![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 15, 13026-13032, April 11, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
,
, and
**
From the
Institute Pasteur Fondazione
Cenci-Bolognetti, Department of Genetics and Molecular Biology,
University "La Sapienza" Piazzale Aldo Moro 5, 00185 Rome, Italy,
the § Department of Biochemistry, University "La
Sapienza," 00185 Rome, Italy, ¶ Proteomics and Mass Spectrometry
Laboratory, Institute for Animal Production System in Mediterranean
Environment, National Research Council, 80147 Naples, Italy, and
the
Institute of Molecular Biology and Pathology, National
Research Council, 00185 Rome, Italy
Received for publication, November 22, 2002, and in revised form, February 3, 2003
| |
ABSTRACT |
|---|
|
|
|---|
Here we report the purification, from
Xenopus laevis oocyte nuclear extracts, of a
new endoribonuclease, XendoU, that is involved in the processing of the
intron-encoded box C/D U16 small nucleolar RNA (snoRNA) from its host
pre-mRNA. Such an activity has never been reported before and has
several uncommon features that make it quite a novel enzyme: it is
poly(U)-specific, it requires Mn2+ ions, and it produces
molecules with 2'-3'-cyclic phosphate termini. Even if XendoU cleaves
U-stretches, it displays some preferential cleavage on snoRNA precursor
molecules. XendoU also participates in the biosynthesis of
another intron-encoded snoRNA, U86, which is contained in the
NOP56 gene of Xenopus laevis. A common feature of
these snoRNAs is that their production is alternative to that of the
mRNA, suggesting an important regulatory role for all the factors involved in the processing reaction.
Endoribonucleases play essential roles in RNA metabolism
participating both in degradative pathways, such as mRNA
decay, and in maturative pathways, to generate functional RNA molecules
(1, 2). Despite the plethora of functions played by processing enzymes
in RNA metabolism, in eukaryotes only a few endoribonucleases have been
isolated to date. Most of these activities are involved in the
biosynthesis of translation components. In particular, RNase P and
RNase mitochondrial RNA processing are ribonucleoprotein enzymes, functioning as site-specific endoribonucleases (3, 4). Other
well characterized endonucleolytic activities, such as the 3'-tRNase,
the tRNA splicing endonuclease, and members of the RNase III-like
family are protein-only enzymes (5-7). Although the majority of these
activities participate in the biosynthesis of a specific class of RNA
molecules, RNase III was shown to be required for a large number of
different maturative pathways. Saccharomyces cerevisiae
RNase III (Rnt1p) was shown to be involved in pre-rRNA, small nuclear
RNA (snRNA),1 and small
nucleolar RNA (snoRNA) processing (8-12). Recently, Rnt1p was also
shown to participate in processing the intron-encoded snoRNAs U18 and
snR38 from their host pre-mRNA (13). Furthermore, a new member of
the metazoan RNase III family has been identified to be involved in the
RNA interference process (14).
Another process in which the participation of endoribonucleases was
expected to play an important role is the biosynthesis of snoRNAs.
These RNAs are part of a complex class of molecules that are localized
in the nucleolus where they participate, as small ribonucleoprotein
particles (snoRNPs), in different rRNA maturative events such as
processing and nucleotide modifications (15, 16). Most snoRNAs
in vertebrates are encoded in introns of protein-coding genes and are
released from the host primary transcript either by debranching and
exo-trimming of the spliced lariat (splicing-dependent
pathway) or by endonucleolytic cleavage of the pre-mRNA
(splicing-independent pathway) (15, 16). There are only a few cases of
intron-encoded snoRNAs in vertebrates, which are released through the
intervention of endoribonucleases (17, 18), but so far these activities
have not been purified and characterized. We previously showed, by
microinjection experiments in X. laevis oocytes, that
precursors containing U16 and U86 snoRNAs undergo very little splicing,
whereas they efficiently produce snoRNAs through a processing pathway,
involving specific endonucleolytic cleavages inside the intron (17,
18). The common feature of U16 and U86 snoRNAs is their localization in
introns, which are poor splicing substrates, due to the presence of
non-canonical consensus sequences.
We previously reported the identification in oocyte nuclear
extracts (ONE) of an endoribonucleolytic activity, named XendoU (19), that produced the release of U16 snoRNA from its host intron by
cleaving at the same sites identified in vivo (17). The same
activity was described to operate also for the processing of U86 snoRNA
(Ref. 18 and this study).
From massive preparations of X. laevis ONE, we purified to
homogeneity the XendoU endoribonuclease and characterized its activity. Partial protein sequencing enabled us to clone a XendoU cDNA, to
express it, and to perform a functional characterization of this
enzyme. Several aspects of XendoU make this protein a novel enzyme,
different from all known endoribonucleases characterized so far in the
following ways: i) it is poly(U)-specific, ii) its activity depends on
Mn2+ ions, and iii) it releases cleavage products with
2'-3'-cyclic phosphate termini.
Purification of XendoU Activity--
The X. laevis
oocyte nuclear extracts were prepared as previously described
(17). The pellet obtained after two sequential ammonium sulfate
precipitations (45 and 70% saturation) was dissolved in buffer A (25 mM Hepes, 50 mM NaCl, 0.1 mM EDTA,
1 mM dithiothreitol, 10% glycerol, pH 7.5) and
applied onto an hydroxyapatite column (CHT-II Econocolumn, Bio-Rad).
Elution was carried out with 100 mM Na-phosphate, pH 7, in
buffer A. The active fractions were diluted with 3 volumes of buffer A
and applied on a Blue-Sepharose column (Blue-Sepharose Fast Flow,
Amersham Biosciences). Elution was performed with 0.2 M NaCl in buffer A, and fractions containing XendoU
activity were pooled and dialyzed against buffer A. The protein mixture
was subjected to a second fractionation on hydroxyapatite column. The
elution was performed with 10-column volumes of a linear gradient
0-100 mM Na-phosphate, pH 7, in buffer A. Selected fractions were then applied on a gel-filtration column (Amersham Biosciences) previously equilibrated in buffer A. By this
procedure, starting from 15 ml of ONE (7 mg/ml), we obtained sufficient
amounts for protein sequencing analysis (~70 µg).
Preparation and Isolation of Tryptic Peptides--
The protein
band from SDS-PAGE (5 µg) stained with Coomassie Blue R250 was
excised, reduced with dithiothreitol, and carboxamidomethylated. The
gel piece was equilibrated in 25 mM
NH4HCO3, pH 8, and finally digested in
situ with trypsin at 37 °C for 18 h. Peptides were extracted by sonication with 100 µl of 25 mM
NH4HCO3/acetonitrile 1:1 v/v, pH 8 (twice). The
peptide mixture was fractionated by reverse-phase HPLC on a Vydac
C18 column 218TP52 (250 × 1 mm), 5 µm, 300 Å pore
size (The Separation Group) by using a linear gradient from 5 to 60%
of acetonitrile in 0.1% trifluoroacetic acid over 60 min at a
flow rate of 90 µl/min. Individual components were manually collected
and lyophilized.
Peptide Sequencing and Mass Spectrometry Analysis--
Sequence
analysis was performed using a Procise 491 protein sequencer (Applied
Biosystems) equipped with a 140C microgradient apparatus and a 785A UV
detector (Applied Biosystems) for the automated identification of
phenylthiohydantoin-derivatives, as previously described
(20).
Matrix-assisted laser desorption ionization mass spectra were recorded
using a Voyager DE-PRO mass spectrometer (Applied Biosystems), as
previously reported (20); a mixture of analyte solution, Plasmids and Templates for RNA Transcription--
U16- and
U86-containing precursors were previously described (17, 18). The
following U16-containing mutant derivatives were obtained by inverse
PCR on plasmid 003 (17) with the oligonucleotides indicated in
parentheses: pre-open stem (open stem fw and open stem rev),
pre-Ms1 (Ms1a and Ms1b), and pre- Oligonucleotides--
The following oligonucleotides were used
for obtaining the templates for in vitro transcription: open
stem fw, GTAATTTGCGTCCTACTCTAC; open stem rev,
GACATCATATTTTGTAAAAAAAGCAC; Ms1a, ATTACGACATCATAGCAAGTA; Ms1b,
TATCGCGTTCTGAGCAAAAAA; 003 int fw, CTTGGATAAGTTTAGAATATATTAATA; 003 int
rev, GTAAAAAAAGCACAAATCTAAATC; In Vitro Processing Reactions of Wild Type and Mutant Derivative
RNAs--
U16 and U86-containing precursors (17, 18) were in
vitro-transcribed in the presence of [
Oligoribonucleotides P1 (5'-GGAAACGUAUCCUUUGGGAG-3'), P2
(5'-GGAAACGUAUCCUUGGGAGG-3'), and P3 (5'-GGAAACGUAUCCUCUGGGAG-3') were
5' end-labeled and incubated in the same conditions as above. Double-stranded P2 was obtained by incubating labeled P2 oligo with its
reverse complementary oligo, in a molar ratio of 1:2 for 1 h at
37 °C in 100 mM KOAc, pH 7.5, 30 mM Hepes
KOH, pH 7.4, and 2 mM Mg(OAc)2. Double-stranded
formation was controlled on a native gel. The RNA ladder was obtained
by incubation of P1 oligo (200,000 cpm) in 500 mM
NaHCO3 at 90 °C for 20 min.
Analysis of 3' Termini of Cleavage Products--
This analysis
was performed by two different approaches. In the first one,
32P-labeled gel-purified I-1b molecules, generated by
incubation of U16-containing precursor with ONE, with purified XendoU,
or in vivo, were treated with 10 µl of 10 mM
HCl at 25 °C for 2 h to hydrolyze the cyclic phosphate moiety
as described by Forster et al. (23). The phosphate
was then removed by incubation of the RNA in 50 mM
Tris-HCl, 0.1 mM EDTA, pH 8.5, in the presence of 1 unit of
calf intestine alkaline phosphatase at 50 °C for 60 min. RNA was
subjected to two subsequent purification steps with phenol/chloroform,
ethanol precipitated, and analyzed on 10% polyacrylamide, 7 M urea gel. In the second approach, the I-1b molecule,
obtained by incubation with purified XendoU, was gel-eluted and
redissolved in 30 mM Tris, pH 8.0, 15 mM
MgCl2, and 1.5 units/µl T4 polynucleotide kinase, and the
mixture was incubated for 45 min at 37 °C to remove the 2'-3'-cyclic
phosphate (24). RNA was then extracted and labeled using
[5'-32P]pCp and T4 RNA ligase for 5 h at
16 °C. RNA was then analyzed on 6% polyacrylamide, 7 M
urea gel.
Isolation of XendoU cDNA and its Expression in Reticulocyte
Lysate and in Bacteria--
A X. laevis stage 28 embryo
cDNA library, constructed in Primer Extension Analysis--
The I-2 and I-4 products, derived
from U16 processing, were gel-purified and reverse-transcribed with 5'
end-labeled oligonucleotides B3 (5'-TACGTCCACCACGACACAT-3') and Purification of XendoU from X. laevis Oocyte Nuclear
Extracts--
We previously developed an in vitro system
able to reproduce the in vivo processing of U16 snoRNA from
its host intron (17). When 32P-labeled U16-containing
precursor was incubated with X. laevis ONE, specific
endonucleolytic products were obtained (Fig.
1B). The I-1 and I-2 molecules
derive from cleavage upstream to the U16 coding region, whereas the I-3
and I-4 molecules are produced by cleavage downstream to U16. When
double cleavage occurs on the same precursor molecule, pre-U16 products
accumulate; these intermediates are eventually converted by
exo-trimming to the mature snoRNA (see Fig. 1A). The
cleavage sites were previously mapped in correspondence of short
U-stretches. Four of them are clustered upstream to U16 and one is
located downstream. This cleaving activity was named XendoU (19).
In this work we carried out the biochemical purification of XendoU
(Fig. 1D). The enzymatic activity was followed, throughout the different steps, by incubating 32P-labeled
U16-containing precursor with aliquots of the different fractions and
by analyzing the cleavage products on polyacrylamide gels. Because we
previously observed the dependence of XendoU activity on
Mn2+ ions (19), this cofactor was always added to the
reaction mixture. The protein content of the active fractions is shown
in Fig. 1E. After several chromatographic steps, a single
component of 37 kDa was identified in those fractions displaying
specific activity (Fig. 1E, lane 6). The elution
profile on the gel filtration chromatography was consistent with
XendoU being a monomeric protein (not shown). Fig. 1B
shows the comparison of processing activity of 1 µg of ONE (ONE
lanes) with that of 1 ng of the purified 37-kDa polypeptide (XendoU lanes). In both cases, the same primary cleavage
products (I-2 and I-3), their complementary cut-off molecules (I-1 and I-4), and pre-U16 molecules were generated.
Characterization of XendoU Cleavage--
To analyze the
specificity of cleavage of the purified enzyme, primer extension
analysis was performed on gel-purified I-2 and I-4 products (Fig.
1C). The results indicate that, at short incubation times,
XendoU cleaves intronic sequences at the same U-rich regions previously
identified in vivo and in extracts (17). Four I-2 molecules
are generated by cleavages at the a, b, c, and d sites, whereas two I-4
molecules are produced by cleavage at two adjacent U residues, 14 nucleotides downstream to U16 (see representation of Fig.
1A). From the reverse transcriptase experiment it appears
that the a and b sites are preferentially utilized in the upstream
cleavage. As a consequence two major I-1 molecules (a and b) are
identified (see gels of Figs. 1 and 4).
Efficient cleavage with the purified enzyme was obtained only when
Mn2+ ions were present in the reaction (Fig. 1B,
lane 7). It is remarkable that the addition of
Mn2+ ions in the in vitro assay is required for
the purified protein and for all the fractions obtained after the
blue-Sepharose step. This finding, along with the requirement of
Mn2+ supply when aged oocyte extracts are utilized (not
shown), is consistent with a loosely bound metal ion in the protein
moiety. The purified enzyme is poorly activated by Mg2+,
whereas it is inactive in the presence of Cd2+,
Zn2+, Ni2+, Co2+, and
Pb2+ (not shown).
The time course of Fig. 1B shows that the purified enzyme
cleaves preferentially at specific sites. Nevertheless, at longer incubations also the primary cleavage products become substrates for
further digestion, producing small-sized RNAs only visible on short run
gels (not shown). The substrate specificity of XendoU was then tested
by incubating the purifed enzyme with a synthetic oligoribonucleotide
(P1), containing the upstream distal XendoU cleavage site (site d, Fig.
1A), and with mutated derivatives thereof (P2 and P3). The
results indicate that the sequence specificity of XendoU is limited to
U-stretches and that only two U residues are sufficient for cleavage
(Fig. 2A). Incubation of
XendoU with the P2 oligo in a double-stranded configuration did not
produce any cleavage (lane dsP2), indicating that the enzyme
is unable to cleave U-stretches present in double-stranded
structures.
From these data it appears that, despite the presence of several
U-stretches in the U16-host intron upstream and downstream to the
snoRNA, specific sites are preferentially cleaved by XendoU. This is
similar to what is described for the bacterial RNase E endonuclease,
which, even if it has a low primary sequence specificity, cleaves the
substrate only at a limited number of sites. In this case, it
was shown that the overall secondary structure of the substrate
modulated cleavage activity and that the role of stem-loop structures
was to limit rather than promote RNase E cleavages (25). Because sno
RNAs are folded in specific secondary structures characterized by the
conserved terminal core motif (see wild type RNA in lower
part of Fig. 2B) (16, 26) and, in many cases, by an
apical stem-loop region (27, 28), we asked whether these structural
elements could influence XendoU activity. Mutants affecting either
structure were raised on precursor molecules and tested for XendoU
cleavage. The terminal core motif was destroyed in the pre-open stem
and pre- Characterization of the Reaction Products--
The chemistry of
XendoU cleavage was assessed by determining the chemical nature of the
termini in the cleaved products. The ends of 32P-labeled
I-1b molecules produced with ONE or with the purified XendoU were
analyzed. These molecules were gel-purified and treated either with HCl
or alkaline phosphatase or with both. Fig. 2C shows that a
slight decrease in migration, due to the loss of a negative charge, is
obtained only when the alkaline phosphatase follows the HCl treatment
(lane 3). These data allowed us to conclude that the 3' end
of the cleavage products, obtained with ONE (ONE lanes) and
with the purified XendoU (XendoU lanes), carry a
2'-3'-cyclic phosphate (23, 29). In fact, only after the acid treatment the phosphate group can be removed by phosphatase, such as to confer
slight decrease in gel mobility. As previously reported (21), the
products of primary cleavage such as I-1 molecules are quite unstable
in vivo because, after cleavage, they are rapidly trimmed
out. Nevertheless, at very short incubation times we were able to
purify small amounts of I-1b molecules and to subject them to
the same treatment described above. Fig. 2C (in vivo
lanes) shows that a slight reduction in migration was obtained,
demonstrating that the products of the in vivo reaction also
have 2'-3'-cyclic phosphate ends. The nature of the 3' ends was also
tested by a different approach (24). The I-1b molecule, generated by
XendoU cleavage, was ligated to [5'-32P]pCp directly or
after kinase treatment, which removes the 2'-3'-cyclic phosphate. The
appearance of a radioactive band only after kinase treatment
(lane 3 of Fig. 2D) confirms that this molecule
has 2'-3'-cyclic phosphate.
Isolation of a XendoU cDNA--
After elution from the gel,
the 37-kDa polypeptide was reduced, alkylated, and digested with
trypsin as reported under "Experimental Procedures." The resulting
peptide mixture was resolved by reversed-phase HPLC, and selected
peptide fractions were submitted to automated Edman degradation. Three
tryptic peptides (indicated as #1, #2, and
#3 in Fig. 3) were utilized to
derive degenerate oligonucleotides. These were employed, in different
combinations, in PCR amplification reactions on cDNA from
poly(A)+ RNA extracted from X. laevis oocytes.
Only the reaction performed with sequence #1 (forward) and sequence #3
(reverse) gave a specific amplification product of 500 nucleotides.
Sequencing of this product indicated the presence of an open reading
frame containing peptide #2. This cDNA probe was then utilized for
screening a X. laevis stage 28 embryo cDNA library,
allowing the isolation of a full-length cDNA (Fig. 3). 65% of the
amino acid sequence determined was confirmed by MALDI-mass spectrometry
spectra of the tryptic peptides.
Activity of in Vitro-translated and Recombinant XendoU--
The
XendoU ORF, 876-bp-long, was cloned into the Blue Script vector and the
protein was produced by in vitro transcription and
translation using a reticulocyte lysate. The translation product was
analyzed on SDS-PAGE and resulted in a 37-kDa protein (Fig. 4A). To assess the activity of
this polypeptide, the reticulocyte lysate expressing the XendoU ORF was
incubated with 32P-labeled U16-containing precursor. Fig.
4B shows that the cleavage pattern produced by the in
vitro-translated 37 kDa protein (lane 2) matches that
obtained with the extracts (lane 1). Furthermore, the lack
of cleavage when Mn2+ ions were not added to the reaction
mixture (lane 3) confirms the specific ion requirement of
XendoU and suggests that the binding to this cofactor is reversible. As
a negative control, the activity assay was carried out by incubating
the RNA substrate with an uncommitted reticulocyte lysate in the
presence of Mn2+ ions (lane 4). Fig. 4 also
shows that a His6-XendoU recombinant protein expressed in
bacteria is able to reproduce the cleavage pattern of the purified
enzyme (lane 5).
XendoU also Participates in the Biosynthesis of Another
Intron-encoded snoRNA--
We previously identified a novel box C/D
snoRNA, named U86, which is encoded by an intron of the NOP56 gene of
X. laevis (18). Similarly to U16 snoRNA, U86 is also
contained in a poorly spliceable intron and its biosynthesis appears to
be alternative to that of the co-transcribed mRNA. Injection of
32P-labeled U86-containing precursor into X. laevis oocytes generates the truncated products I-2 and I-3 and
their 5' and 3' cut-off molecules, I-1 and I-4 (Fig.
5A, in vivo
lanes).
Processing of U86-containing precursor with purified XendoU
(Fig. 5A, XendoU lanes) or with the reticulocyte
lysate expressing XendoU ORF (Fig. 5C, lane 2)
demonstrates that the enzyme is responsible for the cleavage occurring
downstream to the U86 coding region. The activity responsible for the
cleavage upstream to U86, which produces I-2 and I-1 molecules, is
still unidentified and it is not also reproduced in oocyte nuclear
extracts (Fig. 5A, ONE lanes). The XendoU
cleavage sites, downstream to U86, were mapped by primer extension on
I-4 molecules and found to localize in correspondence of three U-rich
sequences (Fig. 5B).
In this study we report the purification to homogeneity of XendoU,
an activity previously shown to be involved in the release of the
intron-encoded U16 and U86 snoRNAs from their host primary transcripts
in X.laevis oocytes. XendoU is a novel
endoribonuclease in that it requires Mn2+ ions and produces
2'-3'-cyclic phosphate termini. Such ends have been previously
associated solely with metal-independent (2, 30) or
Mg2+-dependent endoribonucleases (31-33). On
the contrary, Mn2+-requiring endonucleases usually produce
5'-P and 3'-OH ends (34, 35). The chemistry of cleavage of XendoU
strongly resembles that of ribozymes, where the metal, positioned near
the attacking 2'-oxygen, increases its nucleophilicity and allows the
transesterification reaction with the production of cyclic 3' ends
(36). Until structural data are available, it will not be possible to
assess the role of Mn2+ in the catalytic activity of
XendoU. A clear example that metal ions can have a direct role in
phosphoryl-transfer reactions in the context of metallo-proteins was
derived from the crystal structure of the DNA polymerase I,
3'-5'-exonuclease domain, complexed with single-stranded DNA. In this
case, two metal ions form complexes with the scissible phosphate and
water, facilitating formation of the attacking hydroxide ion and
stabilizing the transition state (37, 38). The role of the protein
component would be exclusively to correctly orient the metal ions, the
substrate, and the attacking water molecule. By analogy, it could be
possible that in the case of XendoU, Mn2+ might participate
directly in the catalytic step, whereas the protein component may
assist the reaction by orienting the ions to specific sites on the
substrate. The availability of the active recombinant protein will
allow us to answer this question in the near future.
Characterization of XendoU activity indicated that it does not have a
stringent sequence specificity in that only two U-residues are
sufficient for cleavage. Nevertheless, preferential cleavages occur at
specific U-stretches localized upstream and downstream to U16 snoRNA.
At prolonged incubations the other U-rich regions are also cleaved,
converting the primary products into small-sized RNA species. Because
sno RNAs, and in particular U16, have been described to be folded in
specific secondary structures characterized by the conserved terminal
core motif (16, 26, 39) and, in many cases, by an apical stem-loop
region (27, 28), we asked whether these elements could provide some
structural information for directing the preferential activity of the
enzyme. Instead, we have observed that these structural motifs of U16
are not required for positioning XendoU cleavage. This is analogous to
the case of RNase E in which McDowall et al. (25) have
described that stem-loops do not serve as entry sites for the enzyme,
but instead they limit cleavage at potentially susceptible sites more
accessible than others to the nuclease.
It is possible to suggest that in vivo specific
RNA/protein interactions should control the accessibility of the
nuclease only to the specific sites on the pre-mRNA. hnRNP C
was previously shown (40) to interact in vivo with the
U-stretches, which are XendoU substrates and to interfere with
cleavage. It is possible to imagine that the hnRNP C, deposited on the
nascent RNA during transcription, can be displaced at specific
locations and under specific circumstances. An attractive hypothesis is
that the assembly of snoRNP factors on the nascent snoRNA could
displace hnRNP C from the flanking regions and help the recruitment of
XendoU, allowing site-specific cleavage and release of the snoRNA. This would be similar to what is demonstrated in the yeast system where the
endonucleolytic release of U18 snoRNA from its host intron depends on
assembly of snoRNPs, which in turn recruit the Rnt1p endoribonuclease
(13).
The antagonistic effect of hnRNP C and XendoU can represent the basis
for the post-transcriptional regulation of the U16 snoRNA processing.
In analogy with Rnt1p, which is involved in the maturation of different
RNA molecules (pre-rRNA, snRNAs, and snoRNAs) it is possible that
XendoU is required for many other processes of RNA maturation or
turnover. So far, we do not know whether XendoU is also present in the
cytoplasm and whether it plays any role in this compartment. Data base
search for XendoU homologs identified significant homology (38%
identity and 55% similarity) only with a human putative serine
protease (41), which, in turn, has homologs in
Caenorhabditis elegans, Arabidopsis thaliana, and Mus
musculus.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-cyano-4-hydroxy-cinnamic acid was applied to the sample plate and
dried. Mass calibration was performed using the molecular ions from
peptides produced by trypsin auto-proteolysis and the matrix as
internal standards.
U16 (003 int fw and 003 int
rev). pre-
C/bD mutant was instead derived by inverse PCR on
plasmid 003 bD (21) with oligos
C/bd fw and Ms1
C rev.
C/bd fw, CGTAATTTGCGTCCTACTC; MS1
C rev, AGCAAGTAAAAAAAGCAC.
-32P]UTP,
and pre-mRNAs were injected into nuclei of stage VI oocytes as
previously described (22). Alternatively, 3 × 104 cpm
of 32P-labeled pre-mRNAs were incubated with 1 µg of
ONE (17) or with 1 ng of purified XendoU, in 5 mM
MnCl2, 50 mM NaCl, 25 mM Hepes, pH
7.5, 1 mM dithiothreitol, 10 µg of
Escherichia coli tRNA, 20 units of RNase inhibitor
(Promega). The products of the reactions were then analyzed on 6%
polyacrylamide, 7 M urea gels.
ZAP II vector, was screened using a
specific probe obtained by PCR amplification on X. laevis
cDNA with degenerate oligonucleotides (MAHs
5'-ATGGCICAYGAYTAYYTIGT-3' and IGTa
5'-ACIGGRTAIGCIGTICCIAT-3') designed on tryptic peptides of
purified XendoU. The XendoU ORF was cloned into Blue Script vector and,
[35S]methionine-labeled proteins were produced by
in vitro transcription and translation using the
TNT-coupled Reticulocyte Lysate System kit (Promega).
Translational products were analyzed on 10% SDS-PAGE. The XendoU
coding sequence was also cloned downstream to the His6 coding region of the pQE30 vector (Qiagen). The fusion protein (His6-XendoU) was induced in the E. coli M15 strain.
(5'-TTTTCCTCAGAACGCAAT-3'), respectively. For the I-4 products derived
from U86 processing, oligonucleotide UHindIII
(5'-AAGCTTCTTCATGGCGGCTCGGCCAAT-3') was utilized.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (31K):
[in a new window]
Fig. 1.
Purification and activity assay of
XendoU. A, schematic representation of U16 snoRNA
processing. The U16-containing precursor is indicated by P.
Cleavage upstream to U16 produces the I-1 and I-2 molecules, whereas
cleavage downstream generates the I-3 and I-4 products. Double cleavage
produces pre-U16 molecules. a, b, c,
and d indicate the cleavage sites upstream to U16; the major
sites of cleavage are represented by large arrows.
e and f point to the cleavage sites downstream to
U16. The Cap structure is shown as a black dot,
exons as boxes, the intron as a continuous line,
and U16 snoRNA coding region as a thicker line.
and
B3 indicate the oligonucleotides utilized in primer
extension experiments. B, 32P-labeled
U16-containing precursor was incubated with 1 µg of unfractionated
oocyte nuclear extracts (ONE lanes) or 1 ng of purified
XendoU (XendoU lanes) under standard conditions for 0 min
(lanes 1), 5 min (lanes 2), 15 min (lanes
3), 30 min (lanes 4), 60 min (lanes 5), and
120 min (lanes 6) or without the addition of
Mn2+ for 30 min (lane 7). The specific cleavage
products are indicated on the side. C, unlabeled
I-2 and I-4 molecules obtained after 5 min of incubation with purified
XendoU were gel-eluted and incubated with oligos
and B3,
respectively (see panel A). The products of primer extension
were run in parallel with the sequencing reaction (lanes G,
A, T, and C) performed with the same
oligonucleotides on U16-containing precursor template. The
arrows point to the extended products and letters
on the left side indicate XendoU cleavage sites.
D, XendoU purification scheme. E, proteins from
the active fractions of the different fractionation steps of
panel D were separated on SDS-PAGE and visualized by Blue
Coomassie staining. The arrow points to the purified enzyme
with an apparent molecular mass of 37 kDa.

View larger version (38K):
[in a new window]
Fig. 2.
Analysis of XendoU cleavage.
A, 32P-labeled synthetic oligoriboligonucleotide
P1, containing the distal cleavage site upstream to U16 (site d), its
mutant derivatives (P2 and P3), and a
double-stranded P2 derivative substrate (dsP2), were
incubated under standard conditions for 30 min with the following:
buffer (lanes 1), unfractionated extracts (lanes
2), or purified XendoU (lanes 3). Lane M
reports the ladder generated by alkaline digestion of P1. On the
side, the sequences of the oligoribonucleotides are
reported; arrows indicate the cleavage sites. B,
XendoU processing of U16-containing precursor and of its mutant
derivatives pre-open stem, pre-
C/bD, pre-Ms1, and pre-
U16
(schematized in the lower part of the
panel). 32P-labeled RNAs were incubated
with XendoU under standard conditions for 0 min (lanes 1),
10 min (lanes 2), 20 min (lanes 3), 40 min
(lanes 4), and 60 min (lanes 5). The processing
products are indicated on the sides (see Fig. 1A
for schematic representation). C, 32P-labeled
I-1b molecules, schematically represented on the left side,
obtained with oocyte nuclear extracts (ONE lanes), with
purified XendoU (XendoU lanes), or after injection in
oocytes (in vivo lanes), were gel purified and incubated
with 1 unit of alkaline phosphatase (lanes 1) or with 10 mM HCl (lanes 2) or with alkaline phosphatase
after acid treatment (lanes 3). Untreated molecules were run
as control in lanes 4. D, I-1b molecule obtained
by incubation of unlabeled U16-containing precursor with purified
XendoU was gel purified and subjected to [5'-32P]pCp
labeling directly (lane 2) or after kinase treatment
(lane 3). In lane 1, a labeled marker I-1b
molecule is run.
C/bD mutants, whereas the apical stem-loop structure was
deleted in the pre-Ms1 derivative (see schematic representation of Fig.
2B). The pattern of XendoU cleavage on such mutants (Fig.
2B) was not altered, suggesting that these structures do not
represent entry sites or positioning elements for XendoU. This
conclusion was definitely confirmed by the analysis of pre-
U16, a
mutant completely lacking the snoRNA sequence. XendoU cleaves this RNA
at the same sites as the wild type RNA substrate, as indicated by the
size of the cleavage products (see Fig. 1A for schematic representation).

View larger version (47K):
[in a new window]
Fig. 3.
cDNA and deduced amino acid sequence of
XendoU. 5' and 3' untranslated regions are shown in
lowercase letters whereas the ORF is in capital
letters. Above each codon the deduced amino acid is
shown. The peptides determined by automated Edman degradation (see
under "Experimental Procedures") that were utilized for deriving
the degenerated oligonucleotides are indicated by #1,
#2, and #3. The stop codon is identified by an
asterisk. The amino acid sequences covered by MALDI-mapping
experiments are underlined.

View larger version (42K):
[in a new window]
Fig. 4.
Functional analysis of in
vitro-translated and recombinant XendoU. A,
SDS-PAGE analysis of [35S]methionine-labeled in
vitro transcription and translation products of XendoU cDNA
(lane 2) and of control luciferase (lane 1). The
arrow points to the 37 kDa product. B, the
U16-containing precursor (P) was incubated for 45 min in the
presence of Mn2+ ions with ONE (lane 1), with
the in vitro-translated XendoU (lane 2), or with
an uncommitted reticulocyte lysate (lane 4). The RNA
substrate was also incubated with in vitro-translated XendoU
in the absence of Mn2+ ions (lane 3). In
lane 5 the cleavage pattern obtained with recombinant
His-XendoU is shown.

View larger version (26K):
[in a new window]
Fig. 5.
XendoU is involved in U86 snoRNA
biosynthesis. A, 32P-labeled U86-containing
precursor (P) was injected in X. laevis oocytes
(in vivo lanes), or incubated in vitro with ONE
(ONE lanes), or with purified XendoU (XendoU
lanes). Incubations were allowed to proceed for the following: 0 min (lane 1), 10 min (lanes 2), 45 min
(lanes 3), 3 h (lanes 4), and 16 h
(lanes 5). The processing products are schematically
represented on the side. Arrows indicate the
cleavage sites. B, 32P-labeled
UHindIII primer was reacted with unlabeled, gel-purified I-4
molecules obtained after a 10-min incubation in oocytes (in vivo
lane), 45 min with ONE (ONE lane), or 45 min with
purified XendoU (XendoU lane). The products of primer
extension were run in parallel with the sequencing reaction
(lanes G, A, T, and C)
performed with the same oligonucleotide on U86-containing precursor
template. The cleavage sites are indicated on the corresponding
sequence. C, U86-containing precursor (P) was
incubated for 45 min in the presence of Mn2+ ions with ONE
(lane 1), with in vitro-translated XendoU
(lane 2), or with an uncommitted reticulocyte lysate
(lane 4). As a control, pre-mRNA was incubated with
in vitro-translated XendoU in the absence of
Mn2+ ions (lane 3).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank Massimo Arceci for skillful technical help.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from Ministero dell'Università e delle Ricerca Scientifica e Tecnologica (Biotechnology Program L.95/95, Biotecnologie, Programmi di Ricerca di Interesse Nazionale 40%, and Centro di Eccellenza Biologia e Medicina Molecolare) and from Consiglio Nazionale delle Ricerche (Target Project on Biotechnology and Tecnologie di Base della Post-genomica).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AJ507315.
** To whom correspondence should be addressed: Inst. of Molecular Biology and Pathology, c/o Department of Genetics and Molecular Biology, University "La Sapienza" P. le Aldo Moro 5, 00185 Rome, Italy. Tel.: 39-06-4991-2217; Fax: 39-06-4991-2500; E-mail: elisa.caffarelli@uniroma1.it.
Published, JBC Papers in Press, February 5, 2003, DOI 10.1074/jbc.M211937200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: snRNA, small nuclear RNA; snoRNA, small nucleolar RNA; snoRNP, small nucleolar ribonucleoprotein particle; hnRNP, heterogeneous nuclear RNP; ONE, oocyte nuclear extracts; ORF, open reading frame; HPLC, high pressure liquid chromatography; MALDI, matrix-assisted laser desorption/ionization-time of flight.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Schoenberg, D. R., and Chernokalskaya, E. (1997) in mRNA Metabolism and Postiptional Gene Regulation (Harford, J. , and Morris, D. R., eds) , pp. 217-240, Wiley, New York |
| 2. |
Deutscher, M. P.
(1993)
J. Biol. Chem.
268,
13011-13014 |
| 3. |
Nashimoto, M.
(1995)
Nucleic Acids Res.
23,
3642-3647 |
| 4. | Lygerou, Z., Allmang, C., Tollervey, D., and Séraphin, B. (1996) Science 272, 268-270[Abstract] |
| 5. | Trotta, C. R., Miao, F., Arn, E. A., Stevens, S. W., Ho, C. K., Rauhut, R., and Abelson, J. (1997) Cell 89, 849-858[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Bujnicki, J. M., and Rychlewski, L. (2000) FEBS Lett. 486, 328-329[CrossRef][Medline] [Order article via Infotrieve] |
| 7. | Zamore, P. D. (2001) Molecular Cell 8, 1158-1160[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Elela, S. A., Igel, H., and Ares, M., Jr. (1996) Cell 85, 115-124[CrossRef][Medline] [Order article via Infotrieve] |
| 9. | Kufel, J., Dichtl, B., and Tollervey, D. (1999) RNA 5, 909-917[Abstract] |
| 10. |
Chanfreau, G.,
Elela, S. A.,
Ares, M., Jr.,
and Guthrie, C.
(1997)
Genes Dev.
11,
2741-2751 |
| 11. | Allmang, C., Kufel, J., Chanfreau, G., Mitchell, P., Petfalski, E., and Tollervey, D. (1999) EMBO J. 18, 5399-5410[CrossRef][Medline] [Order article via Infotrieve] |
| 12. | Chanfreau, G., Legrain, P., and Jacquier, A. (1998) J. Mol. Biol. 284, 975-988[CrossRef][Medline] [Order article via Infotrieve] |
| 13. | Giorgi, C., Fatica, A., Nagel, R., and Bozzoni, I. (2001) EMBO J. 20, 6856-6865[CrossRef][Medline] [Order article via Infotrieve] |
| 14. |
Ambros, V.
(2001)
Science
293,
811-813 |
| 15. | Weinstein, L. B., and Steitz, J. A. (1999) Curr. Opin. Cell Biol. 11, 378-384[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Bachellerie, J. P., Cavaillé, J., and Qu, L. H. (2000) in The Ribosome: Structure, Function, Antibiotics and Cellular Interactions (Garret, R. A. , Douthwaite, S. R. , Liljas, A. , Matheson, T. , Moore, P. B. , and Noller, H. F., eds) , pp. 191-203, ASM Press, Washington, D. C. |
| 17. |
Caffarelli, E.,
Arese, M.,
Santoro, B.,
Fragapane, P.,
and Bozzoni, I.
(1994)
Mol. Cell. Biol.
14,
2966-2974 |
| 18. | Filippini, D., Renzi, F., Bozzoni, I., and Caffarelli, E. (2001) Biochem. Biophys. Res. Commun. 288, 16-21[CrossRef][Medline] [Order article via Infotrieve] |
| 19. | Caffarelli, E., Maggi, L., Fatica, A., Jiricny, J., and Bozzoni, I. (1997) Biochem. Biophys. Res. Commun. 233, 514-517[CrossRef][Medline] [Order article via Infotrieve] |
| 20. |
Allegrini, S.,
Scaloni, A.,
Ferrara, L.,
Pesi, R.,
Pinna, P.,
Camici, M.,
Eriksson, S.,
and Tozzi, M. G.
(2001)
J. Biol. Chem.
276,
33526-33532 |
| 21. | Caffarelli, E., Fatica, A., Prislei, S., De Gregorio, E., Fragapane, P., and Bozzoni, I. (1996) EMBO J. 5, 1121-1131 |
| 22. | Caffarelli, E., Losito, M., Giorgi, C., Fatica, A., and Bozzoni, I. (1998) Mol. Cell. Biol. 2, 1023-1028 |
| 23. | Forster, A. C., Davies, C., Hutchins, C. J., and Symons, R. H. (1990) Methods Enzymol. 181, 583-607[Medline] [Order article via Infotrieve] |
| 24. | Pan, T., and Uhlenbeck, O. C. (1992) Biochemistry 31, 3887-3895[CrossRef][Medline] [Order article via Infotrieve] |
| 25. | McDowall, K. J., Kaberdin, V. R., Wu, S. W., Cohen, S. N., and Lin-Chao, S. (1995) Nature (London) 374, 287-290[CrossRef][Medline] [Order article via Infotrieve] |
| 26. | Watkins, N. J., Segault, V., Charpentier, B., Nottrott, S., Fabrizio, P., Bachi, A., Wilm, M., Rosbash, M., Branlant, C., and Luhrmann, R. (2000) Cell 103, 457-466[CrossRef][Medline] [Order article via Infotrieve] |
| 27. |
Tycowski, K. T.,
Shu, M. D.,
and Steitz, J. A.
(1993)
Genes Dev.
7,
1176-1190 |
| 28. |
Nicoloso, M.,
Caizergues-Ferrer, M.,
Michot, B.,
Azum, M. C.,
and Bachellerie, J. P.
(1994)
Mol. Cell. Biol.
14,
5766-5776 |
| 29. |
Lund, E.,
and Dahlberg, J. E.
(1992)
Science
255,
327-330 |
| 30. | Deutscher, M. P. (1985) Cell 40, 731-732[CrossRef][Medline] [Order article via Infotrieve] |
| 31. | Bachmann, M., Messer, R., Trautmann, F., and Muller, W. E. G. (1984) Biochim. Biophys. Acta 783, 89-99[Medline] [Order article via Infotrieve] |
| 32. | Gandini-Attardi, D., Margarit, I., and Tocchini-Valentini, G. P. (1985) EMBO J. 4, 3289-3297[Medline] [Order article via Infotrieve] |
| 33. |
Rauhut, R.,
Green, P. R.,
and Abelson, J.
(1990)
J. Biol. Chem.
265,
18180-18184 |
| 34. | Cirino, N. M., Cameron, C. E., Smith, J. S., Rausch, J. W., Roth, M. J., Benkovic, S. J., and Le Grice, S. F. (1995) Biochemistry 34, 9936-9943[CrossRef][Medline] [Order article via Infotrieve] |
| 35. |
Eder, P. S.,
and Walder, J. A.
(1991)
J. Biol. Chem.
266,
6472-6479 |
| 36. | Pan, T., Long, D. M., and Uhlenbeck, O. C. (1993) in The RNA World (Gesteland, R. F. , and Atkins, J. F., eds) , pp. 271-302, CSHL Press, New York |
| 37. |
Freemont, P. S.,
Friedman, J. M.,
Beese, L. S.,
Sanderson, M. R.,
and Steitz, T. A.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
8924-8928 |
| 38. |
Steitz, J. A.,
and Steitz, T. A.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
6498-6502 |
| 39. | Prislei, S., Sperandio, S., Fragapane, P., Caffarelli, E., Presutti, C., and Bozzoni, I. (1992) Nucleic Acids Res. 17, 4473-4479 |
| 40. |
Santoro, B.,
De Gregorio, E.,
Caffarelli, E.,
and Bozzoni, I.
(1994)
Mol. Cell. Biol.
14,
6975-6982 |
| 41. | Grundmann, U., Romisch, J., Siebold, B., Bohn, H., and Amann, E. (1990) DNA Cell Biol. 9, 243-250[Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
J. S. Joseph, K. S. Saikatendu, V. Subramanian, B. W. Neuman, M. J. Buchmeier, R. C. Stevens, and P. Kuhn Crystal Structure of a Monomeric Form of Severe Acute Respiratory Syndrome Coronavirus Endonuclease nsp15 Suggests a Role for Hexamerization as an Allosteric Switch J. Virol., June 15, 2007; 81(12): 6700 - 6708. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vincenti, V. De Chiara, I. Bozzoni, and C. Presutti The position of yeast snoRNA-coding regions within host introns is essential for their biosynthesis and for efficient splicing of the host pre-mRNA RNA, January 1, 2007; 13(1): 138 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Renzi, E. Caffarelli, P. Laneve, I. Bozzoni, M. Brunori, and B. Vallone The structure of the endoribonuclease XendoU: From small nucleolar RNA processing to severe acute respiratory syndrome coronavirus replication PNAS, August 15, 2006; 103(33): 12365 - 12370. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ricagno, M.-P. Egloff, R. Ulferts, B. Coutard, D. Nurizzo, V. Campanacci, C. Cambillau, J. Ziebuhr, and B. Canard Crystal structure and mechanistic determinants of SARS coronavirus nonstructural protein 15 define an endoribonuclease family PNAS, August 8, 2006; 103(32): 11892 - 11897. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, Y. Zhai, F. Sun, Z. Lou, D. Su, Y. Xu, R. Zhang, A. Joachimiak, X. C. Zhang, M. Bartlam, et al. New Antiviral Target Revealed by the Hexameric Structure of Mouse Hepatitis Virus Nonstructural Protein nsp15. J. Virol., August 1, 2006; 80(16): 7909 - 7917. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Richard, A. M. Kiss, X. Darzacq, and T. Kiss Cotranscriptional Recognition of Human Intronic Box H/ACA snoRNAs Occurs in a Splicing-Independent Manner. Mol. Cell. Biol., April 1, 2006; 26(7): 2540 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Saladino, C. Crestini, F. Ciciriello, E. Di Mauro, and G. Costanzo Origin of Informational Polymers: DIFFERENTIAL STABILITY OF PHOSPHOESTER BONDS IN RIBOMONOMERS AND RIBOOLIGOMERS J. Biol. Chem., March 3, 2006; 281(9): 5790 - 5796. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Posthuma, D. D. Nedialkova, J. C. Zevenhoven-Dobbe, J. H. Blokhuis, A. E. Gorbalenya, and E. J. Snijder Site-Directed Mutagenesis of the Nidovirus Replicative Endoribonuclease NendoU Exerts Pleiotropic Effects on the Arterivirus Life Cycle J. Virol., February 15, 2006; 80(4): 1653 - 1661. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Gioia, P. Laneve, M. Dlakic, M. Arceci, I. Bozzoni, and E. Caffarelli Functional Characterization of XendoU, the Endoribonuclease Involved in Small Nucleolar RNA Biosynthesis J. Biol. Chem., May 13, 2005; 280(19): 18996 - 19002. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bhardwaj, L. Guarino, and C. C. Kao The Severe Acute Respiratory Syndrome Coronavirus Nsp15 Protein Is an Endoribonuclease That Prefers Manganese as a Cofactor J. Virol., November 15, 2004; 78(22): 12218 - 12224. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Ivanov, T. Hertzig, M. Rozanov, S. Bayer, V. Thiel, A. E. Gorbalenya, and J. Ziebuhr Major genetic marker of nidoviruses encodes a replicative endoribonuclease PNAS, August 24, 2004; 101(34): 12694 - 12699. [Abstract] [Full Text] [PDF] |
||||