![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 15, 13101-13109, April 11, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry, University of California,
Riverside, California 92521
Received for publication, December 10, 2002
The intracellular localization and
physiological functions of the p21-activated protein kinase The p21-activated protein kinases include group I
PAKs1 ( In contrast, All members of the group I PAKs contain two functional domains, an
N-terminal regulatory domain (residues 1-246 in Conditions of hyperosmolarity and the addition of sphingosine to
cultured cells result in translocation of Materials--
GTP Construction of Mammalian Expression Plasmids--
The cDNA
for Transfection of Mammalian Cells--
The monkey kidney cell line
COS-7 and the human embryonic kidney cell line 293T were maintained by
serial passage in Dulbecco's modified Eagle's medium supplemented
with 10% fetal bovine serum at 37 °C in a 5% CO2
incubator. Transient transfection of 293T and COS-7 cells was carried
out with Superfect transfection reagent as described by the
manufacturer. Approximately 5 × 105 cells were plated
in 75-cm2 flasks; the following day, the cells were
transfected for 3 h with 10 µg of pcDNA3.1+ HA-tagged WT or
mutant Western Blotting and Assay for
To assay for protein kinase activity,
To activate
To analyze protein kinase with similar amounts of recombinant WT and
mutant Immunolocalization of Expressed
To examine the effects of expression of WT and mutant
293T cells were grown on collagen-coated six-well plates and
transfected with HA-tagged WT Sucrose Density Gradient Fractionation--
To correlate the
subcellular localization with
Preparation of sucrose density gradients followed the procedure
described by Rexach and Schekman (28) with some modifications. The postnuclear supernatant (250 µl) was loaded onto the top of a
2.5-ml gradient and centrifuged for 2 h at 30,000 rpm in a Beckman rotor (SW 60Ti) at 4 °C. Eleven fractions of 250 µl each were collected from the bottom of the tube. The protein in each fraction was
precipitated by the addition of an equal volume of 10% trichloroacetic acid and 50% acetone at
Calreticulin was detected with rabbit antibody PA3-900 followed by
horseradish peroxidase-goat anti-rabbit IgG antibody. Ionizing radiation of 293T cells was performed as described previously (6).
Cells were then incubated for 2 h before analysis of localization of
To examine Effects of
Experiments with 293T cells showed that the number of cells expressing
the WT Analysis of Expressed Recombinant
The kinase-inactive mutant K278R was expressed at a level 8.8-fold
higher than the recombinant WT enzyme but was present only in the
supernatant (Fig. 2A). A similar expression pattern was observed with T402A, which contained a mutated autophosphorylation site
in the activation loop. When two mutants of the potential autophosphorylation site Ser-490 were examined, S490A (mimicking nonphosphorylated serine) was expressed at a level slightly less than
WT Protein Kinase Activity of Wild Type and Mutant
To measure the relative specific activity of the different forms of
Immunolocalization of Recombinant Wild Type and Mutant
Subcellular Localization of Endogenous and Recombinant
Expressed WT
It is important to note that in dividing cells, the ER-associated and
intermediate density fractions contained 10 and 5% of the total
endogenous
Because S490D had the same intracellular distribution profile as the
inactive mutants of
To examine
A comparison of endogenous
The specific activity of The effects of Recombinant WT Recombinant WT and mutant As shown by immunofluorescence, K278R and S490D are expressed at
significantly higher levels compared with WT A number of substrates have been identified for Because of the cytostatic effects of targeted The majority of endogenous The properties of WT and mutant forms of To evaluate the significance of Ser-490 in
Localization of p21-activated Protein Kinase
-PAK/Pak2 in the
Endoplasmic Reticulum Is Required for Induction of Cytostasis*
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-PAK
have been examined in human embryonic kidney 293T and COS-7 cells. At
1-4 days post-transfection, cell division is inhibited by the
expression of wild type (WT)
-PAK and the mutant S490A, whereas
cells expressing S490D and the inactive mutants K278R and T402A grow
exponentially, indicating a role for
-PAK in the induction of
cytostasis. WT
-PAK and S490A are localized in a region
surrounding the nucleus identified as the endoplasmic reticulum (ER),
as determined by immunofluorescence, whereas K278R, T402A, and S490D
lack localization. As shown by sucrose density gradient centrifugation,
WT
-PAK, S490A, and endogenous
-PAK are distributed among the
high density (ER-associated), intermediate density, and low density
fractions, whereas the mutants that do not inhibit cell division are
present only as soluble enzyme. The amount of endogenous
-PAK
associated with the particulate fractions is increased 4-fold when cell
division is inhibited by ionizing radiation.
-PAK in the ER and
intermediate density fractions has high specific activity and is
active, whereas the soluble form of
-PAK has low activity and is
activable. The importance of localization of
-PAK is supported by
data with the C-terminal mutants S490D and
488; these mutants have
high levels of protein kinase activity but do not induce cytostasis and
are not bound to the ER. A model for the induction of cytostasis by
-PAK through targeting of
-PAK to the ER is presented in which
-PAK activity and Ser-490 are implicated in the regulation of cytostasis.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-PAK (Pak1),
-PAK (Pak3), and
-PAK (Pak2) and group II PAKs (Pak 4, 5, and 6).
The members of group I are activated by autophosphorylation through
binding of the small G proteins Cdc42 and Rac1, whereas the activation
of group II enzymes has not been clearly identified (1-5). Within the
group I PAK family,
-PAK has distinct properties compared with other
PAK isoforms.
-PAK appears to be ubiquitous, whereas
- and
-PAK have greater tissue specificity.
-PAK is primarily inactive
in dividing cells and is transiently activated when cells are subjected
to moderate stress conditions such as hyperosmolarity, ionizing
radiation, and DNA-damaging drugs (1, 6, 7). Phosphatidylinositol
3-kinase and tyrosine kinase activity have been identified as upstream
activators of
-PAK in response to ionizing radiation and araC (7). A
function for
-PAK was suggested initially by microinjection of
active
-PAK into early frog embryos; active
-PAK inhibited cell
cleavage, whereas inactive
-PAK had no inhibitory effect (8).
-PAK is also involved in apoptotic signal transduction and can be
cleaved and activated in vitro by caspase 3, a member of the
cysteine-aspartic acid protease cascade activated during
apoptosis, and in vivo under anti-Fas apoptotic
induction (9-11). Because of the cytotoxic nature of
-PAK, the
enzyme activity and protein level are tightly regulated. In addition to
transient activation by Cdc42 in response to moderate stress,
-PAK
is degraded through the proteosome pathway after ubiquitination (12).
Inactive
-PAK has been shown to be protected from degradation and to
accumulate by association with other proteins, as shown with c-Abl
(12).
-PAK responds to growth-related signals, such as
platelet-derived growth factor (13), epidermal growth factor (14),
inflammatory factors such as interleukin-1 and angiotensin (15) and to
sphingosine (16). Subcellular localization has been shown to be
important for the physiological functioning of
-PAK.
-PAK
localizes to cortical actin structures in growth factor-stimulated
cells (13), resulting in cytoskeletal reorganization, including
membrane ruffling, filopodia extension, focal complex formation, and a
decrease in actin stress fibers (17, 18). Interaction of
-PAK with
the adaptor protein Nck leads to translocation of
-PAK to the
cellular membrane and stimulation of activity (13, 19, 20).
-PAK) and a
C-terminal catalytic domain (residues 247-524). The G protein binding
site, which is also conserved in the Ste20 PAK isoform in
Saccharomyces cerevisiae (21), is located at residues
73-108 in
-PAK (1). In
-PAK, Lys-278 coordinates ATP in the
active site, and the mutant K278R is kinase inactive (9, 22). In the
absence of an activator,
-PAK is autophosphorylated at five sites
but not activated (23, 24). Upon binding of Cdc42(GTP) or cleavage by
caspase 3, an additional three sites are autophosphorylated, resulting
in activation of the protein kinase. A site shown to be involved in
activation of
-PAK is Thr-402, the conserved threonine in the
activation loop; the mutant T402A (mimicking nonphosphorylated threonine) has little protein kinase activity (9, 23).
K/RRXS/T is the preferred recognition sequence
phosphorylated by
-PAK (25). Ser-490 in the sequence KRGS is a
potential autophosphorylation site for
-PAK and for phosphorylation
by protein kinase C. Ser-490 is located adjacent to a region involved
in binding to the
-subunit of the trimeric G protein (26). This
region is removed in the truncated mutant
488 that lacks the
C-terminal 36 amino acid residues.
-PAK to the particulate fraction and subsequent activation of the enzyme (6, 27). It was thus
of interest to examine whether intracellular localization had an effect
on the cytostatic activity of
-PAK. In this study, we examined the
subcellular localization and cytostatic activity of
-PAK in
mammalian cells as shown by sucrose density gradient centrifugation and
immunocytochemistry. Recombinant WT
-PAK and S490A are associated
primarily with the particulate fraction and are localized in the
endoplasmic reticulum (ER). In contrast, the kinase-inactive
-PAK
mutants K278R and T402A and the C-terminal mutants S490D and
488 are
present only as soluble enzymes and are present in the nucleus and the
cytosol. WT
-PAK and S490A inhibit cell growth, whereas the other
mutants have no inhibitory effect. Taken together, the data show that
subcellular localization of active
-PAK is essential for the
induction of cytostasis.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
S was from Roche Molecular Biochemicals.
[
-32P]ATP was purchased from PerkinElmer Life
Sciences. Dulbecco's modified Eagle's medium and fetal bovine serum
were from Invitrogen. BA85 nitrocellulose membranes were from
Schleicher & Schuell. Amersham Biosciences was the source for
glutathione-Sepharose 4 beads. Pfu polymerase was from
Stratagene. Restriction enzymes were purchased from New England
Biolabs. pcDNA3.1+ mammalian expression plasmid was from Invitrogen. Rabbit anti-calreticulin polyclonal antibody was from Affinity Bioreagents. Protein G-Sepharose, goat anti-
-PAK polyclonal antibody N19, and horseradish peroxidase-conjugated mouse anti-goat IgG
were from Santa Cruz Biotechnology. Fluorescein
isothiocyanate-conjugated goat anti-rabbit and tetramethylrhodamine
isothiocyanate-conjugated goat anti-mouse secondary antibodies were
from Sigma. Caspase 3 was expressed in Escherichia coli
strain BL-21 and purified as described previously (9). The Geneclean
kit was from BIO 101, Inc. Qiagen was the source for the Qiaprep spin
kit, the plasmid maxi kit, and Superfect transfection reagent. The
enhanced chemiluminescence kit was from Amersham Biosciences. Mouse
anti-hemagglutinin antigen (HA) tag monoclonal antibody 12CA5 was
generously provided by Dr. Xuan Liu, University of California,
Riverside. The E. coli expression plasmid pET21(b) encoding
the gene for caspase 3 (CPP 32) was generously provided by Drs. G. S. Litwack and E. S. Alnemri, Thomas Jefferson University,
Philadelphia, PA.
-PAK from rabbit and the
-PAK mutants K278R, T402A, S490A,
and S490D were prepared as described previously and subcloned into the
pBlue-NK plasmid (9, 24). To make the C-terminal deletion mutant
488, a 1.2-kb DNA fragment encoding residues 1-487 was generated by
PCR with primers GATCCATATGTCTGATAACGGAGAAC and
TCTAGAGGATCCTTATTTTTCCACATCCAT. The PCR product was cleaved with
NdeI and XbaI and ligated into the pBlue-NK
plasmid. To prepare the double mutants K278R/S490A and K278R/S490D, a
1.2-kb DNA fragment encoding residues 1-402 was cleaved from the
pBlue-NK
-PAK K278R plasmid with NdeI and NcoI
and inserted into pBlue-NK
-PAK S490A or S490D precleaved with
NdeI and NcoI. The resulting double mutations were confirmed by DNA sequencing. The Kozak consensus sequence ACCATG
followed by the DNA sequence encoding a HA tag, YPYDVPDYA, was inserted
immediately before the start site of
-PAK using PCR and was verified
by DNA sequencing. HA-tagged rabbit
-PAK was cloned into the
pcDNA3.1+ expression plasmid at the KpnI and XbaI sites.
-PAK. Two µg of pcDNA3.1+ LacZ was cotransfected as a
control of transfection efficiency. At 48 h post-transfection, the
cells were harvested, washed with phosphate-buffered saline (PBS),
resuspended in 100 µl of COWIE buffer (50 mM Tris-HCl, pH
8.0, 150 mM NaCl, 1 mM dithiothreitol, 1%
Nonidet P-40, and 0.5 mM phenylmethylsulfonyl fluoride) and
frozen at
70 °C. The cells were thawed and vortexed, and the
lysate was centrifuged at 16,000 × g for 5 min at
4 °C; the resulting supernatant and particulate fractions were used for further analysis.
-PAK Activity--
To detect
HA-tagged
-PAK, the supernatant and particulate fractions from
~5 × 105 293T cells were analyzed by SDS-PAGE on
7.5% polyacrylamide gels and the protein transferred onto
nitrocellulose membranes. The samples were probed with mouse anti-HA
tag monoclonal antibody 12CA5 (1:1,000) followed by goat anti-mouse IgG
conjugated with horseradish peroxidase (1:10,000) and detected by chemiluminescence.
-PAK was immunoprecipitated
from the Nonidet P-40-solubilized lysate by incubation with 2 µg of
anti-HA monoclonal antibody 12CA5 for 2 h at 4 °C. After the
addition of 20 µl of protein G-Sepharose, incubation was continued
for 1 h. The beads were washed twice with radioimmune precipitation assay buffer and three times with PBS.
-PAK by cleavage with caspase 3, the immunoprecipitates
were suspended in 30 µl of caspase cleavage buffer (25 mM HEPES, pH 7.5, 5 mM EDTA, 2 mM
dithiothreitol, and 0.1% CHAPS) and incubated in the presence or
absence of caspase 3 for 30 min at 37 °C. For activation of
-PAK
by Cdc42(GTP
S), the immunoprecipitates were incubated in 30 µl of
PBS with 1 µg of Cdc42 preloaded with 0.18 mM GTP
S for
5 min at 30 °C. Protein kinase activity was assayed in a volume of
70 µl in 50 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 30 mM 2-mercaptoethanol, 0.2 mM ATP, 1 µg of histone 4, and [
-32P]ATP
(2,000 dpm/pmol) for 30 min at 30 °C; these were kinetically valid
conditions. Phosphorylation of histone 4 was analyzed by SDS-PAGE on
15% polyacrylamide gels followed by autoradiography.
-PAK protein, the number of cells was adjusted, and the level
of protein was determined by Western blotting. Lysates were prepared
from 2.4 × 107 cells for WT
-PAK and S490A, from
9 × 106 cells for
488, and from 3 × 106 cells for K278R, S490D, and T402A and assayed as
described above. Radiolabeled histone 4 was excised and counted in a
scintillation counter. Aliquots (10 µl) of the same
immunoprecipitates were analyzed by SDS-PAGE and immunoblotted with
anti-HA antibody to ensure that identical amounts of proteins were
used. To assay for protein kinase activity with the synthetic
heptapeptide S3 (AKRESAA), 1 mM S3 was added to the assay
described above in place of histone 4. Phosphorylated S3 was analyzed
on P81 phosphocellulose paper, as described previously (25).
-PAK and Analysis of Cell
Proliferation--
Approximately 1 × 105 COS-7 cells
were plated onto glass coverslips and transfected with 5 µg of
pcDNA3.1+ HA-tagged
-PAK plasmid. At 48 h
post-transfection, the cells were washed twice with PBS, fixed with 4%
paraformaldehyde for 20 min, and washed three times with PBS. After
blocking with 5% fetal bovine serum for 1 h, the cells were
probed for
-PAK with mouse anti-HA antibody (1:200) and for the ER
marker calreticulin with rabbit polyclonal antibody PA3-900 (1:200).
The cells were washed three times with PBS, then incubated with goat
anti-mouse IgG conjugated with rhodamine (1:200) to identify the HA
tag, and goat anti-rabbit IgG conjugated with fluorescin (1:200) to
identify calreticulin. After washing twice with PBS, the coverslips
were mounted on glass slides and analyzed using a confocal laser
scanning imaging system. The images were analyzed with Bio-Rad Confocal
AssistantTM image analysis program. The transfection efficiency was
monitored by cotransfection of
-PAK with the pcDNA3.1+ LacZ
plasmid, and LacZ was assayed 2 days post-transfection. The
transfection efficiency was ~7% for COS-7 cells.
-PAK on cell
proliferation, COS-7 cells were transfected on coverslips, probed with
anti-HA antibody, and stained as described above. The cells were
monitored every 24 h for 4 days using a fluorescent microscope.
About 100-600 cells were counted at each time point from 10 images for
each sample; the 5 images nearest the average were used for
quantitative measurements.
-PAK and the mutants K278R, T402A, S490A, S490D, and
488 in the pTracer vector (Invitrogen) using Superfect reagent. The pTracer vector also contained the enhanced green
fluorescent protein reporter gene under a different promoter, which
allowed coexpression of
-PAK and green fluorescent protein in the
same cell. One and 2 days post-transfection, living cells were examined
for the green fluorescent protein positive signal under an inverted
microscope (Eclipse TE300, Nikon). The same sample was fixed with 4%
formaldehyde for in situ immunofluorescence staining of
-PAK with anti-HA antibody as described. The coexpression of
-PAK
and green fluorescent protein was evaluated using a fluorescence microscope (Eclipse E800, Nikon). Total cells (1,000-2,000) and fluorescent cells were counted from multiple images.
-PAK activity, sucrose density
gradient fractionation of the postnuclear supernatant from 293T cells
was carried out as described (28, 29) with some modifications. At
48 h post-transfection, ~3 × 106 cells were
harvested and washed with PBS and with buffer A as described by Sfeir
and Veis (29). The cell pellet was resuspended and kept on ice
for 5 min in 250 µl of buffer A and then homogenized with a Dounce
homogenizer (pestle B). The homogenization was monitored under a light
microscope and generally resulted in >98% cell lysis. After
centrifugation at 1,000 × g for 10 min at 4 °C, the
pellet was discarded, and the postnuclear supernatant was fractionated as described below.
20 °C for 1 h. After centrifugation
at 16,000 × g for 5 min at 4 °C, the pellet was
washed twice with cold acetone, air-dried, resuspended in 30 µl of
SDS sample buffer, and analyzed by SDS-PAGE on 7.5% polyacrylamide
gels. The proteins were blotted onto a nitrocellulose membrane and
probed with antibody to the HA tag. Endogenous
-PAK was detected
with goat anti-
-PAK polyclonal antibody N19 followed by horseradish
peroxidase-mouse anti-goat IgG.
-PAK.
-PAK activity, Nonidet P-40 was added at a final
concentration of 1% to a 30-µl sample from each fraction from the
sucrose density gradient. The samples were incubated in the presence
and absence of caspase 3 for 30 min at 37 °C and assayed with
histone 4 as described above. Phosphorylation of H4 was quantified using a Bio-Rad phosphorimaging IMAGEQuant program. Specific activity was determined by assaying for protein kinase activity under
kinetically valid conditions (see above), and
-PAK protein was
quantified by immunoblotting. The cleavage of
-PAK by caspase 3 was
confirmed by immunoblotting with anti-HA antibody after SDS-PAGE, as
described above, to detect HA-tagged
-PAK p58 (full-length) and p27
(caspase-cleaved N terminus) in the fractions.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-PAK Expression on Cell Proliferation--
To
examine the effects of
-PAK expression on cell proliferation,
recombinant WT
-PAK and three mutants were expressed in COS-7 cells
and analyzed over a 4-day period. Expression of
-PAK was detected by
immunofluorescence using anti-HA tag antibody, and antibody to
calreticulin was used to determine the total number of cells.
Approximately 7% of the cells were transfected, and the number of
cells increased ~6-fold over the 4-day period, with a doubling time
of 24 h (Fig. 1A). The
number of cells expressing WT
-PAK remained constant over time,
whereas the nontransfected cells continued dividing. The approximate
number of cells expressing K278R on day 1 was comparable with the WT
-PAK; however, the cells with K278R continued dividing over the
first 3 days and remained at that level on day 4, the time limit for
protein expression through transient transfection. S490A had an
expression pattern similar to that of WT
-PAK, whereas expression of
S490D was comparable with that of K278R. The results indicate that
expression of WT
-PAK and S490A resulted in induction of cytostasis,
whereas K278R and S490D had no effect on cell division.

View larger version (21K):
[in a new window]
Fig. 1.
Cytostatic effect of
-PAK expressed in COS-7 and 293T cells.
A, COS-7 cells were plated on coverslips and then
transfected with pcDNA3.1+ HA-tagged WT or mutant
-PAK. The
cells were fixed and probed with anti-HA tag antibody and
anti-calreticulin antibody at the times indicated. The numbers of cells
expressing recombinant WT or mutant
-PAK were counted using a laser
confocal fluorescent microscope. The numbers were determined from five
representative images. B, 293T cells were transfected and
processed as described in A. The numbers of cells expressing
recombinant WT or mutant
-PAK were counted using a laser confocal
fluorescent microscope. The numbers were determined from counting more
than 500 cells from representative images.
-PAK and S490A remained constant over a 2-day incubation
period, whereas the nontransfected cells continued dividing. Thus, the
percentage of cells expressing these two forms of
-PAK was reduced
from 21-24% on day 1 to 10-11% on day 2 (Fig. 1B). Cells
expressing the kinase-inactive mutants K278R and T402A and the
C-terminal mutants S490D and
488 were expressed at around 30% on
days 1 and 2, indicating that 293T cells tranfected with these mutants
continued dividing. Thus, the data supported the conclusions reached
with COS-7 cells, that WT
-PAK and S490A induced a cytostatic response.
-PAK--
The WT and mutant
forms of HA-tagged
-PAK were analyzed after expression in 293T
cells.
-PAK in the supernatant and particulate fractions was
analyzed by SDS-PAGE and immunoblotting with antibody to the HA tag. As
shown in Fig. 2A, WT
-PAK
was present in both the supernatant and the particulate fractions. The
amount of recombinant WT
-PAK in the particulate fraction was 80%
of that in the supernatant. Recombinant
-PAK comigrated on SDS-PAGE
with the major band of endogenous
-PAK (58 kDa) present in the
soluble and particulate fractions (as detected with N19 antibody).

View larger version (56K):
[in a new window]
Fig. 2.
Differential expression and protein kinase
activity of
-PAK in 293T cells.
Approximately 5 × 106 293T cells, transfected with
HA-tagged WT or mutant forms of
-PAK, were harvested after 48 h
and lysed in 100 µl of radioimmune precipitation assay buffer in the
presence of 1% Nonidet P-40 and separated into supernatant and
particulate fractions by centrifugation at 16,000 rpm. A, 20 µg of each cell lysate was analyzed by SDS-PAGE, and expression of
-PAK was detected by Western blotting with antibody to the HA tag.
Endogenous
-PAK in nontransfected cells was detected with antibody
N19 to
-PAK. p58 and p60 identify the two forms of
-PAK. The
relative amounts of
-PAK protein are indicated, as quantified by the
NIH Image processing program; recombinant WT
-PAK in the supernatant
and endogenous
-PAK in the supernatant are separately standardized
to 1. B, 20 µg of each cell lysate was immunoprecipitated
with anti-HA antibody, preincubated in the presence or absence of
caspase 3, and assayed for protein kinase activity with histone 4. The
samples were analyzed by SDS-PAGE followed by autoradiography.
Autoradiograms of phosphorylated H4 are shown. Phosphorylation of H4
was quantified by counting the excised H4 band in a scintillation
counter. Phosphorylation of H4 by WT
-PAK in the absence of caspase
3 was set at 1.
-PAK and was present in both fractions. The level of S490D
(mimicking phosphoserine) was 8.1-fold higher than the WT
-PAK, a
level similar to that of the kinase-inactive mutants, and was present
only in the supernatant. The kinase-active mutant
488, which lacked
the C-terminal 36 amino acid residues including Ser-490, was expressed
at a 3.3-fold higher level than the WT and was present only in the
supernatant. With the double mutants K278R/S490A and K278R/S490D, the
amount of expressed protein and the pattern of expression were similar
to those of K278R. Wild type
-PAK and S490A migrated as a 58-kDa
protein on SDS-PAGE, whereas K278R, T402A, S490D, and the double
mutants migrated at 60 kDa. In contrast, the catalytic domain of
-PAK was expressed at levels 20-50-fold lower than those of the
full-length wild-type protein and was highly unstable in 293T cells as
well as in insect cells (data not shown). The level of expression of WT
-PAK was ~40% of the endogenous
-PAK protein in 293T cells.
The relative levels of expression and mobility on SDS-PAGE of WT
-PAK and the mutants are the same in COS-7 and 293T cells.
-PAK Expressed
in 293T Cells--
To measure the protein kinase activity of
-PAK
expressed in 293T cells, ~5 × 106 cells were
collected at 48 h post-transfection.
-PAK was
immunoprecipitated from the cell lysates with anti-HA antibody and
assayed with the specific substrate histone 4. Basal
-PAK activity
was observed with WT
-PAK, S490A, S490D, and
488, which was
enhanced further upon cleavage with caspase 3 (Fig. 2B). The
immunoprecipitate of S490D had higher kinase activity, consistent with
the higher protein expression level of this mutant. K278R, and T402A
had essentially no protein kinase activity either before or after cleavage, as expected.
-PAK, the number of 293T cells was adjusted to obtain approximately
the same amount of
-PAK; the cells were collected at 48 h
post-transfection, and
-PAK was immunoprecipitated and assayed with
histone 4 and peptide S3. As shown by the immunoblot in Fig.
3A (bottom panel),
approximately the same amount of
-PAK protein was present in each
sample. In the absence of an activator, similar low levels of basal
-PAK activity were observed with WT
-PAK, S490A, and
488, with
very low activity for S490D. Cleavage with caspase 3 or binding of
Cdc42(GTP
S) stimulated phosphorylation of H4 to a similar extent.
This was 2-3-fold when assayed with histone 4 or with S3 (Fig. 3,
B and C), whereas the activity of S490D was
increased 6-fold because of a lower basal activity.

View larger version (24K):
[in a new window]
Fig. 3.
Activity of recombinant
-PAK expressed in 293T cells. The cell lysate
was prepared as described in Fig. 2.
-PAK was immunoprecipitated
from the supernatant fraction with anti-HA tag antibody to give equal
amounts of
-PAK protein for each mutant. The immunoprecipitates were
preincubated in the presence and absence of caspase 3 or Cdc42(GTP
S)
and assayed for protein kinase activity with histone 4. The samples
were analyzed by SDS-PAGE followed by autoradiography. A,
autoradiograms of phosphorylation of H4 by
-PAK are as indicated. A
Western blot of the immunoprecipitates used for this assay is shown in
the bottom panel of A. B,
phosphorylation of H4 was quantified by excision of the H4 band and
counted in a scintillation counter. Phosphorylation of H4 by WT
-PAK
in the absence of an activator was set at 1. C, assays were
carried out with S3 as substrate after preincubation in the presence or
absence of caspase 3. Phosphorylation of H4 and S3 by nonactivated WT
-PAK was set at 1.
-PAK--
To examine the subcellular localization of
-PAK, COS-7
cells transfected with WT and mutant forms of
-PAK were probed with anti-HA tag antibody; fluorescence was visualized by confocal microscopy. WT
-PAK was localized around the nucleus in a broad band, as shown in Fig. 4. In contrast,
K278R was present both in the cytosol and in the nucleus. S490A was
localized around nucleus in a pattern similar to that of WT
-PAK,
whereas S490D lacked distinct localization, similar to that observed
with K278R. To identify the site of localization of WT
-PAK and
S490A around the nucleus, the cells were probed with antibody against
the ER marker calreticulin. As shown by image overlays
(yellow), WT
-PAK and S490A colocalized
specifically with calreticulin in the ER. When 293T cells transfected
with WT
-PAK were examined in a similar manner, identical results
were obtained. In addition, T402A and
488 were present in both the
cytosol and the nucleus (data not shown), similar to that observed with
K278R and S490D (Fig. 4).

View larger version (35K):
[in a new window]
Fig. 4.
Localization of
-PAK
in COS-7 cells by immunofluorescence. COS-7 cells were plated on
coverslips, transfected with pcDNA3.1+ HA-tagged WT or mutant
-PAK. At 48 h post-transfection, the cells were washed, fixed,
and probed with anti-HA tag antibody and anti-calreticulin antibody.
Recombinant HA-tagged
-PAK was visualized with mouse anti-HA tag
monoclonal antibody 12CA5 and TRITC-conjugated goat anti-mouse IgG. The
ER was visualized with rabbit anti-ER marker calreticulin antibody and
fluorescein isothiocyanate-conjugated goat anti-rabbit IgG.
-PAK by
Sucrose Density Gradient Centrifugation--
To examine the
subcellular localization of
-PAK further, the postnuclear
supernatant from 293T cells was subjected to sucrose density gradient
centrifugation. After centrifugation, endogenous
-PAK was identified
in nontransfected cells by Western blotting with anti-
-PAK antibody,
and recombinant
-PAK was identified by anti-HA antibody. Fractions
1-10 contained a gradient ranging from 55 to 15% sucrose,
respectively, whereas fraction 11 was the position of the sample
loading. As shown in Fig. 5A,
endogenous
-PAK in actively dividing cells was localized in three
places in the gradient, in fractions 1-4 (high density; particulate), in fractions 6 and 7 (intermediate density; particulate), and in
fractions 10 and 11 (low density; soluble). The ER marker calreticulin, identified with anti-calreticulin antibody, was colocalized with
-PAK in the ER (fractions 1-4) and was present in soluble fractions 10 and 11.

View larger version (26K):
[in a new window]
Fig. 5.
Distribution of the
-PAK protein and protein kinase activity to the ER
as determined by sucrose density gradient centrifugation. The
postnuclear supernatant was prepared from transfected and
nontransfected 293T cells incubated for 48 h and subjected to
sucrose density gradient fractionation. A, endogenous
-PAK was detected with anti-
-PAK antibody N19. Recombinant
-PAK was detected with anti-HA tag antibody. The ER was identified
with anti-calreticulin antibody. B, irradiated 293T cells
were treated with ionizing radiation, incubated for 2 h, and the
lysates were subjected to sucrose density gradient centrifugation as in
A.
-PAK was detected with anti-
-PAK antibody. 293T
cells transfected with the mutant K278R were used as a control. The
amount of
-PAK in different sucrose density fractions was quantified
with the NIH Image program. C, the sucrose density gradient
fractions (200 µl each fraction) were pooled as 1-4 (ER-associated
fractions), 5-8 (intermediate density fractions), and 9-11 (soluble
fractions). HA-tagged WT
-PAK was immunoprecipitated from the pooled
fractions, incubated in the presence or absence of caspase 3, and
assayed with histone 4. The 32P incorporated into histone 4 was analyzed by SDS-PAGE followed by phosphorimaging
quantification.
-PAK (Fig. 5A) was distributed among
fractions 1-4 (ER), fractions 6 and 7 (intermediate density), and
fractions 10 and 11 (soluble). S490A, which also inhibited growth, was
present in fractions 1-4 and fractions 10 and 11 with a small amount
of protein at the intermediate density. In contrast, the inactive forms
of
-PAK, K278R, T402A, and double mutants K278R/S490A and K278R/S490D were present only at the top of the gradient in fractions 9-11. Interestingly, the kinase-active mutant S490D was also present only in fractions 9-11. These results correlated well with the immunocytochemistry data showing that native and recombinant WT
-PAK, as well as S490A, were localized on the ER.
-PAK protein, respectively; the majority of the
endogenous
-PAK was present as the soluble form. In comparison, the
majority of the recombinant WT
-PAK and S490A were located in the
particulate fractions. To examine this further, 293T cells were
subjected to ionizing radiation to inhibit cell proliferation. Under
these conditions, more than half of the endogenous
-PAK was
translocated to the ER (36%) and intermediate density fractions (20%)
(Fig. 5B). The mutant K278R was not translocated to the ER
after ionizing radiation.
-PAK, but also had high protein kinase activity,
the role of the C-terminal region in subcellular localization was
examined further using the truncated mutant
488. Like S490D,
488
was detected only as a soluble form (Fig. 5A). These data
indicated that the C-terminal region was required for localization of
-PAK in the ER. A comparison of the data with S490A and S490D
suggested that phosphorylation at Ser-490 could have a role in
regulating the release of
-PAK from the ER. The results with the
double mutations K278R/S490A and K278R/S490D indicated that
localization of S490A in the ER could be overruled by the K278R mutation.
-PAK activity in the different subcellular fractions,
HA-tagged WT
-PAK was immunoprecipitated from pooled fractions 1-4,
5-8, and 9-11. The immunoprecipitates were preincubated in the
absence or presence of caspase 3 and assayed for protein kinase activity with histone 4. The specific activity was calculated based on
the phosphorylation of histone 4 and the amount of
-PAK protein in
the fractions. The ER-associated form of
-PAK (fractions 1-4) and
-PAK with the intermediate density fraction (fractions 5-8) were
active and were not activated further by cleavage with caspase 3 (Fig.
5C). In contrast, the soluble form of
-PAK was activated
3-fold by caspase 3.
-PAK with that of the recombinant WT was
measured in a similar manner. As shown in Fig.
6A,
-PAK activity in
nontransfected cells was also associated with the ER (fractions 1-4)
and in the intermediate density fractions (fractions 5-8).
-PAK
activity associated with the ER could not be activated further upon
cleavage by caspase 3. The soluble form (fractions 9-11) had the
lowest activity and could be activated further by cleavage with caspase
3 (Fig. 6A). Upon expression of recombinant WT
-PAK,
total
-PAK activity was increased ~35% and was distributed in a
pattern similar to the endogenous enzyme.
-PAK in the ER-associated and intermediate fractions was not activated by caspase 3, whereas the
soluble form was activated by such cleavage.
-PAK was cleaved by
caspase 3 to an equivalent extent in all three fractions, as shown in
the immunoblots by the appearance of the p27 fragment containing the
N-terminal region of
-PAK (Fig. 6B). This cleavage was
dependent on prior dissociation of
-PAK from the ribosome. When
-PAK was associated with the ER, the protein was protected from
cleavage (data not shown).

View larger version (18K):
[in a new window]
Fig. 6.
Comparison of endogenous and recombinant
-PAK activity. The sucrose density gradient
fractions were carried out as described in Fig. 5. Thirty µl of each
fraction was incubated in the presence or absence of caspase 3 and
assayed with histone 4; phosphorylation was analyzed by SDS-PAGE and
quantified by phosphorimaging. A, activity of
-PAK in
each sucrose density fraction. B, the sucrose density
gradient fractions were pooled as 1-4 (ER-associated fractions), 5-8
(intermediate density fractions), and 9-11 (soluble fractions). The
activity of the recombinant WT was calculated by subtraction of the
endogenous
-PAK activity in nontransfected cells from the total
activity in transfected cells.
-PAK protein was determined by
Western blotting as shown in Fig. 5, and the specific activity was
calculated using these values. Cleavage of recombinant
-PAK is shown
after immunoprecipitation and analysis by SDS-PAGE and Western
blotting.
-PAK was calculated from the activity
measurements of endogenous
-PAK with H4 and the protein content in
the sucrose density gradient. The particulate forms of
-PAK had
significantly higher specific activities (20-fold and 27-fold, respectively) than the soluble form (Fig. 6B). Cells
transfected with recombinant
-PAK had ceased dividing, which
correlated with significantly higher levels of
-PAK associated with
the particulate fractions; 50% of the
-PAK protein was associated
with the ER, and 15% was present in the intermediate density
fractions. The ER-associated and intermediate forms of recombinant WT
-PAK had 5- and 10-fold higher specific activities compared with the
soluble form. The results indicated that endogenous and recombinant
-PAK in ER and intermediate density fractions were highly active and that the level of
-PAK associated with particulate fractions was
significantly greater when cell growth was inhibited.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-PAK on cell proliferation were examined by the
expression of WT and mutant
-PAK in COS-7 and 293T cells. The number
of cells expressing WT
-PAK and S490A remained constant over a 4-day
period, indicating that both WT and S490A inhibit cell growth. With the
kinase-inactive and -activable C-terminal mutants S490D and
488, the
cell number increased exponentially along with the nontransfected
cells, indicating that these mutants have no inhibitory effect on cell
growth. The inhibitory effect of WT
-PAK expressed in COS-7 and 293T
cells was also observed with NIH 3T3 cells and with cells infected with
retroviral expression of
-PAK (data not shown). The data indicate
that expression of the WT
-PAK or S490A induces cytostasis.
-PAK and S490A are associated with the ER as shown by
immunocytochemistry and by sucrose density gradient centrifugation; the
protein kinases are also detected in the intermediate density fractions
and as soluble enzymes. In contrast, the active mutants S490D and
488, and the inactive mutants K278R and T402A, are present in both
the nucleus and the cytosol and do not bind tightly to the ER, as
determined by sucrose density gradient centrifugation. The ER and
intermediate density fractions with WT or S490A contain >50% of the
total recombinant
-PAK protein. These particulate forms of
-PAK
are already active and cannot be activated further, whereas soluble
-PAK has a low specific activity and can be activated by cleavage
with caspase 3. This pattern is the same as that of native
-PAK in
dividing cells, except that only 15% of the endogenous
-PAK is
associated with the ER and intermediate density fractions. Considering
that proliferating cells have primarily inactive endogenous
-PAK,
ionizing radiation was used to render 293T cells in the quiescent
state. Within 2 h after ionizing radiation, ~50% of endogenous
-PAK was translocated to the ER. The major difference between cells
transfected with WT
-PAK or S490A, and cells transfected with
kinase-inactive mutants K278R and T402A or C-terminal mutants S490D and
488, is that the former are unable to undergo cell division, whereas
the latter continue dividing. These data indicate that localization on
the ER results in activation of
-PAK, and the increase in
association of
-PAK with the ER correlates directly with inhibition
of cell growth.
-PAKs have different expression patterns
and different properties in mammalian cells. WT
-PAK and S490A
migrate as 58-kDa proteins on SDS-PAGE compared with the
kinase-inactive mutants K278R and T402A and the active mutant S490D,
which migrate as 60-kDa proteins. K278R, T402A, and S490D are expressed
at an 8-fold higher level than WT
-PAK and S490A. Native
-PAK
purified from rabbit reticulocytes also has electrophoretically distinct forms; the 58-kDa form is active, whereas the 60-kDa form has
little or no protein kinase activity (8). The differences in
electrophoretic mobility of the recombinant forms of
-PAK during
SDS-PAGE correlate with differences in cytostatic activity and could
reflect structural differences resulting from mutation or differential
phosphorylation of the WT and mutant proteins.
-PAK and S490A and do
not localize specifically in the ER. This was confirmed in human
embryonic kidney cells by immunofluorescence (data not shown) and by
sucrose density gradient analysis. Localization of WT
-PAK and
S490A, but not kinase-inactive mutants or C-terminal mutants, suggests
that both protein kinase activity and localization of
-PAK to the ER
are required for the induction and maintenance of cytostasis. These
conclusions are supported by previous studies showing that
-PAK is
targeted to the particulate fraction by Cdc42 in response to
hyperosmolarity and activated at the membrane (6). Cdc42 also results
in growth inhibition in mammalian cells (30, 31). This could occur
through activation of
-PAK as well as other pathways. The fact that
-PAK alone can induce cytostasis indicates that it is a primary
effector in inducing and maintaining cell stasis.
-PAK (1), suggesting
that the molecular mechanisms involved in
cytostasis are multifold. Translational
initiation factors and ribosomal proteins have been identified as
substrates for
-PAK2,3 (32,
33), and WT
-PAK has been shown to inhibit protein synthesis when
transfected into 293T cells, whereas K278R has no effect on
translation.2
-PAK in the intermediate density fractions
appears to be related to
-PAK in the ER. When samples are treated
with 1% Nonidet P-40 before centrifugation,
-PAK moves from the
ER-associated fractions to the intermediate density fraction but not
the soluble fraction (data not shown). Thus
-PAK associated with the
ER and the intermediate density fractions appears to have a common
source. Unpublished data3 indicate that
-PAK in the
intermediate density fractions is bound to ribosomes, suggesting that
-PAK on the ER is also bound to ribosomes. Because translation is a
major function of the ER, inhibition of translation by
-PAK on the
ER could lead to inhibition of cell proliferation, although other
pathways would also be involved. In this regard,
-PAK has been shown
to phosphorylate a wide diversity of proteins (1), and the presence of
-PAK could also result in phosphorylation of newly synthesized
proteins in response to stress.
-PAK, the amount of
the protein kinase in the cells is tightly regulated, whereas the
levels of nontargeted mutants of
-PAK are up to 8-fold higher. The differences in expression levels of the WT enzyme and S490A, and
the kinase-inactive mutants and S490D, suggest that mammalian cells can
tolerate higher levels of nontargeted
-PAK than WT
-PAK. It is of
interest to note that in addition to regulation of
-PAK activity by
Cdc42, sphingosine, and caspase cleavage, the level of WT
-PAK is
tightly regulated by degradation through the proteosome pathway (12).
Generally, stress-related proteins, which result in irreversible damage
if overexpressed, are tightly regulated in mammalian cells. For
instance, WT c-Abl, the tyrosine kinase that has growth-suppressive and
apoptotic activities, and the retinoblastoma tumor suppressor protein
RB are expressed at significantly lower levels than the corresponding
inactive mutant proteins (34, 35). We have shown previously that c-Abl
and
-PAK are associated in vivo and are
cross-phosphorylated (12). In that complex
-PAK is protected from
degradation and reaches levels approaching those of the kinase-inactive
mutants. It is important to note that the cytostatic properties of
-PAK are also observed upon expression of
-PAK in E. coli.
-PAK (85%) is present as soluble enzyme,
whereas around 35% of the recombinant WT
-PAK and S490D is soluble.
These differences can be correlated with the growth status of the
cells. The cells containing only endogenous
-PAK are dividing; thus
the majority of
-PAK is present as inactive enzyme. In cells treated
by ionizing radiation, >50% of the endogenous
-PAK becomes
associated with the particulate fractions, concomitant with the
inhibition of cell division. Similarly, cells overexpressing WT
-PAK
and S490A are not dividing, and active
-PAK accumulates in the ER.
Intracellular localization is also involved in the functioning of other
PAK family members, including
-PAK. Interaction of
-PAK with
adaptor proteins such as Nck is implicated in translocation and
stimulation of
-PAK activity by growth factors (13, 19, 20).
Activation of Cdc42 localizes
-PAK to areas of membrane ruffling and
reformation of the cytoskeleton (13, 36).
488, a truncated mutant simulating a spontaneous frameshift mutant,
provides further evidence that Ser-490 and the C-terminal regulatory
region have an important role in subcellular localization and induction
of cytostasis.
488 has protein kinase activity similar to that of
the WT but is expressed at higher levels than WT
-PAK and exists
only as a soluble form. The lack of specific localization observed with
S490D and
488 suggests that the C terminus is involved in regulating
the association of
-PAK with the ER and that Ser-490 has a key
function in this regulation.
-PAK are summarized in
Table I.
-PAK proteins that are
localized on the ER, including WT and S490A, are expressed at lower
levels in mammalian cells and have cytostatic effects. Mutants of
-PAK which are not localized on the ER are of two types, the
kinase-inactive mutants K278R and T402A, and the active C-terminal
mutants
488 and S490D; these enzymes are expressed at up to 8-fold
higher levels than WT
-PAK and S490A in mammalian cells and do not
inhibit cell proliferation. The summarized results suggest that 1)
protein kinase activity alone is not sufficient for the cytostatic
effect of
-PAK; 2) localization to the ER is important for
cytostasis; 3) the C-terminal region of
-PAK is involved in
localization, as shown with
488, S490A, and S490D, and has a role in
mediating the cytostatic effects of
-PAK. Ser-490 in the sequence
KRGS is a potential recognition and/or phosphorylation site for several
protein kinases including
-PAK, and phosphorylation at this site, as
shown with S490A and S490D, appears to be important in regulating
localization of
-PAK in the ER. Ser-490 has not been identified as a
phosphorylation site in studies examining the autophosphorylation or
phosphorylation of
-PAK (24); however if Ser-490 is phosphorylated
only when
-PAK is associated with the ER, it would not have been
detected in those studies.
Effects of expression of wild type and mutant
-PAK
-PAK, the tertiary
structure of the catalytic domain of
-PAK was modeled using the
SWISS-MODEL program based on the x-ray crystal structures of
-PAK
(37). The two predicted subdomains of
-PAK form a "catalytic
cavity," with Lys-278 located inside (Fig.
7A). Thr-402 in
-PAK
corresponds to the highly conserved threonine in many protein kinases,
which is located in the activation loop (38-40). Thr-402 is an
autophosphorylation site and is required for activation of
-PAK (9,
23). Ser-490 is located on the opposite side of the catalytic domain,
on the surface of an
-helix bundle that may serve as an
"interface" to interact with other proteins. The
subunit of the
heterotrimeric G protein has been shown to bind to Ste20, mouse mPAK3,
rat
-PAK, and yeast Cla4 (26) at a sequence corresponding to
residues 505-518 on
-PAK, which lies in an
-helix near Ser-490.
Because of the proximity of Ser-490 to the G protein binding region, it
is possible that the trimeric G protein
subunit may also
participate in the cytostatic response. Thus, Ser-490 may regulate the
interaction of
-PAK with other components leading to ER localization
of
-PAK.

View larger version (24K):
[in a new window]
Fig. 7.
Regulatory sites and proposed model
for
-PAK in cytostasis. A, the
tertiary structure of the catalytic domain (amino acids 228-521) of
-PAK was predicted using the SWISS MODEL program at
www.expasy.ch/swissmod/course/text/submit.htm. The reference protein
used for modeling was the catalytic domain of human
-PAK (37).
B, a model for localization of
-PAK on the ER and
induction of cytostasis is shown. The C terminus, including Ser-490,
regulates the localization of
-PAK to the ER as described under
"Discussion." Phosphorylation of Ser-490 or removal of the
C-terminal region (indicated by the
488 mutant) and/or a lack of
autophosphorylation of Thr-402 could prevent
-PAK from associating
with the ER or enhance dissociation from the ER.
The absence of phosphate on Ser-490 alone (mimicked by S490A) is not
sufficient to lead to ER localization of
-PAK. As shown in Fig. 5,
mutant K278R/S490A is not localized on the ER and has no cytostatic
properties (data not shown). This implies that autophosphorylation and
activation of
-PAK are required for ER localization. A schematic model for regulating the targeting and functioning of
-PAK in the
induction of cytostasis is shown in Fig. 7B. When Ser-490 is
not phosphorylated and Thr-402 is phosphorylated,
-PAK would be
active and associated with ER, and cells would undergo cytostasis. When
Ser-490 is phosphorylated, or when Thr-402 is not phosphorylated,
-PAK is not associated with ER, and cells could proliferate
normally. Deletion of the C-terminal region containing Ser-490 also
prevents ER association and thus would prevent induction of cytostasis.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Xuan Liu for providing anti-HA tag antibody and for helpful discussions, Drs. Gerald Litwack and Emad S. Alnemri for providing the plasmid for expression of caspase 3, Dr. Kevin Orton for preparation of caspase 3, Barbara Walter for technical support, and Dr. Polygena Tuazon and Yuan-Hao Hsu for helpful suggestions.
| |
FOOTNOTES |
|---|
* This research was supported by United States Public Health Service Grant GM26738 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address: G. W. Hooper Foundation, University of
California, 513 Parnassus Ave. HSW1501, San Francisco, CA
94143-0552.
§ To whom correspondence should be addressed. Fax: 909-787-3590; E-mail: jolinda.traugh@ucr.edu.
Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M212557200
2 J. Ling, S. J. Morley, and J. A. Traugh, manuscript in preparation.
3 Z. Huang, K. Orton, L. Xu, and J. A. Traugh, manuscript in preparation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
PAK(s), p21-activated protein kinase;
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid;
ER, endoplasmic reticulum;
GTP
S, guanosine
5'-O-(thiotriphosphate);
HA, hemagglutinin antigen;
PBS, phosphate-buffered saline;
TRITC, tetramethylrhodamine isothiocyanate;
WT, wild type.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Roig, J., and Traugh, J. A. (2001) Vitam. Horm. 62, 167-198[Medline] [Order article via Infotrieve] |
| 2. | Bagrodia, S., and Cerione, R. A. (1999) Trends Cell Biol. 9, 350-355[CrossRef][Medline] [Order article via Infotrieve] |
| 3. | Knaus, U. G., and Bokoch, G. M. (1998) Cell Biol. 30, 857-862 |
| 4. | Jaffer, Z. M., and Chernoff, J. (2002) Int. J. Biochem. Cell Biol. 34, 713-717[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Manser, E., and Lim, L. (1999) Prog. Mol. Subcell. Biol. 22, 115-133[Medline] [Order article via Infotrieve] |
| 6. |
Roig, J.,
Huang, Z.,
Lytle, C.,
and Traugh, J. A.
(2000)
J. Biol. Chem.
275,
16933-16940 |
| 7. | Roig, J., and Traugh, J. A. (1999) J. Bio |