JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M210772200 on January 30, 2003

J. Biol. Chem., Vol. 278, Issue 15, 12796-12804, April 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/15/12796    most recent
M210772200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Condliffe, S. B.
Right arrow Articles by Zhang, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Condliffe, S. B.
Right arrow Articles by Zhang, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Syntaxin 1A Regulates ENaC via Domain-specific Interactions*

Steven B. CondliffeDagger §, Marcelo D. Carattino||, Raymond A. FrizzellDagger **, and Hui ZhangDagger **

From the Dagger  Department of Cell Biology and Physiology and the  Renal-Electrolyte Division, Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261

Received for publication, October 22, 2002, and in revised form, January 29, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The epithelial sodium channel (ENaC) is a heterotrimeric protein responsible for Na+ absorption across the apical membranes of several absorptive epithelia. The rate of Na+ absorption is governed in part by regulated membrane trafficking mechanisms that control the apical membrane ENaC density. Previous reports have implicated a role for the t-SNARE protein, syntaxin 1A (S1A), in the regulation of ENaC current (INa). In the present study, we examine the structure-function relations influencing S1A-ENaC interactions. In vitro pull-down assays demonstrated that S1A directly interacts with the C termini of the alpha -, beta -, and gamma -ENaC subunits but not with the N terminus of any ENaC subunit. The H3 domain of S1A is the critical motif mediating S1A-ENaC binding. Functional studies in ENaC expressing Xenopus oocytes revealed that deletion of the H3 domain of co-expressed S1A eliminated its inhibition of INa, and acute injection of a GST-H3 fusion protein into ENaC expressing oocytes inhibited INa to the same extent as S1A co-expression. In cell surface ENaC labeling experiments, reductions in plasma membrane ENaC accounted for the H3 domain inhibition of INa. Individually substituting C terminus-truncated alpha -, beta -, or gamma -ENaC subunits for their wild-type counterparts reversed the S1A-induced inhibition of INa, and oocytes expressing ENaC comprised of three C terminus-truncated subunits showed no S1A inhibition of INa. C terminus truncation or disruption of the C terminus beta -subunit PY motif increases INa by interfering with ENaC endocytosis. In contrast to subunit truncation, a beta -ENaC PY mutation did not relieve S1A inhibition of INa, suggesting that S1A does not perturb Nedd4 interactions that lead to ENaC endocytosis/degradation. This study provides support for the concept that S1A inhibits ENaC-mediated Na+ transport by decreasing cell surface channel number via direct protein-protein interactions at the ENaC C termini.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The epithelial Na+ channel (ENaC)1 is located at the apical membranes of aldosterone-responsive epithelial cells of the renal collecting ducts, the descending colon, salivary ducts, and other organs including the airways, where it plays a critical role in the homeostatic control of fluid and electrolyte transport (1). This highly selective pathway for Na+ entry is characterized by a low single channel conductance (~5 picosiemens), high affinity blockade by the diuretic amiloride, and a negligible conductance to K+. Functional ENaCs consist of three homologous subunits (alpha -, beta -, and gamma -ENaC) (2) that associate as a heterotrimeric channel complex; the stoichiometry of subunit associations remains unclear (3, 4). Each ENaC subunit contains two transmembrane domains, one large extracellular domain and relatively short intracellular N- and C termini (2, 5).

To maintain extracellular salt and water homeostasis, Na+ entry via ENaC is tightly regulated. A key component of this regulation involves both short and long term control over the number of functional apical membrane ENaCs, which is achieved by changes in their exocytic insertion and/or endocytic retrieval (6). Recently, significant progress has been made in elucidating the mechanisms underlying ENaC endocytosis (for review see Ref. 6). Retrieval of ENaC from the cell surface has been shown to depend upon a highly conserved PPXY sequence within the C termini of ENaC subunits, known as a PY motif. The ubiquitin ligase Nedd4 interacts primarily with the PY motifs of the beta - and gamma -subunits (7), which decreases cell surface ENaC expression by increasing channel internalization and degradation (8). In addition, recent findings (9, 10) indicate that the aldosterone-induced protein, the serum-glucocorticoid-induced kinase, sgk1, phosphorylates Nedd4 to reduce its interaction with ENaC and thereby increase apical channel density. The ENaC-Nedd4 interaction plays an important role in ENaC regulation, as genetic deletion or mutation of the PY motifs in the C termini of the beta - or gamma -subunits eliminates Nedd4 interactions and produces Liddle's syndrome (11), a gain of function mutation characterized by an increased number of ENaC channels at the cell surface leading to salt retention (12). In addition, the PY motif has also been implicated as an endocytic signal, which is recognized by the AP-2 adapter complex, mediating ENaC retrieval into clathrin-coated endosomes (13).

Although the mechanisms underlying retrieval of ENaC from the cell surface are becoming more apparent, relatively little is known about the processes involved in exocytic trafficking of ENaC to the apical membrane. Previous studies demonstrating functional and physical interactions between ENaC and syntaxin 1A (S1A) (14, 15) suggested that plasma membrane insertion of ENaC is mediated via functional interactions with membrane trafficking proteins of the SNARE complex. Exogenous expression of S1A, a target or t-SNARE protein that is a member of the core complex required for vesicle docking and exocytosis, inhibited Na+ currents expressed in Xenopus oocytes, and this inhibition was associated with a decrease in cell surface ENaC expression (14). A physical interaction between S1A and ENaC was implicated from the results of co-immunoprecipitation experiments, which demonstrated that immunoprecipitation of S1A from A6 epithelia co-precipitated gamma -ENaC (14). In a similar study, Saxena et al. (15) found that S1A co-precipitated from Xenopus oocytes with FLAG-tagged subunits of both beta - and gamma -ENaC, whereas possible interactions with alpha -ENaC were not addressed. Although these studies have identified a functional interaction of ENaC with S1A, the precise domains of both proteins involved in these interactions remain unclear.

The aim of the present study was to determine the specific domains involved in the physical and functional interactions between S1A and ENaC. We evaluated the in vitro binding of S1A with the cytosolic ENaC N and C termini in pull-down assays and examined their functional interactions using oocyte co-expression assays. Our results define the domain interactions between S1A and the ENaC subunits and demonstrate reversal of the S1A inhibitory action on INa by elimination of these domains. These findings, coupled with the effects of S1A on ENaC cell surface expression and on ENaC bearing a PY mutation, support the concept that the S1A-ENaC interaction controls ENaC trafficking mediated by SNARE protein interactions.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- mMESSAGE mMACHINETM T7 or T3 complimentary RNA synthesis kits were purchased from Ambion Inc. (Austin, TX). DNA Mini-Prep kits, Midi-Prep kits, and nickel-nitrilotriacetic acid beads were obtained from Qiagen. Restriction enzymes, T4 DNA Ligase, Taq polymerase, and Pfu polymerase were purchased from New England Biolabs. Glutathione-Sepharose 4B was purchased from Amersham Biosciences. Complete Protease Inhibitor Mixture tablets were obtained from Roche. All other reagent grade chemicals were obtained from Sigma. Plasmids encoding human ENaC alpha -, beta -, and gamma -subunits were kindly provided by Dr. Michael Welsh (University of Iowa). Mouse ENaC constructs were generously provided by the laboratory of Dr. Thomas Kleyman (University of Pittsburgh). Subunit truncations were generated by introducing a stop codon by PCR at the designated amino acid (see below).

Construction of His-tagged ENaC Cytoplasmic Domains-- The N and C termini of the human alpha -, beta -, and gamma -ENaC subunits were produced in bacteria as His6 fusion proteins. The appropriate cDNA fragments were synthesized by PCR with a subunit-specific primer pair and the corresponding template, pBS/KS/ENaCs. The sense and antisense primer pairs employed were as follows: alpha N-ENaC, 5'-CATATGGAGGGGAACAAGCTG and 5'-GGATCCCTAGAAGGCCGTCTTCATGC; alpha C-ENaC, 5'-CATATGCTGCTCCGAAGGTTC and 5'-GGATCCTCAG GGCCCCCCCAG; beta N-ENaC, 5'-CATATGCACGTGAAGAAGTACC and 5'-GGATCCC TAGGCTTTCTTCTTGGGCCC; beta C-ENaC, 5'-CATATGGCCTTGGCCAAGAGCCTA and 5'-GGATCCTTAGATGGCATCACCCTCA; gamma N-ENaC, 5'-CATATGGCACCCGGAG AGAAG and 5'-GGATCCCTAGCGGCGCAGACGGCC; gamma C-ENaC, 5'-CATATGGCCCGCCGCCAGT and 5'-GGATCCTCAGAGCTCATCCAGCATC. PCR amplicons were cloned into the pTA vector and then digested either with NdeI/BamHI or with XhoI/BamHI to recover the ENaC sequences for subcloning into pET15b vectors for bacterial expression. All constructs were confirmed by sequencing.

Syntaxin 1A C Terminus Deletion Mutant (S1A1-189)-- A syntaxin 1A construct deleting amino acids 190-288 of S1A was amplified from the cDNA by PCR using the following primers: sense primer, 5'-ATAAGCTTATGAAGGACCGAACC; antisense primer, 5'-CAGAATTCCTAACTGAGGGCCTGCTTCGA and sense primer, 5'-CGGAATTCATGAAGGACCGAACC; antisense primer, 5'-ATCTCGAGCTAACTGAGGGCCT GCTTC. The amplicons obtained from the first primer set were cloned into a pcDNA3 vector. The product obtained from the second primer set was introduced into a pGEX-6p-1 vector. Other S1A deletion mutants (see below) were constructed in a similar manner. All constructs were verified by microsequence analysis.

Glutathione S-Transferase-S1A Fusion Proteins-- Syntaxin 1A fusion proteins containing GST at the N terminus were produced in BL21 competent cells. GST-H3 contains the S1A H3 domain, S1A191-267, GST-H3-TM adds the transmembrane domain, S1A194-288, and GST-Delta H3 truncates both the H3 and TM domains from full-length S1A, S1A1-189. These constructs were employed in in vitro pull-down assays with the His6-tagged ENaC C termini (domain deletions are also provided with the results; see Fig. 2A). Conditions for bacterial growth and purification of GST fusion proteins have been described previously (16).

Generation of His6-tagged ENaC C and N Termini-- Fresh bacterial BL21 colonies harboring His6-tagged ENaC cDNAs were cultured in 20 ml of LB medium containing ampicillin (50 µg/ml). Overnight cultures were diluted with pre-warmed LB medium at a ratio of 1:10, cultured at 37 °C for 1-1.5 h and then induced with 1 mM isopropyl-beta -D-thiogalactopyranoside at 37 °C with shaking for 3-3.5 h until the A595 was 0.35-0.8. Bacterial pellets were resuspended in sonication buffer (100 mM HEPES, 500 mM KCl, 8 mM beta -mercaptoethanol, 5 mM Na2-ATP, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor mixture, 1 tablet/50 ml). Cells were lysed by sonication and incubated at 4 °C for 30 min. Lysates were clarified by centrifugation at 12000 × g at 4 °C and subsequently incubated with pre-equilibrated nickel-nitrilotriacetic acid beads at room temperature for 30 min. Beads were washed at least three times in Buffer A (20 mM HEPES, 200 mM KCl, 2 mM beta -mercaptoethanol, 0.5 mM Na2-ATP, 10% glycerol, 30 mM imidazole). Fusion proteins were eluted by three washes with 250 mM imidazole in Buffer A. Purified His6-tagged ENaC C-terminal or N-terminal proteins were dialyzed in phosphate-buffered saline for 36 h at 4 °C. The purified proteins were verified using Coomassie Blue-stained SDS-PAGE or by Western blotting with monoclonal anti-polyhistidine antibodies (Sigma).

Pull-down Assays-- These assays were performed as described previously (16), with modifications. Briefly, 10 µg of GST-S1A fusion protein was immobilized on glutathione-Sepharose 4B and incubated with 10 µg of His6-tagged ENaC proteins in 200 µl of a modified DIGNAM D buffer (20 mM HEPES, 50 mM KCl, 2.5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.2% Triton X-100, 20 µM CaCl2, 1 tablet of protease inhibitor mixture/50 ml of buffer, pH to 7.0, with KOH) at 4 °C with shaking. The next day, samples were pelleted by centrifugation, washed three times with DIGNAM D buffer at 4 °C, and resolved using 15% SDS-PAGE. His6-tagged ENaC proteins were detected by use of polyhistidine antibodies (see above). The effect of altered Na+ or Ca2+ on ENaC-S1A interactions was assessed by varying the ion concentrations of the binding buffer; solutions containing 0.1 or 10 µM free Ca2+ were generated by EGTA buffering, as described (17).

Complimentary RNA (cRNA) Transcription and Oocyte Injection-- Vectors containing mouse ENaC, human ENaC, and rat syntaxin 1A inserts were linearized, and cRNAs were synthesized in vitro by use of T7 or T3 cRNA synthesis kits. Oocyte isolation and RNA injection were performed as described previously (18). Briefly, 0.5 ng of cRNA of each ENaC subunit was injected into stage V or VI oocytes. For experiments investigating the effect of S1A co-expression on ENaC function, oocytes were co-injected with 5 ng of S1A. Expression proceeded at 18 °C for 16-24 h in sodium-free ND96 solution before ENaC current recordings. GST fusion proteins were injected in a volume of 50 nl (estimated final concentration, 50 ng/µl) into oocytes expressing ENaC, and currents were recorded 1 h after injection. Protein binding studies (above) were performed using cytoplasmic domains derived from human ENaC, whereas the functional studies generally employed mouse ENaC subunit expression. Amino acid identity within the C-terminal cytoplasmic domains of human and mouse ENaC is >70% (this region is important in S1A-ENaC interactions; see below). In addition, functional experiments with co-expressed S1A, performed using C terminus human ENaC truncation, yielded results identical to those performed with mouse ENaC (see Fig. 3), confirming that these effects are not species-specific.

Electrophysiology-- Two-electrode voltage clamp recordings were performed as described (18) using 3 M KCl-filled micropipettes connected to a GeneClamp 500 amplifier (Axon Instruments, Foster City, CA). Oocytes were bathed continuously in ND96 solution as follows (in mM): 96 NaCl, 1 KCl, 1.8 CaCl2, 1 MgCl2, and 5 HEPES, pH 7.4. In sodium-free ND96, equimolar N-methyl-D-glucamine chloride replaced NaCl. After impalement, membrane potentials were allowed to stabilize before voltage clamping at -100 mV; amiloride-sensitive Na+ currents were recorded as the difference in current before and after addition of 10 µM amiloride.

Cell Surface ENaC Labeling-- The general approach was based on that of Zerangue et al. (19). Briefly, oocytes expressing mouse alpha -, beta -FLAG, and gamma -ENaC subunits for 2 days were blocked for 30 min in MBS supplemented with 1 mg/ml of bovine serum albumin (MBS-BSA) and then exposed to MBS-BSA plus 1 µg/ml of a mouse monoclonal anti-FLAG antibody (M2; Sigma) at 4 °C for 1 h. beta -ENaC contained the FLAG epitope (DYDKKKD) at the extracellular loop position defined by Firsov et al. (20), which did not alter INa relative to wt ENaC expression. This was confirmed in parallel current measurements performed prior to antibody labeling. After primary antibody labeling the oocytes were washed six times with MBS-BSA at 4 °C and then incubated with MBS-BSA supplemented with 1 mg/ml horseradish peroxidase-coupled secondary antibody for 1 h at 4 °C (peroxidase-conjugated AffiniPure F(ab'2) fragment goat anti-mouse IgG; Jackson Immunoresearch Laboratories, West Grove, PA). After 12 additional washes, individual oocytes were placed in 100 µl of SuperSignal ELISA Femto solution (Pierce, Rockford, IL) and incubated at room temperature for 1 min. Chemiluminescence was quantitated in a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA) where the signal was integrated over a 60-s interval and is provided in relative light units. These and other results are expressed as mean ± S.E.; statistical differences were assessed by analysis of variance.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

S1A Interacts with ENaC Subunit C Termini-- Our previous results (14) and those of Saxena et al. (15) demonstrated that S1A co-expression reduced ENaC currents expressed in Xenopus oocytes. A physical interaction of S1A with ENaC subunits was also demonstrated in co-immunoprecipitation assays (14, 15). We reasoned that the ENaC cytoplasmic domains would be the potential binding sites for S1A, a type 2 plasma membrane protein that has no significant structure within the extracellular compartment. To evaluate the cytoplasmic domains of ENaC as potential binding sites for S1A, GST-S1A4-267 protein was employed in pull-down experiments with His6-tagged ENaC C or N termini. As in similar protein interaction studies, a truncated syntaxin 1A (S1A4-267) lacking the transmembrane domain was employed for its enhanced solubility and purification properties and because the last 21 amino acids of the S1A C terminus constitute the transmembrane domain, which is not expected to be involved in cytosolic protein-protein interactions. In addition, previous studies (14) have demonstrated that ENaC currents are inhibited to the same extent by co-expression of either full-length S1A or a soluble S1A4-267, lacking the transmembrane domain. As shown in the upper panel of Fig. 1, the C termini of ENaC alpha -, beta -, and gamma -subunits interacted with GST-S1A. In contrast with these results, no interaction could be detected between S1A and the N terminus of any ENaC subunit (Fig. 1, lower panel). These findings demonstrate that S1A binds to the ENaC subunit cytoplasmic C termini.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1.   Syntaxin 1A interacts with ENaC C termini. Pull-down assays were performed as described under "Experimental Procedures." 10 µg of GST or GST-S1A was immobilized on 20 µl of glutathione beads and incubated with 10 µg of His6-tagged C- or N-terminal fragments of the alpha -, beta -, and gamma -ENaC subunits (designated by subscripts) in binding buffer at 4 °C overnight. After three washes, samples were resolved on 15% SDS-PAGE and blotted with poly-His antibodies (1:2000). The experiment was performed three additional times with similar results. Lane 1, GST; lane 2, GST-S1A; lane 3, 10% sample input of His6 peptides.

H3 Domain of S1A Binds the ENaC C Termini-- As the H3 helical region of S1A is an important domain for protein-protein interactions within the SNARE fusion complex (21) and has been shown to interact with other ion channels (22, 23), we determined whether the H3 domain of S1A was involved in interactions with ENaC. Three deletion constructs (Fig. 2A) containing N terminus GST fusions were derived from a full-length S1A clone for comparison with the data from the GST-S1A used in Fig. 1. These constructs were employed in in vitro pull-down assays with the His6-tagged ENaC C termini. The results (Fig. 2B) show that GST fusions containing the syntaxin 1A H3 domain (GST-H3 and GST-H3-TM) generally exhibited a stronger interaction with the ENaC subunit C termini than did the same amount of GST-S1A. This is not unexpected, because prior work (24) has demonstrated that regions N-terminal to the H3 domain have an autoinhibitory function and can reduce H3 domain interactions with substrates. Deletion of the H3 domain abolished the interactions of syntaxin with the ENaC C termini (Fig. 2B, lane 5). As a negative control, GST alone had no significant affinity for the ENaC C termini. These results indicate that the H3 domain of S1A is the critical site for ENaC C terminus binding.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2.   Domain-specific interactions between S1A and ENaC C termini. A, schematic diagram of S1A proteins, fused to GST at their N terminus. B, in vitro pull-down assays were performed as described for Fig. 1, using GST or GST-S1A constructs incubated with His6-tagged ENaC subunit C termini (alpha C, beta C, and gamma C). Blots were probed with anti-His antibodies (1:2000). The experiment was performed two additional times with similar results. Lane 1, GST; lane 2, GST-S1A; lane 3, GST-H3; lane 4, GST-H3-TM; lane 5, GST-Delta H3; lane 6, 10% sample input.

C Terminus Truncations Reduce S1A Inhibition of ENaC Currents-- To determine whether the physical interaction between S1A and the ENaC C termini is involved in the inhibition of ENaC current observed with S1A co-expression, we evaluated the effect of S1A on Na+ currents expressed from subunits with C terminus truncations. In agreement with previous studies (14, 15), S1A co-expression significantly decreased the amiloride-sensitive Na+ current in oocytes expressing wt ENaC (Fig. 3, A-D). This inhibition averaged 75%. Substitution of the wt alpha -subunit by alpha -H613X had no significant effect on the magnitude of the amiloride-sensitive INa, in agreement with prior studies of alpha -ENaC truncation (12). However, oocytes expressing alpha -H613X ENaC together with S1A had significantly greater currents than those expressing wt ENaC plus S1A. Under these conditions the S1A inhibition was reduced to 38% (Fig. 3A).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   ENaC C terminus truncations reverse syntaxin inhibition. Oocytes were injected with alpha -, beta -, and gamma -ENaC subunit cRNAs with or without S1A cRNA. Channels formed from C terminus truncation mutants are named by the single mutated subunit, expressed with complementary wild-type subunits. Amiloride-sensitive Na+ currents were measured as the difference before and after addition of 10 µM amiloride at a holding potential of -100 mV. Data are expressed as the fraction of the amiloride-sensitive current from each oocyte (n) relative to the wild-type ENaC control mean (I/Iwt) calculated for each animal (N), n = 12; N = 4. The S.E. for wt ENaC currents was calculated from the individual oocyte control values, each taken as a fraction of the wt mean for each animal. A, S1A effect on wt and alpha -H613X ENaC. B, S1A effect on wt and beta -R564X ENaC. C, S1A effect on wt and gamma -R583X ENaC. D, S1A effect on wt and ENaC formed entirely from the above truncated subunits.

Qualitatively similar results were obtained from individual C terminus truncations of the beta - and gamma -subunits. In contrast to the alpha  truncation, expression of the beta -R583X significantly increased INa relative to controls, also consistent with prior findings and the stimulation of INa observed with Liddle's mutations that truncate beta -ENaC (12). Fig. 3B shows that, when co-expressed with beta -R583X ENaC, S1A did not significantly inhibit INa, indicating that S1A inhibition may be reversed by truncation of the beta -ENaC C terminus alone. Truncation of the gamma -ENaC C terminus resulted also in a gain of function consistent with mutations producing Liddle's disease. S1A co-expression did not inhibit gamma -R583X ENaC INa as potently as in wild-type controls (Fig. 3C); the inhibition was reduced to 51% with gamma -ENaC truncation. These results suggest that S1A can interact with each ENaC subunit C terminus to produce an inhibition of INa, because truncation of individual subunit C termini fully or partially reverse the S1A inhibitory effect. The elimination of S1A inhibition by beta -ENaC truncation alone suggests that a selective interaction at this site may be sufficient to account for the inhibitory effect of S1A. Finally, we expressed a functional ENaC comprised of three C terminus truncated subunits and determined the influence of S1A co-expression on INa (Fig. 3D). S1A inhibition was reversed completely under these conditions, as there was no significant difference between the combined alpha beta gamma truncated ENaC currents and those with co-expressed S1A. These findings suggest that the S1A inhibition of INa involves functional interactions of syntaxin with the C termini of all ENaC subunits, which is consistent with the protein binding data.

An ENaC PY Mutant Is Inhibited by S1A-- The PY motif located in the C terminus of the beta - and gamma -ENaC subunits is involved in important interactions with the ubiquitin ligase Nedd4 (7). To examine whether the PY motif may also influence S1A binding and subsequent ENaC inhibition, we measured INa in oocytes co-expressing a beta -ENaC PY mutant, beta -Y618A, together with S1A. As described above and shown in Fig. 4, S1A inhibited wt ENaC current, which was reversed upon truncation of the beta -ENaC C terminus. Amiloride-sensitive currents were approximately doubled in beta -Y618A ENaC-expressing oocytes relative to wt ENaC controls (Fig. 4), as has been demonstrated previously for beta - or gamma -ENaC PY mutations (25). However, in contrast to the beta -ENaC C terminus truncation, co-expression of S1A with beta -Y618A ENaC resulted in a 76% inhibition of the INa (Fig. 4). This value is quantitatively similar the inhibition observed for S1A co-expression with wt ENaC (Fig. 3), indicating that the PY motif itself is not involved in the functional interaction with S1A.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Mutation of the PY motif does not affect S1A inhibition of ENaC. Oocytes were injected with alpha -, beta -, and gamma -ENaC subunit cRNAs with or without S1A cRNA. Channels formed from beta  C terminus mutants are designated by the single mutated subunit and were expressed with complementary wild-type subunits. Wt and beta -R564X ENaC were used as positive and negative controls, respectively. Amiloride-sensitive Na+ currents were measured as described for Fig. 3. Data are expressed as the fraction of amiloride-sensitive current relative to wt ENaC controls (I/Iwt), n = 13-15; N = 4 (see legend for Fig. 3).

The H3 Domain Is Necessary for Inhibition of ENaC Current-- The H3 domain of S1A has been shown to regulate other ion channels, and our results demonstrate that it interacts physically with the ENaC C termini (Fig. 2). To test the hypothesis that the H3 domain interaction with ENaC regulates channel function, we co-expressed a S1A H3 deletion mutant (Delta H3) together with ENaC in oocytes and measured amiloride-sensitive INa. Fig. 5A shows that wt S1A significantly inhibited INa whereas S1A Delta H3 had no effect. These results indicate that functional inhibition of ENaC requires the H3 domain of S1A. To verify this, we examined the effect of acutely injecting various S1A fusion proteins on INa; current recordings were obtained ~1 h after injection. As shown in Fig. 5B, injection of GST alone had no effect on INa. However, injection of GST-H3 significantly attenuated the amiloride-sensitive INa; the inhibition obtained from acute injection of GST-H3 was quantitatively similar to that resulting from co-expression of full-length S1A. This acute effect of the H3 domain suggests that S1A overexpression is not generally interfering with protein production, which is in agreement with prior control experiments in which S1A was expressed with other plasma membrane receptors or transporters (26). Finally, injection of a S1A fusion protein lacking the H3 domain, GST-Delta H3, did not significantly affect INa relative to cells expressing ENaC alone (Fig. 5B). These results support the hypothesis that the H3 domain of S1A is important in its regulation of ENaC activity.


View larger version (8K):
[in this window]
[in a new window]
 
Fig. 5.   The S1A H3 domain is required for inhibition of ENaC currents. A, oocytes were injected with alpha -, beta -, and gamma -ENaC subunit cRNAs with or without full-length S1A or S1A H3 deletion mutant (S1A Delta H3, S1A1-189) cRNAs. Amiloride-sensitive Na+ currents were measured as described for Fig. 3. Data are expressed as the fraction of amiloride-sensitive current relative to wild-type ENaC controls (I/Iwt) obtained for each animal, n = 12; N = 4. B, oocytes were injected with alpha -, beta -, and gamma -ENaC subunit cRNAs; expression proceeded for 18-36 h. 1 h prior to recording, ENaC-expressing oocytes were injected with GST-H3 or GST-Delta H3 fusion proteins or GST (estimated final concentration, 50 ng/µl; see Fig. 2 for definitions). Amiloride-sensitive Na+ currents were measured as described for Fig. 3. Data are expressed as the fraction of amiloride-sensitive current relative to the wild-type ENaC controls (I/Iwt), n = 12; N = 4 (see legend for Fig. 3).

H3 Reduces Cell Surface ENaC Expression-- Previously (14), we found that co-expression of S1A reduced cell surface ENaC localization without changing total protein expression levels. This finding suggests that S1A may interfere with ENaC trafficking to the plasma membrane. In light of the fairly rapid effect of H3 domain injection on INa shown above, we sought to determine whether this short term action of GST-H3 also affected the amount of ENaC expressed at the cell surface; alternately, H3 injection may decrease INa by influencing channel gating. FLAG-tagged surface ENaC expression was assessed using an enzyme-linked luminescence assay developed previously (19) for cell surface K+ channel expression; the results are summarized in Fig. 6. The cell surface signal from beta -FLAG ENaC was about eight times the background level, and the latter was determined using oocytes expressing wt ENaC lacking FLAG epitope. Injection of GST-H3 ~1 h prior to surface labeling reduced this signal by 70% (corrected for background), whereas prior injection of S1A fusion protein lacking the H3 domain had no effect. This reduction in surface labeling correlates with the 75% reduction in INa observed in similar H3 injection experiments (Fig. 5B) or when S1A was co-expressed with ENaC (Fig. 3). The data suggest that, even within this time frame, the primary action of the H3 domain is on expression of ENaC at the cell surface.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   The S1A H3 domain decreases cell surface ENaC. Oocytes were injected with wt or alpha -, beta -FLAG-, or gamma -ENaC cRNAs and assayed for cell surface FLAG epitope expression. 1 h prior to surface labeling, oocytes expressing FLAG-ENaC were injected with GST-H3 or GST-Delta H3 as indicated. Amiloride-sensitive INa was measured prior to labeling in parallel experiments and did not differ between wt and beta -FLAG-ENaC. Data are expressed as relative light units from luminometry of individual oocytes, n = 12; N = 2.

The ENaC-S1A Interaction Is Salt-sensitive-- Increased cellular Na+ concentration elicits a decrease in ENaC-mediated apical membrane conductance in epithelial cells. This cellular protective mechanism balances apical Na+ entry with basolateral Na+ extrusion (1). To determine whether the S1A-ENaC interaction may be involved in feedback regulation of Na+ entry, we determined the effect of ambient Na+ and K+ concentrations in the binding buffer on the physical interaction between syntaxin and ENaC determined in vitro. As shown in Fig. 7, the binding of the beta -ENaC C terminus to GST-S1A decreased with increasing Na+ concentration in the binding buffer, such that 100 mM Na+ virtually abolished this interaction. There was also a marked reduction in binding at 50 mM Na+. Increasing buffer K+ concentration also reduced the interaction of S1A with the beta -ENaC C terminus, but elevated K+ was less disruptive than Na+ (Fig. 7, lower panel). Similar results were obtained for the interaction of S1A with the alpha - and gamma -ENaC C termini (data not shown). These data suggest that ionic forces are involved in the ENaC C terminus interaction with S1A and that binding is particularly sensitive to ambient Na+.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 7.   Na+ and K+ concentration dependence of ENaC-S1A interactions. Pull-down assays were performed using the C terminus of beta -ENaC (as in Fig. 1), except the binding buffers contained the indicated concentrations of NaCl or KCl. Samples were resolved using 15% SDS-PAGE, and blots were probed with poly-His antibodies (1:2000). Gel locations of the C-terminal ENaC fragments are shown by arrows. The experiment was performed two additional times with similar results. The lower panel provides quantitation of the gel data; see text for other details.

Ca2+ Sensitivity of S1A-ENaC Interactions-- Apical Na+ conductance is also inhibited when cellular free Ca2+ concentration rises (1). We evaluated the Ca2+ and ATP dependence of the ENaC-S1A interactions using in vitro pull-down assays performed in the presence of 0.1 or 10 µM free Ca2+ (EGTA-buffered). We also tested the effect of ATP on the S1A-ENaC interaction in vitro. The results in Fig. 8 show that 10 µM Ca2+ abolished the S1A-ENaC interaction. The presence of 2.5 mM ATP in the low Ca2+ binding buffer did not influence the interaction of ENaC with S1A.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 8.   The ENaC-S1A interaction is sensitive to Ca2+ but insensitive to ATP. In vitro pull-down assays were performed to test the interaction between S1A and the C terminus of alpha -ENaC in the presence of 0.1 (L) or 10 µM (H) Ca2+, with or without 2.5 mM ATP. In these experiments, the binding buffer (17) contained 1.2 mM EGTA and sufficient CaCl2 to yield the free Ca2+ level shown. Samples were separated on 15% SDS-PAGE, transferred to polyvinylidene difluoride membrane, and probed with poly-His antibodies (1:2000). The experiment was performed twice with similar results.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The results of this study demonstrate a physical interaction between ENaC and syntaxin 1A that modulates amiloride-sensitive Na+ entry by influencing the density of plasma membrane ENaC channels. Syntaxin 1A binds directly to the C termini of the alpha -, beta -, and gamma -ENaC subunits in vitro and does not associate with the N terminus of any ENaC subunit. Functional data confirm these sites of interaction, because C-terminal truncations of individual subunits reversed the inhibition associated with S1A co-expression, and a channel formed entirely from truncated subunits was not inhibited by S1A. The H3 domain of syntaxin was critical for this functional effect. Its deletion restored INa to values not significantly different from expression of wild-type ENaC alone, and acute injection of a GST-H3 fusion protein, but not a S1A GST-Delta H3 fusion protein, inhibited ENaC currents and cell surface ENaC to the same degree as S1A co-expression. Previous studies (14) showed that co-expression of a soluble S1A lacking the transmembrane domain was as inhibitory for ENaC currents as the full-length protein, in agreement with the inhibitory effect of the soluble H3 domain shown here. Increasing the Na+ or K+ concentrations of the binding buffer reduced ENaC-S1A binding, suggesting that electrostatic forces are involved in these interactions. Although the ENaC C terminus was the structural target for the inhibitory effect of S1A, a Liddle's disease-related mutation in the C terminus PY motif did not obviate the S1A inhibition of ENaC current. This result, together with previous findings (14), has implications for the mechanism of S1A inhibition that will be discussed below.

The rate of Na+ entry across the apical membranes of absorptive epithelial cells is determined by the number and open probability of apical ENaC channels. Control over apical ENaC density is a key component in the regulatory actions of vasopressin, aldosterone, and other factors that govern this rate-determining step in Na+ absorption (see above and Ref. 1 for review). Cognate interactions between specific SNARE proteins mediate the fusion of vesicle and target membranes, and they are undoubtedly a key step in the insertion of ENaC-containing vesicles into the apical membranes during these acute regulatory responses (14, 27). Syntaxin 1A is a t-SNARE protein that plays a critical role in formation of the core fusion complex in neurosecretory vesicles, together with soluble N-ethylmaleimide-sensitive factor attachment protein-25/23 and vesicle-associated membrane protein-2. Together, these proteins mediate the insertion of membrane vesicles into the plasma membranes at nerve terminals, and in other cell types they act in the final steps that mediate the regulated exocytic events involved in protein secretion or the regulated insertion of integral membrane proteins like ENaC (28). Structural studies have shown that the N-terminal amino acids, 28-144, of syntaxin 1A form an independent folded domain comprised of three alpha -helices that can interact to form a twisted, left-handed, up-down bundle (29). This closed conformation of S1A is stabilized by the syntaxin regulatory proteins, munc-13 (30) and munc-18 (31); stabilization of this bundled structure by munc-18 regulates the ability of S1A to interact with other SNAREs (24). The inhibitory effect of S1A overexpression on ENaC currents and its reversal by munc-18 (14) suggested that these proteins play a functional role in the insertion of ENaC-containing vesicles into the plasma membrane.

The bundled structure with which munc-18 interacts occludes the H3 helical domain (amino acids 185-267) and prevents its interaction with soluble N-ethylmaleimide-sensitive factor attachment protein-25/23 and vesicle-associated membrane protein-2. The H3 domain contains the "SNARE motif" that forms the stable tertrameric coiled-coil structure necessary for membrane fusion (21, 32, 33). This H3 region was found to be responsible for the interaction of syntaxin 1A with ENaC. Deletion of the H3 domain abolished the physical interaction of the ENaC C termini with syntaxin (Fig. 2) and eliminated the inhibition of ENaC current observed with S1A expression (Fig. 3). Co-expression of an H3-deleted S1A (Delta H3) had no effect on ENaC currents, and injection of the H3 domain alone was as inhibitory as the co-expression of full-length S1A (Fig. 4). The H3 domain binds to CFTR and Ca2+ channels, which are also down-regulated by S1A overexpression, and this has been suggested as a general mechanism for syntaxin regulation of ion channel activity (34). As observed in the present studies of ENaC, elimination of or interference with the S1A binding site on CFTR, or on the voltage-dependent Ca2+ channel, abolishes the inhibitory effect of syntaxin 1A (22, 35). In the case of CFTR, however, truncation of the S1A binding N terminus interferes with channel processing and reduces CFTR currents to about 10% of the level of wt CFTR. This is not observed for ENaC, because truncation of the S1A binding domains either has no effect (alpha -subunit) or augments (beta - and gamma -subunits) ENaC currents, permitting a clear evaluation of the functional consequences of S1A on the truncated channel.

Previous studies of the functional effect of co-expressed syntaxin 1A on ENaC currents in Xenopus oocytes demonstrated an inhibition of amiloride-sensitive Na+ entry that could not be ascribed to a nonspecific effect on ENaC protein expression (14, 15). The study of Qi et al. (14), attributed the decrease in ENaC current to a reduction in the number of cell surface channels, detected by antibody labeling of non-permeabilized oocytes expressing extracellular FLAG-tagged ENaC subunits. Nevertheless, in a conceptually similar study Saxena et al. (15) found that co-expression of S1A increased cell surface ENaC. This result would require a proportionately greater decrease in channel open probability to override the apparent increase in channel number. However, the surface labeling conditions employed in these experiments are questionable. After fixation of the oocytes in 3% formaldehyde, they were labeled sequentially with primary and secondary antibodies, each for 1 h at 37 °C. Given these conditions, the blotchy ENaC staining detected at low magnification may reflect access of the antibody to intracellular epitope. In the experiments of Qi et al. (14), antibody labeling was performed without fixation or permeabilization at 4 °C, and the resulting ENaC staining pattern was uniform. In the present study, we used luminometry to detect ENaC at the cell surface. The S1A H3 domain suppressed ENaC INa by 75% approximately 1 h after its injection (Fig. 5), and this relatively rapid effect could be attributed to a quantitatively similar reduction in ENaC expression at the cell surface (Fig. 6).

Previous studies (7, 13) have presented evidence for a relatively rapid turnover of channel protein at the plasma membrane, and they have identified the mechanisms responsible for endocytic retrieval of ENaC. Studies in Xenopus oocytes examining the decay of INa following inhibition of ENaC traffic to the plasma membrane estimate the half-life of cell surface ENaC to be about 1 h. Accordingly, the 70% reduction in surface ENaC expression detected about 1 h after H3 domain injection would be in keeping with this rapid turnover of channels at the surface. An H3 domain-mediated block of ENaC insertion, together with an inherently rapid rate of channel retrieval, would reduce INa through a primary effect on channel number.

Inferences regarding the mechanism whereby S1A would reduce ENaC surface expression can be made also from the ENaC mutation analysis. Studies of amiloride-sensitive, genetic hypertension (reviewed in Ref. 6) have implicated structures in the C termini of ENaC subunits in the control of plasma membrane channel number, perhaps by two mechanisms. First, the PPPXYXXL motif within the subunit C termini may serve as an internalization or endocytic motif (13). Second, this motif participates in a physical interaction with the ubiquitin ligase, Nedd4-2, which binds to PY motifs in the ENaC C termini and decreases ENaC current by reducing cell surface channel number (7, 8). Nedd4-mediated ubiquitination of the ENaC N termini promotes channel internalization by endocytosis and its degradation in lysosomes (38).

Syntaxin 1A binds to the ENaC C termini, and its inhibition of ENaC current was eliminated by C terminus truncations. These findings could be compatible with the concept that S1A promotes ENaC retrieval by a mechanism that depends on Nedd4-mediated ENaC endocytosis/degradation. Similar to C terminus truncations, mutants in the PY motif augment ENaC currents (see Figs. 3 and 4) by increasing cell surface ENaC; Nedd4 binding to ENaC is disrupted by C terminus truncation or by mutation of the PY motif (7, 25). However, a mutant that disrupts the PY motif in beta -ENaC, Y618A, was strongly inhibited by S1A co-expression. The persistence of S1A inhibition in the PY mutant therefore suggests that the action of S1A is not related to Nedd4 binding or to the role of the PY motif in ENaC endocytosis, although we cannot formally rule out stimulation of an endocytic process by S1A that does not involve PY. Nevertheless, it seems unlikely that the influence of S1A on cell surface ENaC is because of stimulation of ENaC removal from the cell surface, because the effects of truncation and PY mutation would be expected to affect S1A inhibition similarly. It is more likely that the reduction in cell surface channel number detected here, and in the studies of Qi et al. (14), arises from inhibition of the insertion of ENaC channels into the plasma membrane.

Recent findings have implicated Nedd4 in the inhibition of Na+ entry that is associated with increased intracellular Na+ concentration (39). In addition, truncation of the ENaC C termini attenuates this feedback effect of intracellular Na+ (40). These findings led us to evaluate the influence of increased salt concentrations and Ca2+ on the physical interaction between S1A and the ENaC C termini. Increasing Na+ or K+ concentration of the binding buffer decreased this interaction, and Na+ was a more potent disruptor of S1A binding than K+, as would be expected from a Na+-selective feedback event. However, inasmuch as the interaction of ENaC with expressed S1A is itself inhibitory, it seems difficult to infer a role for Na+-mediated disruption of this interaction in the process of feedback inhibition. Disrupting an inhibitory interaction should increase Na+ transport. However, this reasoning assumes that the physiological action of endogenous S1A is inhibitory. Rather, if endogenous syntaxin 1A normally mediates apical ENaC insertion, or if it positively regulates trafficking reactions that deposit more ENaC in the plasma membrane, then a Na+-induced disruption of the S1A-ENaC interaction could decrease cell surface ENaC and reduce Na+ currents. Similar conclusions would apply to the inhibition of S1A-ENaC binding observed at physiologically high Ca2+ concentrations (10-5 M), because increased intracellular Ca2+ is also inhibitory to ENaC currents (1). Our findings concerning the cation dependence of S1A-ENaC interactions indicate that electrostatic forces are involved in their physical association. However, elucidating a potential role for S1A in ENaC regulatory effects that involve changes in cellular composition will require a better understanding of the physiological role of endogenous syntaxin 1A in regulating apical ENaC density.

How does the effect of overexpressed S1A relate to its physiological action on sodium transport? On one hand, the inhibition of ENaC current associated with S1A overexpression may result from disruption of normal SNARE-mediated ENaC trafficking mechanisms that are responsible for channel insertion into the plasma membrane. The influence of overexpressed syntaxins on specific trafficking pathways is commonly used to infer a physiological role for a specific syntaxin isoform in a specific trafficking pathway. For example, the selective inhibition of endoplasmic reticulum to Golgi traffic observed with exogenous syntaxin 5 expression reflects its physiological role as the t-SNARE in this step of protein secretory pathway traffic (36). Syntaxin 5 overexpression is sometimes used as an experimental means of interfering with vesicle-mediated protein transport between endoplasmic reticulum and Golgi (37). Other examples of selective syntaxin isoform inhibition are provided in Qi et al. (14). However, according to this view, the effect of exogenously expressed syntaxin would arise from disruption of the stoichiometric protein interactions necessary for membrane fusion, a general mechanism that should lack specificity for vesicle cargo, in this case, ENaC. Conversely, the protein binding studies and the elimination of S1A inhibition by ENaC subunit truncation argue for a more selective phenomenon, related to the physical presence of ENaC in the trafficking vesicles. The present findings suggest that domain-specific interactions between the ENaC C-terminal cytoplasmic tails and S1A are involved in regulating plasma membrane channel number. It remains to be determined whether apical S1A is the principal t-SNARE that determines the insertion of ENaC containing vesicles into the epithelial cell apical membrane or whether it may compete with another syntaxin isoform that mediates the insertion of ENaC channels.

    ACKNOWLEDGEMENTS

We express sincere thanks to Drs. Thomas Kleyman and Shaohu Sheng for assistance with mouse ENaC constructs and to Dr. John P. Johnson for comments on the manuscript.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant DK54814 and Cystic Fibrosis Foundation Grants FRIZZE99G0 and FRIZZE97RO.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Recipient of a postdoctoral fellowship from the Cystic Fibrosis Foundation.

|| Recipient of a postdoctoral fellowships from the Pennsylvania-Delaware Affiliate of the American Heart Association.

** To whom correspondence may be addressed: Dept. of Cell Biology and Physiology, University of Pittsburgh School of Medicine, S362 BST, 3500 Terrace St., Pittsburgh, PA 15261. Tel.: 412-648-9498; Fax: 412-648-8330; E-mail: frizzell@pitt.edu or Zhangh{at}pitt.edu.

Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M210772200

    ABBREVIATIONS

The abbreviations used are: ENaC, epithelial Na+ channel; S1A, syntaxin 1A; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor; GST, glutathione S-transferase; INa, amiloride-sensitive Na+ current; CFTR, cystic fibrosis transmembrane conductance regulator; cRNA, complimentary RNA; BSA, bovine serum albumin; wt, wild-type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Garty, H., and Palmer, L. G. (1997) Physiol. Rev. 77, 359-396[Abstract/Free Full Text]
2. Canessa, C. M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Horisberger, J. D., and Rossier, B. C. (1994) Nature 367, 463-467[CrossRef][Medline] [Order article via Infotrieve]
3. Firsov, D., Gautschi, I., Merillat, A. M., Rossier, B. C., and Schild, L. (1998) EMBO J. 17, 334-352
4. Snyder, P. M., Cheng, C., Prince, L. S., Rogers, J. C., and Welsh, M. J. (1998) J. Biol. Chem. 273, 681-684[Abstract/Free Full Text]
5. Renard, S., Lingueglia, E., Voilley, N., Lazdunski, M., and Barbry, P. (1994) J. Biol. Chem. 269, 12981-12986[Abstract/Free Full Text]
6. Snyder, P. M. (2002) Endocr. Rev. 23, 258-275[Abstract/Free Full Text]
7. Staub, O., Gautschi, I., Ishikawa, T., Breitschopf, K., Ciechanover, A., Schild, L., and Rotin, D. (1997) EMBO J. 16, 6325-6336[CrossRef][Medline] [Order article via Infotrieve]
8. Goulet, C. C., Volk, K. A., Adams, C. M., Prince, L. S., Stokes, J. B., and Snyder, P. M. (1998) J. Biol. Chem. 273, 30012-30017[Abstract/Free Full Text]
9. Debonneville, C., Flores, S. Y., Kamynina, E., Plant, P. J., Tauxe, C., Thomas, M. A., Munster, C., Chraibi, A., Pratt, J. H., Horisberger, J. D., Pearce, D., Loffing, J., and Staub, O. (2001) EMBO J. 20, 7052-7059[CrossRef][Medline] [Order article via Infotrieve]
10. Snyder, P. M., Olson, D. R., and Thomas, B. C. (2002) J. Biol. Chem. 277, 5-8[Abstract/Free Full Text]
11. Shimkets, R. A., Warnock, D. G., Bositis, C. M., Nelson-Williams, C., Hansson, J. H., Schambelan, M., Gill, J. R., Jr., Ulick, S., Milora, R. V., and Findling, J. W. (1994) Cell 79, 407-414[CrossRef][Medline] [Order article via Infotrieve]
12. Snyder, P. M., Price, M. P., McDonald, F. J., Adams, C. M., Volk, K. A., Zeiher, B. G., Stokes, J. B., and Welsh, M. J. (1995) Cell 83, 969-978[CrossRef][Medline] [Order article via Infotrieve]
13. Shimkets, R. A., Lifton, R. P., and Canessa, C. M. (1997) J. Biol. Chem. 272, 25537-25541[Abstract/Free Full Text]
14. Qi, J., Peters, K. W., Liu, C., Wang, J. M., Edinger, R. S., Johnson, J. P., Watkins, S. C., and Frizzell, R. A. (1999) J. Biol. Chem. 274, 30345-30348[Abstract/Free Full Text]
15. Saxena, S., Quick, M. W., Tousson, A., Oh, Y., and Warnock, D. G. (1999) J. Biol. Chem. 274, 20812-20817[Abstract/Free Full Text]
16. Zhang, H., Peters, K. W., Sun, F., Marino, C. R., Lang, J., Burgoyne, R. D., and Frizzell, R. A. (2002) J. Biol. Chem. 277, 28948-28958[Abstract/Free Full Text]
17. Pralong, W. F., Spät, A., and Wollheim, C. B. (1994) J. Biol. Chem. 269, 27310-27314[Abstract/Free Full Text]
18. Takahashi, A., Watkins, S. C., Howard, M., and Frizzell, R. A. (1996) Am. J. Physiol. 271, C1887-C1894[Medline] [Order article via Infotrieve]
19. Zerangue, N., Schwappach, B., Jan, Y. N., and Jan, L. Y. (1999) Neuron. 22, 537-548[CrossRef][Medline] [Order article via Infotrieve]
20. Firsov, D., Schild, L., Gautschi, I., Merillat, A. M., Schneeberger, E., and Rossier, B. C. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 15370-15375[Abstract/Free Full Text]
21. Fergestad, T., Wu, M. N., Schulze, K. L., Lloyd, T. E., Bellen, H. J., and Broadie, K. (2001) J. Neurosci. 21, 9142-9150[Abstract/Free Full Text]
22. Naren, A. P., Quick, M. W., Collawn, J. F., Nelson, D. J., and Kirk, K. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10972-10977[Abstract/Free Full Text]
23. Bezprozvanny, I., Zhong, P., Scheller, R. H., and Tsien, R. W. (2001) Proc. Natl. Acad. Sci. U. S. A. 97, 13943-13948
24. Dulubova, I., Sugita, S., Hill, S., Hosaka, M., Fernandez, I., Sudhof, T. C., and Rizo, J. (1999) EMBO J. 18, 4372-4382[CrossRef][Medline] [Order article via Infotrieve]
25. Schild, L., Canessa, C. M., Shimkets, R. A., Gautschi, I., Lifton, R. P., and Rossier, B. C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5699-5703[Abstract/Free Full Text]
26. Peters, K. W., Qi, J., Watkins, S. C., and Frizzell, R. A. (1999) Am. J. Physiol. 277, C174-C180[Medline] [Order article via Infotrieve]
27. Rotin, D. (2000) Curr. Opin. Nephrol. Hypertens. 9, 529-534[CrossRef][Medline] [Order article via Infotrieve]
28. Bock, J. B., and Scheller, R. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 26, 12227-12229
29. Fernandez, I., Ubach, J., Dulubova, I., Zhang, X., Sudhof, T. C., and Rizo, J. (1998) Cell 94, 841-849[CrossRef][Medline] [Order article via Infotrieve]
30. Betz, A., Okamoto, M., Benseler, F., and Brose, N. (1997) J. Biol. Chem. 272, 2520-2526[Abstract/Free Full Text]
31. Hata, Y., Slaughter, C. A., and Sudhof, T. C. (1993) Nature 366, 347-351[CrossRef][Medline] [Order article via Infotrieve]
32. Sutton, R. B., Fasshauer, D., Jahn, R., and Brunger, A. T. (1998) 395, 347-353
33. Misura, K. M., Gonzalez, L. C., Jr., May, A. P., Scheller, R. H., and Weis, W. I. (2001) J. Biol. Chem. 276, 41301-41309[Abstract/Free Full Text]
34. Atlas, D. (2001) J. Neurochem. 77, 972-985[CrossRef][Medline] [Order article via Infotrieve]
35. Rettig, J., Heinemann, C., Ashery, U., Sheng, Z. H., Yokoyama, C. T., Catterall, W. A., and Neher, E. (1997) J. Neurosci. 17, 6647-6656[Abstract/Free Full Text]
36. Dascher, C., Matteson, J., and Balch, W. E. (1994) J. Biol. Chem. 269, 29363-29366[Abstract/Free Full Text]
37. Yoo, J. S., Moyer, B. D., Bannykh, S., Yoo, H. M., Riordan, J. R., and Balch, W. E. (2002) J. Biol. Chem. 277, 11401-11409[Abstract/Free Full Text]
38. Rotin, D., Kanelis, V., and Schild, L. (2001) Am. J. Physiol. 281, F391-F399
39. Dinudom, A., Harvey, K. F., Komwatana, P., Young, J. A., Kumar, S., and Cook, D. I. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 7169-7173[Abstract/Free Full Text]