|
Originally published In Press as doi:10.1074/jbc.M211618200 on January 30, 2003
J. Biol. Chem., Vol. 278, Issue 16, 14185-14195, April 18, 2003
Efficient Initiation of HIV-1 Reverse Transcription
in Vitro
REQUIREMENT FOR RNA SEQUENCES DOWNSTREAM OF THE PRIMER BINDING
SITE ABROGATED BY NUCLEOCAPSID PROTEIN-DEPENDENT PRIMER-TEMPLATE
INTERACTIONS*
Yasumasa
Iwatani §,
Abbey E.
Rosen¶ ,
Jianhui
Guo ,
Karin
Musier-Forsyth¶, and
Judith G.
Levin **
From the Laboratory of Molecular Genetics, NICHD,
National Institutes of Health, Bethesda, Maryland 20892 and the
¶ Department of Chemistry, University of Minnesota, Minneapolis,
Minnesota 55455
Received for publication, November 14, 2002, and in revised form, January 29, 2003
 |
ABSTRACT |
Synthesis of HIV-1 ( ) strong-stop DNA is
initiated following annealing of the 3' 18 nucleotides (nt) of
tRNA to the primer binding site (PBS)
near the 5' terminus of viral RNA. Here, we have investigated whether
sequences downstream of the PBS play a role in promoting efficient ( )
strong-stop DNA synthesis. Our findings demonstrate a template
requirement for at least 24 bases downstream of the PBS when
tRNA or an 18-nt RNA complementary to the PBS
(R18), but not an 18-nt DNA primer, are used. Additional assays using
18-nt DNA-RNA chimeric primers, as well as melting studies and circular
dichroism spectra of 18-nt primer:PBS duplexes, suggest that priming
efficiency is correlated with duplex conformation and stability.
Interestingly, in the presence of nucleocapsid protein (NC), the 24 downstream bases are dispensable for synthesis primed by
tRNA but not by R18. We present data supporting the
conclusion that NC promotes extended interactions between the anticodon
stem and variable loop of tRNA and a sequence
upstream of the A-rich loop in the template. Taken together, this study leads to new insights into the initiation of HIV-1 reverse
transcription and the functional role of NC-facilitated tRNA-template
interactions in this process.
 |
INTRODUCTION |
Human immunodeficiency virus type 1 (HIV-1)1 DNA synthesis is
initiated by annealing of the 3' 18 nucleotides (nt) of a cellular tRNA
primer, tRNA , to the complementary 18-nt primer
binding site (PBS) near the 5' end of the viral RNA template.
Minus-strand DNA synthesis proceeds until the 5' end of the template is
copied, generating the first product of reverse transcription, a 200-nt
DNA termed ( ) strong-stop DNA (( ) SSDNA).
Studies on HIV-1 initiation in vitro indicate that two modes
of synthesis are involved in this process: (i) initiation,
characterized by a distributive, slow extension of the primer and a
high dissociation rate of reverse transcriptase (RT) from the
primer-template complex; and (ii) elongation, which follows a
transition between incorporation of the sixth and seventh nt and
results in a dramatic increase in the processivity and rate of DNA
synthesis (1-5). The inability of HIV-1 RT to initiate ( ) SSDNA
synthesis efficiently in vitro may be in part due to the
nature of the three-dimensional structure of the initiation complex,
which involves extensive intermolecular interactions between the
tRNA primer and the RNA template (see below)
(6-11). In addition, the efficiency of ( ) SSDNA synthesis appears to
be sensitive to the helical conformation of the nucleic acid duplexes
that are accommodated by RT; for example, when an 18-nt DNA primer
complementary to the PBS (D18) is used, ( ) SSDNA synthesis begins
immediately in the elongation mode (1-3, 5).
Initially, the 18-nt duplex region of the tRNA-viral RNA complex adopts
an A-form helical geometry, but after incorporation of dNTPs,
the primer-template complex becomes a DNA-RNA hybrid and assumes an
intermediate conformation in solution (12-14). X-ray crystallographic
structures of RT bound to primer-template complexes (D18 or RNA
polypurine tract (PPT) primer annealed to a complementary DNA template)
reveal a bend in these complexes of about 40° (15-17). The bend
occurs where -helix H in the thumb subdomain of RT contacts the
bound nucleic acid (15-17) and is typically associated with a
transition from A- to B-form geometry (17). It has been suggested that
this structural transition is correlated with the transition from the
initiation to elongation mode (3, 11).
The HIV-1 nucleocapsid protein (NC), a small basic protein with two
zinc-finger structures (18), also functions in the initiation process.
NC is a nucleic acid chaperone and catalyzes conformational rearrangements that lead to the most thermodynamically stable structures (19-30). The NC domain in Gag promotes tRNA primer placement on the RNA genome (31, 32), although the NC protein itself
also has this activity in vitro (32-37). The zinc fingers are not required for the tRNA annealing reaction, either in
vitro (34-37) or in vivo (31). However, there is
evidence suggesting that the zinc fingers are needed to help form a
functional initiation complex that promotes efficient ( ) SSDNA
synthesis (38, 39).
The importance of cis-acting elements in viral RNA for
efficient ( ) SSDNA synthesis was first demonstrated in studies with Rous sarcoma virus indicating that extended interactions between the
U5-IR stem upstream of the PBS and the T C loop of
tRNATrp enhance initiation of reverse transcription (40,
41). More recently, an additional U5-T C interaction has been
described (42). A novel interaction between the 5' terminus of
tRNA and the feline immunodeficiency virus U5-IR
loop has also been reported (43). In the case of HIV-1, chemical and
enzymatic probing revealed complex interactions between U5 sequences
upstream of the PBS and the anticodon loop, the 3' portion of the
anticodon stem, and part of the variable loop of
tRNA (9-11, 44-46). In particular, both in
vitro and in vivo data pointed to an interaction
between the anticodon loop of tRNA and an A-rich
loop in HIV-1 RNA, approximately ten bases upstream of the PBS (1, 4,
8-10, 44, 46-52). The extended interactions between the primer tRNA
and template have been reported to be stabilized by
post-transcriptional modification of tRNA (9) and
to contribute to efficient initiation of ( ) SSDNA synthesis and
transition from the initiation to elongation mode (1). Recently, it was
suggested that an interaction between the 5' portion of the T C loop
of tRNA and a conserved 8-nt sequence in U5,
referred to as a primer activation signal, may facilitate initiation of
( ) SSDNA synthesis (53, 54).
As yet, a possible role in initiation for cis-acting
template sequences downstream of the PBS has not been completely
clarified. Deletion of a 54-nt sequence immediately downstream of the
PBS led to a loss in infectivity and a dramatic reduction in viral DNA
synthesis (55). Further analysis of smaller deletions within the 54-nt
region showed that certain mutations have a greater effect on
infectivity (55, 56) and synthesis of ( ) SSDNA in vivo
(55) than others. In vitro, however, the mutant RNA templates have similar activities but are less efficient than wild-type
RNA in directing tRNA primer extension (4, 56). In other in
vitro work, it was reported that templates with mutations in
downstream sequences that disrupt base pairing with the proposed primer
activation signal, direct increased levels of ( ) SSDNA synthesis,
compared with a wild-type RNA template (53, 54).
In the present study, we have investigated the primer and template
requirements for efficient synthesis of ( ) SSDNA in vitro. We report that in the absence of NC, at least 24 bases immediately downstream of the PBS are required for efficient ( ) SSDNA synthesis when RNA primers (native tRNA or an 18-nt RNA
complementary to the PBS (R18)), but not an all DNA (D18) primer, are
used. These findings, as well as results of assays with chimeric
DNA-RNA primers, are correlated with CD spectra and melting
studies of 18-nt primer:PBS duplexes, underscoring the important role
of helical conformation and thermal stability for priming activity. The
results also suggest that the presence of the 24 additional downstream
bases in viral RNA may allow the template to assume a more favorable
conformation for annealing to the RNA primers. Interestingly, HIV-1 NC
abrogates the requirement for these additional bases if ( ) SSDNA
synthesis is primed by tRNA but not by R18.
Mutational analysis supports the hypothesis that the nucleic acid
chaperone activity of NC facilitates stable formation of extended
interactions between the 3' anticodon stem and variable loop of
tRNA and bases upstream of the A-rich loop in the
RNA template and that these interactions modulate initiation of reverse transcription.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Ribo- and deoxyribonucleosides are indicated by
upper and lowercase letters, respectively. D18 and R18
oligonucleotides (5'-gtccctgttcgggcgcca and 5'-GUCCCUGUUCGGGCGCCA,
respectively) that are complementary to the HIV-1 PBS were purchased
from Oligos Etc., Inc. (Wilsonville, OR). Three DNA-RNA chimeric
oligonucleotide primers, R9D9, D9R9, and R17D1, were prepared by
solid-phase synthesis on an Expedite 8909 RNA/DNA synthesizer
using phosphoramidite monomers, and other chemicals purchased from
Glen Research (Sterling, VA). The sequences were as follows:
5'-GUCCCUGUUcgggcgcca (R9D9); 5'-gtccctgttCGGGCGCCA (D9R9); and
5'-GUCCCUGUUCGGGCGCCa (R17D1). Purified tRNA from human placenta was obtained from Bio S&T (Lachine, Quebec, Canada). PCR primers and an 18-nt oligonucleotide complementary to
the 3' end of tRNA (5'-tggcgcccgaacagggac) were purchased from Lofstrand (Gaithersburg, MD).
[ -32P]ATP (3000 Ci/mmol) and
[ -32P]dCTP (6000 Ci/mmol) were purchased from Amersham
Biosciences. HIV-1 RT was obtained from Worthington Biochemical
Corp. (Lakewood, NJ). Calf intestinal phosphatase and Vent DNA
polymerase were obtained from New England Biolabs (Beverly, MA).
Recombinant wild-type HIV-1 NC (55-amino acid form) was a generous gift
from Dr. Robert Gorelick and was prepared as described previously
(57).
Plasmid Construction--
All plasmid sequences were derived
from the HIV-1 pNL4-3 clone (58). Plasmid pRUG, which was designed to
provide the DNA templates for in vitro synthesis of viral
RNA templates, was constructed from the previously described pJD
plasmid (59). The pNL4-3 fragment from the SacI site (nt
491) in the repeat (R) region of the 5' long terminal repeat to the
PstI site (nt 1419) in the capsid coding region was inserted
into the SacI and PstI sites of the pJD plasmid.
Three mutations were made in pRUG, which result in modification of U5
sequences in the RNA transcribed from the mutant templates: pRUG mut
(143-149), which changes nt 143-149 to their complementary bases;
pRUG AloopU, which substitutes four U residues for the four A residues
(nt 169-172) in the A-rich loop; and pRUG AloopU mut (143-149),
containing the double mutation. For PCR amplification of fragments from
plasmid pRUG, the forward primer (5'-ccaatgcttaatcagtgaggc), located at
the start of the amp gene, 1459 nt upstream of the T7
promoter, was used. The reverse primers were as follows: pRUG mut
(143-149),
5'-gtccctgttcgggcgccactgctagagattttccacactgactaaaagggtgact cccatctctagttacc; pRUG AloopU,
5'-gtccctgttcgggcgccactgctagagaaaaaccacactgactaaaagggtctgagggatctctagttacc; pRUG AloopU mut (143-149),
5'-gtccctgttcgggcgccactgctagagaaaaaccacactgactaaaagggtgactcccatctctagttacc. Each reverse primer has a NarI site starting 11 nt from the
5' end (corresponding to nt 184-190 in the PBS region of the RNA); the
vector also has a NarI site. The fragments were cut with
NarI and inserted into NarI-digested pRUG. In all
cases, the sequences of both the insert and the boundary regions were
verified by DNA sequencing.
Preparation of RNA Templates--
To make the DNA templates for
in vitro RNA transcription, the fragments containing both
the T7 promoter and the desired length of viral RNA were amplified by
PCR from plasmid pRUG or the three pRUG mutants, using Vent DNA
polymerase. The forward primer (5'-ccaatgcttaatcagtgaggc) is located at
the start of the amp gene. The reverse primers were as
follows: RNA 200, 5'-gtccctgttcgggcgccact; RNA 210, 5'-tcgctttcaagtccctgttc; RNA 220, 5'-ggctttactttcgctttcaa; RNA 221, 5'-tggctttactttcgctttca; RNA 222, 5'-ctggctttactttcgctttc; RNA 223, 5'-tctggctttactttcgcttt; RNA 224, 5'-ctctggctttactttcgctt; RNA 226, 5'-tcctctggctttactttcgc; RNA 228, 5'-tctcctctggctttactttc; RNA 230, 5'-gatctcctctggctttactt; RNA 240, 5'-tgcgtcgagagatctcctct; RNA 244, 5'-gtcctgcgtcgagagatc; RNA 732, 5'-gtaattttggctgacctggc. The reverse
primers for RNA 200 and RNA 244 could also be used to generate the
corresponding mutant RNA templates. After PCR amplification, the DNA
fragments were separated on 1.5% agarose gels and were extracted with
a QIAEX II kit (Qiagen, Inc., Valencia, CA). To prepare the DNA template for synthesis of RNA 509, pRUG was linearized with
AccI. RNA templates were transcribed with T7 RNA polymerase,
using an Ambion MEGAscript kit (Ambion Inc., Austin, TX) and were then purified by electrophoresis on a 2 or 3% agarose gel. RNA fragments of
the appropriate size were extracted from the gel with an RNaid kit
(Qbiogene, Carlsbad, CA), according to the manufacturer's instructions. The purified RNA was quantified by measuring the absorbance at 260 nm. Note that the RNA templates are defined by the
number of bases downstream of nt +1 in the viral RNA genome (see Fig.
1B). The secondary structure of a portion of the 5' leader
region of HIV-1 NL4-3 RNA (see Fig. 1A) was predicted from mfold (60, 61).
Preparation of Labeled Primers--
The R18, R9D9, D9R9, and
R17D1 primers were purified on denaturing 20%
polyacrylamide-Tris-borate/EDTA (TBE) gels and were then eluted
with an RNaid kit. All of the 18-nt primers were labeled at their 5'
ends with [ -32P]ATP, as described previously (62). To
prepare 5' 32P-labeled tRNA , the
acceptor stem was first disrupted by annealing the 3' end of the tRNA
to an 18-nt DNA complementary oligonucleotide (see above); this
increases the efficiency of labeling at the 5' end of the tRNA. The
tRNA was then dephosphorylated with calf intestinal phosphatase (1 unit/µg of tRNA ) at 50 °C for 2 h prior to labeling. Following incubation with 0.2 units/µl of RNase-free DNase I (Ambion Inc.) for 30 min at 37 °C, the 76-nt tRNA was separated from other products by electrophoresis on a denaturing 10%
polyacrylamide-TBE gel and was then eluted and quantified, as described
above under "Preparation of RNA Templates."
Assay of ( ) SSDNA Synthesis--
Unless specified otherwise,
the template and primer were annealed with heat, and NC was not present
in the reaction mixture. In these experiments, 0.2 pmol of the
indicated RNA template was annealed to 0.1 pmol of the indicated
32P-labeled primer (3-5 × 105 cpm) in 2 µl
of buffer, containing 50 mM Tris-HCl, pH 8.0, and 75 mM KCl at 65 °C for 5 min followed by gradual cooling to
37 °C. Where annealing was performed in the presence of HIV-1 NC, 0.2 pmol of the RNA template was annealed to 0.1 pmol of the 5' labeled
R18 primer (3-5 × 105 cpm) or to unlabeled
tRNA in 7 µl of solution, containing 50 mM Tris-HCl, pH 8.0, 75 mM KCl, and NC protein
(equivalent to 7 nt per NC) at 37 °C for 15 min. Following annealing, reaction buffer (50 mM Tris, pH 8.0, 75 mM KCl, 7 mM MgCl2, 1 mM dithiothreitol, 50 µM dNTPs) and HIV-1 RT
(0.2 pmol) were added, and the mixture (final volume, 20 µl) was
incubated at 37 °C for 30 min. When unlabeled
tRNA was used, the reaction buffer also contained
10 µCi of [ -32P]dCTP. Reactions were terminated by
freezing on dry ice, followed by addition of 8 µl of gel loading
buffer II (Ambion). The samples were heated at 90 °C for 5 min and
were loaded onto a denaturing 6% polyacrylamide-TBE gel. Radioactivity
was quantified by using a PhosphorImager (Molecular Dynamics) and
ImageQuant software. To calculate the percentage of the ( ) SSDNA
product that was extended from a 5' labeled primer, the
"volume" of the ( ) SSDNA band was divided by the total
volume in that lane. For experiments where ( ) SSDNA was internally
labeled, the amount of ( ) SSDNA product made with a particular RNA
template relative to RNA 200 (taken as 100%) was calculated. Each
experiment was repeated independently at least three times.
Representative data are shown under "Results."
CD Spectra--
For CD spectra, R18, D18, and chimeric DNA-RNA
oligonucleotides were gel-purified on denaturing 16%
polyacrylamide-TBE gels, eluted, and desalted as described (63, 64). To
determine the concentration of the synthetic oligonucleotides, an
extinction coefficient ( 260) of 14.3 × 105 M 1cm 1 was used.
CD spectra were obtained on a Jasco J-710 spectropolarimeter at
25 °C in a 1-mm cell with ~25 µM duplex. The
duplexes were annealed by incubating strands in buffer containing 50 mM Tris-HCl, pH 8.0, and 75 mM KCl at 80 °C
for 2 min, 60 °C for 2 min, followed by addition of 0.1 M MgCl2 to a final concentration of 10 mM and placement on ice. Final CD spectra are the average
of three scans.
Melting Studies--
UV melting profiles (absorbance
versus temperature) were obtained on an Agilent 8453 spectrophotometer equipped with a Peltier device. Samples were heated
at 15 degrees/h, and the absorbance at 260 nm was collected at
0.5-degree increments from 40 to 98 °C in a 1-cm path length
cuvette. Prior to data collection, duplexes (2 µM) were
annealed in 50 mM Tris-HCl, pH 8.0, and 75 mM
KCl by incubating at 65 °C for 5 min, slow cooling to 37 °C,
incubating at 37 °C for 5 min, and then placing on ice. Reported
melting point temperature (Tm) values were
calculated using the first derivative of the heating trace and
represent the average of two or three trials, which differed by
<3.2%.
 |
RESULTS |
Effect of RNA Template Length on ( ) SSDNA Synthesis Primed by the
D18, R18, and tRNA Primers--
To investigate the
potential role of sequences downstream of the PBS in the synthesis of
( ) SSDNA (Fig. 1A), we
analyzed primer extension efficiency with 14 in vitro
transcribed RNA templates containing varying lengths of downstream
sequences (Fig. 1B). The templates tested in the initial
experiments terminated at nt 200 i.e. the 3' end of the PBS
(RNA 200), nt 244 (RNA 244), nt 509 (RNA 509), and nt 732 (RNA 732).
The results showed that at most, 44 downstream bases were required for
efficient priming with the R18 primer consisting of the 3' 18 nt of
tRNA or with full-length native
tRNA (data not shown).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
Proposed secondary structure of a portion of
the HIV-1 NL4-3 5' leader region and schematic diagram of RNA templates
used in this study. A, the predicted secondary
structure of a portion of the 5' leader region of HIV-1 NL4-3 RNA
obtained using mfold (60, 61). The TAR stem-loop, the
poly(A) hairpin, the A-rich loop, and the 18-nt PBS are indicated. The
PBS bases are shown in italics. Note that throughout the
text, upstream sequences refers to template RNA sequences 5' of the
PBS, i.e. beginning at nt 182; downstream sequences refers
to template sequences 3' of the PBS, i.e. beginning at nt
201. B, the boxed PBS sequence (nt 183-200) and
the sequence of downstream bases up to nt 244 are shown at the
top of the panel. The templates start from an
additional G residue upstream of nt +1 in viral genomic RNA and are
designated according to their total number of bases.
|
|
To more closely determine the minimum number of downstream bases
required for efficient synthesis of ( ) SSDNA, additional templates
with smaller differences in template length were tested. A summary of
our observations is presented in Fig. 2,
which shows ( ) SSDNA synthesis initiated with the D18 (Fig.
2A), R18 (Fig. 2B), and tRNA
(Fig. 2C) primers, using the 14 viral RNA templates (Fig.
1B). DNA products were separated by polyacrylamide gel
electrophoresis (upper portion of each panel), and the percent ( ) SSDNA synthesized was calculated from
PhosphorImager analysis of the gel data (lower portion of
each panel).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 2.
( ) SSDNA synthesis initiated by D18, R18,
and tRNA primers. D18 (A), R18
(B), and tRNA (C) primers
were used to initiate ( ) SSDNA synthesis, as described under
"Experimental Procedures." The upper portions of each
panel show gel analysis of the 32P-labeled
products; the position to which ( ) SSDNA migrated is also indicated.
PhosphorImager analysis of the gel data is shown in the bar
graphs in the lower portion of each panel;
the percentage (%) of ( ) SSDNA was calculated as described under
"Experimental Procedures." Lane 1, RNA 200; lane
2, RNA 210; lane 3, RNA 220; lane 4, RNA
221; lane 5, RNA 222; lane 6, RNA 223; lane
7, RNA 224; lane 8, RNA 226; lane 9, RNA
228; lane 10, RNA 230; lane 11, RNA 240;
lane 12, RNA 244; lane 13, RNA 509; lane
14, RNA 732. The numbers corresponding to lanes
1 (RNA 200), 7 (RNA 224), and 12 (RNA 244)
are highlighted.
|
|
As demonstrated in Fig. 2A, ( ) SSDNA synthesis primed by
the D18 primer was independent of template length. However, with the
R18 or tRNA primers and templates RNA 200 to RNA
223, each consecutive addition of downstream bases resulted in
corresponding increases in the amount of ( ) SSDNA synthesis (Fig. 2,
B and C, lanes 1-6). However, once
the template contained 24 downstream bases, adding more bases to the
template did not lead to a further increase in ( ) SSDNA synthesis
(Fig. 2, B and C, lanes 7-14). These
results indicate that the RNA template must contain 24 bases downstream
of the PBS for efficient RT-catalyzed extension in
vitro.
To investigate whether efficient RT extension requires a specific
sequence in the RNA genome or whether a random sequence of 24 bases
downstream of the PBS is sufficient, two different RNA templates (RNA
224a and RNA 224b) were prepared. RNA 224a was constructed by removing
the 44 bases immediately downstream of the PBS but retaining the next
3' 24 bases; similarly, in RNA 224b, the 24 bases immediately
downstream of the PBS were deleted, but the succeeding 3' 24 bases were
retained. Using these two RNA templates and the R18 primer, ( ) SSDNA
synthesis was even lower than that observed with RNA 200 (data not
shown). Thus, the effect of the 24-base sequence downstream of the PBS
on efficient primer extension is dependent on the specific genomic RNA
sequence, presumably because it allows the RNA template to fold into a
stable conformation that is favorable for duplex formation.
( ) SSDNA Synthesis Primed by DNA-RNA Chimeric Primers--
To
gain further insight into the unique dependence of RNA primers on
template length, we compared the activities of chimeric primers that
were complementary to the PBS: R9D9 (Fig.
3A), D9R9 (Fig.
3B), and R17D1 (Fig. 3C). The experimental
procedures were the same as those used for the experiments described in
the previous section. As shown in Fig. 3A, the percent ( )
SSDNA synthesis primed by the R9D9 primer (5' half RNA, 3' half DNA)
was similar with all 14 RNA templates. This result indicates that R9D9
behaves like the all-DNA primer, D18 (compare Fig. 2A and
Fig. 3A).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 3.
( ) SSDNA synthesis initiated by DNA-RNA
chimeric primers. Three DNA-RNA chimeric primers, R9D9
(A), D9R9 (B), and R17D1 (C), were
used to initiate ( ) SSDNA synthesis, as described under
"Experimental Procedures." The RNA and DNA portions of each primer
are represented at the top of each panel by
white and black boxes, respectively. The gel data
are shown in the upper portion of each panel.
PhosphorImager analysis of the gel data (lower portion of
each panel) and calculation of the (%) ( ) SSDNA product
were performed as described in the legend to Fig. 2. The identities of
the RNA templates in lanes 1-14 are the same as in Fig.
2.
|
|
In contrast, when synthesis was primed by R17D1 (substitution of only
one deoxyribonucleotide at the 3' end of R18), the efficiency of ( )
SSDNA synthesis was dependent on the length of the downstream sequences
(Fig. 3C). Thus, RNA templates that had 24 or more
downstream bases (Fig. 3C, lanes 7-14) supported
similar levels of ( ) SSDNA synthesis, whereas with templates having a
total of 200-223 bases (RNA 200 to RNA 223), incremental increases in
the length of the template led to corresponding increases in ( ) SSDNA
(Fig. 3C, lanes 1-6). These findings demonstrate
that R17D1 behaves like the all-RNA primer, R18 (compare Fig.
3C with Fig. 2B). Interestingly, when the D9R9
primer (5' half DNA, 3' half RNA) was used, maximal ( ) SSDNA
synthesis was achieved only if the template contained at least 24 bases
downstream of the PBS (Fig. 3B). However, the dependence on
template length was not as striking as that seen with the R17D1 and R18
primers (compare Fig. 3B with Fig. 3C and Fig.
2B, respectively). Taken together, the observations
illustrated in Fig. 3 raise the possibility that differences between
the helical conformations of duplexes formed by the PBS and each of the
oligonucleotide primers might be responsible for the observed
differences in the requirements for priming activity.
CD Spectra of Duplexes between the PBS (Template) and Various
Oligonucleotide Primers--
To investigate the possibility that
helical conformation may be a determinant for priming activity, we
analyzed the CD spectra of 18-nt primer:PBS duplexes (Fig.
4). The CD spectra of the all-RNA duplex
(R18:PBS), as well as the various deoxy-substituted chimeric duplexes,
indicated overall A-form helices for all variants tested. All spectra
had a large maximum near 265 nm, a shallow negative peak close to 235 nm, and a large negative peak around 210 nm. A very small negative peak
was also observed near 300 nm in all cases. Although the duplexes all
appeared to maintain an overall A-form geometry, which is in good
agreement with earlier CD studies of DNA:RNA hybrids (65-68), slight
shifts in the spectra were apparent in some cases, suggesting subtle
differences in the conformations.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
CD spectra of 18-nt primer:PBS duplexes.
The figure represents CD spectra of primer:PBS duplexes (25 µM) in 50 mM Tris-HCl, pH 8.0, 75 mM KCl, and 10 mM MgCl2 at 25°C.
Comparison of CD spectra of R9D9:PBS (dashed red)
(A) and D9R9:PBS (dashed blue) (B)
with those of R18:PBS (solid blue) and D18:PBS (solid
red) is shown. Insets, wavelength region 295-315 nm
illustrates the shift in shallow negative CD bands.
|
|
Replacement of R18 with D18 resulted in noticeable alteration of the CD
spectrum (Fig. 4). Both a decrease and a slight shift in the maximum of
the D18:PBS spectrum compared with that of R18:PBS suggested that the
hybrid duplex, although maintaining an overall A-form conformation, had
characteristics that are shifted somewhat toward B-form (69). In
particular, the negative CD band around 298 nm present in the RNA
duplex was more shallow and shifted to ~308 nm in the D18:PBS
spectrum (Fig. 4, insets), which is indicative of a shift
toward B-form conformation (69). Thus, the CD spectrum observed with
the D18:PBS duplex suggests that the lack of dependence on template
length in the extension assays (Fig. 2A) with a DNA primer
may be the result of an altered duplex conformation.
Spectra for R9D9:PBS and D9R9:PBS indicated that the conformations of
these chimeric duplexes were also slightly altered relative to those of
R18:PBS and D18:PBS. The R9D9:PBS CD spectrum (Fig. 4A) had
a maximum near 265 nm and a shallow negative band near 300 nm (Fig.
4A, inset) that both shifted slightly toward
longer wavelengths relative to the R18:PBS duplex. Overall, the
spectrum aligns more closely with that of D18:PBS than with the
spectrum of the all-RNA duplex and indicates a slight shift toward a
B-form conformation. This conformational change toward B-form is again correlated with a lack of dependence on downstream template sequences in the reverse transcription assays carried out with the R9D9 primer
(Fig. 3A). In contrast, the CD spectrum of D9R9:PBS was more
similar to that of the all-RNA (R18:PBS) duplex (Fig. 4B). The most significant change in the D9R9:PBS spectrum was a decrease in
the strength of the maximum at 265 nm. This may indicate a minor shift
toward B-form and/or a decrease in overall stability. The minor
deviations from the all-RNA duplex observed in the CD spectrum of the
D9R9:PBS duplex are in accord with the slight deviation in behavior of
the D9R9 primer relative to the all-RNA, R18 primer in the reverse
transcription assays (Fig. 3B).
By overlaying the spectra of the R17D1:PBS and R18:PBS duplexes, it is
evident that they are essentially identical (data not shown).
Therefore, there is no change in the duplex conformation when a single
deoxyribonucleotide is substituted at the 3' end of the primer strand.
The similarity in conformation is in accord with the similar dependence
on downstream sequences in the initiation of reverse transcription when
R17D1 is substituted for R18 (Fig. 3C).
Thus, CD analysis suggests that there is a correlation between the
helical conformation of the various primer:PBS duplexes and their
priming activity. In particular, we find that an increased dependence
on template length in the assays that measure the ability of the
primers to initiate ( ) SSDNA synthesis correlates with A-form helical
geometry (compare Fig. 4 with Figs. 2 and 3). In contrast, the duplexes
that exhibit a shift toward B-form geometry display priming activity
that is relatively independent of downstream sequences.
Melting Studies of Duplexes between the PBS (Template) and Various
Oligonucleotide Primers--
Melting studies were undertaken to
investigate the thermal stability of the primer-template duplexes
(Table I). As expected, the all-RNA duplex was more stable than
the all-DNA duplex (66, 70, 71), whereas
the chimeras were intermediate in their thermal stability. The relative
stability of chimeric DNA-RNA duplexes is difficult to predict and
depends strongly on base composition (65-67, 70, 71). Interestingly,
we find that the R9D9:PBS duplex had a Tm of
78.5 °C, which is very close to the Tm for
the D18 duplex (77.5 °C); in contrast, the D9R9 duplex had a
Tm (84.5 °C) that is more similar to the
Tm for the R18 duplex (88.1 °C). These data
indicate that the R9D9 duplex is more DNA-like in its stability,
whereas the D9R9 duplex is more RNA-like. Thus, the results are in
excellent agreement with the biochemical data (see Figs. 2 and 3) and
CD analysis (Fig. 4) described above.
View this table:
[in this window]
[in a new window]
|
Table I
Melting temperatures of primer:PBS duplexes
All measurements were carried out in 50 mM Tris-HCl, pH
8.0, and 75 mM KCl and represent the average of two or
three trials, which differed by <3.2%.
|
|
Effect of NC on the Requirement for Downstream Bases in Reactions
Primed by R18 or tRNA --
HIV-1 NC activity
appears to be necessary to form a functional initiation complex (38,
39) and achieve efficient synthesis of ( ) SSDNA. It was therefore of
interest to investigate the requirement for downstream bases in
reactions containing NC. In Fig.
5A, R18 (labeled at its 5'
end) was annealed to the RNA templates in the presence of NC (7 nt/NC),
and this was followed by RT-catalyzed extension of the primer to yield
( ) SSDNA. The results showed that the percent ( ) SSDNA was
independent of template length only when 24 bases downstream of the
PBS were included in the template (Fig. 5A, compare
lanes 7-12 with lanes 1-6). This result is
identical to that observed when NC was absent from the reaction and the
primer:template duplex was formed by heat annealing (Fig. 2B).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of NC on ( ) SSDNA synthesis
initiated by the R18 and tRNA primers. 5'
32P-labeled R18 (A) or unlabeled native
tRNA (B) were annealed to RNA templates
in the presence of NC and were extended by HIV-1 RT, as detailed under
"Experimental Procedures." Gel data are shown at the top
of each panel. PhosphorImager analysis of the gel data
(lower portion of each panel) and calculation of
percent ( ) SSDNA (A) or ( ) SSDNA relative to RNA 200 (B) were performed as described under "Experimental
Procedures." The identities of the RNA templates in lanes
1-12 are the same as in Fig. 2.
|
|
To perform the analogous experiment with native
tRNA , unlabeled primer was annealed to the RNA
templates in the presence of NC, and DNA products were internally
labeled by adding [ -32P]dCTP to the reaction mixtures
(Fig. 5B). Interestingly, in this case, approximately the
same amount of ( ) SSDNA was synthesized with each of the templates.
This finding is illustrated by the bar graph in the
lower portion of Fig. 5B, where the amount of ( ) SSDNA synthesized with each template was plotted relative to the
amount made by RNA 200.
The results of Fig. 5 demonstrate that NC was able to abrogate the
requirement for downstream bases seen with templates RNA 200 to RNA 223 when tRNA (Fig. 5B), but not when the
R18 primer (Fig. 5A), was used. Similar results were obtained when unmodified (synthetic) tRNA was added
to RNA 200 reactions, i.e. without NC, ( ) SSDNA synthesis was dependent on sequences downstream of the PBS, but in the presence of NC it was not. However, in these reactions, the level of ( ) SSDNA
synthesis was reduced by ~2-3-fold relative to the amount made in
comparable reactions with the native tRNA primer (data not shown). It
should also be noted that addition of NC following heat annealing gave
the same results as those obtained when NC was maintained in the
mixture during annealing and extension (data not shown), in agreement
with Brulé et al. (72). Thus, using either protocol
with the native tRNA primer, the 24-nt downstream element was
dispensable for efficient ( ) SSDNA synthesis.
Effect of Mutating Template Bases Upstream of the PBS on the
Ability of NC to Abrogate the Requirement for the Downstream
Element--
The results illustrated in Fig. 5, demonstrating a
specific effect of NC with the tRNA primer, but not with R18, suggest
that NC may facilitate extended interactions between
tRNA and upstream template sequences and that these
interactions modulate reverse transcription. Previous work (1, 4,
8-10, 44, 46-52) indicated that residues in the A-rich loop interact
with the anticodon loop of the tRNA primer. In addition, structure probing suggested an interaction between the 3' arm of the anticodon stem and the variable loop of the tRNA (nt 40-46) and U5 sequences upstream of the A-rich loop, corresponding to nt 140-143 in helix 3E
and nt 158-160 in helix 5D in HIV-1 MAL RNA (10, 44, 46). In
HIV-1 NL4-3, used in the present work, we find that the corresponding template sequences are contiguous and include nt 143-149 (58).
To investigate whether such extended tRNA-template interactions could
account for the NC effect on tRNA -primed synthesis
of ( ) SSDNA, two different substitution mutations (Fig. 6) were made in both the RNA 200 and RNA
244 templates, either singly or in combination: (i) mutation of the
four A residues at nt 169-172 to U residues (AloopU); (ii) mutation of
nt 143-149 (mut (143-149)) to the complementary bases; and (iii) the
double mutation. Each of the templates was assayed with unlabeled
tRNA primer, in the absence or presence of NC. A
representative gel and PhosphorImager analysis of gel data averaged
from three independent experiments are shown in Fig.
7, A and B,
respectively. In Fig. 7B, the results are expressed as the
amount of ( ) SSDNA made relative to that synthesized by the wild-type
RNA 244 template in the absence of NC (100%).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
Mutations in RNA template bases upstream of
the PBS. A, the entire sequence of the 76-nt human
tRNA and sequences from nt 113-250 at the 5' end
of NL4-3 genomic RNA are shown. The PBS (italics) and the 3'
acceptor stem in the tRNA are in blue. Upstream RNA
sequences nt 143-149 and the complementary sequence in the 3' arm of
the anticodon stem and variable loop of tRNA (nt
40-46) are in red; the A-rich loop (nt 169-172) and the
complementary anticodon loop in the tRNA are in green.
B, the linear template sequence is shown with the three
regions, nt 143-149, A-rich loop, and PBS, highlighted with
the same colors as those used in A. A schematic
representation of the wild-type and mutant RNA 200 and RNA 244 templates indicating the mutated sequences is shown below
the linear sequence.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of substitution mutations upstream of
the PBS in templates RNA 200 and RNA 244 on ( ) SSDNA synthesis primed
by tRNA in the absence or presence of NC.
A, gel data. ( ) SSDNA synthesis was initiated with
unlabeled native tRNA primer in the absence
(lanes 1-8) or presence of NC (lanes 9-16), as
described under "Experimental Procedures." The DNA products
synthesized with the RNA 200 and RNA 244 templates are shown in
lanes 1-4 and lanes 9-12, and lanes
5-8 and lanes 13-16, respectively. The templates used
were as follows: wild-type, lanes 1 and 9 and
lanes 5 and 13; AloopU, lanes 2 and
10 and lanes 6 and 14; mut (143-149),
lanes 3 and 11 and lanes 7 and
15; and mut (143-149)/AloopU, lanes 4 and
12 and lanes 8 and 16. The position of
( ) SSDNA is indicated by an arrow to the left
of the gel. B, PhosphorImager analysis of gel
data averaged from three independent experiments. The data are
expressed as ( ) SSDNA relative to that made by the wild-type RNA 244 template in the absence of NC (100%). The number below each
bar corresponds to the lane numbers in
A.
|
|
As expected from the data of Fig. 5, reactions with the wild-type RNA
244 template yielded the same amount of ( ) SSDNA independent of the
presence of NC, whereas with the RNA 200 template, the amount of
synthesis reached the RNA 244 level only when NC was added (Fig. 7,
A and B, compare lanes 5 and
13 with lanes 1 and 9). The RNA 200 and RNA 244 templates bearing the AloopU mutation exhibited an increase
in priming efficiency (ranging from ~1.5- to 3-fold) in the presence
of NC (Fig. 7, A and B, lanes 10 and 14), compared with the RNA 244 control (Fig. 7, A
and B, lane 5); with the RNA 244 mutant, a
similar effect was also seen in the absence of NC (Fig. 7, A
and B, lane 6). Under conditions where the
initial products of reverse transcription (+1, +3, and +5 nt) can be
easily detected (low dNTP concentrations), overall accumulation of
these short DNAs in NC-containing mutant reactions was significantly
reduced, relative to the wild-type controls. However, unlike the
corresponding wild-type templates, the AloopU mutants directed
synthesis of a greater amount of the +5 product relative to the +1 and
+3 products (data not shown). These results are in agreement with
findings by Liang et al. (4) that disrupting the interaction
between the A-rich loop in the template and the anticodon loop of the
tRNA primer leads to a decrease in RT pausing in vitro.
In contrast to our observations with the AloopU mutants, mutation of nt
143-149 alone or in combination with the AloopU mutation reduced the
activity of RNA 200 by about 2-fold in the absence of NC (Fig. 7,
A and B, lanes 3 and 4).
With the RNA 244 template, these mutations supported a modest to very
slight increase in ( ) SSDNA synthesis (Fig. 7, A and
B, lanes 7 and 8, respectively). Most
importantly, however, in the presence of NC, there was a major
difference in the activities of the mutant RNA 200 and RNA 244 templates. Thus, when the RNA 200 template contained either the
143-149 mutation or the double mutation, there was an ~16-fold decrease in activity (Fig. 7, A and B,
lanes 11 and 12). Interestingly, the actual
amount of ( ) SSDNA made with these two mutants was the same with or
without NC (compare lanes 3 and 4 with
lanes 11 and 12). However, RNA 244 mut (143-149)
and the double mutant had the same or moderately reduced activity,
respectively, relative to the wild-type template (Fig. 7, A
and B, lanes 15 and 16). Note that the
stimulatory effect of the single AloopU mutation was no longer detected
in the double mutants.
Taken together, these results strongly suggest an
NC-dependent interaction between nt 143-149 in the RNA
template and nt 40-46 in the 3' anticodon stem and variable loop of
the tRNA primer. This interaction modulates the efficiency of
initiation of reverse transcription and replaces the requirement for
additional downstream bases in templates smaller than RNA 224. Importantly, none of the mutations affected ( ) SSDNA synthesis
initiated by the R18 primer in the presence or absence of NC (data not
shown), thus confirming that the effect is tRNA-specific.
 |
DISCUSSION |
In the present study, we have investigated the possible role of
HIV-1 RNA template sequences immediately downstream of the PBS in the
initiation of ( ) SSDNA synthesis, using a reconstituted in
vitro system. Our results demonstrate that in the absence of NC,
at least 24 bases downstream of the PBS are required for maximal synthesis of ( ) SSDNA with the tRNA and R18
primers; in contrast, with the D18 primer, no additional bases beyond
the PBS are needed. Interestingly, in the presence of NC, downstream
bases are dispensable for tRNA-primed ( ) SSDNA synthesis but are
still required when the R18 primer is used.
The specific differences that we observe in the priming activities of
RNA and DNA primers (Fig. 2) have not been reported previously but are
consistent with kinetic (1-3, 5) and mutational (see below) (73, 74)
studies of HIV-1 RT activity indicating that the efficiency of ( )
SSDNA synthesis is sensitive to the helical conformation of
primer-template complexes. The data are also consistent with structural
studies of HIV-1 RT complexed to DNA or RNA primers annealed to a DNA
template (15-17).
To further investigate the role of helical conformation in the
initiation step, we assayed the priming activities of chimeric DNA-RNA primers (Fig. 3). In addition, we also analyzed the
CD spectra and thermostabilities of 18-nt primer:PBS duplexes (see Fig.
4 and Table I). As might be expected, the R18 duplex exhibits classical
A-form geometry, whereas the D18 complex shows an intermediate (12-14,
75, 76) conformation (Fig. 4). Interestingly, the presence of a 3'
deoxyribonucleotide in the primer (R17D1) is not sufficient to alter
RNA-like behavior in assays of ( ) SSDNA synthesis (Fig. 3C) or duplex conformation relative to that of the all-RNA,
R18 primer (data not shown). In contrast, the presence of nine
deoxyribonucleotides at the 3' end (R9D9), but not at the 5' end
(D9R9), of the primer has a dramatic effect on the
requirement for additional template sequences and also affects duplex
conformation. Thus, duplexes that maintain greater A-like character
((R18:PBS, D9R9:PBS) (Fig. 4B), and R17D1:PBS (data not
shown)) show a stronger dependence on downstream template sequences
(see Fig. 2B and Fig. 3, B and C,
respectively), whereas a shift toward B-like conformation (D18:PBS and
R9D9:PBS) (Fig. 4A) is correlated with a lack of a
dependence on template length (see Fig. 2A and Fig.
3A, respectively). Melting studies of the 18-nt duplexes are
in agreement with these data (Table I); R9D9 and D18 duplexes have
similar Tm values, which are several degrees
lower than the values obtained for the R18 and D9R9 duplexes.
Taken together, these results highlight the importance of both helical
conformation and thermostability as determinants of priming activity in
the initiation of minus-strand DNA synthesis. Interestingly, helical
conformation also has a dramatic effect on the initiation of HIV-1
plus-strand DNA synthesis by the 15-nt RNA PPT primer. We demonstrated
previously (73, 74) that plus-strand initiation is dependent on nucleic
acid contacts with "primer grip" residues (16) in the palm
subdomain of the p66 subunit of RT. Thus, aromatic substitution (73)
and alanine-scanning mutations (74) in these residues abolish
plus-strand priming activity with an RNA PPT primer but do not affect
priming with a DNA version of the PPT. Gel shift experiments with RNA
or DNA PPT primer-template complexes demonstrated that the efficiency of binding to RT is the same with an RNA or DNA PPT primer; therefore, differences in binding affinity could not account for the observed differences in priming activity (74). These results led to the conclusion that the unusual helical structure of the RNA PPT is a major
determinant of plus-strand priming activity (74). In addition, these
same primer grip mutations significantly reduce or in some cases
completely block priming of minus-strand DNA synthesis by an R18 or a
synthetic tRNA primer while having no effect on
priming by a D18 primer (73, 74). By analogy to the PPT primers, the
binding affinities of the RNA or D18 primer-template duplexes to RT
might not have a major influence on priming in minus-strand synthesis,
as well. Thus, we conclude that the correct structure of RT in the
primer grip region, as well as the helical conformation of the primer, are critical for efficient initiation of both minus- and plus-strand DNA synthesis.
In the absence of NC, we have also demonstrated that for maximal
synthesis of ( ) SSDNA, at least 24 bases in the RNA template, immediately downstream of the PBS, are required if RNA primers are used
(Fig. 2, B and C). These results are generally in
accord with earlier in vitro data indicating that extension
of tRNA is less efficient if mutant RNA templates
contain deletions of sequences within a 54-nt downstream region (4, 55,
56). However, the present findings and other data (46) appear to be at
variance with the observation that the primer activation signal
increases ( ) SSDNA synthesis when downstream bases are mutated (53,
54).
How can we rationalize the requirement for additional downstream bases
in the viral RNA template? The secondary structure of HIV-1 NL4-3 5'
genomic RNA depicted in Fig. 1A shows that sequences between
nt 218 and 224 form a stem by base-pairing with the sequences from nt
126 to 132. This stem structure is highly conserved in HIV-1 (data not
shown), and it seems possible that the additional 24 downstream bases
might be important to maintain this stem structure and thereby
stabilize the initiation complex when NC is not present. A more stable
complex may also contribute to enhanced binding of the complex to
RT.
To determine whether it is possible to predict formation of a more
stable complex when the additional template bases are present, we
performed mfold analysis (60, 61) on the U5 RNA sequence beginning at nt 113 and extending to nt 200-244 (Fig. 1); the 18-nt
PBS was constrained by annealing to the 3' 18 nt of
tRNA . The analysis showed that RNA 200 has a G
value of 18.7 kcal/mol, whereas the G values for RNA 224 and RNA
244 are 24.1 and 32.4 kcal/mol, respectively. These data are in
agreement with the results shown in Fig. 2, B and
C and support the idea that the longer templates assume
conformations that favor annealing to R18 or tRNA ,
which, in turn, would result in formation of a more stable binary
complex. Apparently, the contribution of nt 201-224 is sufficient for
this effect, and therefore, RNA 224 is able to form the secondary
structure required for efficient ( ) SSDNA synthesis. This correlates
well with the previous observation that an HIV-1 MAL RNA template
consisting only of nt 123-217 has a very similar overall secondary
structure as a longer HIV-1 MAL template consisting of nt 1-311 (11,
44, 46).
One of the most dramatic findings to emerge from this study concerns
the ability of NC to abrogate the requirement for additional downstream
bases in templates smaller than RNA 224 (Fig. 5). The NC effect was
observed regardless of whether heat or NC annealing was used to form
the binary complex (data not shown). The equivalence of heat and NC
annealing has been shown by Brulé et al. (72), but
this finding differs from reports by Rong et al. (38, 39), possibly because of different experimental conditions. It is of interest to note that when the dNTP concentrations are set at 5 µM (conditions that favor RT pausing), NC also has a
significant stimulatory effect on ( ) SSDNA synthesis with the RNA 224 and 244 templates (data not shown), probably because NC reduces pausing at secondary structure sites in viral RNA (57, 77). This observation raises the possibility that in the cell, where dNTPs are thought to be
present at relatively low concentrations (78), NC may facilitate
formation of the most stable template RNA conformation for efficient
minus-strand DNA synthesis, even with genome-size viral RNA.
Because the NC effect is seen only with tRNA and not with R18 (Fig. 5),
we speculated that NC nucleic acid chaperone activity may be
stabilizing extended interactions between the tRNA primer and the RNA
template. We considered the possibility that the interaction between
residues in the A-rich loop and the anticodon loop of tRNA promote efficient ( ) SSDNA synthesis (1, 9).
However, although it has been reported that substitution of the six
residues in the A-rich loop (nt 162-167 in HIV-1 MAL; GUAAAA) with
five residues (CUAUG) can significantly reduce ( ) SSDNA synthesis
in vitro (1), others have shown that deletion of the four A
residues in HIV-1 HXB2 RNA leads to synthesis of slightly lower or very
similar amounts of ( ) SSDNA over time (4, 49, 79). Under the standard
conditions used in our system (HIV-1 NL4-3), mutation of the four A
residues to four U residues increases ( ) SSDNA synthesis by
~1.5-3-fold, in agreement with the conclusion that removal of the
four A residues eliminates pause sites that impede reverse
transcription (data not shown) (4, 8, 49). The discrepancy between the
results with different mutations and HIV-1 strains may reflect the
different effects of each of these mutations on the conformation of the
specific viral RNA-tRNA complex.
We also investigated whether an extended interaction between the 3' arm
of the anticodon stem and variable loop of tRNA and
nt 143-149 in the template is related to the NC effect. On the basis
of modeling experiments, this interaction has been suggested to promote
RT binding by preventing steric clashes between RT and the binary
nucleic acid complex (11). In our experiments, we found that mutation
of nt 143-149 alone or in combination with the AloopU mutation leads
to a severe reduction in the activity of RNA 200 in reactions with NC
(Fig. 7). The fact that the two mutants make the same absolute amount
of ( ) SSDNA in the absence or presence of NC suggests that even when
NC is missing, this interaction plays some role in synthesis of ( )
SSDNA, perhaps by affecting the conformation of the initiation complex.
In contrast, under our usual assay conditions, RNA 244 template
activity is the same in the presence or absence of NC (Fig. 7) and is
not reduced by the single mutation in nt 143-149 (Fig. 7). The small reduction in the activity of the RNA 244 double mutant in the presence
of NC may reflect partial destabilization of the initiation complex,
which NC and/or the downstream sequences cannot overcome. Viewed in
their entirety, these results provide strong evidence that the nucleic
acid chaperone activity of NC modulates the stability of the initiation
complex by favoring an interaction between the 3' anticodon stem and
variable loop of the tRNA and complementary sequences in the template.
In the absence of NC, bases downstream of the PBS also contribute to
stabilization of the initiation complex and promote efficient synthesis
of ( ) SSDNA. Experiments are currently in progress to further
investigate the nature of the anticodon stem/variable loop-template
interaction and the role of NC in this process.
In summary, we have shown that the differences in the activities of
RNA, DNA, and chimeric DNA-RNA primers in the initiation of reverse
transcription are related to differences in helical conformation and
thermal stability of the primer-template complexes. When RNA primers
are used in the absence of NC, the template must contain a minimum of
24 bases downstream of the PBS to achieve efficient ( ) SSDNA
synthesis, presumably because the additional bases lead to a more
stable conformation of the viral RNA template. A similar requirement
for downstream elements is observed with chimeric DNA-RNA primers that
mimic the conformation and stability of the all-RNA primer. NC
abrogates this requirement only in the case of the full-length tRNA
primer by stabilizing the interaction between the 3' anticodon stem and
variable loop of the tRNA and nt 143-149 in the RNA template. Taken
together, these data support an important functional role for
NC-facilitated tRNA-template interactions in initiation of reverse
transcription in vitro.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Besik I. Kankia for assistance
with the CD analysis, as well as helpful discussion. We are also
indebted to Dr. Robert Gorelick for the generous gift of the
recombinant NC protein used in this work.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant AI65056 (to K. M.-F.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of a postdoctoral fellowship from the Japan Society for
the Promotion of Science.
Supported by National Institutes of Health Predoctoral
Training Grant T32-GM08700.
**
To whom correspondence should be addressed: Laboratory of Molecular
Genetics, NICHD, Bldg. 6B, Rm. 216, NIH, Bethesda, MD 20892-2780. Tel.:
301-496-1970; Fax: 301-496-0243; E-mail: jlevin@mail.nih.gov.
Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M211618200
 |
ABBREVIATIONS |
The abbreviations used are:
HIV-1, human
immunodeficiency virus type 1;
nt, nucleotide(s);
PBS, primer binding
site;
( ) SSDNA, ( ) strong-stop DNA;
RT, reverse transcriptase;
PPT, polypurine tract;
NC, nucleocapsid protein;
TBE, Tris-borate/EDTA;
Tm, melting point
temperature.
 |
REFERENCES |
| 1.
|
Isel, C.,
Lanchy, J. M.,
Le Grice, S. F. J.,
Ehresmann, C.,
Ehresmann, B.,
and Marquet, R.
(1996)
EMBO J.
15,
917-924[Medline]
[Order article via Infotrieve]
|
| 2.
|
Lanchy, J. M.,
Ehresmann, C.,
Le Grice, S. F. J.,
Ehresmann, B.,
and Marquet, R.
(1996)
EMBO J.
15,
7178-7187[Medline]
[Order article via Infotrieve]
|
| 3.
|
Lanchy, J. M.,
Keith, G.,
Le Grice, S. F. J.,
Ehresmann, B.,
Ehresmann, C.,
and Marquet, R.
(1998)
J. Biol. Chem.
273,
24425-24432[Abstract/Free Full Text]
|
| 4.
|
Liang, C.,
Rong, L.,
Götte, M.,
Li, X.,
Quan, Y.,
Kleiman, L.,
and Wainberg, M. A.
(1998)
J. Biol. Chem.
273,
21309-21315[Abstract/Free Full Text]
|
| 5.
|
Thrall, S. H.,
Krebs, R.,
Wöhrl, B. M.,
Cellai, L.,
Goody, R. S.,
and Restle, T.
(1998)
Biochemistry
37,
13349-13358[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Beerens, N.,
and Berkhout, B.
(2000)
J. Biol. Chem.
275,
15474-15481[Abstract/Free Full Text]
|
| 7.
|
Beerens, N.,
Groot, F.,
and Berkhout, B.
(2000)
Nucleic Acids Res.
28,
4130-4137[Abstract/Free Full Text]
|
| 8.
|
Arts, E. J.,
Stetor, S. R.,
Li, X.,
Rausch, J. W.,
Howard, K. J.,
Ehresmann, B.,
North, T. W.,
Wöhrl, B. M.,
Goody, R. S.,
Wainberg, M. A.,
and Le Grice, S. F. J.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10063-10068[Abstract/Free Full Text]
|
| 9.
|
Isel, C.,
Marquet, R.,
Keith, G.,
Ehresmann, C.,
and Ehresmann, B.
(1993)
J. Biol. Chem.
268,
25269-25272[Abstract/Free Full Text]
|
| 10.
|
Isel, C.,
Ehresmann, C.,
Keith, G.,
Ehresmann, B.,
and Marquet, R.
(1995)
J. Mol. Biol.
247,
236-250[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Isel, C.,
Westhof, E.,
Massire, C.,
Le Grice, S. F. J.,
Ehresmann, B.,
Ehresmann, C.,
and Marquet, R.
(1999)
EMBO J.
18,
1038-1048[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Arnott, S.,
Chandrasekaran, R.,
Millane, R. P.,
and Park, H. S.
(1986)
J. Mol. Biol.
188,
631-640[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Fedoroff, O. Y.,
Salazar, M.,
and Reid, B. R.
(1993)
J. Mol. Biol.
233,
509-523[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Szyperski, T.,
Götte, M.,
Billeter, M.,
Perola, E.,
Cellai, L.,
Heumann, H.,
and Wüthrich, K.
(1999)
J. Biomol. NMR
13,
343-355[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Ding, J.,
Das, K.,
Hsiou, Y.,
Sarafianos, S. G.,
Clark, A. D., Jr.,
Jacobo-Molina, A.,
Tantillo, C.,
Hughes, S. H.,
and Arnold, E.
(1998)
J. Mol. Biol.
284,
1095-1111[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Jacobo-Molina, A.,
Ding, J.,
Nanni, R. G.,
Clark, A. D., Jr.,
Lu, X.,
Tantillo, C.,
Williams, R. L.,
Kamer, G.,
Ferris, A. L.,
Clark, P.,
Hizi, A.,
Hughes, S. H.,
and Arnold, E.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
6320-6324[Abstract/Free Full Text]
|
| 17.
|
Sarafianos, S. G.,
Das, K.,
Tantillo, C.,
Clark, A. D., Jr.,
Ding, J.,
Whitcomb, J. M.,
Boyer, P. L.,
Hughes, S. H.,
and Arnold, E.
(2001)
EMBO J.
20,
1449-1461[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Coffin, J. M.,
Hughes, S. H.,
and Varmus, H. E.
(1997)
Retroviruses
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 19.
|
Cristofari, G.,
and Darlix, J. L.
(2002)
Prog. Nucleic Acids Res. Mol. Biol.
72,
223-268[Medline]
[Order article via Infotrieve]
|
| 20.
|
Darlix, J. L.,
Lapadat-Tapolsky, M.,
de Rocquigny, H.,
and Roques, B. P.
(1995)
J. Mol. Biol.
254,
523-537[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Herschlag, D.
(1995)
J. Biol. Chem.
270,
20871-20874[Free Full Text]
|
| 22.
|
Rein, A.,
Henderson, L. E.,
and Levin, J. G.
(1998)
Trends Biochem. Sci.
23,
297-301[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Tsuchihashi, Z.,
and Brown, P. O.
(1994)
J. Virol.
68,
5863-5870[Abstract/Free Full Text]
|
| 24.
|
Williams, M. C.,
Rouzina, I.,
Wenner, J. R.,
Gorelick, R. J.,
Musier-Forsyth, K.,
and Bloomfield, V. A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
6121-6126[Abstract/Free Full Text]
|
| 25.
|
Williams, M. C.,
Gorelick, R. J.,
and Musier-Forsyth, K.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
8614-8619[Abstract/Free Full Text]
|
| 26.
|
Guo, J.,
Wu, T.,
Kane, B. F.,
Johnson, D. G.,
Henderson, L. E.,
Gorelick, R. J.,
and Levin, J. G.
(2002)
J. Virol.
76,
4370-4378[Abstract/Free Full Text]
|
| 27.
|
Guo, J.,
Wu, T.,
Anderson, J.,
Kane, B. F.,
Johnson, D. G.,
Gorelick, R. J.,
Henderson, L. E.,
and Levin, J. G.
(2000)
J. Virol.
74,
8980-8988[Abstract/Free Full Text]
|
| 28.
|
Hong, M. K.,
Harbron, E. J.,
O'Connor, D. B.,
Guo, J.,
Barbara, P. F.,
Levin, J. G.,
and Musier-Forsyth, K.
(2003)
J. Mol. Biol.
325,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Johnson, P. E.,
Turner, R. B.,
Wu, Z. R.,
Hairston, L.,
Guo, J.,
Levin, J. G.,
and Summers, M. F.
(2000)
Biochemistry
39,
9084-9091[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Khan, R.,
and Giedroc, D. P.
(1992)
J. Biol. Chem.
267,
6689-6695[Abstract/Free Full Text]
|
| 31.
|
Cen, S.,
Huang, Y.,
Khorchid, A.,
Darlix, J. L.,
Wainberg, M. A.,
and Kleiman, L.
(1999)
J. Virol.
73,
4485-4488[Abstract/Free Full Text]
|
| 32.
|
Feng, Y. X.,
Campbell, S.,
Harvin, D.,
Ehresmann, B.,
Ehresmann, C.,
and Rein, A.
(1999)
J. Virol.
73,
4251-4256[Abstract/Free Full Text]
|
| 33.
|
Chan, B.,
Weidemaier, K.,
Yip, W. T.,
Barbara, P. F.,
and Musier-Forsyth, K.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
459-464[Abstract/Free Full Text]
|
| 34.
|
De Rocquigny, H.,
Gabus, C.,
Vincent, A.,
Fournié-Zaluski, M. C.,
Roques, B.,
and Darlix, J. L.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6472-6476[Abstract/Free Full Text]
|
| 35.
|
Hargittai, M. R. S.,
Mangla, A. T.,
Gorelick, R. J.,
and Musier-Forsyth, K.
(2001)
J. Mol. Biol.
312,
985-997[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Lapadat-Tapolsky, M.,
Pernelle, C.,
Borie, C.,
and Darlix, J. L.
(1995)
Nucleic Acids Res.
23,
2434-2441[Abstract/Free Full Text]
|
| 37.
|
Prats, A. C.,
Housset, V.,
de Billy, G.,
Cornille, F.,
Prats, H.,
Roques, B.,
and Darlix, J. L.
(1991)
Nucleic Acids Res.
19,
3533-3541[Abstract/Free Full Text]
|
| 38.
|
Rong, L.,
Liang, C.,
Hsu, M.,
Guo, X.,
Roques, B. P.,
and Wainberg, M. A.
(2001)
J. Biol. Chem.
276,
47725-47732[Abstract/Free Full Text]
|
| 39.
|
Rong, L.,
Liang, C.,
Hsu, M.,
Kleiman, L.,
Petitjean, P.,
de Rocquigny, H.,
Roques, B. P.,
and Wainberg, M. A.
(1998)
J. Virol.
72,
9353-9358[Abstract/Free Full Text]
|
| 40.
|
Aiyar, A.,
Cobrinik, D.,
Ge, Z.,
Kung, H. J.,
and Leis, J.
(1992)
J. Virol.
66,
2464-2472[Abstract/Free Full Text]
|
| 41.
|
Leis, J.,
Aiyar, A.,
and Cobrinik, D.
(1993)
in
Reverse Transcriptase
(Skalka, A. M.
, and Goff, S. P., eds)
, pp. 33-47, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 42.
|
Morris, S.,
Johnson, M.,
Stavnezer, E.,
and Leis, J.
(2002)
J. Virol.
76,
7571-7577[Abstract/Free Full Text]
|
| 43.
|
Miller, J. T.,
Ehresmann, B.,
Hübscher, U.,
and Le Grice, S. F. J.
(2001)
J. Biol. Chem.
276,
27721-27730[Abstract/Free Full Text]
|
| 44.
|
Isel, C.,
Keith, G.,
Ehresmann, B.,
Ehresmann, C.,
and Marquet, R.
(1998)
Nucleic Acids Res.
26,
1198-1204[Abstract/Free Full Text]
|
| 45.
|
Lanchy, J. M.,
Isel, C.,
Keith, G.,
Le Grice, S. F. J.,
Ehresmann, C.,
Ehresmann, B.,
and Marquet, R.
(2000)
J. Biol. Chem.
275,
12306-12312[Abstract/Free Full Text]
|
| 46.
|
Goldschmidt, V.,
Rigourd, M.,
Ehresmann, C.,
Le Grice, S. F. J.,
Ehresmann, B.,
and Marquet, R.
(2002)
J. Biol. Chem.
277,
43233-43242[Abstract/Free Full Text]
|
| 47.
|
Huang, Y.,
Shalom, A.,
Li, Z.,
Wang, J.,
Mak, J.,
Wainberg, M. A.,
and Kleiman, L.
(1996)
J. Virol.
70,
4700-4706[Abstract]
|
| 48.
|
Kang, S. M.,
Zhang, Z.,
and Morrow, C. D.
(1997)
J. Virol.
71,
207-217[Abstract]
|
| 49.
|
Liang, C.,
Li, X.,
Rong, L.,
Inouye, P.,
Quan, Y.,
Kleiman, L.,
and Wainberg, M. A.
(1997)
J. Virol.
71,
5750-5757[Abstract]
|
| 50.
|
Puglisi, E. V.,
and Puglisi, J. D.
(1998)
Nat. Struct. Biol.
5,
1033-1036[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Skripkin, E.,
Isel, C.,
Marquet, R.,
Ehresmann, B.,
and Ehresmann, C.
(1996)
Nucleic Acids Res.
24,
509-514[Abstract/Free Full Text]
|
| 52.
|
Wakefield, J. K.,
Kang, S. M.,
and Morrow, C. D.
(1996)
J. Virol.
70,
966-975[Abstract]
|
| 53.
|
Beerens, N.,
and Berkhout, B.
(2002)
J. Virol.
76,
2329-2339[Abstract/Free Full Text]
|
| 54.
|
Beerens, N.,
Groot, F.,
and Berkhout, B.
(2001)
J. Biol. Chem.
276,
31247-31256[Abstract/Free Full Text]
|
| 55.
|
Li, X.,
Liang, C.,
Quan, Y.,
Chandok, R.,
Laughrea, M.,
Parniak, M. A.,
Kleiman, L.,
and Wainberg, M. A.
(1997)
J. Virol.
71,
6003-6010[Abstract]
|
| 56.
|
Liang, C.,
Rong, L.,
Russell, R. S.,
and Wainberg, M. A.
(2000)
J. Virol.
74,
6251-6261[Abstract/Free Full Text]
|
| 57.
|
Wu, W.,
Henderson, L. E.,
Copeland, T. D.,
Gorelick, R. J.,
Bosche, W. J.,
Rein, A.,
and Levin, J. G.
(1996)
J. Virol.
70,
7132-7142[Abstract/Free Full Text]
|
| 58.
|
Adachi, A.,
Gendelman, H. E.,
Koenig, S.,
Folks, T.,
Willey, R.,
Rabson, A.,
and Martin, M. A.
(1986)
J. Virol.
59,
284-291[Abstract/Free Full Text]
|
| 59.
|
Guo, J.,
Henderson, L. E.,
Bess, J.,
Kane, B.,
and Levin, J. G.
(1997)
J. Virol.
71,
5178-5188[Abstract]
|
| 60.
|
Zuker, M.,
Mathews, D. H.,
and Turner, D. H.
(1999)
in
RNA Biochemistry and Biotechnology
(Barciszewski, J.
, and Clark, B. F. C., eds)
, pp. 11-43, Kluwer Academic Publishers, Dordrecht, The Netherlands
|
| 61.
|
Mathews, D. H.,
Sabina, J.,
Zuker, M.,
and Turner, D. H.
(1999)
J. Mol. Biol.
288,
911-940[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Guo, J.,
Wu, W.,
Yuan, Z. Y.,
Post, K.,
Crouch, R. J.,
and Levin, J. G.
(1995)
Biochemistry
34,
5018-5029[CrossRef][Medline]
[Order article via Infotrieve]
|
| 63.
|
Scaringe, S. A.,
Francklyn, C.,
and Usman, N.
(1990)
Nucleic Acids Res.
18,
5433-5441[Abstract/Free Full Text]
|
| 64.
|
Sproat, B.,
Colonna, F.,
Mullah, B.,
Tsou, D.,
Andrus, A.,
Hampel, A.,
and Vinayak, R.
(1995)
Nucleosides Nucleotides
14,
255-273
|
| 65.
|
Gyi, J. I.,
Conn, G. L.,
Lane, A. N.,
and Brown, T.
(1996)
Biochemistry
35,
12538-12548[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Kankia, B. I.,
and Marky, L. A.
(1999)
J. Phys. Chem. B
103,
8759-8767
|
| 67.
|
Sugimoto, N.,
Nakano, S.,
Katoh, M.,
Matsumura, A.,
Nakamuta, H.,
Ohmichi, T.,
Yoneyama, M.,
and Sasaki, M.
(1995)
Biochemistry
34,
11211-11216[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Wahl, M. C.,
and Sundaralingam, M.
(2000)
Nucleic Acids Res.
28,
4356-4363[Abstract/Free Full Text]
|
| 69.
|
Yang, J. T.,
and Samejima, T.
(1969)
Prog. Nucleic Acids Res. Mol. Biol.
9,
223-300[Medline]
[Order article via Infotrieve]
|
| 70.
|
Lesnik, E. A.,
and Freier, S. M.
(1995)
Biochemistry
34,
10807-10815[CrossRef][Medline]
[Order article via Infotrieve]
|
| 71.
|
Ratmeyer, L.,
Vinayak, R.,
Zhong, Y. Y.,
Zon, G.,
and Wilson, W. D.
(1994)
Biochemistry
33,
5298-5304[CrossRef][Medline]
[Order article via Infotrieve]
|
| 72.
|
Brulé, F.,
Marquet, R.,
Rong, L.,
Wainberg, M. A.,
Roques, B. P.,
Le Grice, S. F. J.,
Ehresmann, B.,
and Ehresmann, C.
(2002)
RNA
8,
8-15[Abstract]
|
| 73.
|
Ghosh, M.,
Williams, J.,
Powell, M. D.,
Levin, J. G.,
and Le Grice, S. F. J.
(1997)
Biochemistry
36,
5758-5768[CrossRef][Medline]
[Order article via Infotrieve]
|
| 74.
|
Powell, M. D.,
Ghosh, M.,
Jacques, P. S.,
Howard, K. J.,
Le Grice, S. F. J.,
and Levin, J. G.
(1997)
J. Biol. Chem.
272,
13262-13269[Abstract/Free Full Text]
|
| 75.
|
Horton, N. C.,
and Finzel, B. C.
(1996)
J. Mol. Biol.
264,
521-533[CrossRef][Medline]
[Order article via Infotrieve]
|
| 76.
|
Salazar, M.,
Fedoroff, O. Y.,
Miller, J. M.,
Ribeiro, N. S.,
and Reid, B. R.
(1993)
Biochemistry
32,
4207-4215[CrossRef][Medline]
[Order article via Infotrieve]
|
| 77.
|
Ji, X.,
Klarmann, G. J.,
and Preston, B. D.
(1996)
Biochemistry
35,
132-143[CrossRef][Medline]
[Order article via Infotrieve]
|
| 78.
|
Roy, B.,
Beuneu, C.,
Roux, P.,
Buc, H.,
Lemaire, G.,
and Lepoivre, M.
(1999)
Anal. Biochem.
269,
403-409[CrossRef][Medline]
[Order article via Infotrieve]
|
| 79.
|
Li, X.,
Quan, Y.,
Arts, E. J.,
Li, Z.,
Preston, B. D.,
de Rocquigny, H.,
Roques, B. P.,
Darlix, J. L.,
Kleiman, L.,
Parniak, M. A.,
and Wainberg, M. A.
(1996)
J. Virol.
70,
4996-5004[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Post, B. Kankia, S. Gopalakrishnan, V. Yang, E. Cramer, P. Saladores, R. J. Gorelick, J. Guo, K. Musier-Forsyth, and J. G. Levin
Fidelity of plus-strand priming requires the nucleic acid chaperone activity of HIV-1 nucleocapsid protein
Nucleic Acids Res.,
April 1, 2009;
37(6):
1755 - 1766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Iwatani, D. S.B. Chan, F. Wang, K. S. Maynard, W. Sugiura, A. M. Gronenborn, I. Rouzina, M. C. Williams, K. Musier-Forsyth, and J. G. Levin
Deaminase-independent inhibition of HIV-1 reverse transcription by APOBEC3G
Nucleic Acids Res.,
December 18, 2007;
35(21):
7096 - 7108.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, T. E. M. Abbink, C. Pham, and B. Berkhout
Circularization of the HIV-1 RNA genome
Nucleic Acids Res.,
August 7, 2007;
(2007)
gkm564v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, D. Cupac, T. E. M. Abbink, H. Huthoff, and B. Berkhout
The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation
Nucleic Acids Res.,
March 12, 2007;
35(5):
1649 - 1659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-C. Paillart, M. Dettenhofer, X.-f. Yu, C. Ehresmann, B. Ehresmann, and R. Marquet
First Snapshots of the HIV-1 RNA Structure in Infected Cells and in Virions
J. Biol. Chem.,
November 12, 2004;
279(46):
48397 - 48403.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Heilman-Miller, T. Wu, and J. G. Levin
Alteration of Nucleic Acid Structure and Stability Modulates the Efficiency of Minus-Strand Transfer Mediated by the HIV-1 Nucleocapsid Protein
J. Biol. Chem.,
October 15, 2004;
279(42):
44154 - 44165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. M. Abbink, N. Beerens, and B. Berkhout
Forced Selection of a Human Immunodeficiency Virus Type 1 Variant That Uses a Non-Self tRNA Primer for Reverse Transcription: Involvement of Viral RNA Sequences and the Reverse Transcriptase Enzyme
J. Virol.,
October 1, 2004;
78(19):
10706 - 10714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Miller, A. Khvorova, S. A. Scaringe, and S. F. J. Le Grice
Synthetic tRNALys,3 as the replication primer for the HIV-1HXB2 and HIV-1Mal genomes
Nucleic Acids Res.,
September 1, 2004;
32(15):
4687 - 4695.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Goldschmidt, J.-C. Paillart, M. Rigourd, B. Ehresmann, A.-M. Aubertin, C. Ehresmann, and R. Marquet
Structural Variability of the Initiation Complex of HIV-1 Reverse Transcription
J. Biol. Chem.,
August 20, 2004;
279(34):
35923 - 35931.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rigourd, V. Goldschmidt, F. Brule, C. D. Morrow, B. Ehresmann, C. Ehresmann, and R. Marquet
Structure-function relationships of the initiation complex of HIV-1 reverse transcription: the case of mutant viruses using tRNAHis as primer
Nucleic Acids Res.,
October 1, 2003;
31(19):
5764 - 5775.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|