Originally published In Press as doi:10.1074/jbc.M210772200 on January 30, 2003
J. Biol. Chem., Vol. 278, Issue 15, 12796-12804, April 11, 2003
Syntaxin 1A Regulates ENaC via Domain-specific Interactions*
Steven B.
Condliffe
§,
Marcelo D.
Carattino¶
,
Raymond A.
Frizzell
**, and
Hui
Zhang
**
From the
Department of Cell Biology and Physiology
and the ¶ Renal-Electrolyte Division, Department of Medicine,
University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania
15261
Received for publication, October 22, 2002, and in revised form, January 29, 2003
 |
ABSTRACT |
The epithelial sodium channel (ENaC) is a
heterotrimeric protein responsible for Na+ absorption
across the apical membranes of several absorptive epithelia. The rate
of Na+ absorption is governed in part by regulated membrane
trafficking mechanisms that control the apical membrane ENaC density.
Previous reports have implicated a role for the t-SNARE protein,
syntaxin 1A (S1A), in the regulation of ENaC current (INa).
In the present study, we examine the structure-function relations
influencing S1A-ENaC interactions. In vitro pull-down
assays demonstrated that S1A directly interacts with the C termini of
the
-,
-, and
-ENaC subunits but not with the N terminus of
any ENaC subunit. The H3 domain of S1A is the critical motif mediating
S1A-ENaC binding. Functional studies in ENaC expressing
Xenopus oocytes revealed that deletion of the H3
domain of co-expressed S1A eliminated its inhibition of
INa, and acute injection of a GST-H3 fusion protein into
ENaC expressing oocytes inhibited INa to the same extent as
S1A co-expression. In cell surface ENaC labeling experiments, reductions in plasma membrane ENaC accounted for the H3 domain inhibition of INa. Individually substituting C
terminus-truncated
-,
-, or
-ENaC subunits for their wild-type
counterparts reversed the S1A-induced inhibition of INa,
and oocytes expressing ENaC comprised of three C terminus-truncated
subunits showed no S1A inhibition of INa. C terminus
truncation or disruption of the C terminus
-subunit PY motif
increases INa by interfering with ENaC endocytosis. In
contrast to subunit truncation, a
-ENaC PY mutation did not relieve
S1A inhibition of INa, suggesting that S1A does not perturb
Nedd4 interactions that lead to ENaC endocytosis/degradation. This
study provides support for the concept that S1A inhibits ENaC-mediated
Na+ transport by decreasing cell surface channel number via
direct protein-protein interactions at the ENaC C termini.
 |
INTRODUCTION |
The epithelial Na+ channel
(ENaC)1 is located at the
apical membranes of aldosterone-responsive epithelial cells
of the renal collecting ducts, the descending colon, salivary ducts,
and other organs including the airways, where it plays a critical role
in the homeostatic control of fluid and electrolyte transport (1). This
highly selective pathway for Na+ entry is characterized by
a low single channel conductance (~5 picosiemens), high
affinity blockade by the diuretic amiloride, and a negligible
conductance to K+. Functional ENaCs consist of three
homologous subunits (
-,
-, and
-ENaC) (2) that associate as a
heterotrimeric channel complex; the stoichiometry of subunit
associations remains unclear (3, 4). Each ENaC subunit contains two
transmembrane domains, one large extracellular domain and relatively
short intracellular N- and C termini (2, 5).
To maintain extracellular salt and water homeostasis, Na+
entry via ENaC is tightly regulated. A key component of this regulation involves both short and long term control over the number of functional apical membrane ENaCs, which is achieved by changes in their exocytic insertion and/or endocytic retrieval (6). Recently, significant progress has been made in elucidating the mechanisms underlying ENaC
endocytosis (for review see Ref. 6). Retrieval of ENaC from the cell
surface has been shown to depend upon a highly conserved PPXY sequence within the C termini of ENaC subunits, known
as a PY motif. The ubiquitin ligase Nedd4 interacts primarily with the
PY motifs of the
- and
-subunits (7), which decreases cell
surface ENaC expression by increasing channel internalization and
degradation (8). In addition, recent findings (9, 10) indicate that the
aldosterone-induced protein, the serum-glucocorticoid-induced kinase,
sgk1, phosphorylates Nedd4 to reduce its interaction with ENaC and
thereby increase apical channel density. The ENaC-Nedd4 interaction
plays an important role in ENaC regulation, as genetic deletion or
mutation of the PY motifs in the C termini of the
- or
-subunits
eliminates Nedd4 interactions and produces Liddle's syndrome (11), a
gain of function mutation characterized by an increased number of ENaC
channels at the cell surface leading to salt retention (12). In
addition, the PY motif has also been implicated as an endocytic signal,
which is recognized by the AP-2 adapter complex, mediating ENaC
retrieval into clathrin-coated endosomes (13).
Although the mechanisms underlying retrieval of ENaC from the cell
surface are becoming more apparent, relatively little is known about
the processes involved in exocytic trafficking of ENaC to the apical
membrane. Previous studies demonstrating functional and physical
interactions between ENaC and syntaxin 1A (S1A) (14, 15) suggested that
plasma membrane insertion of ENaC is mediated via functional
interactions with membrane trafficking proteins of the SNARE complex.
Exogenous expression of S1A, a target or t-SNARE protein that is a
member of the core complex required for vesicle docking and exocytosis,
inhibited Na+ currents expressed in Xenopus
oocytes, and this inhibition was associated with a decrease in cell
surface ENaC expression (14). A physical interaction between S1A and
ENaC was implicated from the results of co-immunoprecipitation
experiments, which demonstrated that immunoprecipitation of S1A from A6
epithelia co-precipitated
-ENaC (14). In a similar study, Saxena
et al. (15) found that S1A co-precipitated from
Xenopus oocytes with FLAG-tagged subunits of both
- and
-ENaC, whereas possible interactions with
-ENaC were not
addressed. Although these studies have identified a functional
interaction of ENaC with S1A, the precise domains of both proteins
involved in these interactions remain unclear.
The aim of the present study was to determine the specific domains
involved in the physical and functional interactions between S1A and
ENaC. We evaluated the in vitro binding of S1A with the cytosolic ENaC N and C termini in pull-down assays and examined their
functional interactions using oocyte co-expression assays. Our results
define the domain interactions between S1A and the ENaC subunits and
demonstrate reversal of the S1A inhibitory action on INa by
elimination of these domains. These findings, coupled with the effects
of S1A on ENaC cell surface expression and on ENaC bearing a
PY mutation, support the concept that the S1A-ENaC interaction controls
ENaC trafficking mediated by SNARE protein interactions.
 |
EXPERIMENTAL PROCEDURES |
Materials--
mMESSAGE mMACHINETM T7 or T3
complimentary RNA synthesis kits were purchased from Ambion Inc.
(Austin, TX). DNA Mini-Prep kits, Midi-Prep kits, and
nickel-nitrilotriacetic acid beads were obtained from Qiagen.
Restriction enzymes, T4 DNA Ligase, Taq polymerase, and
Pfu polymerase were purchased from New England Biolabs.
Glutathione-Sepharose 4B was purchased from Amersham
Biosciences. Complete Protease Inhibitor Mixture tablets were
obtained from Roche. All other reagent grade chemicals were obtained
from Sigma. Plasmids encoding human ENaC
-,
-, and
-subunits
were kindly provided by Dr. Michael Welsh (University of Iowa). Mouse
ENaC constructs were generously provided by the laboratory of Dr.
Thomas Kleyman (University of Pittsburgh). Subunit truncations were
generated by introducing a stop codon by PCR at the designated amino
acid (see below).
Construction of His-tagged ENaC Cytoplasmic Domains--
The N
and C termini of the human
-,
-, and
-ENaC subunits were
produced in bacteria as His6 fusion proteins. The
appropriate cDNA fragments were synthesized by PCR with a
subunit-specific primer pair and the corresponding template,
pBS/KS/ENaCs. The sense and antisense primer pairs employed were as
follows:
N-ENaC, 5'-CATATGGAGGGGAACAAGCTG and
5'-GGATCCCTAGAAGGCCGTCTTCATGC;
C-ENaC, 5'-CATATGCTGCTCCGAAGGTTC and 5'-GGATCCTCAG GGCCCCCCCAG;
N-ENaC, 5'-CATATGCACGTGAAGAAGTACC and 5'-GGATCCC
TAGGCTTTCTTCTTGGGCCC;
C-ENaC,
5'-CATATGGCCTTGGCCAAGAGCCTA and 5'-GGATCCTTAGATGGCATCACCCTCA;
N-ENaC, 5'-CATATGGCACCCGGAG AGAAG and
5'-GGATCCCTAGCGGCGCAGACGGCC;
C-ENaC,
5'-CATATGGCCCGCCGCCAGT and 5'-GGATCCTCAGAGCTCATCCAGCATC. PCR
amplicons were cloned into the pTA vector and then digested either with
NdeI/BamHI or with
XhoI/BamHI to recover the ENaC sequences for
subcloning into pET15b vectors for bacterial expression. All constructs
were confirmed by sequencing.
Syntaxin 1A C Terminus Deletion Mutant
(S1A1-189)--
A syntaxin 1A construct deleting amino
acids 190-288 of S1A was amplified from the cDNA by PCR using the
following primers: sense primer, 5'-ATAAGCTTATGAAGGACCGAACC;
antisense primer, 5'-CAGAATTCCTAACTGAGGGCCTGCTTCGA and sense primer,
5'-CGGAATTCATGAAGGACCGAACC; antisense primer, 5'-ATCTCGAGCTAACTGAGGGCCT
GCTTC. The amplicons obtained from the first primer set were
cloned into a pcDNA3 vector. The product obtained from the second
primer set was introduced into a pGEX-6p-1 vector. Other S1A deletion
mutants (see below) were constructed in a similar manner. All
constructs were verified by microsequence analysis.
Glutathione S-Transferase-S1A Fusion Proteins--
Syntaxin 1A
fusion proteins containing GST at the N terminus were produced in BL21
competent cells. GST-H3 contains the S1A H3 domain,
S1A191-267, GST-H3-TM adds the transmembrane domain,
S1A194-288, and GST-
H3 truncates both the H3 and TM domains from full-length S1A, S1A1-189. These
constructs were employed in in vitro pull-down assays with
the His6-tagged ENaC C termini (domain deletions are also
provided with the results; see Fig. 2A). Conditions for
bacterial growth and purification of GST fusion proteins have been
described previously (16).
Generation of His6-tagged ENaC C and N
Termini--
Fresh bacterial BL21 colonies harboring
His6-tagged ENaC cDNAs were cultured in 20 ml of LB
medium containing ampicillin (50 µg/ml). Overnight cultures were
diluted with pre-warmed LB medium at a ratio of 1:10, cultured at
37 °C for 1-1.5 h and then induced with 1 mM
isopropyl-
-D-thiogalactopyranoside at 37 °C with
shaking for 3-3.5 h until the A595 was
0.35-0.8. Bacterial pellets were resuspended in sonication buffer (100 mM HEPES, 500 mM KCl, 8 mM
-mercaptoethanol, 5 mM Na2-ATP, 1% Triton
X-100, 1 mM phenylmethylsulfonyl fluoride, and protease
inhibitor mixture, 1 tablet/50 ml). Cells were lysed by sonication and
incubated at 4 °C for 30 min. Lysates were clarified by
centrifugation at 12000 × g at 4 °C and
subsequently incubated with pre-equilibrated nickel-nitrilotriacetic
acid beads at room temperature for 30 min. Beads were washed at least
three times in Buffer A (20 mM HEPES, 200 mM
KCl, 2 mM
-mercaptoethanol, 0.5 mM
Na2-ATP, 10% glycerol, 30 mM imidazole).
Fusion proteins were eluted by three washes with 250 mM
imidazole in Buffer A. Purified His6-tagged ENaC C-terminal
or N-terminal proteins were dialyzed in phosphate-buffered saline for
36 h at 4 °C. The purified proteins were verified using
Coomassie Blue-stained SDS-PAGE or by Western blotting with monoclonal
anti-polyhistidine antibodies (Sigma).
Pull-down Assays--
These assays were performed as described
previously (16), with modifications. Briefly, 10 µg of GST-S1A fusion
protein was immobilized on glutathione-Sepharose 4B and incubated with
10 µg of His6-tagged ENaC proteins in 200 µl of a
modified DIGNAM D buffer (20 mM HEPES, 50 mM
KCl, 2.5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.2% Triton X-100, 20 µM CaCl2, 1 tablet of protease inhibitor mixture/50 ml of buffer, pH to 7.0, with
KOH) at 4 °C with shaking. The next day, samples were pelleted by
centrifugation, washed three times with DIGNAM D buffer at 4 °C, and
resolved using 15% SDS-PAGE. His6-tagged ENaC proteins
were detected by use of polyhistidine antibodies (see above). The
effect of altered Na+ or Ca2+ on ENaC-S1A
interactions was assessed by varying the ion concentrations of the
binding buffer; solutions containing 0.1 or 10 µM free Ca2+ were generated by EGTA buffering, as described
(17).
Complimentary RNA (cRNA) Transcription and Oocyte
Injection--
Vectors containing mouse ENaC, human ENaC, and
rat syntaxin 1A inserts were linearized, and cRNAs were synthesized
in vitro by use of T7 or T3 cRNA synthesis kits. Oocyte
isolation and RNA injection were performed as described previously
(18). Briefly, 0.5 ng of cRNA of each ENaC subunit was injected into
stage V or VI oocytes. For experiments investigating the effect of S1A co-expression on ENaC function, oocytes were co-injected with 5 ng of
S1A. Expression proceeded at 18 °C for 16-24 h in sodium-free ND96
solution before ENaC current recordings. GST fusion proteins were
injected in a volume of 50 nl (estimated final concentration, 50 ng/µl) into oocytes expressing ENaC, and currents were recorded 1 h after injection. Protein binding studies (above) were
performed using cytoplasmic domains derived from human ENaC, whereas
the functional studies generally employed mouse ENaC subunit
expression. Amino acid identity within the C-terminal cytoplasmic
domains of human and mouse ENaC is >70% (this region is important in
S1A-ENaC interactions; see below). In addition, functional experiments with co-expressed S1A, performed using C terminus human ENaC
truncation, yielded results identical to those performed with mouse
ENaC (see Fig. 3), confirming that these effects are not
species-specific.
Electrophysiology--
Two-electrode voltage clamp recordings
were performed as described (18) using 3 M KCl-filled
micropipettes connected to a GeneClamp 500 amplifier (Axon Instruments,
Foster City, CA). Oocytes were bathed continuously in ND96 solution as
follows (in mM): 96 NaCl, 1 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, pH 7.4. In sodium-free ND96, equimolar
N-methyl-D-glucamine chloride replaced NaCl. After impalement, membrane potentials were allowed to stabilize before voltage clamping at
100 mV; amiloride-sensitive
Na+ currents were recorded as the difference in current
before and after addition of 10 µM amiloride.
Cell Surface ENaC Labeling--
The general approach was based
on that of Zerangue et al. (19). Briefly, oocytes expressing
mouse
-,
-FLAG, and
-ENaC subunits for 2 days were blocked for
30 min in MBS supplemented with 1 mg/ml of bovine serum albumin
(MBS-BSA) and then exposed to MBS-BSA plus 1 µg/ml of a mouse
monoclonal anti-FLAG antibody (M2; Sigma) at 4 °C for 1 h.
-ENaC contained the FLAG epitope (DYDKKKD) at the extracellular
loop position defined by Firsov et al. (20), which did not
alter INa relative to wt ENaC expression. This was
confirmed in parallel current measurements performed prior to antibody
labeling. After primary antibody labeling the oocytes were washed six
times with MBS-BSA at 4 °C and then incubated with MBS-BSA
supplemented with 1 mg/ml horseradish peroxidase-coupled secondary
antibody for 1 h at 4 °C (peroxidase-conjugated AffiniPure F(ab'2) fragment goat anti-mouse IgG; Jackson
Immunoresearch Laboratories, West Grove, PA). After 12 additional
washes, individual oocytes were placed in 100 µl of SuperSignal ELISA
Femto solution (Pierce, Rockford, IL) and incubated at room temperature
for 1 min. Chemiluminescence was quantitated in a TD-20/20 luminometer
(Turner Designs, Sunnyvale, CA) where the signal was integrated over a
60-s interval and is provided in relative light units. These and other
results are expressed as mean ± S.E.; statistical differences
were assessed by analysis of variance.
 |
RESULTS |
S1A Interacts with ENaC Subunit C Termini--
Our previous
results (14) and those of Saxena et al. (15) demonstrated
that S1A co-expression reduced ENaC currents expressed in
Xenopus oocytes. A physical interaction of S1A
with ENaC subunits was also demonstrated in co-immunoprecipitation
assays (14, 15). We reasoned that the ENaC cytoplasmic domains would be the potential binding sites for S1A, a type 2 plasma membrane protein that has no significant structure within the extracellular compartment. To evaluate the cytoplasmic domains of ENaC as potential binding sites for S1A, GST-S1A4-267 protein was
employed in pull-down experiments with His6-tagged ENaC C
or N termini. As in similar protein interaction studies, a truncated
syntaxin 1A (S1A4-267) lacking the transmembrane domain
was employed for its enhanced solubility and purification properties
and because the last 21 amino acids of the S1A C terminus constitute
the transmembrane domain, which is not expected to be involved in
cytosolic protein-protein interactions. In addition, previous studies
(14) have demonstrated that ENaC currents are inhibited to the same
extent by co-expression of either full-length S1A or a soluble
S1A4-267, lacking the transmembrane domain. As shown in
the upper panel of Fig. 1, the
C termini of ENaC
-,
-, and
-subunits interacted with GST-S1A.
In contrast with these results, no interaction could be detected
between S1A and the N terminus of any ENaC subunit (Fig. 1, lower
panel). These findings demonstrate that S1A binds to the ENaC
subunit cytoplasmic C termini.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 1.
Syntaxin 1A interacts with ENaC C
termini. Pull-down assays were performed as described under
"Experimental Procedures." 10 µg of GST or GST-S1A was
immobilized on 20 µl of glutathione beads and incubated with 10 µg
of His6-tagged C- or N-terminal fragments of the -,
-, and -ENaC subunits (designated by subscripts) in
binding buffer at 4 °C overnight. After three washes, samples were
resolved on 15% SDS-PAGE and blotted with poly-His antibodies
(1:2000). The experiment was performed three additional times with
similar results. Lane 1, GST; lane 2, GST-S1A;
lane 3, 10% sample input of His6
peptides.
|
|
H3 Domain of S1A Binds the ENaC C Termini--
As the H3 helical
region of S1A is an important domain for protein-protein interactions
within the SNARE fusion complex (21) and has been shown to interact
with other ion channels (22, 23), we determined whether the H3 domain
of S1A was involved in interactions with ENaC. Three deletion
constructs (Fig. 2A) containing N terminus GST fusions were derived from a full-length S1A
clone for comparison with the data from the GST-S1A used in Fig. 1.
These constructs were employed in in vitro pull-down assays with the His6-tagged ENaC C termini. The results (Fig.
2B) show that GST fusions containing the syntaxin 1A H3
domain (GST-H3 and GST-H3-TM) generally exhibited a stronger
interaction with the ENaC subunit C termini than did the same amount of
GST-S1A. This is not unexpected, because prior work (24) has
demonstrated that regions N-terminal to the H3 domain have an
autoinhibitory function and can reduce H3 domain interactions with
substrates. Deletion of the H3 domain abolished the interactions of
syntaxin with the ENaC C termini (Fig. 2B, lane
5). As a negative control, GST alone had no significant affinity
for the ENaC C termini. These results indicate that the H3 domain of
S1A is the critical site for ENaC C terminus binding.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Domain-specific interactions between S1A and
ENaC C termini. A, schematic diagram of S1A proteins,
fused to GST at their N terminus. B, in vitro
pull-down assays were performed as described for Fig. 1, using GST or
GST-S1A constructs incubated with His6-tagged ENaC subunit
C termini ( C, C,
and C). Blots were probed with anti-His
antibodies (1:2000). The experiment was performed two additional times
with similar results. Lane 1, GST; lane 2,
GST-S1A; lane 3, GST-H3; lane 4, GST-H3-TM;
lane 5, GST- H3; lane 6, 10% sample
input.
|
|
C Terminus Truncations Reduce S1A Inhibition of ENaC
Currents--
To determine whether the physical interaction between
S1A and the ENaC C termini is involved in the inhibition of ENaC
current observed with S1A co-expression, we evaluated the effect of S1A on Na+ currents expressed from subunits with C terminus
truncations. In agreement with previous studies (14, 15), S1A
co-expression significantly decreased the amiloride-sensitive
Na+ current in oocytes expressing wt ENaC (Fig.
3, A-D). This
inhibition averaged 75%. Substitution of the wt
-subunit by
-H613X had no significant effect on the magnitude of the
amiloride-sensitive INa, in agreement with prior studies of
-ENaC truncation (12). However, oocytes expressing
-H613X ENaC
together with S1A had significantly greater currents than those
expressing wt ENaC plus S1A. Under these conditions the S1A inhibition
was reduced to 38% (Fig. 3A).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
ENaC C terminus truncations reverse syntaxin
inhibition. Oocytes were injected with -, -, and -ENaC
subunit cRNAs with or without S1A cRNA. Channels formed from C terminus
truncation mutants are named by the single mutated subunit, expressed
with complementary wild-type subunits. Amiloride-sensitive
Na+ currents were measured as the difference before and
after addition of 10 µM amiloride at a holding potential
of 100 mV. Data are expressed as the fraction of the
amiloride-sensitive current from each oocyte (n) relative to
the wild-type ENaC control mean (I/Iwt)
calculated for each animal (N), n = 12;
N = 4. The S.E. for wt ENaC currents was
calculated from the individual oocyte control values, each taken as a
fraction of the wt mean for each animal. A, S1A effect on wt
and -H613X ENaC. B, S1A effect on wt and -R564X ENaC.
C, S1A effect on wt and -R583X ENaC. D, S1A
effect on wt and ENaC formed entirely from the above truncated
subunits.
|
|
Qualitatively similar results were obtained from individual C terminus
truncations of the
- and
-subunits. In contrast to the
truncation, expression of the
-R583X significantly increased INa relative to controls, also consistent with prior
findings and the stimulation of INa observed with Liddle's
mutations that truncate
-ENaC (12). Fig. 3B shows that,
when co-expressed with
-R583X ENaC, S1A did not significantly
inhibit INa, indicating that S1A inhibition may be reversed
by truncation of the
-ENaC C terminus alone. Truncation of the
-ENaC C terminus resulted also in a gain of function consistent with
mutations producing Liddle's disease. S1A co-expression did not
inhibit
-R583X ENaC INa as potently as in wild-type
controls (Fig. 3C); the inhibition was reduced to 51% with
-ENaC truncation. These results suggest that S1A can interact
with each ENaC subunit C terminus to produce an inhibition of
INa, because truncation of individual subunit C termini
fully or partially reverse the S1A inhibitory effect. The elimination
of S1A inhibition by
-ENaC truncation alone suggests that a
selective interaction at this site may be sufficient to account for the
inhibitory effect of S1A. Finally, we expressed a functional ENaC
comprised of three C terminus truncated subunits and determined the
influence of S1A co-expression on INa (Fig. 3D).
S1A inhibition was reversed completely under these conditions, as there
was no significant difference between the combined 

truncated
ENaC currents and those with co-expressed S1A. These findings suggest
that the S1A inhibition of INa involves functional interactions of syntaxin with the C termini of all ENaC subunits, which
is consistent with the protein binding data.
An ENaC PY Mutant Is Inhibited by S1A--
The PY motif located in
the C terminus of the
- and
-ENaC subunits is involved in
important interactions with the ubiquitin ligase Nedd4 (7). To examine
whether the PY motif may also influence S1A binding and subsequent ENaC
inhibition, we measured INa in oocytes co-expressing a
-ENaC PY mutant,
-Y618A, together with S1A. As described above
and shown in Fig. 4, S1A inhibited wt
ENaC current, which was reversed upon truncation of the
-ENaC C
terminus. Amiloride-sensitive currents were approximately doubled in
-Y618A ENaC-expressing oocytes relative to wt ENaC controls (Fig.
4), as has been demonstrated previously for
- or
-ENaC PY
mutations (25). However, in contrast to the
-ENaC C terminus truncation, co-expression of S1A with
-Y618A ENaC resulted in a 76%
inhibition of the INa (Fig. 4). This value is
quantitatively similar the inhibition observed for S1A co-expression
with wt ENaC (Fig. 3), indicating that the PY motif itself is not
involved in the functional interaction with S1A.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 4.
Mutation of the PY motif does not affect S1A
inhibition of ENaC. Oocytes were injected with -, -, and
-ENaC subunit cRNAs with or without S1A cRNA. Channels formed from
C terminus mutants are designated by the single mutated subunit and
were expressed with complementary wild-type subunits. Wt and -R564X
ENaC were used as positive and negative controls, respectively.
Amiloride-sensitive Na+ currents were measured as described
for Fig. 3. Data are expressed as the fraction of amiloride-sensitive
current relative to wt ENaC controls (I/Iwt),
n = 13-15; N = 4 (see legend for Fig.
3).
|
|
The H3 Domain Is Necessary for Inhibition of ENaC Current--
The
H3 domain of S1A has been shown to regulate other ion channels, and our
results demonstrate that it interacts physically with the ENaC C
termini (Fig. 2). To test the hypothesis that the H3 domain interaction
with ENaC regulates channel function, we co-expressed a S1A H3 deletion
mutant (
H3) together with ENaC in oocytes and measured
amiloride-sensitive INa. Fig.
5A shows that wt S1A
significantly inhibited INa whereas S1A
H3 had no effect. These results indicate that functional inhibition of ENaC requires the H3 domain of S1A. To verify this, we examined the effect
of acutely injecting various S1A fusion proteins on INa; current recordings were obtained ~1 h after injection. As shown in
Fig. 5B, injection of GST alone had no effect on
INa. However, injection of GST-H3 significantly attenuated
the amiloride-sensitive INa; the inhibition obtained from
acute injection of GST-H3 was quantitatively similar to that resulting
from co-expression of full-length S1A. This acute effect of the H3
domain suggests that S1A overexpression is not generally interfering
with protein production, which is in agreement with prior control
experiments in which S1A was expressed with other plasma membrane
receptors or transporters (26). Finally, injection of a S1A fusion
protein lacking the H3 domain, GST-
H3, did not significantly affect
INa relative to cells expressing ENaC alone (Fig.
5B). These results support the hypothesis that the H3 domain
of S1A is important in its regulation of ENaC activity.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 5.
The S1A H3 domain is required for inhibition
of ENaC currents. A, oocytes were injected with -,
-, and -ENaC subunit cRNAs with or without full-length S1A or S1A
H3 deletion mutant (S1A H3, S1A1-189) cRNAs.
Amiloride-sensitive Na+ currents were measured as described
for Fig. 3. Data are expressed as the fraction of amiloride-sensitive
current relative to wild-type ENaC controls
(I/Iwt) obtained for each animal,
n = 12; N = 4. B, oocytes
were injected with -, -, and -ENaC subunit cRNAs; expression
proceeded for 18-36 h. 1 h prior to recording, ENaC-expressing
oocytes were injected with GST-H3 or GST- H3 fusion proteins or GST
(estimated final concentration, 50 ng/µl; see Fig. 2 for
definitions). Amiloride-sensitive Na+ currents were
measured as described for Fig. 3. Data are expressed as the fraction of
amiloride-sensitive current relative to the wild-type ENaC controls
(I/Iwt), n = 12;
N = 4 (see legend for Fig. 3).
|
|
H3 Reduces Cell Surface ENaC Expression--
Previously (14), we
found that co-expression of S1A reduced cell surface ENaC localization
without changing total protein expression levels. This finding suggests
that S1A may interfere with ENaC trafficking to the plasma membrane. In
light of the fairly rapid effect of H3 domain injection on
INa shown above, we sought to determine whether this short
term action of GST-H3 also affected the amount of ENaC expressed at the
cell surface; alternately, H3 injection may decrease INa by
influencing channel gating. FLAG-tagged surface ENaC expression was
assessed using an enzyme-linked luminescence assay developed previously
(19) for cell surface K+ channel expression; the results
are summarized in Fig. 6. The cell
surface signal from
-FLAG ENaC was about eight times the background
level, and the latter was determined using oocytes expressing wt ENaC
lacking FLAG epitope. Injection of GST-H3 ~1 h prior to surface
labeling reduced this signal by 70% (corrected for background),
whereas prior injection of S1A fusion protein lacking the H3 domain had
no effect. This reduction in surface labeling correlates with the 75%
reduction in INa observed in similar H3 injection
experiments (Fig. 5B) or when S1A was co-expressed with ENaC
(Fig. 3). The data suggest that, even within this time frame, the
primary action of the H3 domain is on expression of ENaC at the cell
surface.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
The S1A H3 domain decreases cell surface
ENaC. Oocytes were injected with wt or -, -FLAG-, or
-ENaC cRNAs and assayed for cell surface FLAG epitope expression.
1 h prior to surface labeling, oocytes expressing FLAG-ENaC were
injected with GST-H3 or GST- H3 as indicated. Amiloride-sensitive
INa was measured prior to labeling in parallel experiments
and did not differ between wt and -FLAG-ENaC. Data are expressed as
relative light units from luminometry of individual oocytes,
n = 12; N = 2.
|
|
The ENaC-S1A Interaction Is Salt-sensitive--
Increased cellular
Na+ concentration elicits a decrease in ENaC-mediated
apical membrane conductance in epithelial cells. This cellular
protective mechanism balances apical Na+ entry with
basolateral Na+ extrusion (1). To determine whether the
S1A-ENaC interaction may be involved in feedback regulation of
Na+ entry, we determined the effect of ambient
Na+ and K+ concentrations in the binding buffer
on the physical interaction between syntaxin and ENaC determined
in vitro. As shown in Fig. 7,
the binding of the
-ENaC C terminus to GST-S1A decreased with increasing Na+ concentration in the binding buffer, such
that 100 mM Na+ virtually abolished this
interaction. There was also a marked reduction in binding at 50 mM Na+. Increasing buffer
K+ concentration also reduced the interaction of S1A with
the
-ENaC C terminus, but elevated K+ was less
disruptive than Na+ (Fig. 7, lower panel).
Similar results were obtained for the interaction of S1A with the
-
and
-ENaC C termini (data not shown). These data suggest that ionic
forces are involved in the ENaC C terminus interaction with S1A and
that binding is particularly sensitive to ambient Na+.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 7.
Na+ and K+
concentration dependence of ENaC-S1A interactions. Pull-down
assays were performed using the C terminus of -ENaC (as in Fig. 1),
except the binding buffers contained the indicated concentrations of
NaCl or KCl. Samples were resolved using 15% SDS-PAGE, and blots were
probed with poly-His antibodies (1:2000). Gel locations of the
C-terminal ENaC fragments are shown by arrows. The
experiment was performed two additional times with similar results. The
lower panel provides quantitation of the gel data; see text
for other details.
|
|
Ca2+ Sensitivity of S1A-ENaC Interactions--
Apical
Na+ conductance is also inhibited when cellular free
Ca2+ concentration rises (1). We evaluated the
Ca2+ and ATP dependence of the ENaC-S1A interactions using
in vitro pull-down assays performed in the presence of 0.1 or 10 µM free Ca2+ (EGTA-buffered). We also
tested the effect of ATP on the S1A-ENaC interaction in
vitro. The results in Fig. 8 show
that 10 µM Ca2+ abolished the S1A-ENaC
interaction. The presence of 2.5 mM ATP in the low
Ca2+ binding buffer did not influence the interaction of
ENaC with S1A.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 8.
The ENaC-S1A interaction is sensitive to
Ca2+ but insensitive to ATP. In vitro
pull-down assays were performed to test the interaction between S1A and
the C terminus of -ENaC in the presence of 0.1 (L) or 10 µM (H) Ca2+, with or without 2.5 mM ATP. In these experiments, the binding buffer (17)
contained 1.2 mM EGTA and sufficient CaCl2 to
yield the free Ca2+ level shown. Samples were separated on
15% SDS-PAGE, transferred to polyvinylidene difluoride membrane, and
probed with poly-His antibodies (1:2000). The experiment was performed
twice with similar results.
|
|
 |
DISCUSSION |
The results of this study demonstrate a physical interaction
between ENaC and syntaxin 1A that modulates amiloride-sensitive Na+ entry by influencing the density of plasma membrane
ENaC channels. Syntaxin 1A binds directly to the C termini of the
-,
-, and
-ENaC subunits in vitro and does not associate
with the N terminus of any ENaC subunit. Functional data confirm these
sites of interaction, because C-terminal truncations of individual
subunits reversed the inhibition associated with S1A co-expression, and
a channel formed entirely from truncated subunits was not inhibited by
S1A. The H3 domain of syntaxin was critical for this functional effect. Its deletion restored INa to values not significantly
different from expression of wild-type ENaC alone, and acute injection
of a GST-H3 fusion protein, but not a S1A GST-
H3 fusion protein, inhibited ENaC currents and cell surface ENaC to the same degree as S1A
co-expression. Previous studies (14) showed that co-expression of a
soluble S1A lacking the transmembrane domain was as inhibitory for ENaC
currents as the full-length protein, in agreement with the inhibitory
effect of the soluble H3 domain shown here. Increasing the
Na+ or K+ concentrations of the binding buffer
reduced ENaC-S1A binding, suggesting that electrostatic forces are
involved in these interactions. Although the ENaC C terminus was the
structural target for the inhibitory effect of S1A, a Liddle's
disease-related mutation in the C terminus PY motif did not obviate the
S1A inhibition of ENaC current. This result, together with previous
findings (14), has implications for the mechanism of S1A inhibition
that will be discussed below.
The rate of Na+ entry across the apical membranes of
absorptive epithelial cells is determined by the number and open
probability of apical ENaC channels. Control over apical ENaC density
is a key component in the regulatory actions of vasopressin,
aldosterone, and other factors that govern this rate-determining step
in Na+ absorption (see above and Ref. 1 for review).
Cognate interactions between specific SNARE proteins mediate the fusion
of vesicle and target membranes, and they are undoubtedly a key step in
the insertion of ENaC-containing vesicles into the apical membranes during these acute regulatory responses (14, 27). Syntaxin 1A is a
t-SNARE protein that plays a critical role in formation of the core
fusion complex in neurosecretory vesicles, together with soluble
N-ethylmaleimide-sensitive factor attachment protein-25/23 and vesicle-associated membrane protein-2. Together, these proteins mediate the insertion of membrane vesicles into the plasma membranes at
nerve terminals, and in other cell types they act in the final steps
that mediate the regulated exocytic events involved in protein secretion or the regulated insertion of integral membrane proteins like
ENaC (28). Structural studies have shown that the N-terminal amino
acids, 28-144, of syntaxin 1A form an independent folded domain
comprised of three
-helices that can interact to form a twisted,
left-handed, up-down bundle (29). This closed conformation of S1A is
stabilized by the syntaxin regulatory proteins, munc-13 (30) and
munc-18 (31); stabilization of this bundled structure by munc-18
regulates the ability of S1A to interact with other SNAREs (24). The
inhibitory effect of S1A overexpression on ENaC currents and its
reversal by munc-18 (14) suggested that these proteins play a
functional role in the insertion of ENaC-containing vesicles into the
plasma membrane.
The bundled structure with which munc-18 interacts occludes the H3
helical domain (amino acids 185-267) and prevents its interaction with
soluble N-ethylmaleimide-sensitive factor attachment
protein-25/23 and vesicle-associated membrane protein-2. The H3 domain
contains the "SNARE motif" that forms the stable
tertrameric coiled-coil structure necessary for membrane fusion (21,
32, 33). This H3 region was found to be responsible for the interaction
of syntaxin 1A with ENaC. Deletion of the H3 domain abolished the
physical interaction of the ENaC C termini with syntaxin (Fig. 2) and
eliminated the inhibition of ENaC current observed with S1A expression
(Fig. 3). Co-expression of an H3-deleted S1A (
H3) had no effect on ENaC currents, and injection of the H3 domain alone was as inhibitory as the co-expression of full-length S1A (Fig. 4). The H3 domain binds
to CFTR and Ca2+ channels, which are also down-regulated by
S1A overexpression, and this has been suggested as a general mechanism
for syntaxin regulation of ion channel activity (34). As observed in
the present studies of ENaC, elimination of or interference with the S1A binding site on CFTR, or on the voltage-dependent
Ca2+ channel, abolishes the inhibitory effect of syntaxin
1A (22, 35). In the case of CFTR, however, truncation of the S1A
binding N terminus interferes with channel processing and reduces CFTR currents to about 10% of the level of wt CFTR. This is not observed for ENaC, because truncation of the S1A binding domains either has no
effect (
-subunit) or augments (
- and
-subunits) ENaC currents,
permitting a clear evaluation of the functional consequences of S1A on
the truncated channel.
Previous studies of the functional effect of co-expressed syntaxin 1A
on ENaC currents in Xenopus oocytes demonstrated an inhibition of amiloride-sensitive Na+ entry that could not
be ascribed to a nonspecific effect on ENaC protein expression (14,
15). The study of Qi et al. (14), attributed the decrease in
ENaC current to a reduction in the number of cell surface channels,
detected by antibody labeling of non-permeabilized oocytes expressing
extracellular FLAG-tagged ENaC subunits. Nevertheless, in a
conceptually similar study Saxena et al. (15) found that
co-expression of S1A increased cell surface ENaC. This result would
require a proportionately greater decrease in channel open probability
to override the apparent increase in channel number. However, the
surface labeling conditions employed in these experiments are
questionable. After fixation of the oocytes in 3% formaldehyde, they
were labeled sequentially with primary and secondary antibodies, each
for 1 h at 37 °C. Given these conditions, the blotchy ENaC
staining detected at low magnification may reflect access of the
antibody to intracellular epitope. In the experiments of Qi et
al. (14), antibody labeling was performed without fixation or
permeabilization at 4 °C, and the resulting ENaC staining pattern was uniform. In the present study, we used luminometry to detect ENaC
at the cell surface. The S1A H3 domain suppressed ENaC INa by 75% approximately 1 h after its injection (Fig. 5), and this relatively rapid effect could be attributed to a quantitatively similar
reduction in ENaC expression at the cell surface (Fig. 6).
Previous studies (7, 13) have presented evidence for a relatively rapid
turnover of channel protein at the plasma membrane, and they have
identified the mechanisms responsible for endocytic retrieval of ENaC.
Studies in Xenopus oocytes examining the decay of
INa following inhibition of ENaC traffic to the plasma
membrane estimate the half-life of cell surface ENaC to be about 1 h. Accordingly, the 70% reduction in surface ENaC expression detected
about 1 h after H3 domain injection would be in keeping with this
rapid turnover of channels at the surface. An H3 domain-mediated block of ENaC insertion, together with an inherently rapid rate of channel retrieval, would reduce INa through a primary effect on
channel number.
Inferences regarding the mechanism whereby S1A would reduce
ENaC surface expression can be made also from the ENaC mutation analysis. Studies of amiloride-sensitive, genetic hypertension (reviewed in Ref. 6) have implicated structures in the C termini of
ENaC subunits in the control of plasma membrane channel number, perhaps
by two mechanisms. First, the PPPXYXXL motif
within the subunit C termini may serve as an internalization or
endocytic motif (13). Second, this motif participates in a physical
interaction with the ubiquitin ligase, Nedd4-2, which binds to PY
motifs in the ENaC C termini and decreases ENaC current by reducing
cell surface channel number (7, 8). Nedd4-mediated ubiquitination of
the ENaC N termini promotes channel internalization by endocytosis and
its degradation in lysosomes (38).
Syntaxin 1A binds to the ENaC C termini, and its inhibition of ENaC
current was eliminated by C terminus truncations. These findings could
be compatible with the concept that S1A promotes ENaC retrieval by a
mechanism that depends on Nedd4-mediated ENaC endocytosis/degradation.
Similar to C terminus truncations, mutants in the PY motif augment ENaC
currents (see Figs. 3 and 4) by increasing cell surface ENaC; Nedd4
binding to ENaC is disrupted by C terminus truncation or by mutation of
the PY motif (7, 25). However, a mutant that disrupts the PY motif in
-ENaC, Y618A, was strongly inhibited by S1A co-expression. The
persistence of S1A inhibition in the PY mutant therefore suggests that
the action of S1A is not related to Nedd4 binding or to the role of the
PY motif in ENaC endocytosis, although we cannot formally rule out
stimulation of an endocytic process by S1A that does not involve PY.
Nevertheless, it seems unlikely that the influence of S1A on cell
surface ENaC is because of stimulation of ENaC removal from the cell
surface, because the effects of truncation and PY mutation would
be expected to affect S1A inhibition similarly. It is more likely that
the reduction in cell surface channel number detected here, and in the
studies of Qi et al. (14), arises from inhibition of the insertion of ENaC channels into the plasma membrane.
Recent findings have implicated Nedd4 in the inhibition of
Na+ entry that is associated with increased intracellular
Na+ concentration (39). In addition, truncation of the ENaC
C termini attenuates this feedback effect of intracellular
Na+ (40). These findings led us to evaluate the influence
of increased salt concentrations and Ca2+ on the physical
interaction between S1A and the ENaC C termini. Increasing
Na+ or K+ concentration of the binding buffer
decreased this interaction, and Na+ was a more potent
disruptor of S1A binding than K+, as would be expected from
a Na+-selective feedback event. However, inasmuch as the
interaction of ENaC with expressed S1A is itself inhibitory, it seems
difficult to infer a role for Na+-mediated disruption of
this interaction in the process of feedback inhibition. Disrupting an
inhibitory interaction should increase Na+ transport.
However, this reasoning assumes that the physiological action of
endogenous S1A is inhibitory. Rather, if endogenous syntaxin 1A
normally mediates apical ENaC insertion, or if it positively regulates
trafficking reactions that deposit more ENaC in the plasma membrane,
then a Na+-induced disruption of the S1A-ENaC interaction
could decrease cell surface ENaC and reduce Na+ currents.
Similar conclusions would apply to the inhibition of S1A-ENaC binding
observed at physiologically high Ca2+ concentrations
(10
5 M), because increased intracellular
Ca2+ is also inhibitory to ENaC currents (1). Our findings
concerning the cation dependence of S1A-ENaC interactions indicate that
electrostatic forces are involved in their physical association.
However, elucidating a potential role for S1A in ENaC regulatory
effects that involve changes in cellular composition will require a
better understanding of the physiological role of endogenous syntaxin
1A in regulating apical ENaC density.
How does the effect of overexpressed S1A relate to its physiological
action on sodium transport? On one hand, the inhibition of ENaC current
associated with S1A overexpression may result from disruption of normal
SNARE-mediated ENaC trafficking mechanisms that are responsible for
channel insertion into the plasma membrane. The influence of
overexpressed syntaxins on specific trafficking pathways is commonly
used to infer a physiological role for a specific syntaxin isoform in a
specific trafficking pathway. For example, the selective inhibition of
endoplasmic reticulum to Golgi traffic observed with
exogenous syntaxin 5 expression reflects its physiological
role as the t-SNARE in this step of protein secretory pathway traffic
(36). Syntaxin 5 overexpression is sometimes used as an experimental
means of interfering with vesicle-mediated protein transport between
endoplasmic reticulum and Golgi (37). Other examples of selective
syntaxin isoform inhibition are provided in Qi et al. (14).
However, according to this view, the effect of exogenously expressed
syntaxin would arise from disruption of the stoichiometric protein
interactions necessary for membrane fusion, a general mechanism that
should lack specificity for vesicle cargo, in this case, ENaC.
Conversely, the protein binding studies and the elimination of S1A
inhibition by ENaC subunit truncation argue for a more selective
phenomenon, related to the physical presence of ENaC in the trafficking
vesicles. The present findings suggest that domain-specific
interactions between the ENaC C-terminal cytoplasmic tails and S1A are
involved in regulating plasma membrane channel number. It remains to be
determined whether apical S1A is the principal t-SNARE that determines
the insertion of ENaC containing vesicles into the epithelial cell
apical membrane or whether it may compete with another syntaxin isoform
that mediates the insertion of ENaC channels.
 |
ACKNOWLEDGEMENTS |
We express sincere thanks to Drs. Thomas
Kleyman and Shaohu Sheng for assistance with mouse ENaC constructs
and to Dr. John P. Johnson for comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant DK54814 and Cystic Fibrosis Foundation Grants FRIZZE99G0 and FRIZZE97RO.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of a postdoctoral fellowship from the Cystic Fibrosis Foundation.
Recipient of a postdoctoral fellowships from the
Pennsylvania-Delaware Affiliate of the American Heart Association.
**
To whom correspondence may be addressed: Dept. of Cell Biology and
Physiology, University of Pittsburgh School of Medicine, S362 BST, 3500 Terrace St., Pittsburgh, PA 15261. Tel.: 412-648-9498; Fax:
412-648-8330; E-mail: frizzell@pitt.edu or Zhangh{at}pitt.edu.
Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M210772200
 |
ABBREVIATIONS |
The abbreviations used are:
ENaC, epithelial
Na+ channel;
S1A, syntaxin 1A;
SNARE, soluble
N-ethylmaleimide-sensitive factor attachment protein
receptor;
GST, glutathione S-transferase;
INa, amiloride-sensitive Na+ current;
CFTR, cystic fibrosis transmembrane conductance regulator;
cRNA, complimentary RNA;
BSA, bovine serum albumin;
wt, wild-type.
 |
REFERENCES |
| 1.
|
Garty, H.,
and Palmer, L. G.
(1997)
Physiol. Rev.
77,
359-396[Abstract/Free Full Text]
|
| 2.
|
Canessa, C. M.,
Schild, L.,
Buell, G.,
Thorens, B.,
Gautschi, I.,
Horisberger, J. D.,
and Rossier, B. C.
(1994)
Nature
367,
463-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Firsov, D.,
Gautschi, I.,
Merillat, A. M.,
Rossier, B. C.,
and Schild, L.
(1998)
EMBO J.
17,
334-352
|
| 4.
|
Snyder, P. M.,
Cheng, C.,
Prince, L. S.,
Rogers, J. C.,
and Welsh, M. J.
(1998)
J. Biol. Chem.
273,
681-684[Abstract/Free Full Text]
|
| 5.
|
Renard, S.,
Lingueglia, E.,
Voilley, N.,
Lazdunski, M.,
and Barbry, P.
(1994)
J. Biol. Chem.
269,
12981-12986[Abstract/Free Full Text]
|
| 6.
|
Snyder, P. M.
(2002)
Endocr. Rev.
23,
258-275[Abstract/Free Full Text]
|
| 7.
|
Staub, O.,
Gautschi, I.,
Ishikawa, T.,
Breitschopf, K.,
Ciechanover, A.,
Schild, L.,
and Rotin, D.
(1997)
EMBO J.
16,
6325-6336[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Goulet, C. C.,
Volk, K. A.,
Adams, C. M.,
Prince, L. S.,
Stokes, J. B.,
and Snyder, P. M.
(1998)
J. Biol. Chem.
273,
30012-30017[Abstract/Free Full Text]
|
| 9.
|
Debonneville, C.,
Flores, S. Y.,
Kamynina, E.,
Plant, P. J.,
Tauxe, C.,
Thomas, M. A.,
Munster, C.,
Chraibi, A.,
Pratt, J. H.,
Horisberger, J. D.,
Pearce, D.,
Loffing, J.,
and Staub, O.
(2001)
EMBO J.
20,
7052-7059[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Snyder, P. M.,
Olson, D. R.,
and Thomas, B. C.
(2002)
J. Biol. Chem.
277,
5-8[Abstract/Free Full Text]
|
| 11.
|
Shimkets, R. A.,
Warnock, D. G.,
Bositis, C. M.,
Nelson-Williams, C.,
Hansson, J. H.,
Schambelan, M.,
Gill, J. R., Jr.,
Ulick, S.,
Milora, R. V.,
and Findling, J. W.
(1994)
Cell
79,
407-414[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Snyder, P. M.,
Price, M. P.,
McDonald, F. J.,
Adams, C. M.,
Volk, K. A.,
Zeiher, B. G.,
Stokes, J. B.,
and Welsh, M. J.
(1995)
Cell
83,
969-978[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Shimkets, R. A.,
Lifton, R. P.,
and Canessa, C. M.
(1997)
J. Biol. Chem.
272,
25537-25541[Abstract/Free Full Text]
|
| 14.
|
Qi, J.,
Peters, K. W.,
Liu, C.,
Wang, J. M.,
Edinger, R. S.,
Johnson, J. P.,
Watkins, S. C.,
and Frizzell, R. A.
(1999)
J. Biol. Chem.
274,
30345-30348[Abstract/Free Full Text]
|
| 15.
|
Saxena, S.,
Quick, M. W.,
Tousson, A.,
Oh, Y.,
and Warnock, D. G.
(1999)
J. Biol. Chem.
274,
20812-20817[Abstract/Free Full Text]
|
| 16.
|
Zhang, H.,
Peters, K. W.,
Sun, F.,
Marino, C. R.,
Lang, J.,
Burgoyne, R. D.,
and Frizzell, R. A.
(2002)
J. Biol. Chem.
277,
28948-28958[Abstract/Free Full Text]
|
| 17.
|
Pralong, W. F.,
Spät, A.,
and Wollheim, C. B.
(1994)
J. Biol. Chem.
269,
27310-27314[Abstract/Free Full Text]
|
| 18.
|
Takahashi, A.,
Watkins, S. C.,
Howard, M.,
and Frizzell, R. A.
(1996)
Am. J. Physiol.
271,
C1887-C1894[Medline]
[Order article via Infotrieve]
|
| 19.
|
Zerangue, N.,
Schwappach, B.,
Jan, Y. N.,
and Jan, L. Y.
(1999)
Neuron.
22,
537-548[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Firsov, D.,
Schild, L.,
Gautschi, I.,
Merillat, A. M.,
Schneeberger, E.,
and Rossier, B. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
15370-15375[Abstract/Free Full Text]
|
| 21.
|
Fergestad, T.,
Wu, M. N.,
Schulze, K. L.,
Lloyd, T. E.,
Bellen, H. J.,
and Broadie, K.
(2001)
J. Neurosci.
21,
9142-9150[Abstract/Free Full Text]
|
| 22.
|
Naren, A. P.,
Quick, M. W.,
Collawn, J. F.,
Nelson, D. J.,
and Kirk, K. L.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
10972-10977[Abstract/Free Full Text]
|
| 23.
|
Bezprozvanny, I.,
Zhong, P.,
Scheller, R. H.,
and Tsien, R. W.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
97,
13943-13948
|
| 24.
|
Dulubova, I.,
Sugita, S.,
Hill, S.,
Hosaka, M.,
Fernandez, I.,
Sudhof, T. C.,
and Rizo, J.
(1999)
EMBO J.
18,
4372-4382[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Schild, L.,
Canessa, C. M.,
Shimkets, R. A.,
Gautschi, I.,
Lifton, R. P.,
and Rossier, B. C.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
5699-5703[Abstract/Free Full Text]
|
| 26.
|
Peters, K. W.,
Qi, J.,
Watkins, S. C.,
and Frizzell, R. A.
(1999)
Am. J. Physiol.
277,
C174-C180[Medline]
[Order article via Infotrieve]
|
| 27.
|
Rotin, D.
(2000)
Curr. Opin. Nephrol. Hypertens.
9,
529-534[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Bock, J. B.,
and Scheller, R. H.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
26,
12227-12229
|
| 29.
|
Fernandez, I.,
Ubach, J.,
Dulubova, I.,
Zhang, X.,
Sudhof, T. C.,
and Rizo, J.
(1998)
Cell
94,
841-849[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Betz, A.,
Okamoto, M.,
Benseler, F.,
and Brose, N.
(1997)
J. Biol. Chem.
272,
2520-2526[Abstract/Free Full Text]
|
| 31.
|
Hata, Y.,
Slaughter, C. A.,
and Sudhof, T. C.
(1993)
Nature
366,
347-351[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
| Sutton, R. B., Fasshauer, D., Jahn, R., and Brunger, A. T. (1998) 395, 347-353
|
| 33.
|
Misura, K. M.,
Gonzalez, L. C., Jr.,
May, A. P.,
Scheller, R. H.,
and Weis, W. I.
(2001)
J. Biol. Chem.
276,
41301-41309[Abstract/Free Full Text]
|
| 34.
|
Atlas, D.
(2001)
J. Neurochem.
77,
972-985[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Rettig, J.,
Heinemann, C.,
Ashery, U.,
Sheng, Z. H.,
Yokoyama, C. T.,
Catterall, W. A.,
and Neher, E.
(1997)
J. Neurosci.
17,
6647-6656[Abstract/Free Full Text]
|
| 36.
|
Dascher, C.,
Matteson, J.,
and Balch, W. E.
(1994)
J. Biol. Chem.
269,
29363-29366[Abstract/Free Full Text]
|
| 37.
|
Yoo, J. S.,
Moyer, B. D.,
Bannykh, S.,
Yoo, H. M.,
Riordan, J. R.,
and Balch, W. E.
(2002)
J. Biol. Chem.
277,
11401-11409[Abstract/Free Full Text]
|
| 38.
|
Rotin, D.,
Kanelis, V.,
and Schild, L.
(2001)
Am. J. Physiol.
281,
F391-F399
|
| 39.
|
Dinudom, A.,
Harvey, K. F.,
Komwatana, P.,
Young, J. A.,
Kumar, S.,
and Cook, D. I.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
7169-7173[Abstract/Free Full Text]
|
|