JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M211937200 on February 5, 2003

J. Biol. Chem., Vol. 278, Issue 15, 13026-13032, April 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/15/13026    most recent
M211937200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laneve, P.
Right arrow Articles by Caffarelli, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laneve, P.
Right arrow Articles by Caffarelli, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Purification, Cloning, and Characterization of XendoU, a Novel Endoribonuclease Involved in Processing of Intron-encoded Small Nucleolar RNAs in Xenopus laevis*

Pietro LaneveDagger , Fabio Altieri§, Micol E. FioriDagger , Andrea Scaloni, Irene BozzoniDagger , and Elisa Caffarelli||**

From the Dagger  Institute Pasteur Fondazione Cenci-Bolognetti, Department of Genetics and Molecular Biology, University "La Sapienza" Piazzale Aldo Moro 5, 00185 Rome, Italy, the § Department of Biochemistry, University "La Sapienza," 00185 Rome, Italy,  Proteomics and Mass Spectrometry Laboratory, Institute for Animal Production System in Mediterranean Environment, National Research Council, 80147 Naples, Italy, and the || Institute of Molecular Biology and Pathology, National Research Council, 00185 Rome, Italy

Received for publication, November 22, 2002, and in revised form, February 3, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Here we report the purification, from Xenopus laevis oocyte nuclear extracts, of a new endoribonuclease, XendoU, that is involved in the processing of the intron-encoded box C/D U16 small nucleolar RNA (snoRNA) from its host pre-mRNA. Such an activity has never been reported before and has several uncommon features that make it quite a novel enzyme: it is poly(U)-specific, it requires Mn2+ ions, and it produces molecules with 2'-3'-cyclic phosphate termini. Even if XendoU cleaves U-stretches, it displays some preferential cleavage on snoRNA precursor molecules. XendoU also participates in the biosynthesis of another intron-encoded snoRNA, U86, which is contained in the NOP56 gene of Xenopus laevis. A common feature of these snoRNAs is that their production is alternative to that of the mRNA, suggesting an important regulatory role for all the factors involved in the processing reaction.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Endoribonucleases play essential roles in RNA metabolism participating both in degradative pathways, such as mRNA decay, and in maturative pathways, to generate functional RNA molecules (1, 2). Despite the plethora of functions played by processing enzymes in RNA metabolism, in eukaryotes only a few endoribonucleases have been isolated to date. Most of these activities are involved in the biosynthesis of translation components. In particular, RNase P and RNase mitochondrial RNA processing are ribonucleoprotein enzymes, functioning as site-specific endoribonucleases (3, 4). Other well characterized endonucleolytic activities, such as the 3'-tRNase, the tRNA splicing endonuclease, and members of the RNase III-like family are protein-only enzymes (5-7). Although the majority of these activities participate in the biosynthesis of a specific class of RNA molecules, RNase III was shown to be required for a large number of different maturative pathways. Saccharomyces cerevisiae RNase III (Rnt1p) was shown to be involved in pre-rRNA, small nuclear RNA (snRNA),1 and small nucleolar RNA (snoRNA) processing (8-12). Recently, Rnt1p was also shown to participate in processing the intron-encoded snoRNAs U18 and snR38 from their host pre-mRNA (13). Furthermore, a new member of the metazoan RNase III family has been identified to be involved in the RNA interference process (14).

Another process in which the participation of endoribonucleases was expected to play an important role is the biosynthesis of snoRNAs. These RNAs are part of a complex class of molecules that are localized in the nucleolus where they participate, as small ribonucleoprotein particles (snoRNPs), in different rRNA maturative events such as processing and nucleotide modifications (15, 16). Most snoRNAs in vertebrates are encoded in introns of protein-coding genes and are released from the host primary transcript either by debranching and exo-trimming of the spliced lariat (splicing-dependent pathway) or by endonucleolytic cleavage of the pre-mRNA (splicing-independent pathway) (15, 16). There are only a few cases of intron-encoded snoRNAs in vertebrates, which are released through the intervention of endoribonucleases (17, 18), but so far these activities have not been purified and characterized. We previously showed, by microinjection experiments in X. laevis oocytes, that precursors containing U16 and U86 snoRNAs undergo very little splicing, whereas they efficiently produce snoRNAs through a processing pathway, involving specific endonucleolytic cleavages inside the intron (17, 18). The common feature of U16 and U86 snoRNAs is their localization in introns, which are poor splicing substrates, due to the presence of non-canonical consensus sequences.

We previously reported the identification in oocyte nuclear extracts (ONE) of an endoribonucleolytic activity, named XendoU (19), that produced the release of U16 snoRNA from its host intron by cleaving at the same sites identified in vivo (17). The same activity was described to operate also for the processing of U86 snoRNA (Ref. 18 and this study).

From massive preparations of X. laevis ONE, we purified to homogeneity the XendoU endoribonuclease and characterized its activity. Partial protein sequencing enabled us to clone a XendoU cDNA, to express it, and to perform a functional characterization of this enzyme. Several aspects of XendoU make this protein a novel enzyme, different from all known endoribonucleases characterized so far in the following ways: i) it is poly(U)-specific, ii) its activity depends on Mn2+ ions, and iii) it releases cleavage products with 2'-3'-cyclic phosphate termini.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification of XendoU Activity-- The X. laevis oocyte nuclear extracts were prepared as previously described (17). The pellet obtained after two sequential ammonium sulfate precipitations (45 and 70% saturation) was dissolved in buffer A (25 mM Hepes, 50 mM NaCl, 0.1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, pH 7.5) and applied onto an hydroxyapatite column (CHT-II Econocolumn, Bio-Rad). Elution was carried out with 100 mM Na-phosphate, pH 7, in buffer A. The active fractions were diluted with 3 volumes of buffer A and applied on a Blue-Sepharose column (Blue-Sepharose Fast Flow, Amersham Biosciences). Elution was performed with 0.2 M NaCl in buffer A, and fractions containing XendoU activity were pooled and dialyzed against buffer A. The protein mixture was subjected to a second fractionation on hydroxyapatite column. The elution was performed with 10-column volumes of a linear gradient 0-100 mM Na-phosphate, pH 7, in buffer A. Selected fractions were then applied on a gel-filtration column (Amersham Biosciences) previously equilibrated in buffer A. By this procedure, starting from 15 ml of ONE (7 mg/ml), we obtained sufficient amounts for protein sequencing analysis (~70 µg).

Preparation and Isolation of Tryptic Peptides-- The protein band from SDS-PAGE (5 µg) stained with Coomassie Blue R250 was excised, reduced with dithiothreitol, and carboxamidomethylated. The gel piece was equilibrated in 25 mM NH4HCO3, pH 8, and finally digested in situ with trypsin at 37 °C for 18 h. Peptides were extracted by sonication with 100 µl of 25 mM NH4HCO3/acetonitrile 1:1 v/v, pH 8 (twice). The peptide mixture was fractionated by reverse-phase HPLC on a Vydac C18 column 218TP52 (250 × 1 mm), 5 µm, 300 Å pore size (The Separation Group) by using a linear gradient from 5 to 60% of acetonitrile in 0.1% trifluoroacetic acid over 60 min at a flow rate of 90 µl/min. Individual components were manually collected and lyophilized.

Peptide Sequencing and Mass Spectrometry Analysis-- Sequence analysis was performed using a Procise 491 protein sequencer (Applied Biosystems) equipped with a 140C microgradient apparatus and a 785A UV detector (Applied Biosystems) for the automated identification of phenylthiohydantoin-derivatives, as previously described (20).

Matrix-assisted laser desorption ionization mass spectra were recorded using a Voyager DE-PRO mass spectrometer (Applied Biosystems), as previously reported (20); a mixture of analyte solution, alpha -cyano-4-hydroxy-cinnamic acid was applied to the sample plate and dried. Mass calibration was performed using the molecular ions from peptides produced by trypsin auto-proteolysis and the matrix as internal standards.

Plasmids and Templates for RNA Transcription-- U16- and U86-containing precursors were previously described (17, 18). The following U16-containing mutant derivatives were obtained by inverse PCR on plasmid 003 (17) with the oligonucleotides indicated in parentheses: pre-open stem (open stem fw and open stem rev), pre-Ms1 (Ms1a and Ms1b), and pre-Delta U16 (003 int fw and 003 int rev). pre-Delta C/bD mutant was instead derived by inverse PCR on plasmid 003 bD (21) with oligos Delta C/bd fw and Ms1 Delta C rev.

Oligonucleotides-- The following oligonucleotides were used for obtaining the templates for in vitro transcription: open stem fw, GTAATTTGCGTCCTACTCTAC; open stem rev, GACATCATATTTTGTAAAAAAAGCAC; Ms1a, ATTACGACATCATAGCAAGTA; Ms1b, TATCGCGTTCTGAGCAAAAAA; 003 int fw, CTTGGATAAGTTTAGAATATATTAATA; 003 int rev, GTAAAAAAAGCACAAATCTAAATC; Delta C/bd fw, CGTAATTTGCGTCCTACTC; MS1 Delta C rev, AGCAAGTAAAAAAAGCAC.

In Vitro Processing Reactions of Wild Type and Mutant Derivative RNAs-- U16 and U86-containing precursors (17, 18) were in vitro-transcribed in the presence of [alpha -32P]UTP, and pre-mRNAs were injected into nuclei of stage VI oocytes as previously described (22). Alternatively, 3 × 104 cpm of 32P-labeled pre-mRNAs were incubated with 1 µg of ONE (17) or with 1 ng of purified XendoU, in 5 mM MnCl2, 50 mM NaCl, 25 mM Hepes, pH 7.5, 1 mM dithiothreitol, 10 µg of Escherichia coli tRNA, 20 units of RNase inhibitor (Promega). The products of the reactions were then analyzed on 6% polyacrylamide, 7 M urea gels.

Oligoribonucleotides P1 (5'-GGAAACGUAUCCUUUGGGAG-3'), P2 (5'-GGAAACGUAUCCUUGGGAGG-3'), and P3 (5'-GGAAACGUAUCCUCUGGGAG-3') were 5' end-labeled and incubated in the same conditions as above. Double-stranded P2 was obtained by incubating labeled P2 oligo with its reverse complementary oligo, in a molar ratio of 1:2 for 1 h at 37 °C in 100 mM KOAc, pH 7.5, 30 mM Hepes KOH, pH 7.4, and 2 mM Mg(OAc)2. Double-stranded formation was controlled on a native gel. The RNA ladder was obtained by incubation of P1 oligo (200,000 cpm) in 500 mM NaHCO3 at 90 °C for 20 min.

Analysis of 3' Termini of Cleavage Products-- This analysis was performed by two different approaches. In the first one, 32P-labeled gel-purified I-1b molecules, generated by incubation of U16-containing precursor with ONE, with purified XendoU, or in vivo, were treated with 10 µl of 10 mM HCl at 25 °C for 2 h to hydrolyze the cyclic phosphate moiety as described by Forster et al. (23). The phosphate was then removed by incubation of the RNA in 50 mM Tris-HCl, 0.1 mM EDTA, pH 8.5, in the presence of 1 unit of calf intestine alkaline phosphatase at 50 °C for 60 min. RNA was subjected to two subsequent purification steps with phenol/chloroform, ethanol precipitated, and analyzed on 10% polyacrylamide, 7 M urea gel. In the second approach, the I-1b molecule, obtained by incubation with purified XendoU, was gel-eluted and redissolved in 30 mM Tris, pH 8.0, 15 mM MgCl2, and 1.5 units/µl T4 polynucleotide kinase, and the mixture was incubated for 45 min at 37 °C to remove the 2'-3'-cyclic phosphate (24). RNA was then extracted and labeled using [5'-32P]pCp and T4 RNA ligase for 5 h at 16 °C. RNA was then analyzed on 6% polyacrylamide, 7 M urea gel.

Isolation of XendoU cDNA and its Expression in Reticulocyte Lysate and in Bacteria-- A X. laevis stage 28 embryo cDNA library, constructed in lambda ZAP II vector, was screened using a specific probe obtained by PCR amplification on X. laevis cDNA with degenerate oligonucleotides (MAHs 5'-ATGGCICAYGAYTAYYTIGT-3' and IGTa 5'-ACIGGRTAIGCIGTICCIAT-3') designed on tryptic peptides of purified XendoU. The XendoU ORF was cloned into Blue Script vector and, [35S]methionine-labeled proteins were produced by in vitro transcription and translation using the TNT-coupled Reticulocyte Lysate System kit (Promega). Translational products were analyzed on 10% SDS-PAGE. The XendoU coding sequence was also cloned downstream to the His6 coding region of the pQE30 vector (Qiagen). The fusion protein (His6-XendoU) was induced in the E. coli M15 strain.

Primer Extension Analysis-- The I-2 and I-4 products, derived from U16 processing, were gel-purified and reverse-transcribed with 5' end-labeled oligonucleotides B3 (5'-TACGTCCACCACGACACAT-3') and gamma  (5'-TTTTCCTCAGAACGCAAT-3'), respectively. For the I-4 products derived from U86 processing, oligonucleotide UHindIII (5'-AAGCTTCTTCATGGCGGCTCGGCCAAT-3') was utilized.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification of XendoU from X. laevis Oocyte Nuclear Extracts-- We previously developed an in vitro system able to reproduce the in vivo processing of U16 snoRNA from its host intron (17). When 32P-labeled U16-containing precursor was incubated with X. laevis ONE, specific endonucleolytic products were obtained (Fig. 1B). The I-1 and I-2 molecules derive from cleavage upstream to the U16 coding region, whereas the I-3 and I-4 molecules are produced by cleavage downstream to U16. When double cleavage occurs on the same precursor molecule, pre-U16 products accumulate; these intermediates are eventually converted by exo-trimming to the mature snoRNA (see Fig. 1A). The cleavage sites were previously mapped in correspondence of short U-stretches. Four of them are clustered upstream to U16 and one is located downstream. This cleaving activity was named XendoU (19).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Purification and activity assay of XendoU. A, schematic representation of U16 snoRNA processing. The U16-containing precursor is indicated by P. Cleavage upstream to U16 produces the I-1 and I-2 molecules, whereas cleavage downstream generates the I-3 and I-4 products. Double cleavage produces pre-U16 molecules. a, b, c, and d indicate the cleavage sites upstream to U16; the major sites of cleavage are represented by large arrows. e and f point to the cleavage sites downstream to U16. The Cap structure is shown as a black dot, exons as boxes, the intron as a continuous line, and U16 snoRNA coding region as a thicker line. gamma  and B3 indicate the oligonucleotides utilized in primer extension experiments. B, 32P-labeled U16-containing precursor was incubated with 1 µg of unfractionated oocyte nuclear extracts (ONE lanes) or 1 ng of purified XendoU (XendoU lanes) under standard conditions for 0 min (lanes 1), 5 min (lanes 2), 15 min (lanes 3), 30 min (lanes 4), 60 min (lanes 5), and 120 min (lanes 6) or without the addition of Mn2+ for 30 min (lane 7). The specific cleavage products are indicated on the side. C, unlabeled I-2 and I-4 molecules obtained after 5 min of incubation with purified XendoU were gel-eluted and incubated with oligos gamma  and B3, respectively (see panel A). The products of primer extension were run in parallel with the sequencing reaction (lanes G, A, T, and C) performed with the same oligonucleotides on U16-containing precursor template. The arrows point to the extended products and letters on the left side indicate XendoU cleavage sites. D, XendoU purification scheme. E, proteins from the active fractions of the different fractionation steps of panel D were separated on SDS-PAGE and visualized by Blue Coomassie staining. The arrow points to the purified enzyme with an apparent molecular mass of 37 kDa.

In this work we carried out the biochemical purification of XendoU (Fig. 1D). The enzymatic activity was followed, throughout the different steps, by incubating 32P-labeled U16-containing precursor with aliquots of the different fractions and by analyzing the cleavage products on polyacrylamide gels. Because we previously observed the dependence of XendoU activity on Mn2+ ions (19), this cofactor was always added to the reaction mixture. The protein content of the active fractions is shown in Fig. 1E. After several chromatographic steps, a single component of 37 kDa was identified in those fractions displaying specific activity (Fig. 1E, lane 6). The elution profile on the gel filtration chromatography was consistent with XendoU being a monomeric protein (not shown). Fig. 1B shows the comparison of processing activity of 1 µg of ONE (ONE lanes) with that of 1 ng of the purified 37-kDa polypeptide (XendoU lanes). In both cases, the same primary cleavage products (I-2 and I-3), their complementary cut-off molecules (I-1 and I-4), and pre-U16 molecules were generated.

Characterization of XendoU Cleavage-- To analyze the specificity of cleavage of the purified enzyme, primer extension analysis was performed on gel-purified I-2 and I-4 products (Fig. 1C). The results indicate that, at short incubation times, XendoU cleaves intronic sequences at the same U-rich regions previously identified in vivo and in extracts (17). Four I-2 molecules are generated by cleavages at the a, b, c, and d sites, whereas two I-4 molecules are produced by cleavage at two adjacent U residues, 14 nucleotides downstream to U16 (see representation of Fig. 1A). From the reverse transcriptase experiment it appears that the a and b sites are preferentially utilized in the upstream cleavage. As a consequence two major I-1 molecules (a and b) are identified (see gels of Figs. 1 and 4).

Efficient cleavage with the purified enzyme was obtained only when Mn2+ ions were present in the reaction (Fig. 1B, lane 7). It is remarkable that the addition of Mn2+ ions in the in vitro assay is required for the purified protein and for all the fractions obtained after the blue-Sepharose step. This finding, along with the requirement of Mn2+ supply when aged oocyte extracts are utilized (not shown), is consistent with a loosely bound metal ion in the protein moiety. The purified enzyme is poorly activated by Mg2+, whereas it is inactive in the presence of Cd2+, Zn2+, Ni2+, Co2+, and Pb2+ (not shown).

The time course of Fig. 1B shows that the purified enzyme cleaves preferentially at specific sites. Nevertheless, at longer incubations also the primary cleavage products become substrates for further digestion, producing small-sized RNAs only visible on short run gels (not shown). The substrate specificity of XendoU was then tested by incubating the purifed enzyme with a synthetic oligoribonucleotide (P1), containing the upstream distal XendoU cleavage site (site d, Fig. 1A), and with mutated derivatives thereof (P2 and P3). The results indicate that the sequence specificity of XendoU is limited to U-stretches and that only two U residues are sufficient for cleavage (Fig. 2A). Incubation of XendoU with the P2 oligo in a double-stranded configuration did not produce any cleavage (lane dsP2), indicating that the enzyme is unable to cleave U-stretches present in double-stranded structures.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2.   Analysis of XendoU cleavage. A, 32P-labeled synthetic oligoriboligonucleotide P1, containing the distal cleavage site upstream to U16 (site d), its mutant derivatives (P2 and P3), and a double-stranded P2 derivative substrate (dsP2), were incubated under standard conditions for 30 min with the following: buffer (lanes 1), unfractionated extracts (lanes 2), or purified XendoU (lanes 3). Lane M reports the ladder generated by alkaline digestion of P1. On the side, the sequences of the oligoribonucleotides are reported; arrows indicate the cleavage sites. B, XendoU processing of U16-containing precursor and of its mutant derivatives pre-open stem, pre-Delta C/bD, pre-Ms1, and pre-Delta U16 (schematized in the lower part of the panel). 32P-labeled RNAs were incubated with XendoU under standard conditions for 0 min (lanes 1), 10 min (lanes 2), 20 min (lanes 3), 40 min (lanes 4), and 60 min (lanes 5). The processing products are indicated on the sides (see Fig. 1A for schematic representation). C, 32P-labeled I-1b molecules, schematically represented on the left side, obtained with oocyte nuclear extracts (ONE lanes), with purified XendoU (XendoU lanes), or after injection in oocytes (in vivo lanes), were gel purified and incubated with 1 unit of alkaline phosphatase (lanes 1) or with 10 mM HCl (lanes 2) or with alkaline phosphatase after acid treatment (lanes 3). Untreated molecules were run as control in lanes 4. D, I-1b molecule obtained by incubation of unlabeled U16-containing precursor with purified XendoU was gel purified and subjected to [5'-32P]pCp labeling directly (lane 2) or after kinase treatment (lane 3). In lane 1, a labeled marker I-1b molecule is run.

From these data it appears that, despite the presence of several U-stretches in the U16-host intron upstream and downstream to the snoRNA, specific sites are preferentially cleaved by XendoU. This is similar to what is described for the bacterial RNase E endonuclease, which, even if it has a low primary sequence specificity, cleaves the substrate only at a limited number of sites. In this case, it was shown that the overall secondary structure of the substrate modulated cleavage activity and that the role of stem-loop structures was to limit rather than promote RNase E cleavages (25). Because sno RNAs are folded in specific secondary structures characterized by the conserved terminal core motif (see wild type RNA in lower part of Fig. 2B) (16, 26) and, in many cases, by an apical stem-loop region (27, 28), we asked whether these structural elements could influence XendoU activity. Mutants affecting either structure were raised on precursor molecules and tested for XendoU cleavage. The terminal core motif was destroyed in the pre-open stem and pre-Delta C/bD mutants, whereas the apical stem-loop structure was deleted in the pre-Ms1 derivative (see schematic representation of Fig. 2B). The pattern of XendoU cleavage on such mutants (Fig. 2B) was not altered, suggesting that these structures do not represent entry sites or positioning elements for XendoU. This conclusion was definitely confirmed by the analysis of pre-Delta U16, a mutant completely lacking the snoRNA sequence. XendoU cleaves this RNA at the same sites as the wild type RNA substrate, as indicated by the size of the cleavage products (see Fig. 1A for schematic representation).

Characterization of the Reaction Products-- The chemistry of XendoU cleavage was assessed by determining the chemical nature of the termini in the cleaved products. The ends of 32P-labeled I-1b molecules produced with ONE or with the purified XendoU were analyzed. These molecules were gel-purified and treated either with HCl or alkaline phosphatase or with both. Fig. 2C shows that a slight decrease in migration, due to the loss of a negative charge, is obtained only when the alkaline phosphatase follows the HCl treatment (lane 3). These data allowed us to conclude that the 3' end of the cleavage products, obtained with ONE (ONE lanes) and with the purified XendoU (XendoU lanes), carry a 2'-3'-cyclic phosphate (23, 29). In fact, only after the acid treatment the phosphate group can be removed by phosphatase, such as to confer slight decrease in gel mobility. As previously reported (21), the products of primary cleavage such as I-1 molecules are quite unstable in vivo because, after cleavage, they are rapidly trimmed out. Nevertheless, at very short incubation times we were able to purify small amounts of I-1b molecules and to subject them to the same treatment described above. Fig. 2C (in vivo lanes) shows that a slight reduction in migration was obtained, demonstrating that the products of the in vivo reaction also have 2'-3'-cyclic phosphate ends. The nature of the 3' ends was also tested by a different approach (24). The I-1b molecule, generated by XendoU cleavage, was ligated to [5'-32P]pCp directly or after kinase treatment, which removes the 2'-3'-cyclic phosphate. The appearance of a radioactive band only after kinase treatment (lane 3 of Fig. 2D) confirms that this molecule has 2'-3'-cyclic phosphate.

Isolation of a XendoU cDNA-- After elution from the gel, the 37-kDa polypeptide was reduced, alkylated, and digested with trypsin as reported under "Experimental Procedures." The resulting peptide mixture was resolved by reversed-phase HPLC, and selected peptide fractions were submitted to automated Edman degradation. Three tryptic peptides (indicated as #1, #2, and #3 in Fig. 3) were utilized to derive degenerate oligonucleotides. These were employed, in different combinations, in PCR amplification reactions on cDNA from poly(A)+ RNA extracted from X. laevis oocytes. Only the reaction performed with sequence #1 (forward) and sequence #3 (reverse) gave a specific amplification product of 500 nucleotides. Sequencing of this product indicated the presence of an open reading frame containing peptide #2. This cDNA probe was then utilized for screening a X. laevis stage 28 embryo cDNA library, allowing the isolation of a full-length cDNA (Fig. 3). 65% of the amino acid sequence determined was confirmed by MALDI-mass spectrometry spectra of the tryptic peptides.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3.   cDNA and deduced amino acid sequence of XendoU. 5' and 3' untranslated regions are shown in lowercase letters whereas the ORF is in capital letters. Above each codon the deduced amino acid is shown. The peptides determined by automated Edman degradation (see under "Experimental Procedures") that were utilized for deriving the degenerated oligonucleotides are indicated by #1, #2, and #3. The stop codon is identified by an asterisk. The amino acid sequences covered by MALDI-mapping experiments are underlined.

Activity of in Vitro-translated and Recombinant XendoU-- The XendoU ORF, 876-bp-long, was cloned into the Blue Script vector and the protein was produced by in vitro transcription and translation using a reticulocyte lysate. The translation product was analyzed on SDS-PAGE and resulted in a 37-kDa protein (Fig. 4A). To assess the activity of this polypeptide, the reticulocyte lysate expressing the XendoU ORF was incubated with 32P-labeled U16-containing precursor. Fig. 4B shows that the cleavage pattern produced by the in vitro-translated 37 kDa protein (lane 2) matches that obtained with the extracts (lane 1). Furthermore, the lack of cleavage when Mn2+ ions were not added to the reaction mixture (lane 3) confirms the specific ion requirement of XendoU and suggests that the binding to this cofactor is reversible. As a negative control, the activity assay was carried out by incubating the RNA substrate with an uncommitted reticulocyte lysate in the presence of Mn2+ ions (lane 4). Fig. 4 also shows that a His6-XendoU recombinant protein expressed in bacteria is able to reproduce the cleavage pattern of the purified enzyme (lane 5).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4.   Functional analysis of in vitro-translated and recombinant XendoU. A, SDS-PAGE analysis of [35S]methionine-labeled in vitro transcription and translation products of XendoU cDNA (lane 2) and of control luciferase (lane 1). The arrow points to the 37 kDa product. B, the U16-containing precursor (P) was incubated for 45 min in the presence of Mn2+ ions with ONE (lane 1), with the in vitro-translated XendoU (lane 2), or with an uncommitted reticulocyte lysate (lane 4). The RNA substrate was also incubated with in vitro-translated XendoU in the absence of Mn2+ ions (lane 3). In lane 5 the cleavage pattern obtained with recombinant His-XendoU is shown.

XendoU also Participates in the Biosynthesis of Another Intron-encoded snoRNA-- We previously identified a novel box C/D snoRNA, named U86, which is encoded by an intron of the NOP56 gene of X. laevis (18). Similarly to U16 snoRNA, U86 is also contained in a poorly spliceable intron and its biosynthesis appears to be alternative to that of the co-transcribed mRNA. Injection of 32P-labeled U86-containing precursor into X. laevis oocytes generates the truncated products I-2 and I-3 and their 5' and 3' cut-off molecules, I-1 and I-4 (Fig. 5A, in vivo lanes).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   XendoU is involved in U86 snoRNA biosynthesis. A, 32P-labeled U86-containing precursor (P) was injected in X. laevis oocytes (in vivo lanes), or incubated in vitro with ONE (ONE lanes), or with purified XendoU (XendoU lanes). Incubations were allowed to proceed for the following: 0 min (lane 1), 10 min (lanes 2), 45 min (lanes 3), 3 h (lanes 4), and 16 h (lanes 5). The processing products are schematically represented on the side. Arrows indicate the cleavage sites. B, 32P-labeled UHindIII primer was reacted with unlabeled, gel-purified I-4 molecules obtained after a 10-min incubation in oocytes (in vivo lane), 45 min with ONE (ONE lane), or 45 min with purified XendoU (XendoU lane). The products of primer extension were run in parallel with the sequencing reaction (lanes G, A, T, and C) performed with the same oligonucleotide on U86-containing precursor template. The cleavage sites are indicated on the corresponding sequence. C, U86-containing precursor (P) was incubated for 45 min in the presence of Mn2+ ions with ONE (lane 1), with in vitro-translated XendoU (lane 2), or with an uncommitted reticulocyte lysate (lane 4). As a control, pre-mRNA was incubated with in vitro-translated XendoU in the absence of Mn2+ ions (lane 3).

Processing of U86-containing precursor with purified XendoU (Fig. 5A, XendoU lanes) or with the reticulocyte lysate expressing XendoU ORF (Fig. 5C, lane 2) demonstrates that the enzyme is responsible for the cleavage occurring downstream to the U86 coding region. The activity responsible for the cleavage upstream to U86, which produces I-2 and I-1 molecules, is still unidentified and it is not also reproduced in oocyte nuclear extracts (Fig. 5A, ONE lanes). The XendoU cleavage sites, downstream to U86, were mapped by primer extension on I-4 molecules and found to localize in correspondence of three U-rich sequences (Fig. 5B).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study we report the purification to homogeneity of XendoU, an activity previously shown to be involved in the release of the intron-encoded U16 and U86 snoRNAs from their host primary transcripts in X.laevis oocytes. XendoU is a novel endoribonuclease in that it requires Mn2+ ions and produces 2'-3'-cyclic phosphate termini. Such ends have been previously associated solely with metal-independent (2, 30) or Mg2+-dependent endoribonucleases (31-33). On the contrary, Mn2+-requiring endonucleases usually produce 5'-P and 3'-OH ends (34, 35). The chemistry of cleavage of XendoU strongly resembles that of ribozymes, where the metal, positioned near the attacking 2'-oxygen, increases its nucleophilicity and allows the transesterification reaction with the production of cyclic 3' ends (36). Until structural data are available, it will not be possible to assess the role of Mn2+ in the catalytic activity of XendoU. A clear example that metal ions can have a direct role in phosphoryl-transfer reactions in the context of metallo-proteins was derived from the crystal structure of the DNA polymerase I, 3'-5'-exonuclease domain, complexed with single-stranded DNA. In this case, two metal ions form complexes with the scissible phosphate and water, facilitating formation of the attacking hydroxide ion and stabilizing the transition state (37, 38). The role of the protein component would be exclusively to correctly orient the metal ions, the substrate, and the attacking water molecule. By analogy, it could be possible that in the case of XendoU, Mn2+ might participate directly in the catalytic step, whereas the protein component may assist the reaction by orienting the ions to specific sites on the substrate. The availability of the active recombinant protein will allow us to answer this question in the near future.

Characterization of XendoU activity indicated that it does not have a stringent sequence specificity in that only two U-residues are sufficient for cleavage. Nevertheless, preferential cleavages occur at specific U-stretches localized upstream and downstream to U16 snoRNA. At prolonged incubations the other U-rich regions are also cleaved, converting the primary products into small-sized RNA species. Because sno RNAs, and in particular U16, have been described to be folded in specific secondary structures characterized by the conserved terminal core motif (16, 26, 39) and, in many cases, by an apical stem-loop region (27, 28), we asked whether these elements could provide some structural information for directing the preferential activity of the enzyme. Instead, we have observed that these structural motifs of U16 are not required for positioning XendoU cleavage. This is analogous to the case of RNase E in which McDowall et al. (25) have described that stem-loops do not serve as entry sites for the enzyme, but instead they limit cleavage at potentially susceptible sites more accessible than others to the nuclease.

It is possible to suggest that in vivo specific RNA/protein interactions should control the accessibility of the nuclease only to the specific sites on the pre-mRNA. hnRNP C was previously shown (40) to interact in vivo with the U-stretches, which are XendoU substrates and to interfere with cleavage. It is possible to imagine that the hnRNP C, deposited on the nascent RNA during transcription, can be displaced at specific locations and under specific circumstances. An attractive hypothesis is that the assembly of snoRNP factors on the nascent snoRNA could displace hnRNP C from the flanking regions and help the recruitment of XendoU, allowing site-specific cleavage and release of the snoRNA. This would be similar to what is demonstrated in the yeast system where the endonucleolytic release of U18 snoRNA from its host intron depends on assembly of snoRNPs, which in turn recruit the Rnt1p endoribonuclease (13).

The antagonistic effect of hnRNP C and XendoU can represent the basis for the post-transcriptional regulation of the U16 snoRNA processing. In analogy with Rnt1p, which is involved in the maturation of different RNA molecules (pre-rRNA, snRNAs, and snoRNAs) it is possible that XendoU is required for many other processes of RNA maturation or turnover. So far, we do not know whether XendoU is also present in the cytoplasm and whether it plays any role in this compartment. Data base search for XendoU homologs identified significant homology (38% identity and 55% similarity) only with a human putative serine protease (41), which, in turn, has homologs in Caenorhabditis elegans, Arabidopsis thaliana, and Mus musculus.

    ACKNOWLEDGEMENTS

We thank Massimo Arceci for skillful technical help.

    FOOTNOTES

* This work was supported in part by grants from Ministero dell'Università e delle Ricerca Scientifica e Tecnologica (Biotechnology Program L.95/95, Biotecnologie, Programmi di Ricerca di Interesse Nazionale 40%, and Centro di Eccellenza Biologia e Medicina Molecolare) and from Consiglio Nazionale delle Ricerche (Target Project on Biotechnology and Tecnologie di Base della Post-genomica).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AJ507315.

** To whom correspondence should be addressed: Inst. of Molecular Biology and Pathology, c/o Department of Genetics and Molecular Biology, University "La Sapienza" P. le Aldo Moro 5, 00185 Rome, Italy. Tel.: 39-06-4991-2217; Fax: 39-06-4991-2500; E-mail: elisa.caffarelli@uniroma1.it.

Published, JBC Papers in Press, February 5, 2003, DOI 10.1074/jbc.M211937200

    ABBREVIATIONS

The abbreviations used are: snRNA, small nuclear RNA; snoRNA, small nucleolar RNA; snoRNP, small nucleolar ribonucleoprotein particle; hnRNP, heterogeneous nuclear RNP; ONE, oocyte nuclear extracts; ORF, open reading frame; HPLC, high pressure liquid chromatography; MALDI, matrix-assisted laser desorption/ionization-time of flight.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Schoenberg, D. R., and Chernokalskaya, E. (1997) in mRNA Metabolism and Postiptional Gene Regulation (Harford, J. , and Morris, D. R., eds) , pp. 217-240, Wiley, New York
2. Deutscher, M. P. (1993) J. Biol. Chem. 268, 13011-13014[Free Full Text]
3. Nashimoto, M. (1995) Nucleic Acids Res. 23, 3642-3647[Abstract/Free Full Text]
4. Lygerou, Z., Allmang, C., Tollervey, D., and Séraphin, B. (1996) Science 272, 268-270[Abstract]
5. Trotta, C. R., Miao, F., Arn, E. A., Stevens, S. W., Ho, C. K., Rauhut, R., and Abelson, J. (1997) Cell 89, 849-858[CrossRef][Medline] [Order article via Infotrieve]
6. Bujnicki, J. M., and Rychlewski, L. (2000) FEBS Lett. 486, 328-329[CrossRef][Medline] [Order article via Infotrieve]
7. Zamore, P. D. (2001) Molecular Cell 8, 1158-1160[CrossRef][Medline] [Order article via Infotrieve]
8. Elela, S. A., Igel, H., and Ares, M., Jr. (1996) Cell 85, 115-124[CrossRef][Medline] [Order article via Infotrieve]
9. Kufel, J., Dichtl, B., and Tollervey, D. (1999) RNA 5, 909-917[Abstract]
10. Chanfreau, G., Elela, S. A., Ares, M., Jr., and Guthrie, C. (1997) Genes Dev. 11, 2741-2751[Abstract/Free Full Text]
11. Allmang, C., Kufel, J., Chanfreau, G., Mitchell, P., Petfalski, E., and Tollervey, D. (1999) EMBO J. 18, 5399-5410[CrossRef][Medline] [Order article via Infotrieve]
12. Chanfreau, G., Legrain, P., and Jacquier, A. (1998) J. Mol. Biol. 284, 975-988[CrossRef][Medline] [Order article via Infotrieve]
13. Giorgi, C., Fatica, A., Nagel, R., and Bozzoni, I. (2001) EMBO J. 20, 6856-6865[CrossRef][Medline] [Order article via Infotrieve]
14. Ambros, V. (2001) Science 293, 811-813[Free Full Text]
15. Weinstein, L. B., and Steitz, J. A. (1999) Curr. Opin. Cell Biol. 11, 378-384[CrossRef][Medline] [Order article via Infotrieve]
16. Bachellerie, J. P., Cavaillé, J., and Qu, L. H. (2000) in The Ribosome: Structure, Function, Antibiotics and Cellular Interactions (Garret, R. A. , Douthwaite, S. R. , Liljas, A. , Matheson, T. , Moore, P. B. , and Noller, H. F., eds) , pp. 191-203, ASM Press, Washington, D. C.
17. Caffarelli, E., Arese, M., Santoro, B., Fragapane, P., and Bozzoni, I. (1994) Mol. Cell. Biol. 14, 2966-2974[Abstract/Free Full Text]
18. Filippini, D., Renzi, F., Bozzoni, I., and Caffarelli, E. (2001) Biochem. Biophys. Res. Commun. 288, 16-21[CrossRef][Medline] [Order article via Infotrieve]
19. Caffarelli, E., Maggi, L., Fatica, A., Jiricny, J., and Bozzoni, I. (1997) Biochem. Biophys. Res. Commun. 233, 514-517[CrossRef][Medline] [Order article via Infotrieve]
20. Allegrini, S., Scaloni, A., Ferrara, L., Pesi, R., Pinna, P., Camici, M., Eriksson, S., and Tozzi, M. G. (2001) J. Biol. Chem. 276, 33526-33532[Abstract/Free Full Text]
21. Caffarelli, E., Fatica, A., Prislei, S., De Gregorio, E., Fragapane, P., and Bozzoni, I. (1996) EMBO J. 5, 1121-1131
22. Caffarelli, E., Losito, M., Giorgi, C., Fatica, A., and Bozzoni, I. (1998) Mol. Cell. Biol. 2, 1023-1028
23. Forster, A. C., Davies, C., Hutchins, C. J., and Symons, R. H. (1990) Methods Enzymol. 181, 583-607[Medline] [Order article via Infotrieve]
24. Pan, T., and Uhlenbeck, O. C. (1992) Biochemistry 31, 3887-3895[CrossRef][Medline] [Order article via Infotrieve]
25. McDowall, K. J., Kaberdin, V. R., Wu, S. W., Cohen, S. N., and Lin-Chao, S. (1995) Nature (London) 374, 287-290[CrossRef][Medline] [Order article via Infotrieve]
26. Watkins, N. J., Segault, V., Charpentier, B., Nottrott, S., Fabrizio, P., Bachi, A., Wilm, M., Rosbash, M., Branlant, C., and Luhrmann, R. (2000) Cell 103, 457-466[CrossRef][Medline] [Order article via Infotrieve]
27. Tycowski, K. T., Shu, M. D., and Steitz, J. A. (1993) Genes Dev. 7, 1176-1190[Abstract/Free Full Text]
28. Nicoloso, M., Caizergues-Ferrer, M., Michot, B., Azum, M. C., and Bachellerie, J. P. (1994) Mol. Cell. Biol. 14, 5766-5776[Abstract/Free Full Text]
29. Lund, E., and Dahlberg, J. E. (1992) Science 255, 327-330[Abstract/Free Full Text]
30. Deutscher, M. P. (1985) Cell 40, 731-732[CrossRef][Medline] [Order article via Infotrieve]
31. Bachmann, M., Messer, R., Trautmann, F., and Muller, W. E. G. (1984) Biochim. Biophys. Acta 783, 89-99[Medline] [Order article via Infotrieve]
32. Gandini-Attardi, D., Margarit, I., and Tocchini-Valentini, G. P. (1985) EMBO J. 4, 3289-3297[Medline] [Order article via Infotrieve]
33. Rauhut, R., Green, P. R., and Abelson, J. (1990) J. Biol. Chem. 265, 18180-18184[Abstract/Free Full Text]
34. Cirino, N. M., Cameron, C. E., Smith, J. S., Rausch, J. W., Roth, M. J., Benkovic, S. J., and Le Grice, S. F. (1995) Biochemistry 34, 9936-9943[CrossRef][Medline] [Order article via Infotrieve]
35. Eder, P. S., and Walder, J. A. (1991) J. Biol. Chem. 266, 6472-6479[Abstract/Free Full Text]
36. Pan, T., Long, D. M., and Uhlenbeck, O. C. (1993) in The RNA World (Gesteland, R. F. , and Atkins, J. F., eds) , pp. 271-302, CSHL Press, New York
37. Freemont, P. S., Friedman, J. M., Beese, L. S., Sanderson, M. R., and Steitz, T. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8924-8928[Abstract/Free Full Text]
38. Steitz, J. A., and Steitz, T. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6498-6502[Abstract/Free Full Text]
39. Prislei, S., Sperandio, S., Fragapane, P., Caffarelli, E., Presutti, C., and Bozzoni, I. (1992) Nucleic Acids Res. 17, 4473-4479
40. Santoro, B., De Gregorio, E., Caffarelli, E., and Bozzoni, I. (1994) Mol. Cell. Biol. 14, 6975-6982[Abstract/Free Full Text]
41. Grundmann, U., Romisch, J., Siebold, B., Bohn, H., and Amann, E. (1990) DNA Cell Biol. 9, 243-250[Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
J. S. Joseph, K. S. Saikatendu, V. Subramanian, B. W. Neuman, M. J. Buchmeier, R. C. Stevens, and P. Kuhn
Crystal Structure of a Monomeric Form of Severe Acute Respiratory Syndrome Coronavirus Endonuclease nsp15 Suggests a Role for Hexamerization as an Allosteric Switch
J. Virol., June 15, 2007; 81(12): 6700 - 6708.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
S. Vincenti, V. De Chiara, I. Bozzoni, and C. Presutti
The position of yeast snoRNA-coding regions within host introns is essential for their biosynthesis and for efficient splicing of the host pre-mRNA
RNA, January 1, 2007; 13(1): 138 - 150.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Renzi, E. Caffarelli, P. Laneve, I. Bozzoni, M. Brunori, and B. Vallone
The structure of the endoribonuclease XendoU: From small nucleolar RNA processing to severe acute respiratory syndrome coronavirus replication
PNAS, August 15, 2006; 103(33): 12365 - 12370.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Ricagno, M.-P. Egloff, R. Ulferts, B. Coutard, D. Nurizzo, V. Campanacci, C. Cambillau, J. Ziebuhr, and B. Canard
Crystal structure and mechanistic determinants of SARS coronavirus nonstructural protein 15 define an endoribonuclease family
PNAS, August 8, 2006; 103(32): 11892 - 11897.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
X. Xu, Y. Zhai, F. Sun, Z. Lou, D. Su, Y. Xu, R. Zhang, A. Joachimiak, X. C. Zhang, M. Bartlam, et al.
New Antiviral Target Revealed by the Hexameric Structure of Mouse Hepatitis Virus Nonstructural Protein nsp15.
J. Virol., August 1, 2006; 80(16): 7909 - 7917.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Richard, A. M. Kiss, X. Darzacq, and T. Kiss
Cotranscriptional Recognition of Human Intronic Box H/ACA snoRNAs Occurs in a Splicing-Independent Manner.
Mol. Cell. Biol., April 1, 2006; 26(7): 2540 - 2549.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Saladino, C. Crestini, F. Ciciriello, E. Di Mauro, and G. Costanzo
Origin of Informational Polymers: DIFFERENTIAL STABILITY OF PHOSPHOESTER BONDS IN RIBOMONOMERS AND RIBOOLIGOMERS
J. Biol. Chem., March 3, 2006; 281(9): 5790 - 5796.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. C. Posthuma, D. D. Nedialkova, J. C. Zevenhoven-Dobbe, J. H. Blokhuis, A. E. Gorbalenya, and E. J. Snijder
Site-Directed Mutagenesis of the Nidovirus Replicative Endoribonuclease NendoU Exerts Pleiotropic Effects on the Arterivirus Life Cycle
J. Virol., February 15, 2006; 80(4): 1653 - 1661.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. Gioia, P. Laneve, M. Dlakic, M. Arceci, I. Bozzoni, and E. Caffarelli
Functional Characterization of XendoU, the Endoribonuclease Involved in Small Nucleolar RNA Biosynthesis
J. Biol. Chem., May 13, 2005; 280(19): 18996 - 19002.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Bhardwaj, L. Guarino, and C. C. Kao
The Severe Acute Respiratory Syndrome Coronavirus Nsp15 Protein Is an Endoribonuclease That Prefers Manganese as a Cofactor
J. Virol., November 15, 2004; 78(22): 12218 - 12224.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. A. Ivanov, T. Hertzig, M. Rozanov, S. Bayer, V. Thiel, A. E. Gorbalenya, and J. Ziebuhr
Major genetic marker of nidoviruses encodes a replicative endoribonuclease
PNAS, August 24, 2004; 101(34): 12694 - 12699.
[Abstract] [Full Text] [PDF]