JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M209684200 on January 15, 2003

J. Biol. Chem., Vol. 278, Issue 16, 14461-14468, April 18, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/16/14461    most recent
M209684200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, B.
Right arrow Articles by Shore, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, B.
Right arrow Articles by Shore, G. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Uncleaved BAP31 in Association with A4 Protein at the Endoplasmic Reticulum Is an Inhibitor of Fas-initiated Release of Cytochrome c from Mitochondria*

Bing WangDagger §, Mai NguyenDagger §, David G. BreckenridgeDagger , Marina StojanovicDagger , Paul A. Clemons||, Stephan Kuppig**, and Gordon C. ShoreDagger DaggerDagger

From the Dagger  Department of Biochemistry, McGill University, Montreal, Quebec H3G 1Y, Canada, the || Institute of Chemistry and Cell Biology, Harvard Medical School, Boston, Massachusetts 02115, and the ** Department of Molecular Immunology, Biology III, University of Freiberg and the Max Planck Institute of Immunobiology, Freiburg 71908, Germany

Received for publication, September 20, 2002, and in revised form, December 2, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

BAP31 is a polytopic integral protein of the endoplasmic reticulum membrane and, like BID, is a preferred substrate of caspase-8. Upon Fas/CD95 stimulation, BAP31 is cleaved within its cytosolic domain, generating proapoptotic p20 BAP31. In human KB epithelial cells expressing the caspase-resistant mutant crBAP31, Fas stimulation resulted in cleavage of BID and insertion of BAX into mitochondrial membrane, but subsequent oligomerization of BAX and BAK, egress of cytochrome c to the cytosol, and apoptosis were impaired. Bap31-null mouse cells expressing crBAP31 cannot generate the endogenous p20 BAP31 cleavage product, yet crBAP31 conferred resistance to cellular condensation and cytochrome c release in response to activation of ectopic FKBPcasp8 by FK1012z. Full-length BAP31, therefore, is a direct inhibitor of these caspase-8-initiated events, acting independently of its ability to sequester p20, with which it interacts. Employing a novel split ubiquitin yeast two-hybrid screen for BAP31-interacting membrane proteins, the putative ion channel protein of the endoplasmic reticulum, A4, was detected and identified as a constitutive binding partner of BAP31 in human cells. Ectopic A4 that was introduced into A4-deficient cells cooperated with crBAP31 to resist Fas-induced egress of cytochrome c from mitochondria and cytoplasmic apoptosis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

An emerging model for the regulation of apoptosis posits that BCL-2 family members regulate and integrate upstream death signals that ultimately cause a breach in the mitochondrial outer membrane, releasing factors that contribute to the demise of the cell (1-3). Although multiple extrinsic and intrinsic pathways likely converge on mitochondria to achieve this end, the coupling of mitochondrial responses to upstream stimuli has been most intensively investigated for apoptosis initiated by cell surface death receptors. Activation of the Fas/CD95 signaling complex, for example, causes recruitment and processing of the two major isoforms of procaspase-8, -8/a and -8/b (for review, see Ref. 4). The resulting caspase-8 holoenzyme can then initiate a downstream cascade of events, including direct processing of effector procaspases such as procaspase-3, at least in certain contexts (5-7). An additional target of caspase-8, however, is the proapoptotic BH3-only member of the BCL-2 family, BID (8-10). Caspase-8 cleavage of BID generates tBID, which inserts into the mitochondrial outer membrane where its exposed BH3 death ligand drives the release of cytochrome c from the organelle (11). In addition to recruiting BAX into the outer membrane bilayer (12, 13), mitochondrial tBID induces intramembrane oligomerization of BAX (12, 14, 15) and BAK (11, 16), causing these proapoptotic BCL-2 members to form a proposed conduit for cytochrome c egress from the organelle (3, 17). Once released, cytochrome c becomes an integral constituent of the apoptosome, resulting in further amplification of a caspase cascade (18, 19). Consistent with an essential but redundant role for BAX and BAK in these tBID-dependent events, Bax and Bak double knockout mouse cells, but not single knockouts, remain refractory to ectopic tBID (16). In view of the fact that several other caspase-8 preferred substrates have been identified (20-22), however, an obvious question concerns the contribution they might make to Fas signaling pathways.

Human BAP31 is a 28-kDa polytopic integral protein of the endoplasmic reticulum (ER)1 and part of a large BAP hetero-oligomeric complex that includes the related BAP29 protein and connections to actomyosin (21, 23-25). In addition to its role in the recruitment and regulation of the novel procaspase-8 isoform, procaspase-8L, in response to apoptotic signaling by oncogenic E1A (25), BAP31 itself is a preferred substrate for caspase-8 (23). Cleavage occurs at two identical sites (AAVD.G) in the human protein that flank the DECC (death effector-like coiled coil) domain within the cytosolic disposed C-terminal tail of BAP31 (21). As a first step to investigate the contribution of BAP31 cleavage during apoptosis, we recently established a KB epithelial cell line that expresses caspase-resistant (cr) BAP31, in which the caspase-recognition Asp residues have been mutated to Ala. Caspase-8 activation that is independent of BAP31 in these cells is then achieved by stimulating the Fas death-inducing signaling complex (21). In this system, crBAP31 provided a remarkably pleiotropic resistance to Fas-mediated cytoplasmic apoptosis even though it had little influence on processing procaspases-8/a and -8/b and activation of downstream effector caspases. In contrast, apoptotic membrane blebbing/fragmentation and redistribution of actin were strongly inhibited, the cells retained a near normal morphology, and irreversible loss of cell growth potential after removal of the Fas stimulus was delayed (21). Preservation of full-length BAP31 in the face of Fas stimulation also restrained the release of cytochrome c from the mitochondria (21). These results suggest, therefore, that cleavage of BAP31 during Fas-mediated cell death might regulate a proximal step that impacts several components of cytoplasmic apoptosis.

Here, we have addressed two questions regarding the regulation of the Fas pathway by full-length BAP31. Is BAP31 itself a direct inhibitor of the Fas pathway rather than simply acting as a precursor for generating the proapoptotic caspase-8 cleavage product, p20BAP31? And, if so, does this activity of BAP31 depend on the association of BAP31 with other proteins located in the ER membrane?

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

General

The routine procedures used in this study for measuring apoptotic cell death by microscopic examination of uptake of trypan blue, generation of cellular fractions, SDS-PAGE, immunoblotting and development of blots by enhanced chemoluminescence, and assays to measure release of cytochrome c from mitochondria have been documented in earlier publications (13, 21, 24, 26).

Antibodies

The following antibodies were used in this study: chicken anti-human BAP31 (24) and anti-human TOM20 (27); rabbit polyclonal antibody raised against a recombinant A4 C terminus (amino acids 132-152); rabbit anti-human BAK (Upstate Biotechnology); mouse anti-FLAG (Sigma); rabbit polyclonal antibodies against the p18 catalytic subunit of caspase-8 (gift from D. Nicholson) and gamma -actin (gift from P. Braun); rabbit polyclonal antibody raised against the p15 caspase cleavage product of recombinant BID and purified by affinity selection; mouse monoclonal antibody against pigeon cytochrome c (Pharmingen); rabbit antibody against human BAX amino acids 1-21 (Upstate Biotechnology) or amino acids 1-20 (Santa Cruz).

Cells and Transfections

Human KB epithelial cell lines expressing wt BAP31-FLAG or crBAP31-FLAG were created and cultured as described previously (21). Differentiated Bap31-null mouse embryonic stem cells were created as described (25). Stable expression of crBAP31-FLAG in differentiated Bap31-null cells was established by transfection (21) using LipofectAMINE 2000 (Invitrogen) following the manufacturer's protocol, and cells were cultured in Knockout Dulbecco's modified Eagle's medium (Invitrogen) in the presence of 150 µg/ml G418. Clones were isolated which expressed crBAP31-FLAG at levels similar to the level of Bap31 expressed in wt cells. HepG2 cells were maintained in minimum essential medium supplemented with 10% fetal calf serum and 1% penicillin/streptomycin, at 37 °C in humidified 5% CO2. Stable cell lines expressing pcDNA3.1/hygromycin vector, pcDNA3.1/hygromycin- A4-HA, or pcDNA3.1/neomycin-crBAP31-FLAG were created, and A4/crBAP31 double expression cell lines were created by transfecting A4-HA into crBAP31-FLAG stable cell lines under a dual selection strategy.

Activation of FKBPcasp8 by the Dimerizing Compound FK1012z

The expression vectors MFpk3HAFLICE (28) and pcDNA3-GFP were transiently cotransfected into differentiated Bap31-null or wt mouse embryonic stem cells. After 24 h, solvent (mixture of 50% ethanol and 50% dimethyl sulfoxide) containing or lacking FK1012z (final concentration, 1.0 nM), a derivative of FK1012 prepared by olefin metathesis using a modification of the procedure described by Diver and Schreiber (29), was added. At the indicated times, cells were collected, and 25 µg of total lysates was subjected to SDS-PAGE and immunoblotting using anti-HA antibody.

Immunofluorescence

For stable cell lines, cells were grown on coverslips for 24 h. They were treated with 0.5 µg/ml alpha -human Fas-activating antibody (Upstate Biotechnology) in the presence of 10 µg/ml cycloheximide for the indicated times. Cells were fixed in 4% paraformaldehyde and immunostained as described elsewhere (21). Cells were visualized by confocal microscopy or by Nikon TE-FM Epi-fl microscopy.

For analysis of the Bap31-null cells or their derivatives, the cells were grown on glass coverslips for 24 h. They were transfected, using LipofectAMINE 2000, with 0.2 µg of pCMS-EGFP (Clontech) and 0.8 µg of MFpk3HAFLICE (28)/coverslip. 24 h later, they were treated with or without FK1012z, and the cells were subsequently fixed at the indicated times with 4% paraformaldehyde. Similarly, COS-1 cells were transfected with 0.5 µg of A4-HA and 0.5 µg of BAP31-FLAG coverslip for 24 h before fixing and immunostaining. Nuclei were stained with DAPI and fluorescence analyzed by confocal microscopy or by Nikon TE-FM Epi-fl microscopy.

Split Ubiquitin Yeast Two-hybrid Screen

pRSB(BAP31-Cub-Protein A-LexA-VP16)-- The entire coding sequence of human BAP31 with NsiI-BsiwI linker at the 5'-end was generated by PCR using primers TCCGCTCGAGATGCATCTCTCTCTCTCGTACGATGAGTCTGCAGTGGACT and TCCGCTCGAGCTCTTCCTTCTTGTCCAT. Delta wbp1 was excised from pRSB (Delta wbp1-Cub-PLV) (30) and replaced with BAP31 to generate pRS305(BAP31-Cub-PLV). The yeast CUP1 promoter was created by PCR using primers CCAATGCATTGGATCCCATTACCGACATTTG and CCACGTACGGCTTGATATCGAATTCGT and inserted into NsiI-BsiwI upstream of BAP31. The resulting plasmid, termed pRSB, was integrated into the CUP1 gene of Saccharomyces cerevisiae strain L40 (MATa trp1 leu2 his3 LYS2::lexA-HIS3 URA3::lexA-lacZ), and clones (termed pRSB-L40) were selected on leucine plates. The expression of the BAP31-Cub-PLV fusion protein was verified by immunoblotting using antibodies against BAP31 or horseradish peroxidase-conjugated rabbit IgG.

cDNA Libraries-- CUP1-NubG with linkers SalI-EcoRI at the 5'-end and XhoI-BglII at the 3'-end of NubG was generated by PCR from pRS314(NubG-ALG5) (30) using oligonucleotides TCGGCGGTGGCGGCCGCTCTAGAAC and AACTGCAGCTCGAGGAGAGAGAGATCTCCACCAGGGATCCCTTC. The resulting PCR products were ligated to pRS314 (NubG-ALG5 deleted) and sequenced thoroughly. Standard protocols were employed to generate double stranded cDNA from HeLa mRNA. Linkers containing restriction sites BglII-XhoI or SalI-EcoRI were added, and the resulting cDNAs were fractionated on a 10-30% sucrose gradient. Fractions containing cDNAs in the range of 2-13 kb were collected, ligated to pRSN(CUP1-NubG), and transformed into HB101 to create pRSC(CUP1-cDNA-NubG) libraries, using the SalI-EcoRI link, or pRS314(CUP1-NubG-cDNA) libraries, using the BglII-XhoI link. Four different size-selected libraries (averaging 5 × 106 transformants/library) were generated for each orientation. Plasmid DNA were purified and used to transform pRSB-L40.

Identification of Clones-- All yeast transformations were done as described (31). Routinely, 20 µg of DNA of each library was transformed into pRSB-L40 and clones were selected on leucine/tryptophane/histidine plates in the presence of 0.2 mM CuSO4 and 5 mM 3-aminotriazole. 50 independent clones were picked from each of the eight libraries, and their DNAs were isolated. After transformation into Escherichia coli DH5alpha , the sequences of individual clones were determined and compared with sequences deposited in NCBI data base using BLAST. Potential candidates were tested further for specificity by retransformation into pRSB-L40.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

crBAP31-- The schematic in Fig. 1A depicts the topology of human BAP31 in the membrane of the ER and denotes the two identical caspase recognition sites (AAVD.G) flanking the cytosolic disposed DECC domain in the protein (21, 24). Cleavage at these sites generates the products p27 and p20 (21; Fig. 1B). In contrast to the human protein, murine BAP31 lacks the distal caspase cleavage site and generates only the p20 product during apoptosis (24).2 Human crBAP31-FLAG was created by mutating the two caspase recognition aspartate residues to alanine and inserting the FLAG epitope immediately upstream from the canonical KKEE ER retrieval signal located at the extreme C terminus of the protein. Human KB epithelial cell lines were established which stably express crBAP31-FLAG at levels 2-3-fold higher than that of the endogenous BAP31 protein (21). Upon stimulation of these crBAP31-FLAG cells with 0.5 µg/ml agonistic antibody against Fas/CD95, in the presence of 10 µg/ml cycloheximide (CHX) to enhance sensitivity to Fas activation (6), caspases, including caspase-8 and caspase-3, are activated. As a result, caspase targets such as endogenous BAP31 and poly(ADP-ribosyl) polymerase are cleaved (21).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   Cleavage of BAP31 after stimulation of death receptors. A, topology of BAP31 in the ER membrane (24). The presence of charged residues in the predicted transmembrane segments are indicated by + and -. To create crBAP31, the caspase-recognition Asp residues were converted to Ala (asterisks); the FLAG epitope sequence was inserted immediately upstream from the KKEE ER retrieval signal located at the C terminus (21). DECC, weak death effector and overlapping coiled coil domain. The hetero-oligomer of ectopic p28 crBAP31-FLAG and endogenous p20 BAP31 is shown on the right. B, crBAP31 resists Fas-induced caspase cleavage. Wild type (Wt) parental (control) KB cells (upper panel) or KB cells expressing crBAP31-FLAG (lower panel) were stimulated with 0.5 µg/ml anti-Fas (alpha  Fas) antibody in the presence of 10 µg/ml CHX for the indicated times, and whole cell lysates were subjected to SDS-PAGE, immunoblotted with chicken anti-BAP31 (alpha  BAP31) antibody, and visualized by enhanced chemiluminescence. C, parental KB cells (Wt) or KB cells expressing crBAP31-FLAG were stimulated for 7 h with the indicated concentrations of Fas in the presence of 10 µg/ml CHX and analyzed for the apoptotic index (percent trypan blue-positive apoptotic cells ± S.D. for three independent determinations). D, MCF-7 cells were treated with TNF-alpha /CHX exactly as described by Stegh et al. (22), and at the indicated times aliquots of whole cell lysates containing equivalent amounts of protein were subjected to SDS-PAGE and immunoblotted with antibodies (alpha ) against p18 caspase-8 (top two panels, showing unprocessed procaspase-8/a and -8/b and the processing intermediates p24 and p26), anti-BAP31, which detects full-length BAP31 as well as the p27 and p20 cleavage products (middle two panels), and anti-BID, which also weakly detects p15 tBID (bottom two panels). E, KB cells expressing crBAP31-FLAG were stimulated with or without 0.5 µg/ml anti-Fas antibody in the presence of 10 µg/ml CHX for 7 h, and total cell lysates were subjected to immunoprecipitation (i.p.) with anti-FLAG antibody. The resulting precipitates were resolved by SDS-PAGE and immunoblotted with chicken anti-BAP31.

As documented in Fig. 1B, the time course for this Fas-induced cleavage of endogenous BAP31 was very similar for wt parental KB cells and KB cells expressing crBAP31-FLAG, indicating that the activity of the upstream caspase is similar in the two cell types. Moreover, the two cell types express equivalent levels of Fas receptor (as determined by immunoblot; not shown) and, after stimulation, process procaspase-8/a and -8/b to a similar extent (21). In contrast to endogenous BAP31, however, crBAP31-FLAG was not cleaved (Fig. 1B), and cells expressing crBAP31-FLAG resisted apoptotic membrane blebbing (21) and loss of cell viability as assessed by the uptake of trypan blue (Fig. 1C), even though caspases are active in these cells. Caspase cleavage of the endogenous BAP31 in crBAP31-FLAG-expressing cells generated the proapoptotic fragment, p20 BAP31 (Fig. 1B); however, this truncated p20 BAP31 product was associated with excess crBAP31-FLAG (Fig. 1E) and remained nontoxic (21).2

In vitro, BAP31 exhibits a marked preference for cleavage by caspase-8 rather than by caspase-3 (24). To extend this to a cellular context, MCF-7 mammary epithelial cells lacking caspase-3 were stimulated with TNF-alpha , which leads to high levels of caspase-8 activity but low or insignificant activation of caspases-1, -2, -3, -5, -6, -7, -9, or -10 (22, 32). As shown in Fig. 1D, TNF-alpha stimulation of MCF-7 cells caused procaspase-8/a and -8/b to be processed, which correlated with the detectable cleavage of both BAP31 and BID. Thus, caspase-8 generates BAP31 and BID cleavage products as early events after TNF-alpha receptor activation in intact MCF-7 cells.

Full-length BAP31 Is an Inhibitor of Caspase-8-induced Release of Cytochrome c from Mitochondria in Intact Cells-- To test the ability of full-length BAP31 to inhibit directly the apoptotic pathway initiated by caspase-8, as opposed to simply binding and sequestering the p20 cleavage product (Fig. 1E), crBAP31-FLAG was reconstituted in mouse cells from which the Bap31 gene had been deleted (Ref. 25), and the cytochrome c release pathway was initiated by chemical activation of caspase-8. Because these Bap31-null cells do not express endogenous (i.e. cleavable) BAP31, their resistance to caspase-8 cannot be explained by the ability of crBAP31 to sequester the proapoptotic p20 cleavage product of endogenous Bap31 (Fig. 1, A and E). The response of Bap31-null/crBAP31-FLAG cells was compared with that of Bap31-null cells as control; again, the latter cannot generate the proapoptotic cleavage product of endogenous Bap31, which could contribute to the outcome. MFpk3HAFLICE, a vector expressing a fusion protein in which triplicate copies of FKBP and an HA tag replace the prodomain of procaspase-8 (28), was transiently transfected into Bap31-null and Bap31-null/crBAP31-FLAG cells, together with vector expressing GFP. 24 h later, cells were treated with the FKBP-dimerizing chemical, FK1012z, which initiates aggregation and autoactivation of the caspase-8 fusion protein (28), or the cells were treated with vehicle alone. Commensurate with processing of FKBPcasp8 (Fig. 2C), cotransfected GFP-expressing Bap31-null cells lacking crBAP31-FLAG condensed rapidly, whereas those expressing crBAP31-FLAG resisted this apoptotic response (Fig. 2, A and B). Moreover, cytochrome c remained punctate in cells expressing crBAP31 and treated with FK1012z, whereas it was found diffuse throughout the apoptotic cells lacking crBAP31 (Fig. 2, D and E). In both cell types, however, similar levels and processing of ectopic MFpk3HAFLICE in response to FK1012z were observed (Fig. 2C). Collectively, the results show that full-length (uncleaved) BAP31 is an inhibitor of caspase-8-driven cellular condensation and release of cytochrome c from mitochondria. Moreover the results indicate that the p20 cleavage product of BAP31 is not essential for these caspase-8-initiated events but rather may provide an amplifying effect. As expected, Bap31-null cells expressing wt BAP31, which was cleaved and generated p20 after activation of caspase-8, were fully sensitive to the caspase-8-initiated events (not shown).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.   crBAP31 inhibits caspase-8-induced cellular condensation and cytochrome c release from mitochondria. A, Bap31-null mouse cells or Bap31-null/crBAP31 cells were transfected with MFpk3FLICE and pCMS-EGFP for 24 h after which time FK1012z (or vehicle alone, not shown) was added. At the indicated time points, cells were fixed and stained with DAPI. Visualization of the fluorescence for DAPI (blue) or GFP (green) was carried out using confocal microscopy. B, after treatment with FK1012z or vehicle alone, green fluorescent cells that had a condensed morphology were scored and expressed as a percent of total GFP-positive cells (±S.D. from three independent determinations). C, immunoblotting of total cellular lysate with anti-HA antibody to detect the HA-tagged MFpk3FLICE at the indicated time points after the addition of FK1012z. Equivalent gel loading was determined by probing the blot with anti-gamma -actin antibody. D, similar to A except that cells were stained with Alexa-594-conjugated anti-cytochrome c (Cyt c), and the green (GFP) and red (cytochrome c) fluorescence was visualized by Nikon TE-FM Epi-fl microscopy. E, GFP-expressing cells that showed diffuse cytochrome c staining (released, see arrows in D) after treatment of cells with FK1012z or vehicle alone were scored and expressed as a percent of total green cells (±S.D. from three independent determinations).

crBAP31 Inhibits Fas-induced Cytochrome c Egress from Mitochondria Upstream from Activation of BAX and BAK at the Mitochondrial Outer Membrane-- Because a specific pathway has now been elucidated for Fas-induced cytochrome c egress from mitochondria, dependent on BID (3), the individual steps on this pathway were analyzed in crBAP31-expressing KB cells (Fig. 3A). Full-length BID was found in loose association with mitochondria isolated from these cells, where it remained extractable at pH 11.5 (not shown), indicative of a peripheral rather than integral association with membrane (33). Upon stimulation of the Fas pathway, BID was processed, and crBAP31 had little influence on this step (Fig. 3B, top panel). Similarly, crBAP31 exerted little influence on BAX insertion into the mitochondrial outer membrane. In the absence of Fas ligation, negligible BAX was integrated into mitochondrial membrane as judged by its failure to acquire resistance to alkaline extraction (time 0, Fig. 3B, middle panel). In contrast, Fas stimulation rapidly induced BAX membrane integration in both wt and crBAP31-expressing cells. The inhibition of cytochrome c release which is imposed by crBAP31 on the Fas death pathway (21; Fig. 3A), therefore, occurs downstream from stimulation-induced insertion of BAX into mitochondrial membrane.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   KB cells expressing crBAP31 resist Fas-induced apoptotic membrane fragmentation and release of cytochrome c from mitochondria. A, wt (parental) KB epithelial cells and KB cells stably expressing crBAP31-FLAG were stimulated with 0.5 µg/ml anti (alpha )-Fas/CHX (see Fig. 1) for the indicated times, and cytochrome c was examined by immunofluorescence microscopy, as described under "Experimental Procedures." The images shown are typical of multiple independent fields that were examined. B, as in A except that the heavy membrane fraction enriched in mitochondria was isolated (26). Aliquots containing equivalent amounts of protein were analyzed by SDS-PAGE and immunoblotting either directly (-Alkali) with antibody against BID or after the mitochondrial fraction had been extracted with 0.1 M NaCO3, pH 11.5 (+Alkali) (26), in which case the blots were probed either with antibody against BAX or with antibody against the human mitochondrial outer membrane protein import receptor, TOM20 (27, 37). C, parental KB (Wt) cells or KB cells stably expressing crBAP31-FLAG were stimulated with anti-Fas as described in A for 0 or 6 h, and the cells were analyzed by immunofluorescence microscopy employing the conformation-sensitive antibody against BAX, alpha  BAX-NT (amino acids l-21) (Upstate Biotechnology). D, as in B except that the heavy membrane fraction enriched in mitochondria was isolated after the indicated treatments and incubated with the chemical cross-linking agent bis-maleimidohexane (BMH) or with vehicle (dimethyl sulfoxide (DMSO)) alone. The fractions were then subjected to SDS-PAGE and immunoblotted with antibody against BAK. Solid squares indicate cross-linked BAK products, and asterisks indicate BAK that harbors an intramolecular cross-link (11). The positions of protein size markers are also indicated (left).

To examine the subsequent steps in the Fas pathway (3), we exploited the observation that BAX undergoes a conformational change in response to cell death stimuli in intact cells, manifesting in the acquisition of reactivity with an antibody directed to the N terminus of the protein (34). This acquisition of immunoreactivity in intact cells correlates with the appearance of large oligomeric structures containing BAX and the release of cytochrome c from mitochondria (12, 15). At a time when significant BAX membrane insertion had occurred (6 h after stimulation of Fas; Fig. 3B), a strong Fas-induced fluorescent immunoreactivity was observed for BAX in wt but not in crBAP31-expressing KB cells (Fig. 3C). Quantification revealed that greater than 85% of wt cells acquired BAX immunofluorescence after Fas stimulation, and this was reduced to less than 15% for crBAP31 cells. The results of Fig. 3, B and C, therefore, indicate that the predicted BAX oligomerization based on immunofluorescence occurs subsequent to BAX membrane insertion and that it is only the oligomerization step that is inhibited by crBAP31. Similarly, a direct analysis of the oligomeric status of BAK, which is constitutively integrated in the mitochondrial outer membrane, in response to Fas stimulation revealed a failure of BAK to enter into higher order structures. Mitochondria isolated from Fas-stimulated wt KB cells and treated with the homobifunctional chemical cross-linker bis-maleimidohexane (11) exhibited a time-dependent shift of BAK into oligomeric structures (Fig. 3D), with a concomitant decrease in that fraction of monomeric BAK which can sustain intramolecular cross-linking (11) (designated BAK** in Fig. 3D). In contrast, the induction of BAK oligomers was strongly curtailed in Fas-stimulated cells expressing crBAP31 (Fig. 3D).

BAP31 Interacts with the Resident ER Membrane Protein, A4-- The split ubiquitin yeast two-hybrid assay for detecting interactions between integral membrane proteins (30, and references therein) was adapted to include BAP31 as bait and HeLa cell cDNA expression libraries as a source of potential BAP31-binding partners (see Fig. 4A and "Experimental Procedures"). One directional library, harboring cDNAs tagged at the 3'-end of coding sequences with a sequence encoding the NubG fragment, yielded multiple hits for a cDNA encoding full-length A4, a small (17 kDa) four-membrane-spanning integral protein of the ER membrane which multimerizes and exhibits characteristics of an ion channel (35; Fig. 4B). Because BAP31 is also an ER resident protein (24), fluorescence microscopy of COS-1 cells cotransfected with cDNAs encoding A4-HA and BAP31-FLAG revealed an extensive colocalization of the two proteins (yellow fluorescence in Fig. 4C). Moreover, a rabbit polyclonal antibody raised against the cytosolic-exposed C terminus of A4 successfully precipitated the endogenous A4 protein expressed in KB epithelial cells, and an analysis of this immunoprecipitate with anti-BAP31 revealed the presence of endogenous BAP31 as well (Fig. 5A). We conclude, therefore, that BAP31 constitutively associates with A4 in the ER membrane. Of note, transient cotransfection analyses revealed that the caspase-generated p20 BAP31 fragment (Fig. 1A) also can associate with A4 (Fig. 5B), suggesting that A4 remains part of the caspase-cleaved BAP31 complex during Fas-induced apoptosis. This was confirmed by identifying the presence of the p20 cleavage product after precipitation of endogenous A4 in Fas-stimulated cells (data not shown).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 4.   Identification of the BAP31-associated protein, A4. A, polypeptides that interact with bait protein in the split ubiquitin yeast two-hybrid screen bring together the C-terminal fragment of ubiquitin (Cub) and a modified N-terminal fragment (NubG), allowing ubiquitin-activated protease (UBP) to liberate the associated fusion protein, Protein A-LexA promoter-binding protein-VP16 activation domain (PLV), which enters the nucleus and activates the expression of selectable marker genes under the control of LexA promoter sites. B, topology of A4 in the membrane of the ER (35). C, COS-1 cells were transiently transfected with vectors expressing A4-HA and BAP31-FLAG, and the fixed cells visualized by fluorescence microscopy after staining with antibodies against A4 (green) and FLAG (red). A representative cell in which the merged red and green fluorescence overlap is detected in yellow.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Endogenous BAP31 and A4 interact. A, total cell lysates from KB epithelial cells (30) were subjected to immunoprecipitation (i.p.) with rabbit preimmune (lane 2) or anti-A4 (lane 3), and the precipitates were probed by blotting with anti-A4 (upper panel) or with anti-BAP31 (lower panel). Lane 1, a portion of the input cell lysate. B, 293T cells were transiently cotransfected with vectors expressing the indicated proteins, immunoprecipitations were conducted with anti-HA or anti-FLAG as described (50), and the precipitates were blotted and probed with the indicated antibody.

A screen of various human cell lines identified hepatocarcinoma-derived HepG2 cells as lacking expression of A4 (Fig. 6A). HepG2 cells are responsive to Fas ligation, which results in cleavage of endogenous BAP31 and death by apoptosis (not shown). Remarkably, however, HepG2 cells stably expressing crBAP31 at levels 2-3-fold higher than endogenous BAP31 were not resistant to Fas-induced release of cytochrome c from mitochondria or to cytoplasmic membrane blebbing (Fig. 6, C and D). To address the question of functional interaction between BAP31 and A4 and the requirement for this interaction to inhibit the Fas pathway, therefore, we created HepG2 cell lines that stably express crBAP31 and A4 either alone or in combination (Fig. 6B). Clones were selected which expressed A4 at levels commensurate with the expression levels seen in other cell lines (Fig. 6A). After Fas stimulation, the cells were assessed for release of cytochrome c from mitochondria. The results indicate a cooperative interaction between A4 and crBAP31, where both proteins together resisted Fas-mediated cytochrome c release more effectively than either protein alone (Fig. 6, C and D). Moreover, the results that are presented in Fig. 6, B-D, were also obtained for a second set of cell clones selected for similar expression levels of crBAP31-FLAG and A4-HA. Inhibition of Fas-mediated cytoplasmic apoptosis by full-length BAP31, therefore, depends upon the presence of A4 protein.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6.   crBAP31 cooperates with A4 to inhibit Fas-mediated apoptosis. A, cell lysates derived from the indicated cell lines were subjected to immunoblot with antibody against A4, BAP31, or gamma -actin. B, HepG2 cells stably expressing crBAP31-FLAG, A4-HA, or crBAP31-FLAG and A4-HA were analyzed by immunoblot using antibodies against A4 and FLAG. C, the cells described in B were stimulated with 0.5 µg/ml anti- (alpha )-Fas/CHX (see Fig. 1) for the indicated times and cytochrome c examined by immunofluorescence microscopy, as described under "Experimental Procedures." Representative images for crBAP31 versus crBAP31/A4 cells are presented with arrows denoting apoptotic cells with diffuse cytochrome c staining. Quantification of the results for vector alone (control) or crBAP31-FLAG and A4-HA either alone or in combination with S.D. is shown in D.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Initiation of apoptosis after stimulation of the Fas/CD95 family of death receptors involves the recruitment and autoactivation of procaspase-8/a,b at the receptor death-inducing signaling complex, resulting in formation of the caspase-8 holoenzyme (4, 33, 36). Cleavage of a limited number of substrates by this initiator caspase is then sufficient to commit the cell to die unless downstream pathways are blocked by antiapoptotic regulators. One set of substrates is the effector procaspases including procaspase-3, at least in certain cellular contexts (5-7). Other preferred substrates of caspase-8 which have been identified, however, include RIP (20), BID (8-10), plectin (22), and BAP31 (24). Cleavage of these and other potential substrates downstream from receptor activation may induce critical proapoptotic changes at specific cellular sites that collectively support the early events of apoptosis progression in intact cells.

Although the p20 BAP31 caspase cleavage product itself is an inducer of apoptosis (24),2 we have exploited Bap31-null mouse cells (Ref. 25) to establish that full-length BAP31 is in fact a direct inhibitor of apoptosis initiated by caspase-8 in the absence of p20 BAP31. BAP31 cleavage, therefore, likely removes this barrier to caspase-8-induced downstream events, permitting apoptosis progression initiated by this caspase in the Fas death program. BAP31, therefore, may be like other inhibitors of apoptosis such as RIP (20), BCL-2 (38), and BCL-XL (39) whose cleavage by caspase converts the inhibitor into an activator that contributes to but is not essential for apoptosis progression. In MCF-7 cells, in which only caspase-8 and not caspases-1, -2, -3, -5, -6, -7, -9, or -10 become strongly activated in response to TNF-alpha stimulation (22, 32), we showed that cleavage of both BID and BAP31 correlated with processing of procaspase-8/a,b. Furthermore, in KB cells, the expression of crBAP31-FLAG did not interfere with the apparent cleavage of BID or insertion of BAX into mitochondrial membrane after Fas stimulation. However, the subsequent steps of BAX and BAK oligomerization and release of cytochrome c from the organelle were inhibited. Thus, cleavage of BAP31 at the ER appears to be required to support these caspase-8- and tBID-initiated steps at mitochondria in intact cells.

We showed that BAP31 associates with another resident protein of the ER, A4, a multimeric four-membrane-spanning proteolipid protein with reported ion channel activity (35), and that BAP31 cooperates with A4 to resist cytochrome c release from mitochondria and cytoplasmic apoptosis in the Fas pathway. Each of the transmembrane segments of A4 is predicted to contain a charged amino acid (Fig. 4B and Ref. 35), as do transmembrane segments 1 and 3 of BAP31 (24). A4 also exhibits overall structural similarities with the 16-kDa subunit c of proton-conducting vacuolar ATPase (35). Apoptosis progression typically involves changes in cytoplasmic calcium and magnesium, pH, and the redox status of the cell (40-49). One possibility, therefore, is that the BAP31-A4 complex can resist one or more of the pathways controlling these changes and that this inhibition is lost upon cleavage of BAP31. This in turn may result in sensitization of mitochondria to other caspase-8-induced events, leading to efficient apoptosis in the Fas pathway in intact cells.

    ACKNOWLEDGEMENTS

We are very grateful to Vishva Dixit, Marta Muzio, and Claudius Vincenz for the gift of MFpk3HAFLICE; to Stephan Heesan, Igor Stagljar, Annette Herscovics, and Michel Masaad for the gift of split ubiquitin vectors and for advice; and to Marc Germain for discussions.

    FOOTNOTES

* This work was supported in part by the National Cancer Institute of Canada, the Canadian Institutes of Health Research, the Deutsche Forchungsgemeinschaft through Grant SFB 388, and the Leibniz program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ These authors contributed equally to this work.

Recipient of a Canadian Institutes of Health doctoral research award.

Dagger Dagger To whom correspondence should be addressed: Dept. of Biochemistry, McIntyre Medical Sciences Bldg., McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec H3G 1Y6, Canada. Tel.: 514-398-7282; Fax: 514-398-7384; E-mail: gordon.shore@mcgill.ca.

Published, JBC Papers in Press, January 15, 2003, DOI 10.1074/jbc.M209684200

2 B. Wang, M. Nguyen, D. G. Breckenridge, M. Stojanovic, P. A. Clemons, S. Kuppig, and G. C. Shore, unpublished data.

    ABBREVIATIONS

The abbreviations used are: ER, endoplasmic reticulum; CHX, cycloheximide; crBAP31, caspase-resistant BAP31; DAPI, 4,6-diamidino-2-phenylindole; DECC, death effector-like coiled coil; EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; HA, hemagglutinin; TNF, tumor necrosis factor; wt, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Bouillet, P., and Strasser, A. (2002) J. Cell Sci. 115, 1567-1574[Abstract/Free Full Text]
2. Bernardi, P., Petronilli, V., Di Lisa, F., and Forte, M. (2001) Trends Biochem. Sci. 26, 112-117[CrossRef][Medline] [Order article via Infotrieve]
3. Korsmeyer, S. J., Wei, M. C., Saito, M., Oh, S., Weiler, K. J., and Schlesinger, P. H. (2000) Cell Death Differ. 12, 1166-1173
4. Krammer, P. H. (2000) Nature 407, 789-795[CrossRef][Medline] [Order article via Infotrieve]
5. Scaffidi, C., Fulda, F., Srinivasan, A., Friesen, C., Li, F., Tomaselli, K. J., Debatin, K. M., Krammer, P. H., and Peter, M. E. (1998) EMBO J. 17, 1675-1687[CrossRef][Medline] [Order article via Infotrieve]
6. Scaffidi, C., Schmitz, I., Zha, J., Korsmeyer, S. K., Krammer, P. H., and Peter, M. E. (1999) J. Biol. Chem. 274, 22532-22538[Abstract/Free Full Text]
7. Huang, D. C., Tschopp, J., and Strasser, A. (2000) Cell Death Differ. 7, 754-755[CrossRef][Medline] [Order article via Infotrieve]
8. Li, H., Zhu, H., Xu, C.-J., and Yuan, J. (1998) Cell 94, 491-501[CrossRef][Medline] [Order article via Infotrieve]
9. Luo, X., Budihardji, I., Zou, H., Slaughter, C., and Wang, X. (1998) Cell 84, 481-490
10. Gross, A., Yin, X. M., Wang, K., Wei, M. C., Jockel, J., Milliman, C., Erdjument-Bromage, H., Tempst, P., and Korsmeyer, S. K. (1999) J. Biol. Chem. 274, 1156-1163[Abstract/Free Full Text]
11. Wei, M. C., Lindsten, T., Mootha, V. K., Weiler, S., Gross, A., Ashiya, M., Thompson, C. B., and Korsmeyer, S. K. (2000) Genes Dev. 14, 2060-2071[Abstract/Free Full Text]
12. Eskes, R., Desagher, S., Antonsson, B., and Martinou, J.-C. (2000) Mol. Cell. Biol. 20, 929-935[Abstract/Free Full Text]
13. Ruffolo, S. C., Breckenridge, D. G., Nguyen, M., Goping, I. S., Gross, A., Korsmeyer, S. J., Li, H., Yuan, J., and Shore, G. C. (2000) Cell Death Differ 7, 1101-1108[CrossRef][Medline] [Order article via Infotrieve]
14. Perez, D., and White, E. (2000) Mol. Cell 6, 53-63[CrossRef][Medline] [Order article via Infotrieve]
15. Antonsson, B., Montessuit, S., Sanchez, B., and Martinou, J. C. (2001) J. Biol. Chem. 276, 11615-11623[Abstract/Free Full Text]
16. Wei, M. C., Zong, W. X., Cheng, E. H., Lindsten, T., Panoutsakopoulou, V., Ross, A. J., Roth, K. A., MacGregor, G. R., Thompson, C. B., and Korsmeyer, S. J. (2001) Science 292, 727-730[Abstract/Free Full Text]
17. Saito, M., Korsmeyer, S. K., and Schlesinger, P. H. (2000) Nat. Cell Biol. 2, 553-555[CrossRef][Medline] [Order article via Infotrieve]
18. Budihardjo, I., Oliver, H., Lutter, M., Luo, X., and Wang, W. (1999) Annu. Rev. Cell Dev. Biol. 15, 269-290[CrossRef][Medline] [Order article via Infotrieve]
19. Adrain, C., and Martin, S. J. (2001) Trends Biochem. Sci. 26, 390-397[CrossRef][Medline] [Order article via Infotrieve]
20. Lin, Y., Devin, A., Rodriguez, Y., and Liu, Z. G. (1999) Genes Dev. 13, 2514-2526[Abstract/Free Full Text]
21. Nguyen, M., Breckenridge, D. G., Ducret, A., and Shore, G. C. (2000) Mol. Cell. Biol. 20, 6731-6740[Abstract/Free Full Text]
22. Stegh, A. H., Herrmann, H., Lampel, S., Weisenberg, D., Andra, K., Seper, M., Wiche, G., Krammer, P. H., and Peter, M. E. (2000) Mol. Cell. Biol. 20, 5665-5679[Abstract/Free Full Text]
23. Kim, K. M., Adachi, T., Nielsen, P. J., Terashima, M., Lamers, M. C., Kohler, G., and Reth, M. (1994) EMBO J. 13, 3793-3800[Medline] [Order article via Infotrieve]
24. Ng, F. W., Nguyen, M., Kwan, T., Branton, P. E., Nicholson, D. W., Cromlish, J. A., and Shore, G. C. (1997) J. Cell Biol. 139, 327-338[Abstract/Free Full Text]
25. Breckenridge, D. G., Nguyen, M., Kuppig, S., Reth, M., and Shore, G. C. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 4331-4336[Abstract/Free Full Text]
26. Goping, I. S., Gross, A., Lavoie, J. N., Nguyen, M., Jemmerson, R., Roth, K., Korsmeyer, S. J., and Shore, G. C. (1998) J. Cell Biol. 143, 207-215[Abstract/Free Full Text]
27. Goping, I. S., Millar, D. G., and Shore, G. C. (1995) FEBS Lett. 373, 45-50[CrossRef][Medline] [Order article via Infotrieve]
28. Muzio, M., Stockwell, B. R., Stennicke, H. R., Salvesen, G. S., and Dixit, V. M. (1998) J. Biol. Chem. 273, 2926-2930[Abstract/Free Full Text]
29. Diver, S. T., and Schreiber, S. L. (1997) J. Am. Chem. Soc. 119, 5106-5109
30. Stagljar, I., Korostensky, C., Johnsson, N., and Heesen, S. T. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5187-5192[Abstract/Free Full Text]
31. Wang, B., Lemay, S., Tsai, S., and Veillettete, A. (2001) Mol. Cell. Biol. 21, 1077-1088[Abstract/Free Full Text]
32. Janicke, R. U., Ng, P., Sprengart, M. L., and Porter, A. G. (1998) J. Biol. Chem. 273, 15540-15545[Abstract/Free Full Text]
33. Fujiki, Y., Fowler, S., Shio, H., Hubbard, A. L., and Lazarow, P. B. (1982) J. Cell Biol. 93, 103-110[Abstract/Free Full Text]
34. Desagher, S., Osen-Sand, A., Nichols, A., Eskes, R., Montessuit, S., Lauper, S., Maundrell, K., Antonsson, B., and Martinou, J.-C. (1999) J. Cell Biol. 144, 891-901[Abstract/Free Full Text]
35. Breitwieser, G. E., McLenithan, J. C., Cortese, J. F., Shields, J. M., Oliva, M. M., Majewski, J. L., Machamer, C. E., and Yang, V. W. (1997) Am. J. Physiol. 272, 957-965
36. Peter, M. E., and Krammer, P. H. (1998) Curr. Opin. Immunol. 10, 545-551[CrossRef][Medline] [Order article via Infotrieve]
37. McBride, H. M., Goping, I. S., and Shore, G. C. (1996) J. Cell Biol. 134, 307-313[Abstract/Free Full Text]
38. Cheng, E. H., Kirsch, D. G., Clem, R. J., Ravi, R., Kastan, M. B., Bedi, A., Ueno, K., and Hardwick, J. M. (1997) Science 278, 1966-1968[Abstract/Free Full Text]
39. Clem, R. J., Cheng, E. H., Karp, C. L., Kirsch, D. G., Ueno, K., Takahashi, A., Kastan, M. B., Griffin, D. E., Earnshaw, W. C., Veliuona, M. A., and Hardwick, J. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 554-559[Abstract/Free Full Text]
40. Breckenridge, D. G., and Shore, G. C. (2003) Genetics of Apoptosis , pp. 93-113, BIOS Scientific Publishers Ltd., Oxford
41. Csordas, G., Thomas, A. P., and Hajnoczky, G. (2001) Trends Cardiovasc. Med. 11, 269-275[CrossRef][Medline] [Order article via Infotrieve]
42. Esser, M. T., Haverstick, D. M., Fuller, C. L., Gullo, C. A., and Braciale, V. L. (1998) J. Exp. Med. 187, 1057-1067[Abstract/Free Full Text]
43. Pinton, P., Ferrari, D., Rapizzi, E., Di Virgilio, F., Pozzan, T., and Rizzuto, R. (2002) Biochimie (Paris) 84, 195-201
44. Scoltock, A. B., Bortner, C. D., St, J., Bird, G., Putney, J. W., Jr., and Cidlowski, J. A. (2000) J. Biol. Chem. 275, 30586-30596[Abstract/Free Full Text]
45. Hockenbery, D. M., Oltvai, Z. N., Yin, X. M., Milliman, C. L., and Korsmeyer, S. J. (1993) Cell 75, 241-251[CrossRef][Medline] [Order article via Infotrieve]
46. Eskes, R., Antonsson, B., Osen-Sand, A., Montessuit, S., Richter, C., Sadoul, R., Mazzei, G., Nichols, A., and Martinou, J.-C. (1998) J. Cell Biol. 143, 217-224[Abstract/Free Full Text]
47. Chien, M. M., Zahradka, K. E., Newell, M. K., and Freed, J. H. (1999) J. Biol. Chem. 274, 7059-7066[Abstract/Free Full Text]
48. Matsuyama, S., Llopis, J., Devereaux, Q. L., Tsien, R. Y., and Reed, J. C. (2000) Nature Cell Biol. 2, 318-325[CrossRef][Medline] [Order article via Infotrieve]
49. Nakamura, K., Bossy-Wetzel, E., Burns, K., Fadel, M. P., Lozyk, M., Goping, I. S., Opas, M., Bleackley, R. C., Green, D. R., and Michalak, M. (2000) J. Cell Biol. 150, 731-740[Abstract/Free Full Text]
50. Ng, F. W., and Shore, G. C. (1998) J. Biol. Chem. 273, 3140-3143[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Szczesna-Skorupa and B. Kemper
BAP31 Is Involved in the Retention of Cytochrome P450 2C2 in the Endoplasmic Reticulum
J. Biol. Chem., February 17, 2006; 281(7): 4142 - 4148.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Stojanovic, M. Germain, M. Nguyen, and G. C. Shore
BAP31 and Its Caspase Cleavage Product Regulate Cell Surface Expression of Tetraspanins and Integrin-mediated Cell Survival
J. Biol. Chem., August 26, 2005; 280(34): 30018 - 30024.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. P. Mathai, M. Germain, and G. C. Shore
BH3-only BIK Regulates BAX,BAK-dependent Release of Ca2+ from Endoplasmic Reticulum Stores and Mitochondrial Apoptosis during Stress-induced Cell Death
J. Biol. Chem., June 24, 2005; 280(25): 23829 - 23836.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. S. Maag, M. Mancini, A. Rosen, and C. E. Machamer
Caspase-resistant Golgin-160 Disrupts Apoptosis Induced by Secretory Pathway Stress and Ligation of Death Receptors
Mol. Biol. Cell, June 1, 2005; 16(6): 3019 - 3027.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
K. Iyer, L. Burkle, D. Auerbach, S. Thaminy, M. Dinkel, K. Engels, and I. Stagljar
Utilizing the Split-Ubiquitin Membrane Yeast Two-Hybrid System to Identify Protein-Protein Interactions of Integral Membrane Proteins
Sci. Signal., March 15, 2005; 2005(275): pl3 - pl3.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Obrdlik, M. El-Bakkoury, T. Hamacher, C. Cappellaro, C. Vilarino, C. Fleischer, H. Ellerbrok, R. Kamuzinzi, V. Ledent, D. Blaudez, et al.
K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions
PNAS, August 17, 2004; 101(33): 12242 - 12247.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. B. Gustafsson, J. G. Tsai, S. E. Logue, M. T. Crow, and R. A. Gottlieb
Apoptosis Repressor with Caspase Recruitment Domain Protects against Cell Death by Interfering with Bax Activation
J. Biol. Chem., May 14, 2004; 279(20): 21233 - 21238.
[Abstract] [Full Text] [PDF]