|
Originally published In Press as doi:10.1074/jbc.M212779200 on February 3, 2003
J. Biol. Chem., Vol. 278, Issue 16, 14029-14036, April 18, 2003
A Novel Function of Rad54 Protein
STABILIZATION OF THE Rad51 NUCLEOPROTEIN FILAMENT*
Alexander V.
Mazin §,
Andrei A.
Alexeev§, and
Stephen C.
Kowalczykowski§¶
From the Department of Biochemistry, Drexel
University College of Medicine, Philadelphia, Pennsylvania 19102-1192 and the § Division of Biological Sciences, Sections of
Microbiology and of Molecular and Cellular Biology, University of
California, Davis, California 95616-8665
Received for publication, December 16, 2002, and in revised form, February 3, 2003
 |
ABSTRACT |
Homologous recombination is important for the
repair of double-stranded DNA breaks in all organisms. Rad51 and Rad54
proteins are two key components of the homologous recombination
machinery in eukaryotes. In vitro, Rad51 protein assembles
with single-stranded DNA to form the helical nucleoprotein
filament that promotes DNA strand exchange, a basic step of homologous
recombination. Rad54 protein interacts with this Rad51 nucleoprotein
filament and stimulates its DNA pairing activity, suggesting that Rad54
protein is a component of the nucleoprotein complex involved in the DNA
homology search. Here, using physical criteria, we demonstrate directly
the formation of Rad54-Rad51-DNA nucleoprotein co-complexes that
contain equimolar amounts of each protein. The binding of Rad54 protein
significantly stabilizes the Rad51 nucleoprotein filament formed on
either single-stranded DNA or double-stranded DNA. The Rad54-stabilized
nucleoprotein filament is more competent in DNA strand exchange and
acts over a broader range of solution conditions. Thus, the co-assembly of an interacting partner with the Rad51 nucleoprotein filament represents a novel means of stabilizing the biochemical entity central
to homologous recombination, and reveals a new function of Rad54 protein.
 |
INTRODUCTION |
Homologous recombination plays an essential role in repair of DNA
double-stranded breaks, a lethal type of DNA damage. The mechanisms of
double-stranded break repair by recombination have been extensively
investigated at the genetic and biochemical levels (1-6). In yeast,
genetic analysis reveals a set of genes, called the RAD52
epistasis group, that are directly involved in double-stranded break
repair (7). This group includes the RAD50,
RAD58/MRE11, XRS2, RPA1,
RAD51, RAD52, RAD54, RAD55,
RAD57, and RAD59 genes. Among the proteins
encoded by these genes, the Rad51 protein is the most evolutionarily
conserved; its homologues are spread from bacteria to mammals (8). The
Rad51 protein family members possess a unique property; they form
helical nucleoprotein filaments with DNA (9-11) and promote DNA
pairing and strand transfer, a basic step of homologous recombination
(11-16).
More recently, it was demonstrated that Rad52 protein, Rad54 protein,
and the Rad55/Rad57 heterodimer stimulate DNA pairing promoted by Rad51
protein. The mechanistic studies revealed that stimulation by Rad52
protein and the Rad55/Rad57 proteins is at the early (presynaptic)
stage of DNA strand exchange. Rad52 protein enhances the ability of
Rad51 protein to displace RPA from
ssDNA1 (17-20), as do the
Rad55/Rad57 proteins, but by a different mechanism (21).
The mechanism by which Rad54 protein stimulates the DNA pairing
activity of Rad51 protein is different (22-28). It was found that, in
contrast to other proteins that stimulate the DNA pairing activity of
Rad51 protein, Rad54 protein acts at a later (synaptic) stage of DNA
strand exchange (24, 29). Rad54 protein belongs to the Snf2/Swi2
group of proteins, which are involved in ATP-dependent remodeling of protein complexes, including mainly chromatin complexes (30). Rad54 protein was discovered to have a dsDNA topology-modifying activity, and this activity was implicated in the mechanism of stimulation of DNA strand exchange (23, 27). Previously, we inferred
from the analysis of joint molecule formation by Rad51 protein that
Rad54 protein binds to the assembled Rad51-ssDNA nucleoprotein filament
(24, 31). We suggested that Rad54 protein is a component of a
nucleoprotein filament that is involved in the search for DNA homology,
and, in that capacity, Rad54 protein modifies the topology of
dsDNA-target, thereby making it more readily accessible for DNA pairing.
Here, in experiments with DNA attached to polystyrene beads, we provide
direct evidence for a stoichiometric complex of Rad54 protein bound to
the Rad51-ssDNA nucleoprotein filament. We discovered that the binding
of Rad54 protein to the filament increased the stability of the Rad51
nucleoprotein complex substantially. We suggest that this stabilization
of the filament represents a novel presynaptic and, possibly, synaptic
function of Rad54 protein that, in addition to its dsDNA unwinding
activity, contributes to its stimulation of DNA strand exchange.
 |
EXPERIMENTAL PROCEDURES |
Proteins and DNA--
Saccharomyces cerevisiae Rad51
protein, RPA, and Rad54 protein were purified as described (18, 31,
32). The Rad54 protein is a glutathione S-transferase fusion
protein that is fully active both in vivo (31) and in
vitro (24). The oligonucleotides used in this study were as
follows: number 2, 63-mer
(TCCTTTTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGT); 5, 32-mer (CCATCCGCAAAAATGACCTCTTATCAAAAGGA); 6, 32-mer
(TCCTTTTGATAAGAGGTCATTTTTGCGGATGG); 26, 48-mer (TCCT
TTTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGC); 48, 48-mer
(GCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCT TATCAAAAGGA-biotin); 77, 100-mer (biotin-GGGCTACGTCTTGCTG
GCGTTCGCGACGCGAGGCTGGTGGCCTTCCCCATTATGATTCTTC TCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCA); 78, 100-mer
(TGGCCTGCAACGCGGGCATCCCGATGCCGCCGGAAGCG AGAAGAATCATAATGGGGAAGGCCACCAGCCTCGCGTCGCGAAC GCCAGCAAGACGTAGCCC); 109, 63-mer (GTCGACGACGTCTGAGTACTCATCTAGTGTGACATCATCGCATCGAGAACAGCACCAGATT CA); and 111, 63-mer (TGAATCTGGTGCTGTTCTCGATGCGATGAT GTCACACTAGATGAGTACTCAGACGTCGTCGAC).
All oligonucleotides were synthesized using standard phosphoroamidite
chemistry and were purified by electrophoresis in a polyacrylamide gel
containing 50% urea (33). The concentrations of the oligonucleotides
were determined spectrophotometrically using the extinction coefficient
260 = 9833 M 1·cm 1 (1 A260 = 33 µg/ml). Oligonucleotide dsDNA
preparations were as described (34). Oligonucleotides were stored at
20 °C. Covalently closed circular pUC19 DNA was purified using
alkaline lysis, followed by precipitation with LiCl and by
CsCl-ethidium bromide equilibrium centrifugation (34). Relaxed circular
DNA was produced by treating pUC19 supercoiled DNA (50 µg/ml) with
topoisomerase I from wheat germ (0.75 units/ml) for 30 min at 37 °C,
followed by phenol deproteinization and repeated ethanol
precipitations. All DNA concentrations are expressed as molar in
nucleotide concentration. Single-stranded oligonucleotides were labeled
using T4 polynucleotide kinase and [ -32P]ATP in the
buffer containing 70 mM Tris-HCl (pH 7.6), 10 mM MgCl2, and 5 mM dithiothreitol
at 37 °C for 1 h. To inactivate the T4 polynucleotide kinase,
the reaction mixture was heated for 10 min at 75 °C. Labeled
oligonucleotides were stored at 20 °C.
Immobilization of Biotinylated DNA on Polystyrene Streptavidin
Beads--
A tube containing a 1% (w/v) stock of beads (0.95-µm
mean diameter; Bang Laboratories, Inc.) was stirred vigorously for 2 min. Aliquots of 20-40 µl of a bead suspension were withdrawn from
the stock and pelleted by centrifugation for 4 min using a bench top
centrifuge (2000 × g). The pellet was resuspended (2 min of intense stirring) in an original volume of 0.1 M
NaHCO3 and mixed with 32P-labeled biotinylated
DNA. Prior to the immobilization, the radioactivity (cpm) of the
biotinylated DNA was determined using a scintillation counter LS6500
(Beckman) and its specific activity (cpm per mg) was calculated. The
immobilization was carried out for 15 min at 37 °C. Non-immobilized
DNA was removed by centrifugation for 4 min. After immobilization, the
beads with attached DNA were pelleted by centrifugation, and the
pellets were washed in the original volume of NaHCO3 and
pelleted again by centrifugation. The washing procedure was repeated
twice. The amount of DNA attached to beads was determined by measuring
the radioactivity of the bead, supernatant, and wash fractions and by
calculating it as a fraction relative to total DNA with known specific activity.
Protein Binding to Bead-immobilized ds- or ssDNA--
Fig. 1
illustrates our procedure for measuring the binding of Rad51 and Rad54
proteins to the DNA-beads. Rad51 and Rad54 proteins were bound to
DNA-beads in standard binding buffer containing 33 mM HEPES
(pH 7.0), 20 mM (or 25 mM) magnesium acetate,
and 2 mM ATP. Previously, we established that these
conditions are optimal for DNA strand exchange promoted by the yeast
Rad51 protein (32, 35). Typically, the reaction volumes were in
multiples of 10 µl; 10 µl represented the smallest volume unit of
the reaction mixture. Where indicated, the mixture was supplemented
with an ATP regeneration system containing either 3 mM
phosphoenolpyruvate and 20 units/ml pyruvate kinase or 20 mM phosphocreatine and 30 units/ml phosphocreatine kinase.
Rad51 protein was incubated with beads for 15 min at 37 °C. Rad54
protein was incubated with dsDNA-beads or Rad51-dsDNA-beads for 10 min
at 37 °C, unless indicated otherwise. When longer periods of
incubation were applied, the Rad51-dsDNA filaments were formed at
37 °C and then cooled to room temperature (23 °C) prior to the
addition of Rad54 protein. After completion of protein binding, 10-µl
aliquots were withdrawn from reaction mixtures, and beads were pelleted
by centrifugation for 4 min. Where indicated, pellets were resuspended
in 10 µl of standard buffer and pelleted again. Finally, beads were
resuspended in 10 µl of SDS-polyacrylamide gel running buffer and
mixed with 2 µl of 6× SDS loading buffer (350 mM
Tris-HCl, pH 6.8, 1% SDS, 6% 2-mercaptoethanol, 36% glycerol, and
0.1% bromphenol blue) and incubated at 95 °C for 3 min. Samples
were then analyzed by electrophoresis in 8% SDS-polyacrylamide gels.
Protein bands were visualized by staining with Coomassie Brilliant Blue
(R-250). Typically, we analyzed both the bound and free protein
fractions and determined the relative amounts of proteins in these
fractions using high resolution cooled CCD digital camera and GelPro
3.0 software.
To determine the salt titration midpoint (STMP) of the Rad51-DNA
complexes, the preformed Rad51-DNA or Rad54-Rad51-DNA nucleoprotein complexes were incubated in reaction mixtures of 11.9 µl in the presence of various concentrations (0-880 mM) of NaCl for
5 min. The beads were pelleted by centrifugation, and the amounts of DNA-bound proteins were determined as described above. Salt that was
added along with Rad54 or Rad54 K341R protein, whose stocks contained 1 M NaCl, was taken into account in all STMP calculations.
Restriction Endonuclease Protection Assay--
To form Rad51
nucleoprotein filaments, Rad51 protein (0.575 or 0.85 µM)
was incubated with dsDNA (3.45 µM, nucleotides) (63 base
pairs, oligonucleotides 109-111) in buffer containing 33 mM HEPES (pH 7.0), 10 mM magnesium acetate, 2 mM dithiothreitol, 2 mM ATP, 100 µg/ml bovine
serum albumin at 37 °C for 15 min. For ATP regeneration, 15 mM phosphocreatine and 20 units/ml of phosphocreatine
kinase were included in the reaction. Aliquots of 9 µl containing the
Rad51-dsDNA complexes were withdrawn from the reaction mixture and
mixed with 1 µl of Rad54 protein at various concentrations. DNA
cleavage was initiated by the addition of 1 µl of RsaI (10 units) endonuclease. The reactions were carried out for 15 min at
37 °C. DNA products were deproteinized by the addition of EDTA to 50 mM, SDS to 1%, and proteinase K to 700 mg/ml, incubated
for 5 min at 37 °C, and analyzed in 10% polyacrylamide gels.
DNA Strand Exchange--
To form Rad51 nucleoprotein filaments,
Rad51 protein (1 µM) was incubated with ssDNA (63-mer,
oligonucleotide 2) (3 µM) in buffer containing 33 mM HEPES (pH 7.0), 10 mM magnesium acetate, 2 mM dithiothreitol, 2 mM ATP, 100 µg/ml bovine
serum albumin at 37 °C for 15 min. The reaction temperature was
decreased to 30 °C, and, where indicated, Rad54 protein (0.125 µM) was added to the reaction. Aliquots (8 µl) were
mixed with the indicated amounts of NaCl (1 µl), and pairing
reactions were initiated immediately by the addition of 1 µl of dsDNA
(32 base pairs, oligonucleotides 5 and 6) (3 µM,
nucleotides) and continued for 15 min. DNA products were deproteinized
by the addition of EDTA to 50 mM, SDS to 1%, and
proteinase K to 500 µg/ml followed by incubation for 5 min at
37 °C. Samples were mixed with one-tenth volume of loading buffer
(20% Ficoll, 0.1% bromphenol blue) and analyzed by electrophoresis in
a 10% polyacrylamide gel in TBE buffer (90 mM Tris borate, pH 8.3, and 0.5 mM EDTA). The extent of DNA strand exchange
was quantified using a Storm 840 PhosphorImager (Amersham
Biosciences).
 |
RESULTS |
Rad54 Protein Forms Stoichiometric Complexes with Rad51-DNA
Filaments--
Previously, we found that a stoichiometric amount (1:1)
of Rad54 protein relative to Rad51 protein is required for maximal stimulation of joint molecule formation by the Rad51 nucleoprotein filament (24). This finding implied that a co-complex with the nucleoprotein filament, containing equimolar amounts of Rad54 and Rad51
proteins, is the functional species. To obtain physical evidence for
this complex, we quantified the binding of Rad54 protein to Rad51
nucleoprotein filaments assembled on biotinylated DNA, which was
attached to streptavidin-coated polystyrene beads (Fig.
1).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Experimental design. Biotinylated DNA
that was immobilized on streptavidin-coated beads was used as a binding
substrate for Rad51 and Rad54 proteins. Nucleoprotein complexes
were separated from unbound proteins by centrifugation, and
proteins bound and those remaining free were analyzed by
SDS-polyacrylamide gel electrophoresis (the image of the gel is simply
an illustration of the expected results).
|
|
First, we confirmed the stoichiometry of Rad51 protein binding to ssDNA
(48-mer). For this purpose, we incubated a fixed amount of ssDNA-beads
with increasing amounts of Rad51 protein and then analyzed the amount
of Rad51 protein bound to the DNA-beads by SDS-gel electrophoresis. As
expected, Rad51 protein binds to the ssDNA with a stoichiometry that is
~1 protein monomer per 3 nucleotides of ssDNA, based on the amount of
Rad51 protein (~0.6 µM) bound to DNA (1.93 µM, total concentration) at saturation (Fig.
2, A and B). Then,
in a similar experiment, we examined the binding of Rad51 protein to
dsDNA (100 base pairs) immobilized on beads at two different
concentrations. As with ssDNA, the stoichiometry of Rad51 protein
binding to the dsDNA is ~1 protein monomer per 3 base pairs of dsDNA
at two different DNA concentrations (Fig. 2C). In these
experiments, the level of nonspecific Rad51 protein binding to the
polystyrene beads lacking DNA never exceeded 10% of Rad51 protein
binding to either dsDNA-beads or ssDNA-beads (Fig. 2). Therefore,
Rad51 protein binds to ssDNA and dsDNA that is immobilized on
beads with the same binding stoichiometry that was observed previously
(10, 36, 37).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2.
Rad51 protein binds stoichiometrically to DNA
immobilized on polystyrene beads. Bead-immobilized ssDNA or dsDNA
was incubated with Rad51 protein at the indicated concentrations. The
bound and free Rad51 protein fractions were separated by centrifugation
and analyzed by SDS electrophoresis in 8% polyacrylamide gels.
Coomassie-stained gels showing the binding of Rad51 protein to ssDNA
(48-mer, oligonucleotide 48) (1.93 µM) are shown in
A; quantification of these gels is shown in B.
Note that only 55% of the fractions of bound protein were loaded on
the gel; for the fractions of free protein, the entire fractions were
loaded. The graph in C depicts binding of Rad51
protein to bead-immobilized dsDNA (100 base pairs, positions 77 and 78)
at a nucleotide concentration of either 1.62 µM
(squares) or 3.85 µM (circles). The
nonspecific binding of Rad51 protein to the beads lacking DNA is shown
by the triangles. Typically, experiments were repeated at
least three times, with S.E. not exceeding 10%.
|
|
Next, we determined the stoichiometry of Rad54 protein binding to a
Rad51 nucleoprotein filament that was assembled on the ssDNA. These
preassembled Rad51-nucleoprotein filaments were incubated with
increasing amounts of Rad54 protein. We found that Rad54 protein forms
a stable complex with the Rad51-ssDNA complexes (Fig.
3A). The amount of Rad51
protein in these co-complexes does not decrease with increasing Rad54
protein binding, demonstrating that the Rad51 protein is not being
displaced; if anything, there was a slight increase in the amount of
bound Rad51 protein, suggesting stabilization (see below). At
saturating Rad54 protein concentrations, these complexes contain
equimolar amounts of Rad51 and Rad54 proteins (Fig. 3B). The
level of nonspecific Rad54 protein binding to the polystyrene beads
lacking DNA did not exceed 15% of Rad54 protein binding to the
Rad51-ssDNA complexes (see Fig.
4A).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
Rad54 protein binds stoichiometrically to the
Rad51-DNA filament. Bead-immobilized ssDNA (48-mer,
oligonucleotide 48) (0.64 µM) or dsDNA (100 base pairs,
oligonucleotides 77 and 78) (0.62 µM, nucleotide) was
incubated first with Rad51 protein (0.32 µM) and then
with Rad54 protein at the indicated concentrations as described under
"Experimental Procedures." The mixture was supplemented with an ATP
regeneration system containing 3 mM phosphoenolpyruvate and
20 units/ml pyruvate kinase. Proteins bound to ssDNA-beads or
dsDNA-beads were separated from free protein by centrifugation and
analyzed by SDS gel electrophoresis in 8% polyacrylamide gels.
Coomassie-stained gels showing the binding of Rad54 and Rad51
proteins to ssDNA are shown in A. Note that relative to the
fractions of free protein, only 80% of the volume of the fractions of
bound protein was loaded on the gel. The pyruvate kinase in the
fractions of bound protein results from the residual solution that
remains associated with the beads. Graphs show the binding of Rad51 and
Rad54 proteins to ssDNA-beads (B) and to dsDNA-beads
(C). The thin horizontal
lines in B and C indicate the
theoretical stoichiometry for binding of 1 Rad51 protein monomer per 3 nucleotides or base pairs. The binding experiments were repeated three
times; S.E. values for the measurements were smaller than 12%.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4.
Rad54 protein stabilizes the Rad51
nucleoprotein filament on either ssDNA or dsDNA. A and
C, the Rad51-ssDNA filaments were assembled by incubating
Rad51 protein (0.85 µM) with bead-immobilized ssDNA
(48-mer, oligonucleotide 48) (1.73 µM). Rad54 protein
(0.42 µM) (A) or mutant K341R Rad54 protein
(0.42 µM) (C) was added to the Rad51-ssDNA
nucleoprotein filaments to form Rad54-Rad51-ssDNA co-complexes. The
stability of the nucleoprotein complexes was challenged by NaCl for 5 min at 37 °C. The amounts of Rad51 protein, Rad54 protein, and K341R
Rad54 protein bound to ssDNA and dsDNA were determined using
SDS-polyacrylamide gel electrophoresis. The levels of Rad51 protein
binding either alone (51p) or in the presence of Rad54
protein (51p (+54p)) or of Rad54 K341R
mutant protein (51p (+K341R)) are indicated
by squares and triangles, respectively. The
levels of Rad54 protein (54p (+51)) or Rad54
K341R mutant protein binding in the presence of Rad51 protein
(K341R (+51p)) are indicated by
circles and open circles,
respectively. The nonspecific binding of Rad54 protein to beads devoid
of DNA is indicated in A by open
squares. The arrows indicate the STMP of the
Rad51-ssDNA complexes. Typically, binding experiments were repeated
three times; S.E. values for each point were smaller than 10%.
B, Rad51-dsDNA filaments were assembled by incubating Rad51
protein (0.85 µM) with bead-immobilized dsDNA (48 base
pairs, positions 48-26) (3.45 µM, nucleotides).
Rad54 protein was added at the indicated concentrations. The stability
of the nucleoprotein complex was challenged by NaCl for 5 min at
37 °C. For each Rad54 protein concentration, the STMP was determined
from experiments done at 5-11 different NaCl concentrations. The STMP
for each Rad54 protein-Rad51 protein-dsDNA complex is plotted.
|
|
Similar experiments were conducted using Rad51-dsDNA filaments (gel
data not shown). In this case, we also observed increased binding of
Rad54 protein until saturation of the Rad51-dsDNA complexes was
achieved (Fig. 3C). As was the case for ssDNA, saturation occurred at approximately one Rad54 monomer per Rad51 monomer. Also, it
appeared that increasing amounts of Rad54 protein promoted a slight
increase of Rad51 protein bound, particularly at the lower
concentrations of Rad54 protein (see below). Thus, Rad54 protein forms
a stable co-complex with the Rad51 nucleoprotein filament, assembled on
either ssDNA or dsDNA, without the displacement of Rad51 protein.
Rad54 Protein Stabilizes the Rad51 Nucleoprotein Filament Assembled
on Either ssDNA or dsDNA--
The slight increase in bound Rad51
protein that was detected in Fig. 3, when Rad54 protein was present,
suggested that Rad54 protein might affect the stability of the
Rad51-ssDNA and Rad51-dsDNA nucleoprotein filaments. As a criterion for
stability, we used the resistance of the filament to disruption by NaCl
(36, 38, 39). Consequently, the nucleoprotein complexes were incubated in the presence of increasing concentrations of NaCl, and the amount of
Rad51 protein bound to ssDNA was determined (Fig. 4A). We
observed a decreased amount of Rad51 protein bound to dsDNA upon the
addition of NaCl (36). The STMP, which is defined as the NaCl
concentration at which one-half of the protein (relative to the fully
saturated complex) is dissociated from the nucleoprotein complexes, is
~120 mM NaCl for Rad51 protein, when Rad54 protein was
absent (Fig. 4A, squares). Interestingly, in the
presence of 0.42 µM Rad54 protein (triangles),
the STMP for the Rad51-ssDNA complexes increased to 300 mM.
Similar NaCl titration experiments were conducted using dsDNA instead
of ssDNA (titrations not shown). We found that Rad54 protein also
stabilized the Rad51-dsDNA filament in a similar manner (Fig.
4B). The STMP for the Rad51-dsDNA complexes is less than 50 mM NaCl for Rad51 protein, when Rad54 protein was absent. In the presence of Rad54 protein, we found that the addition of increasing amounts caused a gradual increase in the salt resistance of
the Rad51-dsDNA complex. At the highest Rad54 protein concentration tested (0.42 µM), representing a stoichiometry of one
Rad54 protein monomer per two Rad51 protein monomers), the STMP for
Rad51 protein increased to 260 mM NaCl. Thus, Rad54 protein
substantially stabilizes both the Rad51-ssDNA and the Rad51-dsDNA
nucleoprotein complexes.
In the salt stability experiments described above, we also measured the
binding of Rad54 protein to the Rad51-ssDNA and Rad51-dsDNA complexes
at each of the NaCl concentrations. The Rad54 nucleoprotein complexes
show a very high resistance to NaCl: at 770 mM NaCl, about
80 and 50% of Rad54 protein remains complexed with ssDNA (Fig.
4A, filled circles) and dsDNA (data
not shown), respectively. The effect of nonspecific binding of Rad54
protein to beads was also tested; it was negligible over the entire
range of tested salt concentrations (Fig. 4A,
open squares). Thus, Rad54 protein remains bound
to DNA over the range of these experiments, and the stabilizing effect
of Rad54 protein on the Rad51-DNA nucleoprotein complexes is probably
associated with its high affinity for DNA.
Stabilization of the Rad51-DNA Complex Is Independent of the ATPase
Activity of Rad54 Protein--
Previously, it was shown that the Rad54
K341R mutant protein, which lacks ATP hydrolysis and dsDNA unwinding
activities, is still proficient in binding to both DNA and Rad51
protein (29).2 Therefore, we
tested this mutant protein with regard to its capacity to stabilize
Rad51 nucleoprotein filaments. We found that the K341R mutant protein
also stabilized the Rad51-ssDNA nucleoprotein to the same degree as the
wild type Rad54 protein and that it also showed a high affinity for DNA
(Fig. 4C). These results show that neither ATP hydrolysis
nor DNA unwinding activity is needed for stabilization of the Rad51
nucleoprotein filament. Rather, we conclude that the stabilizing effect
of Rad54 protein on the Rad51 filament results from both its high
affinity for DNA and its ability to bind DNA and Rad51 protein
simultaneously within the filament.
Rad54 Protein Increases Protection of dsDNA within the Rad51
Filament from Restriction Endonucleases--
As an independent measure
of filament stability, we examined the ability of Rad54 protein to
protect dsDNA, within a Rad51 filament, from restriction endonuclease
cleavage. The nucleoprotein complexes were formed by incubating Rad51
and Rad54 proteins with dsDNA (63 base pairs), which was then incubated
with RsaI restriction endonuclease. The binding of Rad51
protein alone, at a stoichiometry of 1:3 base pairs, provided only
partial protection, whereas the binding of Rad54 protein alone provided
no protection to dsDNA against cleavage by RsaI endonuclease
(Fig. 5A). However, the addition of Rad54 protein to the Rad51-dsDNA filament led to an almost
complete protection of the dsDNA against RsaI cleavage. The
Rad54 protein concentration dependence of this protection (Fig.
5B) also resembled the profile observed in the salt
titration experiments; these results are consistent with Rad54 protein
stabilizing the Rad51-dsDNA nucleoprotein, thereby reducing its
dissociation from dsDNA and, consequently, protecting the dsDNA from
endonuclease cleavage. Thus, using two independent approaches, we find
that the binding of Rad54 protein increases the stability of the
Rad51-dsDNA nucleoprotein.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
The binding of Rad54 protein to the
Rad51-dsDNA nucleoprotein protects it against endonucleolytic
cleavage. A, the Rad51 and Rad54 nucleoprotein
complexes were formed by incubating Rad51 protein (0.575 µM) or Rad54 protein (0.575 µM),
respectively, with dsDNA (63 base pairs, oligonucleotides 109-111)
(3.45 µM, nucleotides). Rad54-Rad51-dsDNA nucleoprotein
co-complexes were formed by incubating the Rad51-dsDNA complexes with
Rad54 protein (0.575 µM) for 5 min. RsaI
endonuclease (10 units) was added to each complex. DNA products were
deproteinized and analyzed by electrophoresis in 10% polyacrylamide
gels, with untreated dsDNA as a control (left
lane). B, a titration with Rad54 protein was
performed as in A, except the Rad51 concentration was 0.85 µM.
|
|
Rad54 Protein Stabilizes the Rad51 Nucleoprotein Filament against
Dissociation--
The experiments described thus far were performed
with relatively short DNA substrates. The Rad51 nucleoprotein filaments formed with such short fragments are intrinsically unstable. Therefore, we asked whether Rad54 protein also stabilizes longer Rad51-DNA nucleoprotein filaments. To answer this question, we studied the effect
of Rad54 protein on the transfer of Rad51 protein from complexes formed
with relaxed circular pUC19 dsDNA to bead-immobilized dsDNA (100 base
pairs) (Fig. 6A). We found
that even low Rad54 protein concentrations (0.034 µM;
representing a stoichiometry of 1 Rad54 protein monomer per 50 Rad51
protein monomers) significantly inhibited transfer of Rad51 protein
from the nucleoprotein complex with pUC19 DNA to the naked
bead-immobilized dsDNA (Fig. 6B). Thus, Rad54 protein has
significant stabilizing effect on both short and long Rad51
nucleoprotein filaments.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 6.
Rad54 protein inhibits transfer of Rad51
protein between DNA molecules. The experimental outline is shown
in A. The Rad51 nucleoprotein filament was formed by
incubating Rad51 protein (1.7 µM) with relaxed circular
pUC19 dsDNA (10 µM, nucleotides). The reaction mixture
was divided in two, and Rad54 protein (0.034 µM) was
added to one set. These two mixtures were incubated with dsDNA-beads
(100 base pairs, oligonucleotides 77 and 78) (10 µM,
nucleotides) for 30 min at 37 °C. B, the amounts of Rad51
protein remaining associated with the pUC19 dsDNA in solution
(white bars) or transferred to the DNA-bead
fraction (gray bars) were determined as described
under "Experimental Procedures."
|
|
Rad54 Protein Increases the Salt Resistance of DNA Strand Exchange
Promoted by Rad51 Protein--
We next asked whether the stabilizing
effect of Rad54 protein on the Rad51-DNA nucleoprotein filament
contributes to the latter's capacity to promote DNA strand exchange.
To answer this question, we measured the efficiency of DNA strand
exchange in the presence of Rad54 protein at increasing NaCl
concentrations. DNA strand exchange promoted by Rad51 protein alone
showed a sensitivity to NaCl; the product yield decreased by one-half
at 115 mM NaCl (Fig. 7).
However, in the presence of Rad54 protein, both the yield of DNA strand
exchange products was higher at all conditions, and the reaction itself
was less sensitive to inhibition by NaCl; 220 mM NaCl was
required for a 50% inhibition. Thus, we conclude that Rad54 protein
not only stimulates DNA strand exchange under what might be considered
"standard" in vitro reaction conditions, but it also
specifically increases the resistance of the reaction to increasing
salt concentrations. This result indicates that the stabilizing effect
of Rad54 protein on the Rad51-ssDNA filament, indeed, contributes to
the stimulation of DNA strand exchange.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Rad54 protein increases the salt resistance
of DNA strand exchange promoted by Rad51 protein. The DNA strand
exchange reaction employed is shown in the right
panel. Nucleoprotein complexes were formed by incubating
Rad51 protein (1 µM) with ssDNA (63-mer, oligonucleotide
2) (3 µM). The reaction mixture was divided in two, and
Rad54 protein (0.125 µM) was added to one set. DNA strand
exchange with dsDNA (32 base pairs, oligonucleotides 5 and 6) (3 µM, nucleotides) was carried out for 15 min at the
indicated NaCl concentrations. The products of DNA strand exchange were
deproteinized and analyzed by electrophoresis in a 10% polyacrylamide
gel in TBE buffer. The arrows indicate the salt
concentration at which the reaction is half-inhibited. Experiments were
repeated three times, with S.E. values not exceeding 10-12%.
|
|
 |
DISCUSSION |
Recent studies have revealed extensive species-specific
interactions between the proteins involved in homologous recombination. For instance, the Rad51 protein interacts with a number of other homologous recombination proteins, including Rad52 protein (8), Rad55
protein (40), and Rad54 protein (41, 42). In addition, Rad55 protein
forms a stable heterodimer with Rad57 protein (21); Rad50 protein,
Mre11 protein, and Xrs2 protein form a heterotrimer (43); and Rad52
protein interacts with RPA (44, 45). These multiple interactions permit
formation of a variety of complexes, whose dynamic properties permit
great flexibility in responding to various endogenous or exogenous DNA
damages. It is important, therefore, to understand the consequences of
these interactions on the DNA pairing activity of a protein central to
the recombinational repair process, the Rad51 protein.
Our results demonstrate that Rad54 protein binds directly to the
Rad51-DNA nucleoprotein filament to form a Rad54-Rad51-DNA co-complex.
At saturation, the binding stoichiometry of Rad54 protein within this
joint complex is ~1:1 relative to Rad51 protein. Previously, based on
enzymatic assays, Rad54 was inferred to interact with the assembled
Rad51-ssDNA filament (24, 31). This interaction leads to synergistic
enhancement of the DNA pairing activity of Rad51 protein and,
reciprocally, the dsDNA-dependent ATPase and the dsDNA
topological unwinding activities of Rad54 protein. These findings were
important primarily because they argued that Rad54 protein was not
acting independently at the duplex DNA to promote DNA recombination
but, rather, that it was acting as part of, and in concert with, the
Rad51 presynaptic filament. Our findings here provide physical evidence
for this novel stoichiometric interaction between a recombination
protein and the Rad51 nucleoprotein filament, and they also provide a
mechanistic explanation for enhancement of the enzymatic activities of
both Rad51 and Rad54 proteins.
We should emphasize that, despite demonstrating the existence of
saturated Rad54-Rad51-DNA complexes, the stimulatory effects are linear
in response to increasing Rad54 protein concentration, and stimulation
occurs over a broad range of concentrations. For example, our current
results demonstrate that even when present at 1 Rad54 protein monomer
per 50 Rad51 protein monomers, Rad54 protein exerts a stabilizing
effect on the Rad51-DNA filament, and increasing the Rad54 protein
concentration results in progressively increased stabilization.
Similarly, increasing Rad54 protein concentrations progressively
stimulate DNA strand exchange at protein ratios ranging from
"catalytic" (1:50 Rad54/Rad51) to "stoichiometric" (1:1) (24,
28, 31). Thus, the maximal stimulation seen at equimolar amounts of
Rad54 and Rad51 proteins in certain assays represents the limiting
level rather than an obligatory requirement to form such saturated
complexes. In this regard, it remains intriguing that the intracellular
ratio of Rad54 protein to Rad51 protein for both yeast and mouse cells
is approximately equimolar (46, 47), a physiological finding that is
consistent with our biochemical observations. The observation that
stimulation saturates at lower than equimolar in some in
vitro experiments can result from any number of factors. For
instance, the maximal level of the stimulation observed in experiments
with longer (kb-sized) ssDNA substrates was at ~1 Rad54 protein per
20-50 Rad51 protein monomers (31). Because Rad51 protein forms more
stable filaments with longer DNA substrates, saturating amounts of
Rad54 protein would not necessarily be needed; furthermore, we found
that with such DNA substrates (e.g. X174 ssDNA), the
higher Rad54 protein concentrations caused artifactual aggregation of
the DNA and the consequent inhibition of DNA strand
exchange.3 Also, lowering
either the magnesium ion concentration or the temperature, both factors
that destabilize RecA- and Rad51-ssDNA filament, may result in less
assembly of Rad51 protein into the presynaptic filament than expected,
particularly with short DNA substrates, resulting in a concomitantly
reduced concentration of Rad54 protein at saturation (28). The thermal
instability of Rad54 protein (31, 48) cannot explain the observed
stoichiometries in the oligonucleotide-based D-loop assays
(28), because the assay time is short. Thus, both real and artifactual
reasons can explain lower than maximal stoichiometries. Regardless,
these collective experiments demonstrate that Rad54 protein interacts directly with the Rad51 nucleoprotein filament and that this co-complex is the active species in recombination processes.
We showed here that the binding of Rad54 protein to the Rad51-DNA
nucleoprotein filament has a strong effect on its stability and that
this is one element explaining the enhanced functionality of the
co-complex. Our results provide three lines of evidence that the
binding of Rad54 protein increases the structural stability of both the
Rad51-ssDNA and Rad51-dsDNA nucleoprotein filaments. First,
salt-titration experiments yield direct evidence that Rad54 protein has
a stabilizing effect on the Rad51 nucleoprotein complex formed with
either ssDNA or dsDNA. Second, the Rad54-Rad51-dsDNA co-complex
provides much better protection to dsDNA against restriction endonucleases than does either protein alone. Finally, the binding of
Rad54 protein significantly inhibits the transfer of Rad51 protein from
one dsDNA molecule onto another. Stabilization does not depend on
either the ATPase or on DNA topology-remodeling activities of Rad54
protein, because the Rad54 mutant protein, K341R, which lacks both of
these activities, has a similar stabilizing effect on the Rad51
nucleoprotein filament. Hence, we believe that Rad54 protein stabilizes
the Rad51-DNA nucleoprotein filament by virtue of its ability to
interact simultaneously with Rad51 protein and the DNA molecule within
the filament.
Experiments using the yeast two-hybrid system and immunoprecipitation
proved that Rad51 protein can interact with Rad54 protein (41, 42). We
demonstrated directly that Rad51 protein retains its ability to
interact with Rad54 protein when it is assembled into a filament on
DNA, and we also showed that Rad54 protein also interacts with the DNA
component of the complex (Fig. 4). In addition, we observed that the
Rad51-dsDNA nucleoprotein filament, formed with saturating
concentrations of Rad51 protein, stimulates the ATPase activity of
Rad54 protein better than naked dsDNA, especially at low Rad54 protein
concentrations.3 This stimulation is species-specific,
because when yeast Rad51 protein was replaced in the nucleoprotein
complex with its human homologue, an inhibition of the ATPase activity
of Rad54 protein resulted.3 Taken together, these results
indicate that Rad51 protein within the filament interacts specifically
with Rad54 protein and facilitates its incorporation onto the filament,
and we conclude that Rad54 protein can interact with dsDNA within the
Rad51-dsDNA nucleoprotein filament. In contrast, the binding of Rad54
protein to the Rad51-ssDNA does not activate ATP hydrolysis by Rad54
protein (24), indicating that the interaction of Rad54 protein with
dsDNA within the filament is essential for its ATPase activity. The
DNA-binding experiments show that, even in the context of the Rad51-DNA
nucleoprotein filament, Rad54 protein displays very high affinity for
DNA; incubation of the Rad54-Rad51-DNA complexes at 0.8 M
NaCl, which removes virtually all Rad51 protein, could not remove Rad54
protein completely. This is true for both ssDNA (Fig. 4) and dsDNA (not
shown). We believe that this high affinity for DNA is the factor
responsible for the stabilizing effect of Rad54 protein on the Rad51
nucleoprotein filament.
Genetic studies suggest that Rad54 protein functions after formation of
the Rad51 presynaptic filament (49, 50). Our current results add to
this now canonical view by establishing that the binding of Rad54
protein to the preformed Rad51-DNA filament stabilizes it against
dissociation. Thus, the stabilization of existing Rad51-ssDNA filaments
constitutes an additional role of Rad54 protein in a "late" step of
the presynaptic stage of DNA strand exchange. There are in
vivo observations regarding this proposed presynaptic function for
Rad54 protein that are consistent with our results. First, in mouse
embryonic stem cells or in meiotic S. cerevisiae cells, Rad51 protein foci formation is either Rad54
protein-dependent (23) or accelerated by Rad54 protein
(51). Given that visible foci represent extensive protein-DNA
complexes, our results suggest that the stabilization afforded by Rad54
protein binding allows detection of either presynaptic complexes (a
stabilized Rad51-ssDNA filament) or synaptic complexes (a stabilized
Rad51-heteroduplex DNA filament). Second, expression of human Rad54
K189R, which is completely deficient in the ATPase and DNA topology
remodeling activities that are essential for stimulation of DNA strand
exchange in vitro, partially rescues the -ray and
mitomycin-C sensitivity of mRAD54 knockout mouse ES cells
(48). These observations point to an additional Rad54 protein function
that is independent of its enzymatic activities; perhaps, in
vivo, the stabilization of Rad51-DNA nucleoprotein complex
by the Rad54 K341R protein that we detect might protect the processed
ssDNA against nucleolytic degradation and thereby allow it to
participate in repair through alternative mechanisms. Third, recently
it was demonstrated that overexpression of Rad54 protein in S. cerevisiae suppresses the -ray sensitivity of rad57
or rad51-K191R strains and that functional RAD57
was needed for this suppression of the mutant rad51-K191R strain (52). These results indicate that the Rad51-K191R protein, which
probably has a decreased affinity for DNA (53), requires Rad55/57
protein to form a presynaptic complex (21) and that this mutant Rad51
protein can function only when excess Rad54 is present. The authors
concluded that these in vivo findings are consistent with a
stabilizing effect of Rad54 protein on the Rad51-ssDNA filament
(52).
In summary, our results demonstrate that Rad54 protein forms a
co-complex with the Rad51-DNA filament and stabilizes it. We imagine
that co-complex formation and stabilization are important for several
steps in genetic recombination (Fig. 8).
By binding to the Rad51-ssDNA complex, Rad54 protein stabilizes the
presynaptic complex. In vitro, this stabilization is
especially important for stimulation of DNA pairing by Rad51 protein
using short ssDNA substrates. In vivo, this mode of
stimulation may act in a similar way by stabilizing short, and
therefore intrinsically unstable, Rad51-ssDNA filaments and making them
longer lived in both the homology search process and dsDNA invasion.
Because Rad54 protein is part of the presynaptic filament, it can now
participate directly in the homology search and DNA pairing steps,
probably facilitating DNA strand exchange through its DNA topological
unwinding ability. In addition, recently it was shown that Rad54
protein is needed for pairing when the target is chromatin (54); both
that work and our own (55) have shown that that Rad54 protein can
remodel chromatin. Thus, the removal of nucleosomal structure further increases the accessibility of dsDNA for homologous recognition and
pairing in vivo. Furthermore, since Rad51 protein is bound to the heteroduplex DNA product, the continued binding of Rad54 protein
to this heteroduplex product will help to stabilize this intrinsically
labile nascent joint molecule; one suggested interpretation of recent
mutational analysis is in accord with heteroduplex DNA stabilization
(56). Finally, by virtue of having been delivered to the heteroduplex
DNA, Rad54 protein can use its inferred translocation ability (26, 27)
to migrate the heteroduplex joint as is observed (25). This movement of
Rad54 protein on the duplex DNA can also help strip the stable
Rad51-dsDNA complex that remains (57), especially if Rad54 protein were
to start translocating through the region of DNA heteroduplex that is
bound with Rad51 protein. Therefore, Rad54 protein is a multifunctional
protein that can have a role in the presynaptic, synaptic, and
postsynaptic steps of DNA strand exchange, acting in each step by a
different mechanism: binding, unwinding, and translocation,
respectively.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
Proposed role of Rad54 protein: stabilization
of the Rad51 nucleoprotein filament. Shown is Rad51-ssDNA filament
formed on ssDNA resulting from nucleolytic processing of a
double-stranded break. Binding of Rad54 protein stabilizes the
initially unstable Rad51-ssDNA filament and prevents Rad51 protein
dissociation and transfer to undamaged dsDNA. This stabilization
stimulates DNA strand exchange promoted by Rad51 protein, and Rad54
protein is delivered to the homologous target dsDNA by the Rad51
nucleoprotein filament. The enhanced stability of the Rad51-dsDNA
product stabilizes the nascent DNA heteroduplex.
|
|
 |
ACKNOWLEDGEMENTS |
We are grateful to Mark Dillingham, Naofumi
Handa, Cynthia Haseltine, Alexander Ichtchenko, Noriko Kantake, Olga
Mazina, Katsumi Morimatsu, James New, Zeynep Ozsoy, Maria Spies, Edgar
Velencia-Morales, and Yun Wu for comments on the manuscript. We also
thank Jennifer Hanekamp for help in developing the techniques of using
bead-immobilized DNA to measure protein binding. We are especially
grateful to Wolf Heyer (University of California, Davis) for
providing Rad54 K341R mutant protein.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM-62653 (to S. C. K.), Drexel University College of Medicine startup funds, and Pennsylvania Health Research Formula Funds from the
Tobacco Settlement Act (to A. V. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Section of
Microbiology, Briggs Hall, University of California, Davis, Davis, CA 95616-8665. Tel.: 530-752-5938; Fax: 530-752-5939;
E-mail: sckowalczykowski@ucdavis.edu.
Published, JBC Papers in Press, February 3, 2003, DOI 10.1074/jbc.M212779200
2
A. V. Mazin, A. A. Alexeev, and
S. C. Kowalczykowski, unpublished observations.
3
A. V. Mazin and S. C. Kowalczykowski,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
ssDNA, single-stranded DNA;
dsDNA, double-stranded DNA;
STMP, salt titration
midpoint.
 |
REFERENCES |
| 1.
|
Kuzminov, A.
(1999)
Microbiol. Mol. Biol. Rev.
63,
751-813[Abstract/Free Full Text]
|
| 2.
|
Kowalczykowski, S. C.
(2000)
Trends Biochem. Sci.
25,
156-165[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Baumann, P.,
and West, S. C.
(1998)
Trends Biochem. Sci.
23,
247-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Seitz, E. M.,
Haseltine, C. A.,
and Kowalczykowski, S. C.
(2001)
Adv. Appl. Microbiol.
50,
101-169[Medline]
[Order article via Infotrieve]
|
| 5.
|
Sung, P.,
Trujillo, K. M.,
and Van Komen, S.
(2000)
Mutat. Res.
451,
257-275[Medline]
[Order article via Infotrieve]
|
| 6.
|
van Gent, D. C.,
Hoeijmakers, J. H.,
and Kanaar, R.
(2001)
Nat. Rev. Genet.
2,
196-206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Game, J. C.
(2000)
Mutat. Res.
451,
277-293[Medline]
[Order article via Infotrieve]
|
| 8.
|
Shinohara, A.,
Ogawa, H.,
and Ogawa, T.
(1992)
Cell
69,
457-470[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Stasiak, A.,
and Di Capua, E.
(1982)
Nature
299,
185-186[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Ogawa, T., Yu, X.,
Shinohara, A.,
and Egelman, E. H.
(1993)
Science
259,
1896-1899[Abstract/Free Full Text]
|
| 11.
|
Seitz, E. M.,
Brockman, J. P.,
Sandler, S. J.,
Clark, A. J.,
and Kowalczykowski, S. C.
(1998)
Genes Dev.
12,
1248-1253[Abstract/Free Full Text]
|
| 12.
|
McEntee, K.,
Weinstock, G. M.,
and Lehman, I. R.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
2615-2619[Abstract/Free Full Text]
|
| 13.
|
Shibata, T.,
DasGupta, C.,
Cunningham, R. P.,
and Radding, C. M.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
1638-1642[Abstract/Free Full Text]
|
| 14.
|
Sung, P.
(1994)
Science
265,
1241-1243[Abstract/Free Full Text]
|
| 15.
|
Baumann, P.,
Benson, F. E.,
and West, S. C.
(1996)
Cell
87,
757-766[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Gupta, R. C.,
Bazemore, L. R.,
Golub, E. I.,
and Radding, C. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
463-468[Abstract/Free Full Text]
|
| 17.
|
Sung, P.
(1997)
J. Biol. Chem.
272,
28194-28197[Abstract/Free Full Text]
|
| 18.
|
New, J. H.,
Sugiyama, T.,
Zaitseva, E.,
and Kowalczykowski, S. C.
(1998)
Nature
391,
407-410[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Shinohara, A.,
and Ogawa, T.
(1998)
Nature
391,
404-407[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Sugiyama, T.,
and Kowalczykowski, S. C.
(2002)
J. Biol. Chem.
277,
31663-31672[Abstract/Free Full Text]
|
| 21.
|
Sung, P.
(1997)
Genes Dev.
11,
1111-1121[Abstract/Free Full Text]
|
| 22.
|
Petukhova, G.,
Stratton, S.,
and Sung, P.
(1998)
Nature
393,
91-94[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Tan, T. L.,
Essers, J.,
Citterio, E.,
Swagemakers, S. M.,
de Wit, J.,
Benson, F. E.,
Hoeijmakers, J. H.,
and Kanaar, R.
(1999)
Curr. Biol.
9,
325-328[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Mazin, A. V.,
Bornarth, C. J.,
Solinger, J. A.,
Heyer, W. D.,
and Kowalczykowski, S. C.
(2000)
Mol. Cell
6,
583-592[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Solinger, J. A.,
and Heyer, W. D.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
8447-8453[Abstract/Free Full Text]
|
| 26.
|
Ristic, D.,
Wyman, C.,
Paulusma, C.,
and Kanaar, R.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
8454-8460[Abstract/Free Full Text]
|
| 27.
|
Van Komen, S.,
Petukhova, G.,
Sigurdsson, S.,
Stratton, S.,
and Sung, P.
(2000)
Mol. Cell
6,
563-572[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Van Komen, S.,
Petukhova, G.,
Sigurdsson, S.,
and Sung, P.
(2002)
J. Biol. Chem.
277,
43578-43587[Abstract/Free Full Text]
|
| 29.
|
Petukhova, G.,
Van Komen, S.,
Vergano, S.,
Klein, H.,
and Sung, P.
(1999)
J. Biol. Chem.
274,
29453-29462[Abstract/Free Full Text]
|
| 30.
|
Fyodorov, D. V.,
and Kadonaga, J. T.
(2001)
Cell
106,
523-525[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Solinger, J. A.,
Lutz, G.,
Sugiyama, T.,
Kowalczykowski, S. C.,
and Heyer, W. D.
(2001)
J. Mol. Biol.
307,
1207-1221[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Sugiyama, T.,
Zaitseva, E. M.,
and Kowalczykowski, S. C.
(1997)
J. Biol. Chem.
272,
7940-7945[Abstract/Free Full Text]
|
| 33.
|
Mazin, A. V.,
and Kowalczykowski, S. C.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10673-10678[Abstract/Free Full Text]
|
| 34.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed., Vol. 2
, p. 11.46, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 35.
|
Mazin, A. V.,
Zaitseva, E.,
Sung, P.,
and Kowalczykowski, S. C.
(2000)
EMBO J.
19,
1148-1156[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Zaitseva, E. M.,
Zaitsev, E. N.,
and Kowalczykowski, S. C.
(1999)
J. Biol. Chem.
274,
2907-2915[Abstract/Free Full Text]
|
| 37.
|
Sung, P.,
and Robberson, D. L.
(1995)
Cell
82,
453-461[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Menetski, J. P.,
and Kowalczykowski, S. C.
(1985)
J. Mol. Biol.
181,
281-295[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Lauder, S. D.,
and Kowalczykowski, S. C.
(1993)
J. Mol. Biol.
234,
72-86[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Hays, S. L.,
Firmenich, A. A.,
and Berg, P.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
6925-6929[Abstract/Free Full Text]
|
| 41.
|
Jiang, H.,
Xie, Y.,
Houston, P.,
Stemke-Hale, K.,
Mortensen, U. H.,
Rothstein, R.,
and Kodadek, T.
(1996)
J. Biol. Chem.
271,
33181-33186[Abstract/Free Full Text]
|
| 42.
|
Clever, B.,
Interthal, H.,
Schmuckli-Maurer, J.,
King, J.,
Sigrist, M.,
and Heyer, W. D.
(1997)
EMBO J.
16,
2535-2544[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Trujillo, K. M.,
Yuan, S. S.,
Lee, E. Y.,
and Sung, P.
(1998)
J. Biol. Chem.
273,
21447-21450[Abstract/Free Full Text]
|
| 44.
|
Shinohara, A.,
Shinohara, M.,
Ohta, T.,
Matsuda, S.,
and Ogawa, T.
(1998)
Genes Cells
3,
145-156[Abstract]
|
| 45.
|
Sugiyama, T.,
New, J. H.,
and Kowalczykowski, S. C.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
6049-6054[Abstract/Free Full Text]
|
| 46.
|
Clever, B.,
Schmuckli-Maurer, J.,
Sigrist, M.,
Glassner, B. J.,
and Heyer, W. D.
(1999)
Yeast
15,
721-740[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Essers, J.,
Hendriks, R. W.,
Wesoly, J.,
Beerens, C. E. T. M.,
Smit, B.,
Hoeijmakers, J. H. J.,
Wyman, C.,
Dronkert, M. L. G.,
and Kanaar, R.
(2002)
DNA Repair
1,
779-793[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Swagemakers, S. M.,
Essers, J.,
de Wit, J.,
Hoeijmakers, J. H.,
and Kanaar, R.
(1998)
J. Biol. Chem.
273,
28292-28297[Abstract/Free Full Text]
|
| 49.
|
Schild, D.
(1995)
Genetics
140,
115-127[Abstract]
|
| 50.
|
Rattray, A. J.,
and Symington, L. S.
(1995)
Genetics
139,
45-56[Abstract]
|
| 51.
|
Shinohara, M.,
Gasior, S. L.,
Bishop, D. K.,
and Shinohara, A.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
10814-10819[Abstract/Free Full Text]
|
| 52.
|
Morgan, E. A.,
Shah, N.,
and Symington, L. S.
(2002)
Mol. Cell. Biol.
22,
6336-6343[Abstract/Free Full Text]
|
| 53.
|
Sung, P.,
and Stratton, S. A.
(1996)
J. Biol. Chem.
271,
27983-27986[Abstract/Free Full Text]
|
| 54.
|
Alexiadis, V.,
and Kadonaga, J. T.
(2002)
Genes Dev.
16,
2767-2771[Abstract/Free Full Text]
|
| 55.
|
Alexeev, A.,
Mazin, A. V.,
and Kowalczykowski, S. C.
(2003)
Nat. Struct. Biol.
10,
182-186[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Kim, P. M.,
Paffett, K. S.,
Solinger, J. A.,
Heyer, W. D.,
and Nickoloff, J. A.
(2002)
Nucleic Acids Res.
30,
2727-2735[Abstract/Free Full Text]
|
| 57.
|
Kiianitsa, K.,
Solinger, J. A.,
and Heyer, W. D.
(2002)
J. Biol. Chem.
277,
46205-46215[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. C. Burgess, M. Lisby, V. Altmannova, L. Krejci, P. Sung, and R. Rothstein
Localization of recombination proteins and Srs2 reveals anti-recombinase function in vivo
J. Cell Biol.,
June 15, 2009;
185(6):
969 - 981.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Haseltine and S. C. Kowalczykowski
An archaeal Rad54 protein remodels DNA and stimulates DNA strand exchange by RadA
Nucleic Acids Res.,
May 1, 2009;
37(8):
2757 - 2770.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Nimonkar, R. A. Sica, and S. C. Kowalczykowski
Rad52 promotes second-end DNA capture in double-stranded break repair to form complement-stabilized joint molecules
PNAS,
March 3, 2009;
106(9):
3077 - 3082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li and W.-D. Heyer
RAD54 controls access to the invading 3'-OH end after RAD51-mediated DNA strand invasion in homologous recombination in Saccharomyces cerevisiae
Nucleic Acids Res.,
February 1, 2009;
37(2):
638 - 646.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Rothenberg, J. M. Grimme, M. Spies, and T. Ha
Human Rad52-mediated homology search and annealing occurs by continuous interactions between overlapping nucleoprotein complexes
PNAS,
December 23, 2008;
105(51):
20274 - 20279.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Mazina and A. V. Mazin
Human Rad54 protein stimulates human Mus81-Eme1 endonuclease
PNAS,
November 25, 2008;
105(47):
18249 - 18254.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sarai, W. Kagawa, N. Fujikawa, K. Saito, J. Hikiba, K. Tanaka, K. Miyagawa, H. Kurumizaka, and S. Yokoyama
Biochemical analysis of the N-terminal domain of human RAD54B
Nucleic Acids Res.,
October 1, 2008;
36(17):
5441 - 5450.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. J. Rossi and A. V. Mazin
Rad51 Protein Stimulates the Branch Migration Activity of Rad54 Protein
J. Biol. Chem.,
September 5, 2008;
283(36):
24698 - 24706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Trickey, M. Grimaldi, and H. Yamano
The Anaphase-Promoting Complex/Cyclosome Controls Repair and Recombination by Ubiquitylating Rhp54 in Fission Yeast
Mol. Cell. Biol.,
June 15, 2008;
28(12):
3905 - 3916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wu, N. Kantake, T. Sugiyama, and S. C. Kowalczykowski
Rad51 Protein Controls Rad52-mediated DNA Annealing
J. Biol. Chem.,
May 23, 2008;
283(21):
14883 - 14892.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Seong, M. G. Sehorn, I. Plate, I. Shi, B. Song, P. Chi, U. Mortensen, P. Sung, and L. Krejci
Molecular Anatomy of the Recombination Mediator Function of Saccharomyces cerevisiae Rad52
J. Biol. Chem.,
May 2, 2008;
283(18):
12166 - 12174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Klutstein, H. Shaked, A. Sherman, N. Avivi-Ragolsky, E. Shema, D. Zenvirth, A. A. Levy, and G. Simchen
Functional Conservation of the Yeast and Arabidopsis RAD54-Like Genes
Genetics,
April 1, 2008;
178(4):
2389 - 2397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Snowden, K.-S. Shim, C. Schmutte, S. Acharya, and R. Fishel
hMSH4-hMSH5 Adenosine Nucleotide Processing and Interactions with Homologous Recombination Machinery
J. Biol. Chem.,
January 4, 2008;
283(1):
145 - 154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Mine, L. Disseau, M. Takahashi, G. Cappello, M. Dutreix, and J.-L. Viovy
Real-time measurements of the nucleation, growth and dissociation of single Rad51 DNA nucleoprotein filaments
Nucleic Acids Res.,
December 18, 2007;
35(21):
7171 - 7187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Cullen, S. P. Hussey, C. Walker, J. Prudden, B.-Y. Wee, A. Dave, J. S. Findlay, A. P. Savory, and T. C. Humphrey
Break-Induced Loss of Heterozygosity in Fission Yeast: Dual Roles for Homologous Recombination in Promoting Translocations and Preventing De Novo Telomere Addition
Mol. Cell. Biol.,
November 1, 2007;
27(21):
7745 - 7757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Mazina, M. J. Rossi, N. H. Thomaa, and A. V. Mazin
Interactions of Human Rad54 Protein with Branched DNA Molecules
J. Biol. Chem.,
July 20, 2007;
282(29):
21068 - 21080.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Chi, J. San Filippo, M. G. Sehorn, G. V. Petukhova, and P. Sung
Bipartite stimulatory action of the Hop2-Mnd1 complex on the Rad51 recombinase
Genes & Dev.,
July 15, 2007;
21(14):
1747 - 1757.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, X.-P. Zhang, J. A. Solinger, K. Kiianitsa, X. Yu, E. H. Egelman, and W.-D. Heyer
Rad51 and Rad54 ATPase activities are both required to modulate Rad51-dsDNA filament dynamics
Nucleic Acids Res.,
June 22, 2007;
(2007)
gkm412v2.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. Fung, G. S. Fortin, S. E. Peterson, and L. S. Symington
The rad51-K191R ATPase-Defective Mutant Is Impaired for Presynaptic Filament Formation
Mol. Cell. Biol.,
December 15, 2006;
26(24):
9544 - 9554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Otterlei, P. Bruheim, B. Ahn, W. Bussen, P. Karmakar, K. Baynton, and V. A. Bohr
Werner syndrome protein participates in a complex with RAD51, RAD54, RAD54B and ATR in response to ICL-induced replication arrest
J. Cell Sci.,
December 15, 2006;
119(24):
5137 - 5146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. S. Symington and W.-D. Heyer
Some disassembly required: role of DNA translocases in the disruption of recombination intermediates and dead-end complexes
Genes & Dev.,
September 15, 2006;
20(18):
2479 - 2486.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Sarai, W. Kagawa, T. Kinebuchi, A. Kagawa, K. Tanaka, K. Miyagawa, S. Ikawa, T. Shibata, H. Kurumizaka, and S. Yokoyama
Stimulation of Dmc1-mediated DNA strand exchange by the human Rad54B protein
Nucleic Acids Res.,
September 11, 2006;
34(16):
4429 - 4437.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-D. Heyer, X. Li, M. Rolfsmeier, and X.-P. Zhang
Rad54: the Swiss Army knife of homologous recombination?
Nucleic Acids Res.,
September 10, 2006;
34(15):
4115 - 4125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. McCabe, N. C. Turner, C. J. Lord, K. Kluzek, A. Bialkowska, S. Swift, S. Giavara, M. J. O'Connor, A. N. Tutt, M. Z. Zdzienicka, et al.
Deficiency in the Repair of DNA Damage by Homologous Recombination and Sensitivity to Poly(ADP-Ribose) Polymerase Inhibition
Cancer Res.,
August 15, 2006;
66(16):
8109 - 8115.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kiianitsa, J. A. Solinger, and W.-D. Heyer
Terminal association of Rad54 protein with the Rad51-dsDNA filament
PNAS,
June 27, 2006;
103(26):
9767 - 9772.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wesoly, S. Agarwal, S. Sigurdsson, W. Bussen, S. Van Komen, J. Qin, H. van Steeg, J. van Benthem, E. Wassenaar, W. M. Baarends, et al.
Differential Contributions of Mammalian Rad54 Paralogs to Recombination, DNA Damage Repair, and Meiosis
Mol. Cell. Biol.,
February 1, 2006;
26(3):
976 - 989.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-P. Zhang, K.-I. Lee, J. A. Solinger, K. Kiianitsa, and W.-D. Heyer
Gly-103 in the N-terminal Domain of Saccharomyces cerevisiae Rad51 Protein Is Critical for DNA Binding
J. Biol. Chem.,
July 15, 2005;
280(28):
26303 - 26311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Ristic, M. Modesti, T. van der Heijden, J. van Noort, C. Dekker, R. Kanaar, and C. Wyman
Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function
Nucleic Acids Res.,
June 8, 2005;
33(10):
3292 - 3302.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Wolner and C. L. Peterson
ATP-dependent and ATP-independent Roles for the Rad54 Chromatin Remodeling Enzyme during Recombinational Repair of a DNA Double Strand Break
J. Biol. Chem.,
March 18, 2005;
280(11):
10855 - 10860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Raschle, S. Van Komen, P. Chi, T. Ellenberger, and P. Sung
Multiple Interactions with the Rad51 Recombinase Govern the Homologous Recombination Function of Rad54
J. Biol. Chem.,
December 10, 2004;
279(50):
51973 - 51980.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Mazina and A. V. Mazin
Human Rad54 Protein Stimulates DNA Strand Exchange Activity of hRad51 Protein in the Presence of Ca2+
J. Biol. Chem.,
December 10, 2004;
279(50):
52042 - 52051.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Alexiadis, A. Lusser, and J. T. Kadonaga
A Conserved N-terminal Motif in Rad54 Is Important for Chromatin Remodeling and Homologous Strand Pairing
J. Biol. Chem.,
June 25, 2004;
279(26):
27824 - 27829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Soustelle, L. Vernis, K. Freon, A. Reynaud-Angelin, R. Chanet, F. Fabre, and M. Heude
A New Saccharomyces cerevisiae Strain with a Mutant Smt3-Deconjugating Ulp1 Protein Is Affected in DNA Replication and Requires Srs2 and Homologous Recombination for Its Viability
Mol. Cell. Biol.,
June 15, 2004;
24(12):
5130 - 5143.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Smirnova, S. Van Komen, P. Sung, and H. L. Klein
Effects of Tumor-associated Mutations on Rad54 Functions
J. Biol. Chem.,
June 4, 2004;
279(23):
24081 - 24088.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sung, L. Krejci, S. Van Komen, and M. G. Sehorn
Rad51 Recombinase and Recombination Mediators
J. Biol. Chem.,
October 31, 2003;
278(44):
42729 - 42732.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Adachi, H. Suzuki, S. Iiizumi, and H. Koyama
Hypersensitivity of Nonhomologous DNA End-joining Mutants to VP-16 and ICRF-193: IMPLICATIONS FOR THE REPAIR OF TOPOISOMERASE II-MEDIATED DNA DAMAGE
J. Biol. Chem.,
September 19, 2003;
278(38):
35897 - 35902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ogrunc and A. Sancar
Identification and Characterization of Human MUS81-MMS4 Structure-specific Endonuclease
J. Biol. Chem.,
June 6, 2003;
278(24):
21715 - 21720.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|