whereas the
other fragments, including the overlapping BPV1 L2 peptide comprising
amino acids 45-173, did not (Fig.
3A). This implies that
residues 1-45 of L2 mediate binding to a 43-kDa cellular protein.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
The conserved N terminus of BPV1 and HPV16 L2
binds to the 43-kDa cellular protein. A, detergent
lysates of 35S-radiolabeled HeLa cells were subjected to
centrifugation at 12,000 × g for 15 min at 4 °C and
precleared with 100 µl of protein G-Sepharose and 20 µg/ml isotypic
control (contr.) antibody for 2 h at 4 °C. After
addition of His6-tagged BPV1 L2 fragments comprising the
residues indicated, immunoprecipitation was performed with
His5-specific monoclonal antibody and protein G-Sepharose
for 16 h at 4 °C with slow agitation. The immunoprecipitates
were washed six times with ice-cold lysis buffer and resolved by 10%
SDS-PAGE and autoradiography. B, purified GST-GFP alone
(GFP) or fused to HPV16 L2 residues 1-128
(1-128) was incubated with 35S-radiolabeled and
precleared SiHa cell lysates and immunoprecipitated using monoclonal
antibody to GFP or isotype-matched control antibody. C,
coprecipitation was performed as described for B, but using
GST-GFP fused to different regions of HPV16 L2. D, HeLa cell
lysate in ice-cold buffer A was clarified by centrifugation at
16,000 × g for 30 min and passed over
glutathione-Sepharose precoated with GST-GFP either alone or fused to
HPV16 L2 residues 25-45, 1-128, or 299-333 or with GST fused
to full-length HPV16 L2. After extensive washing, the bound proteins
were eluted with 50 mM Tris-HCl and 10 mM
reduced glutathione (pH 8.0) and analyzed by Western blotting with
mouse anti- -actin monoclonal antibody (AC-15, Sigma). E,
purified GST-GFP alone or fused to HPV16 L2 fragment 25-45 or
control fragment 299-333 was incubated with purified rabbit muscle
actin in PBS for 1 h and then passed through a GSTrap FF column.
After extensive washing, the bound proteins were eluted and visualized
by SDS-PAGE and Coomassie staining.
|
|
Unlike the C-terminal sequence, the first ~120 amino acids of L2 are
well conserved among the >70 known papillomavirus genotypes. To
examine whether the N-terminal domain of L2 derived from other papillomavirus genotypes is also able bind to this 43-kDa cellular protein, we next generated in E. coli a chimera comprising
GST fused in-frame to amino acids 1-128 of HPV16 L2 and GFP to form GST-HPV16 L2-(1-128)-GFP. The purified fusion protein was incubated with [35S]methionine/cysteine-radiolabeled SiHa cell
lysates and immunoprecipitated using a monoclonal antibody to GFP. The
GST-HPV16 L2-(1-128)-GFP (but not GST-GFP) fusion protein also bound
to the 43-kDa cellular protein (Fig. 3B), showing that this
interaction is conserved in two evolutionarily distant papillomavirus
types, BPV1 and HPV16. When testing smaller N-terminal
subfragments of HPV16 L2, only residues 25-45 co-immunoprecipitated
with the 43-kDa cellular protein from detergent lysates of radiolabeled
SiHa cells (Fig. 3C), suggesting that this motif is
sufficient for interaction.
To determine the distribution of the cellular protein that interacts
with the HPV16 L2-GFP fusion protein, we examined, by confocal
fluorescence microscopy (Fig. 4,
A1.1-A1.4) and flow cytometry (A2.1-A2.4), the
binding to detergent-permeabilized human cervical carcinoma-derived
cell lines of GST-GFP chimeric proteins either with or without HPV16 L2
residues 1-128. Whereas the GST-GFP fusion protein failed to bind to
SiHa cells, GFP fusion proteins containing either residues 1-128 or
25-45 of HPV16 L2 bound to a similar extent within the cytoplasm of
the detergent-permeabilized SiHa cells (Fig. 4). To eliminate the
possible effects of GST in the binding of the fusion protein to cells,
the GST-HPV16 L2-GFP fusion proteins were digested with
PreScission protease (Fig. 4B1, PreS.P) to
release the GST tag (37). Thus, the binding to SiHa cells of
PreScission protease-digested (Fig. 4B3.2) and undigested
(Fig. 4B3.4) GST-HPV16 L2-(25-45)-GFP fusion protein was
compared. L2-GFP (but not GFP alone) bound to SiHa cells to a similar
extent either with or without GST, indicating that neither GST nor GFP
mediates binding. Flow cytometric analysis showed that HPV16 L2
residues 1-128 bound to both HPV-positive cervical carcinoma-derived
cell lines HeLa (data not shown) and SiHa (Fig. 4A2.2) to a
similar extent as the HPV-negative human cervical carcinoma-derived
cell line C33A (Fig. 4A2.4), indicating that HPV16 L2 binds
to a cytoplasmic component that is not derived from papillomavirus.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4.
Residues 25-45 of HPV16 L2 bind to a
non-viral component of the cytoplasm. A,
HPV16-positive (SiHa; A1.1, A1.2,
A2.1, and A2.2) and HPV-negative (C33A;
A1.3, A1.4, A2.3, and A2.4)
cervical carcinoma-derived cell lines were washed with PBS, fixed with
3.7% paraformaldehyde, and then permeabilized with 1% (v/v) Triton
X-100 for 20 min. The cells were incubated for 1 h at room
temperature with purified fusion protein comprising GST-GFP alone
(A1.1, A1.3, A2.1, and
A2.3) or fused to residues 1-128 of HPV16 L2
(A1.2, A1.4, A2.2, and
A2.4), washed, and examined by confocal fluorescence
microscopy (A1 panels; scale bars = 10 µm)
or flow cytometry (A2 panels). B1, GST-GFP fusion
proteins containing various HPV16 L2 fragments (shown for residues
25-45) were affinity-purified, digested with PreScission
protease (PreS.P), and analyzed by SDS-PAGE and Coomassie
staining. B2.1 and B2.2, the binding of GFP alone
and the HPV16 L2-(25-45)-GFP fragment, respectively, to SiHa cells was
detected by laser scanning confocal microscopy. B3.1-B3.4,
the binding of the HPV16 L2-(25-45)-GFP fragment to SiHa cells
is independent of the GST tag. Shown are the results from flow
cytometric analysis of the binding to SiHa cells of PreScission
protease-digested (B3.1 and B3.2) or undigested
(B3.3 and B3.4) GFP-GST fusion protein either
lacking (B3.1 and B3.3) or including
(B3.2 and B3.4) residues 25-45 of HPV16
L2.
|
|
To identity the 43-kDa cellular protein, a detergent lysate of SiHa
cells was passed over a GST-HPV16 L2-(1-128)-GFP-coated column. After
extensive washing, the proteins bound were eluted and visualized by
SDS-PAGE and silver staining (data not shown). The 43-kDa protein band
recovered was excised and subjected to in-gel trypsin digestion and
MALDI-TOF analysis. This analysis resulted in the identification of 13 peptides whose protein sequences were all consistent with -actin
(Fig. 5, A and
B).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Tryptic mass fingerprint identifies the
43-kDa band as -actin. A, the
43-kDa protein band that bound to residues 1-128 of HPV16 L2 was
excised and digested with TPCK-treated sequencing grade trypsin as
previously described (28). Masses of the resulting peptides were
measured by MALDI-TOF analysis on a Voyager DE STR apparatus. Positive
ion mass spectra were analyzed using Data Explorer (Version 3.5). Mass
accuracy was better than 100 ppm. B, the predicted and
measured peptide masses are listed. -Actin was identified by using
the acquired monoisotopic masses to search the NCBI Non-redundant
Database using the MS-Fit search engine on the Protein Prospector Web
site (see Footnote 2).
|
|
Because peptides of L2 were used for the actin binding experiments, it
is possible that the truncations resulted in exposure on a
nonphysiologic cryptic epitope. To demonstrate interaction between
full-length L2 and actin, a detergent lysate of HeLa cells was passed
over glutathione-Sepharose beads precoated with GST fused to
full-length HPV16 L2. The bound proteins were separated by
electrophoresis and subjected to Western blot analysis using a mouse
monoclonal antibody to -actin (Fig. 3D). Full-length HPV16 L2 and its fragments 1-128 and 25-45 bound to actin,
whereas fragment 299-333 and the GFP control did not (Fig.
3D). Thus, binding to actin is a property of full-length L2.
It is unclear whether L2 binds directly to actin. Therefore, to address
this question, purified GST-GFP fusion proteins containing HPV16
L2 residues 25-45 or, as a negative control, residues 299-333 were incubated for 1 h at ambient temperature with actin purified from rabbit muscle (A-2522, Sigma). Upon pull-down with
glutathione-Sepharose, actin copurified with the GST-GFP fusion protein
containing residues 25-45 (but not residues 299-333) of HPV16 L2
(Fig. 3E). This observation strongly supports the existence
of a direct interaction between HPV16 L2 residues 25-45 and actin.
L2 Residues 25-45 Are Necessary for Efficient Transport to the
Perinuclear Region and HPV16 Infection--
Studies in other viral
systems suggest that interaction with actin can facilitate the
intracellular transport of viral particles and infection. Therefore, to
address the biologic significance of the putative actin-binding domain
in HPV16 L2, we compared the uptake of HPV16 VLPs comprising wild-type
L1 alone, L1 and L2, and L1 and L2 with residues 25-45 deleted
(L1/L2 25-45). Whereas wild-type HPV16 L1/L2 VLPs were
rapidly transported to the perinuclear region along radial tracts (Fig.
2A1), L1/L2 VLPs lacking residues 25-45 failed to align
along radial tracts in the cytoplasm and did not reach the perinuclear
region during a 6-h time course (Fig. 2, C1-C3). Rather,
L1/L2 25-45 VLPs remained widely distributed throughout the cell as
described for L1 VLPs (Fig. 2, B1-B3).
Because papillomavirus exhibits a high particle to infectivity ratio
in vitro (22), it is possible that the uptake of HPV16 VLPs
shown in Fig. 1 does not represent the true infectious pathway. Therefore, to examine the significance of this interaction between L2
and -actin to the infectious process, we generated HPV16
pseudovirions lacking the conserved -actin-binding domain,
viz. residues 25-45 (Fig.
6A), and tested their
infectivity using a previously described system. Briefly, the hamster
fibroblast cell line BPHE-1 harbors 50-200 episomal copies of the
bovine papillomavirus genome/cell (29), but it produces no virus
because the L1 and L2 genes are not expressed. However, ectopic
expression of HPV16 L1 and L2 in BPHE-1 cells via infection with
recombinant defective Semliki Forest viruses results in the generation
of infectious HPV16 pseudovirions containing the BPV genome within
capsids formed of HPV16 L1 and L2 (22). Like native BPV1 virions, the
infectivity of HPV16 {BPV1} pseudovirions can readily be quantified
using the in vitro focal transformation of mouse C127 cells
(36). HPV16 pseudovirions lacking residues 25-45 of L2 showed
dramatically reduced infectivity (Fig. 6), suggesting that interaction
between L2 and -actin indeed plays a critical role in the infectious
process of papillomavirus.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
L2 residues 25-45 are required for efficient
HPV16 pseudovirion infection. A, the putative
actin-binding motif (residues 25-45 of HPV16 L2) is highly conserved
among the different papillomavirus types. EEPV,
European Elk Papillomavirus; RhPV, Rhesus papillomavirus.
B, shown is the effect of the L2 25-45 deletion mutation
on infection of C127 cells by HPV16 pseudovirions. HPV16 pseudovirions
were generated in BPHE-1 cells, and their infectivity was assayed as
described previously (22). The presence of infectious HPV16
pseudovirions in extracts of BPHE-1 cells expressing wild-type HPV16 L1
and L2 (L1+L2), L1 and L2 lacking residues 25-45
(L1+L2(25+45)), or L1 alone was assessed using the focus
forming assay in monolayers of C127 cells and compared with untreated
control (Contr.) C127 cells. Mouse C127 cells were
maintained for 3 weeks in Dulbecco's modified Eagle's medium
containing 10% fetal calf serum. The plates were stained with 0.5%
(w/v) methylene blue and 0.25% (w/v) carbol fuchsin in methanol to
highlight transformed foci for counting. C, foci counted in
four experiments are plotted.
|
|
Cytoplasmic Overexpression of HPV16 L2 Residues 25-45 Disrupts the
Actin Architecture--
Actin is one of most abundant proteins in
eukaryotic cells, and its role as a primary determinant of cell shape,
cytoplasmic structure, and locomotion is highly regulated by a plethora
of binding proteins. Given the ability of L2 to bind to actin and the
karyophilic nature of full-length L2, we hypothesized that an
overabundance of L2 within the cytoplasm might induce changes in the
cytoskeleton and cell morphology. To test this hypothesis, the fragment
of HPV16 L2 encoding residues 25-45 was inserted 3' of the GFP gene in
the mammalian expression vector pEGFP-C2 to form pEGFP-L2-(25-45).
COS-7 cells were transfected with either pEGFP-C2 or pEGFP-L2-(25-45).
Three days after transfection, equivalent expression of GFP alone and
fused to HPV16 L2 residues 25-45 was confirmed by Western blot
analysis with a monoclonal antibody to GFP (data not shown). The
subcellular localization of actin (upon staining with
rhodamine-phalloidin) and either GFP alone or fused to HPV16 L2
residues 25-45 was examined by confocal fluorescence microscopy.
Transient expression of GFP fused to HPV16 L2 residues 25-45 within
the cytoplasm of COS-7 cells induced a dramatic retraction of
transfected cells from the culture surface (Fig.
7B1). In contrast, expression
of GFP alone in the transfected cells did not noticeably influence cell
morphology (Fig. 7A1) compared with the parental untransfected cells (data not shown). Interestingly, staining revealed
apparent reorganization of filamentous actin into cytoplasmic bundles,
which colocalized with the GFP fusion proteins containing HPV16 L2
residues 25-45 (Fig. 7, B1-B4). GFP did not significantly colocalize with actin staining even in dividing cells that had retracted from the culture dish (Fig. 7, A1-A4). Thus,
cytoplasmic overexpression of the actin-binding domain of HPV16 L2 is
sufficient to induce retraction of COS-7 cells and actin
reorganization.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of HPV16 L2 residues 25-45 in
COS-7 cells alters cell morphology and actin structure. COS-7
cells in two-well chamber slides were transfected using LipofectAMINE
2000 with 1 µg of plasmid vector pEGFP encoding GFP (A
panels) or pEGFP-L2-(25-45) encoding GFP fused to HPV16 L2
residues 25-45 (B panels). After 3 days, the cells were
stained with rhodamine-phalloidin and analyzed by confocal microscopy.
A1 and B1, phase-contrast light microscopy;
A2 and B2, GFP fluorescence; A3 and
B3, actin stained with rhodamine-phalloidin; A4
and B4, overlays of fluorescence channels.
|
|
Furthermore, we examined, by transmission electron microscopy, sections
of BPHE-1 cells 30 min after addition of HPV16 VLPs for the association
of intracellular L1/L2 or L1 particles with actin microfilament-like
structures. Fig. 1B3 shows surface-bound HPV16 L1/L2 VLPs,
large groups of particles within vesicles, and individual particles
free in the cytoplasm. The majority of 50 HPV16 L1/L2 VLPs present in
the cytoplasm were associated with fine filamentous structures whose
width is consistent with that of actin microfilaments. HPV16 L1/L2 VLPs
occasionally formed "star-like" structures (Fig. 1B4)
with fine filaments radiating from the capsid surface or a halo around
the particle in the dense cortical actin (data not shown), suggestive
of actin rearrangement. Fine filaments (Fig. 1B5,
arrow 1) that seemed to link HPV16 L1/L2 particles to
microtubules (arrow 2) were also found. However, we did not
observe such structures in association with 50 L1 VLPs free in the
cytoplasm of BPHE-1 cells (data not shown).
 |
DISCUSSION |
During the infectious process, an intracellular pathogen hijacks
the normal cellular function of its receptor molecules for transportation to its site of replication. Thus, study of such infectious pathways can both enhance our understanding of normal cellular transport as well as identify targets for intervention. Although intracellular pathogens use diverse primary and secondary receptors to gain entry to the cell, the mechanisms employed for intracellular transport are more restricted. For example,
microorganisms as diverse as Listeria, Shigella,
Rickettsia, vaccinia, and SV40 employ different receptors to
gain entry to a cell, but a similar mode of intracellular transport (6,
34). However, despite their structural similarity to SV40 (18), the
papillomaviruses use a distinct cell-surface receptor and entry
pathway, about which little is known. Indeed, three different surface
molecules (12-14) have been proposed to bind to the major capsid
protein L1 and to function as the primary receptor for papillomavirus. Papillomavirus L1 pseudovirions prepared in vitro are
infectious, although significantly less so than those containing L2
(38-40). We have provided genetic evidence that L2 also plays a
critical role during papillomavirus infection, but after the initial
binding of the particle to the cell surface (23). By virtue of its
ability to bind to and enter cells, L2 was recently proposed to bind to a secondary viral receptor and to facilitate uptake (24). The inability
of L1 VLPs to enter the nucleus (41) and the importance of the
DNA-binding and karyophilic domains of L2 to the infectious process
suggest that interaction of L2 with the viral genome may play a key
role in its delivery to the nucleus (23, 42).
The high local protein concentration (as high as 300 mg/ml),
organelles, and the cytoskeleton contribute to the molecular crowding
within a cell that restricts the free diffusion of molecules of >500
kDa (1). Because the papillomavirus capsid is 55 nm in diameter and
>2000 kDa, its free diffusion within the cell will be extremely slow
(15). During infection, the virus needs to rapidly traffic to the
nucleus, the site of viral replication, rather than to other organelles
such as lysosomes. To efficiently transport particles across the
cytoplasm during infection, residues 25-45 of HPV16 L2 bind to
-actin, and this interaction influences microfilament structure.
However, understanding the mechanism of locomotion requires further investigation.
The high degree of sequence conservation of the L2 motif (Fig.
6A) and the ability of both BPV1 and HPV16 L2 to bind actin suggest that this interaction is common to other papillomavirus genotypes and therefore may represent a useful target for the development of pan-papillomavirus-preventative treatments. Indeed, antibody to L2 (but not L1) neutralizes diverse papillomavirus genotypes, suggesting that a conserved functional domain of L2 is
displayed on the capsid surface (25, 43). Furthermore, L2-specific
neutralizing antibodies predominantly recognize its N terminus and do
not prevent virions from binding to the cell surface (26), suggesting
that neutralization may occur by a blockade of virion uptake or
intracellular transport.
Several pathogens have independently evolved mechanisms to harness the
power of actin polymerization to get into and out of cells (34).
Indeed, the entry of a wide variety of viruses, including
papillomavirus, human immunodeficiency virus, vaccinia, Autographa californica M nucleopolyhedrovirus, adenovirus
type 2, and echoviruses, is dependent upon actin polymerization
as demonstrated by blockade with the inhibitor cytochalasin D (44). However, this does not necessarily reflect a direct interaction between
the virus and actin because actin function is necessary for
receptor-mediated endocytosis and many other cellular processes.
A. californica M nucleopolyhedrovirus induces the formation
of thick actin cables that frequently project toward the nucleus. These
actin cables are transiently formed in association with the viral
nucleocapsids prior to viral gene expression and concomitantly with
nucleocapsid transport to the nucleus (45). Two virus-encoded capsid
proteins, p39 and p78/83, in A. californica M
nucleopolyhedrovirus were found to bind to actin directly and therefore
could be involved in the observed acceleration of actin polymerization
by viral actin-binding proteins (46). It is unclear how this effect
relates to the changes in actin structure produced by overexpression of L2 residues 25-45 within the cytoplasm because neither papillomavirus L1/L2 VLPs nor L2 induces such actin cables.
Both endosomes and diverse pathogens are able to recruit host
cytoskeletal factors to induce the polymerization of actin filaments from their surface into a structure known as a comet tail for intracellular propulsion (34). However, the presence of L2 or L1/L2
VLPs during infection did not promote the formation of such actin comet
tails, suggesting that interaction of L2 with -actin facilitates particle transport by another mechanism.
Actin is an ATPase, and ATP hydrolysis affects the kinetics of
polymerization (47). In vivo, actin polymerization is a
highly regulated process controlled both by ATP binding and hydrolysis and by the action of a number of actin-binding proteins that initiate, cleave, cross-link, stabilize, or destabilize the filaments (48). Actin
comet tails result from a depolymerization of filamentous actin and
re-polymerization behind the particle (34). Interestingly, overexpression of the -actin-binding motif comprising residues 25-45 of HPV16 L2 in the cytoplasm was associated with the
redistribution of actin in COS-7 cells and altered cell morphology.
This is consistent with a functional interaction between L2 and actin
in vivo that orchestrates the intracellular motility of
papillomavirus during infection.
In addition to promoting uptake, the actin cytoskeleton facilitates
egress of vaccinia from infected cells (8, 34). The spread of vaccinia
is enhanced by actin tail formation that is triggered via tyrosine
phosphorylation of A36R. Herpesvirus type 1 VP22 exploits
microfilaments to promote intercellular spreading (49). Furthermore,
interaction of the Black Creek Canal virus N protein with actin
microfilaments is required for virion morphogenesis and release,
but not infection (50). However, papillomavirus accumulates in
microcrystalline arrays within the nucleus of productively infected
cells, and there is currently no evidence for such an egress pathway
mediated by L2-actin interaction.
 |
ACKNOWLEDGEMENTS |
We thank T.-C. Wu (The Johns Hopkins
University) and Andrew Lewis (Food and Drug Administration) for
donating cell lines; Neil D. Christensen (Pennsylvania State
University) for antibody H16.V5; Robert N. Cole for assistance in
protein identification; the Mass Spectrometry Facility of The Johns
Hopkins School of Medicine; Mike Delannoy (Microscopy Facility, The
Johns Hopkins School of Medicine) for expert confocal and electron
microscopy; Hung Chien-Fu and Lin Ken-Yu for discussion on molecular
biotechnology; Liang-Mei He for technical assistance; and Drs. T.-C. Wu
and Douglas Robinson (The Johns Hopkins University) and John T. Schiller and Douglas R. Lowy (National Cancer Institute) for providing
critiques during the preparation of this manuscript.
 |
FOOTNOTES |
*
This work was supported by Grants AI48203 and CA83706
from the National Institutes of Health the Cancer Research Institute, and by American Cancer Society Grant RSG MBC-103111 (to
R. B. S. R.). The work performed at the Mass Spectrometry Facility
of The Johns Hopkins School of Medicine was supported by National Center for Research Resources Shared Instrumentation Grant 1S10-RR14702 and the Johns Hopkins Fund for Medical Discovery.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Pathology, The Johns Hopkins School of Medicine, Ross 512B, 720 Rutland Ave., Baltimore, MD 21205. Tel.: 410-502-5161; Fax: 443-287-4295; E-mail: roden@jhmi.edu.
Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M208691200
2
Available at prospector.ucsf.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
HPV, human
papillomavirus;
VLP, virus-like particle;
BPV, bovine papillomavirus;
GST, glutathione S-transferase;
GFP, green fluorescent
protein;
TPCK, L-1-tosylamido-2-phenylethyl chloromethyl
ketone;
MALDI-TOF, matrix-assisted laser desorption ionization
time-of-flight;
PBS, phosphate-buffered saline.
 |
REFERENCES |
| 1.
|
Luby-Phelps, K.
(2000)
Int. Rev. Cytol.
192,
189-221[Medline]
[Order article via Infotrieve]
|
| 2.
|
Sodeik, B.
(2000)
Trends Microbiol.
8,
465-472[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Taunton, J.,
Rowning, B. A.,
Coughlin, M. L.,
Wu, M.,
Moon, R. T.,
Mitchison, T. J.,
and Larabell, C. A.
(2000)
J. Cell Biol.
148,
519-530[Abstract/Free Full Text]
|
| 4.
|
Dramsi, S.,
and Cossart, P.
(1998)
Annu. Rev. Cell Dev. Biol.
14,
137-166[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Cudmore, S.,
Reckmann, I.,
and Way, M.
(1997)
Trends Microbiol.
5,
142-148[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Pelkmans, L.,
Puntener, D.,
and Helenius, A.
(2002)
Science
296,
535-539[Abstract/Free Full Text]
|
| 7.
|
Rietdorf, J.,
Ploubidou, A.,
Reckmann, I.,
Holmstrom, A.,
Frischknecht, F.,
Zettl, M.,
Zimmermann, T.,
and Way, M.
(2001)
Nat. Cell Biol.
3,
992-1000[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Moss, B.,
and Ward, B. M.
(2001)
Nat. Cell Biol.
3,
E245-E246[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Walboomers, J. M.,
Jacobs, M. V.,
Manos, M. M.,
Bosch, F. X.,
Kummer, J. A.,
Shah, K. V.,
Snijders, P. J.,
Peto, J.,
Meijer, C. J.,
and Muñoz, N.
(1999)
J. Pathol.
189,
12-19[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Pisani, P.,
Parkin, D. M.,
Bray, F.,
and Ferlay, J.
(1999)
Int. J. Cancer
83,
18-29[Medline]
[Order article via Infotrieve]
|
| 11.
|
zur Hausen, H.
(2002)
Nat. Rev. Cancer
2,
342-350[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Joyce, J. G.,
Tung, J. S.,
Przysiecki, C. T.,
Cook, J. C.,
Lehman, E. D.,
Sands, J. A.,
Jansen, K. U.,
and Keller, P. M.
(1999)
J. Biol. Chem.
274,
5810-5822[Abstract/Free Full Text]
|
| 13.
|
Evander, M.,
Frazer, I. H.,
Payne, E.,
Qi, Y. M.,
Hengst, K.,
and McMillan, N. A.
(1997)
J. Virol.
71,
2449-2456[Abstract]
|
| 14.
|
Da Silva, D. M.,
Velders, M. P.,
Nieland, J. D.,
Schiller, J. T.,
Nickoloff, B. J.,
and Kast, W. M.
(2001)
Int. Immunol.
13,
633-641[Abstract/Free Full Text]
|
| 15.
|
Baker, T. S.,
Newcomb, W. W.,
Olson, N. H.,
Cowsert, L. M.,
Olson, C.,
and Brown, J. C.
(1991)
Biophys. J.
60,
1445-1456[Medline]
[Order article via Infotrieve]
|
| 16.
|
Hagensee, M. E.,
Olson, N. H.,
Baker, T. S.,
and Galloway, D. A.
(1994)
J. Virol.
68,
4503-4505[Abstract/Free Full Text]
|
| 17.
|
Doorbar, J.,
and Gallimore, P. H.
(1987)
J. Virol.
61,
2793-2799[Abstract/Free Full Text]
|
| 18.
|
Trus, B. L.,
Roden, R. B.,
Greenstone, H. L.,
Vrhel, M.,
Schiller, J. T.,
and Booy, F. P.
(1997)
Nat. Struct. Biol.
4,
413-420[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Kirnbauer, R.,
Booy, F.,
Cheng, N.,
Lowy, D. R.,
and Schiller, J. T.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
12180-12184[Abstract/Free Full Text]
|
| 20.
|
Roden, R. B.,
Kirnbauer, R.,
Jenson, A. B.,
Lowy, D. R.,
and Schiller, J. T.
(1994)
J. Virol.
68,
7260-7266[Abstract/Free Full Text]
|
| 21.
|
Zhou, J.,
Stenzel, D. J.,
Sun, X. Y.,
and Frazer, I. H.
(1993)
J. Gen. Virol.
74,
763-768[Abstract/Free Full Text]
|
| 22.
|
Roden, R. B.,
Greenstone, H. L.,
Kirnbauer, R.,
Booy, F. P.,
Jessie, J.,
Lowy, D. R.,
and Schiller, J. T.
(1996)
J. Virol.
70,
5875-5883[Abstract]
|
| 23.
|
Roden, R. B.,
Day, P. M.,
Bronzo, B. K.,
Yutzy, W. H., IV,
Yang, Y.,
Lowy, D. R.,
and Schiller, J. T.
(2001)
J. Virol.
75,
10493-10497[Abstract/Free Full Text]W. H.
|
| 24.
|
Kawana, Y.,
Kawana, K.,
Yoshikawa, H.,
Taketani, Y.,
Yoshiike, K.,
and Kanda, T.
(2001)
J. Virol.
75,
2331-2336[Abstract/Free Full Text]
|
| 25.
|
Kawana, K.,
Yoshikawa, H.,
Taketani, Y.,
Yoshiike, K.,
and Kanda, T.
(1999)
J. Virol.
73,
6188-6190[Abstract/Free Full Text]
|
| 26.
|
Roden, R. B.,
Weissinger, E. M.,
Henderson, D. W.,
Booy, F.,
Kirnbauer, R.,
Mushinski, J. F.,
Lowy, D. R.,
and Schiller, J. T.
(1994)
J. Virol.
68,
7570-7574[Abstract/Free Full Text]
|
| 27.
|
Kirnbauer, R.,
Taub, J.,
Greenstone, H.,
Roden, R.,
Durst, M.,
Gissmann, L.,
Lowy, D. R.,
and Schiller, J. T.
(1993)
J. Virol.
67,
6929-6936[Abstract/Free Full Text]
|
| 28.
|
Shevchenko, A.,
Wilm, M.,
Vorm, O.,
and Mann, M.
(1996)
Anal. Chem.
68,
850-858[Medline]
[Order article via Infotrieve]
|
| 29.
|
Zhang, Y. L.,
Lewis, A., Jr.,
Wade-Glass, M.,
and Schlegel, R.
(1987)
J. Virol.
61,
2924-2928[Abstract/Free Full Text]
|
| 30.
|
Christensen, N. D.,
Dillner, J.,
Eklund, C.,
Carter, J. J.,
Wipf, G. C.,
Reed, C. A.,
Cladel, N. M.,
and Galloway, D. A.
(1996)
Virology
223,
174-184[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Roden, R. B.,
Armstrong, A.,
Haderer, P.,
Christensen, N. D.,
Hubbert, N. L.,
Lowy, D. R.,
Schiller, J. T.,
and Kirnbauer, R.
(1997)
J. Virol.
71,
6247-6252[Abstract]
|
| 32.
|
Liu, W. J.,
Qi, Y. M.,
Zhao, K. N.,
Liu, Y. H.,
Liu, X. S.,
and Frazer, I. H.
(2001)
Virology
282,
237-244[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Zhou, J.,
Gissmann, L.,
Zentgraf, H.,
Muller, H.,
Picken, M.,
and Muller, M.
(1995)
Virology
214,
167-176[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Frischknecht, F.,
and Way, M.
(2001)
Trends Cell Biol.
11,
30-38[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Meyers, C.,
Frattini, M. G.,
Hudson, J. B.,
and Laimins, L. A.
(1992)
Science
257,
971-973[Abstract/Free Full Text]
|
| 36.
|
Dvoretzky, I.,
Shober, R.,
Chattopadhyay, S. K.,
and Lowy, D. R.
(1980)
Virology
103,
369-375[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Cordingley, M. G.,
Callahan, P. L.,
Sardana, V. V.,
Garsky, V. M.,
and Colonno, R. J.
(1990)
J. Biol. Chem.
265,
9062-9065[Abstract/Free Full Text]
|
| 38.
|
Touze, A.,
and Coursaget, P.
(1998)
Nucleic Acids Res.
26,
1317-1323[Abstract/Free Full Text]
|
| 39.
|
Kawana, K.,
Yoshikawa, H.,
Taketani, Y.,
Yoshiike, K.,
and Kanda, T.
(1998)
J. Virol.
72,
10298-10300[Abstract/Free Full Text]
|
| 40.
|
Unckell, F.,
Streeck, R. E.,
and Sapp, M.
(1997)
J. Virol.
71,
2934-2939[Abstract]
|
| 41.
|
Merle, E.,
Rose, R. C.,
LeRoux, L.,
and Moroianu, J.
(1999)
J. Cell. Biochem.
74,
628-637[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Zhou, J.,
Sun, X. Y.,
Louis, K.,
and Frazer, I. H.
(1994)
J. Virol.
68,
619-625[Abstract/Free Full Text]
|
| 43.
|
Roden, R. B.,
Yutzy, W. H., IV,
Fallon, R.,
Inglis, S.,
Lowy, D. R.,
and Schiller, J. T.
(2000)
Virology
270,
254-257[CrossRef][Medline]
[Order article via Infotrieve]W. I.
|
| 44.
|
Ploubidou, A.,
and Way, M.
(2001)
Curr. Opin. Cell Biol.
13,
97-105[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Charlton, C. A.,
and Volkman, L. E.
(1993)
Virology
197,
245-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Lanier, L. M.,
and Volkman, L. E.
(1998)
Virology
243,
167-177[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Korn, E. D.,
Carlier, M. F.,
and Pantaloni, D.
(1987)
Science
238,
638-644[Abstract/Free Full Text]
|
| 48.
|
Schmidt, A.,
and Hall, M. N.
(1998)
Annu. Rev. Cell Dev. Biol.
14,
305-338[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Elliott, G.,
and O'Hare, P.
(1997)
Cell
88,
223-233[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Ravkov, E. V.,
Nichol, S. T.,
Peters, C. J.,
and Compans, R. W.
(1998)
J. Virol.
72,
2865-2870[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. Zeng, H. Li, Y. Liu, Z. Zhang, Y. Zhang, and R. Yang
Tumor-Induced Suppressor of Cytokine Signaling 3 Inhibits Toll-like Receptor 3 Signaling in Dendritic Cells via Binding to Tyrosine Kinase 2
Cancer Res.,
July 1, 2008;
68(13):
5397 - 5404.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Buck, N. Cheng, C. D. Thompson, D. R. Lowy, A. C. Steven, J. T. Schiller, and B. L. Trus
Arrangement of L2 within the Papillomavirus Capsid
J. Virol.,
June 1, 2008;
82(11):
5190 - 5197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gambhira, B. Karanam, S. Jagu, J. N. Roberts, C. B. Buck, I. Bossis, H. Alphs, T. Culp, N. D. Christensen, and R. B. S. Roden
A Protective and Broadly Cross-Neutralizing Epitope of Human Papillomavirus L2
J. Virol.,
December 15, 2007;
81(24):
13927 - 13931.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gambhira, S. Jagu, B. Karanam, P. E. Gravitt, T. D. Culp, N. D. Christensen, and R. B. S. Roden
Protection of Rabbits against Challenge with Rabbit Papillomaviruses by Immunization with the N Terminus of Human Papillomavirus Type 16 Minor Capsid Antigen L2
J. Virol.,
November 1, 2007;
81(21):
11585 - 11592.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Bordeaux, S. Forte, E. Harding, M. S. Darshan, K. Klucevsek, and J. Moroianu
The l2 minor capsid protein of low-risk human papillomavirus type 11 interacts with host nuclear import receptors and viral DNA.
J. Virol.,
August 1, 2006;
80(16):
8259 - 8262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Yang, F. M. Murillo, M. J. Delannoy, R. L. Blosser, W. H. Yutzy IV, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden
B Lymphocyte Activation by Human Papillomavirus-Like Particles Directly Induces Ig Class Switch Recombination via TLR4-MyD88
J. Immunol.,
June 15, 2005;
174(12):
7912 - 7919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Bossis, R. B. S. Roden, R. Gambhira, R. Yang, M. Tagaya, P. M. Howley, and P. I. Meneses
Interaction of tSNARE Syntaxin 18 with the Papillomavirus Minor Capsid Protein Mediates Infection
J. Virol.,
June 1, 2005;
79(11):
6723 - 6731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Holmgren, N. A. Patterson, M. A. Ozbun, and P. F. Lambert
The Minor Capsid Protein L2 Contributes to Two Steps in the Human Papillomavirus Type 31 Life Cycle
J. Virol.,
April 1, 2005;
79(7):
3938 - 3948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fay, W. H. Yutzy IV, R. B. S. Roden, and J. Moroianu
The Positively Charged Termini of L2 Minor Capsid Protein Required for Bovine Papillomavirus Infection Function Separately in Nuclear Import and DNA Binding
J. Virol.,
December 15, 2004;
78(24):
13447 - 13454.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Yang, F. M. Murillo, H. Cui, R. Blosser, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden
Papillomavirus-Like Particles Stimulate Murine Bone Marrow-Derived Dendritic Cells To Produce Alpha Interferon and Th1 Immune Responses via MyD88
J. Virol.,
October 15, 2004;
78(20):
11152 - 11160.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Yang, F. M. Murillo, K.-Y. Lin, W. H. Yutzy IV, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden
Human Papillomavirus Type-16 Virus-Like Particles Activate Complementary Defense Responses in Key Dendritic Cell Subpopulations
J. Immunol.,
August 15, 2004;
173(4):
2624 - 2631.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|