![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 16, 14461-14468, April 18, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, September 20, 2002, and in revised form, December 2, 2002
BAP31 is a polytopic integral
protein of the endoplasmic reticulum membrane and, like BID, is
a preferred substrate of caspase-8. Upon Fas/CD95 stimulation, BAP31 is
cleaved within its cytosolic domain, generating proapoptotic p20 BAP31.
In human KB epithelial cells expressing the caspase-resistant mutant
crBAP31, Fas stimulation resulted in cleavage of BID and
insertion of BAX into mitochondrial membrane, but subsequent
oligomerization of BAX and BAK, egress of cytochrome c to
the cytosol, and apoptosis were impaired. Bap31-null mouse
cells expressing crBAP31 cannot generate the endogenous p20 BAP31
cleavage product, yet crBAP31 conferred resistance to cellular
condensation and cytochrome c release in response to activation of ectopic FKBPcasp8 by FK1012z. Full-length BAP31, therefore, is a direct inhibitor of these caspase-8-initiated events,
acting independently of its ability to sequester p20, with which it
interacts. Employing a novel split ubiquitin yeast two-hybrid screen
for BAP31-interacting membrane proteins, the putative ion channel
protein of the endoplasmic reticulum, A4, was detected and identified
as a constitutive binding partner of BAP31 in human cells. Ectopic A4
that was introduced into A4-deficient cells cooperated with crBAP31 to
resist Fas-induced egress of cytochrome c from mitochondria
and cytoplasmic apoptosis.
An emerging model for the regulation of apoptosis posits that
BCL-2 family members regulate and integrate upstream death signals that
ultimately cause a breach in the mitochondrial outer membrane, releasing factors that contribute to the demise of the cell (1-3). Although multiple extrinsic and intrinsic pathways likely converge on
mitochondria to achieve this end, the coupling of mitochondrial responses to upstream stimuli has been most intensively investigated for apoptosis initiated by cell surface death receptors. Activation of
the Fas/CD95 signaling complex, for example, causes recruitment and
processing of the two major isoforms of procaspase-8, -8/a and -8/b
(for review, see Ref. 4). The resulting caspase-8 holoenzyme can then
initiate a downstream cascade of events, including direct processing of
effector procaspases such as procaspase-3, at least in certain contexts
(5-7). An additional target of caspase-8, however, is the proapoptotic
BH3-only member of the BCL-2 family, BID (8-10). Caspase-8
cleavage of BID generates tBID, which inserts into the mitochondrial
outer membrane where its exposed BH3 death ligand drives the release of
cytochrome c from the organelle (11). In addition to
recruiting BAX into the outer membrane bilayer (12, 13), mitochondrial
tBID induces intramembrane oligomerization of BAX (12, 14, 15) and BAK
(11, 16), causing these proapoptotic BCL-2 members to form a proposed
conduit for cytochrome c egress from the organelle (3, 17).
Once released, cytochrome c becomes an integral constituent
of the apoptosome, resulting in further amplification of a caspase
cascade (18, 19). Consistent with an essential but redundant role for
BAX and BAK in these tBID-dependent events, Bax
and Bak double knockout mouse cells, but not single
knockouts, remain refractory to ectopic tBID (16). In view of the fact
that several other caspase-8 preferred substrates have been identified
(20-22), however, an obvious question concerns the contribution they
might make to Fas signaling pathways.
Human BAP31 is a 28-kDa polytopic integral protein of the endoplasmic
reticulum (ER)1 and part of a
large BAP hetero-oligomeric complex that includes the related BAP29
protein and connections to actomyosin (21, 23-25). In addition to its
role in the recruitment and regulation of the novel procaspase-8
isoform, procaspase-8L, in response to apoptotic signaling by oncogenic
E1A (25), BAP31 itself is a preferred substrate for caspase-8 (23).
Cleavage occurs at two identical sites (AAVD.G) in the human protein
that flank the DECC (death effector-like coiled coil) domain within the
cytosolic disposed C-terminal tail of BAP31 (21). As a first step to
investigate the contribution of BAP31 cleavage during apoptosis, we
recently established a KB epithelial cell line that expresses
caspase-resistant (cr) BAP31, in which the caspase-recognition Asp
residues have been mutated to Ala. Caspase-8 activation that is
independent of BAP31 in these cells is then achieved by
stimulating the Fas death-inducing signaling complex (21).
In this system, crBAP31 provided a remarkably pleiotropic resistance to
Fas-mediated cytoplasmic apoptosis even though it had little influence
on processing procaspases-8/a and -8/b and activation of downstream
effector caspases. In contrast, apoptotic membrane
blebbing/fragmentation and redistribution of actin were strongly
inhibited, the cells retained a near normal morphology, and
irreversible loss of cell growth potential after removal of the Fas
stimulus was delayed (21). Preservation of full-length BAP31 in the
face of Fas stimulation also restrained the release of cytochrome
c from the mitochondria (21). These results suggest,
therefore, that cleavage of BAP31 during Fas-mediated cell death might
regulate a proximal step that impacts several components of cytoplasmic apoptosis.
Here, we have addressed two questions regarding the regulation of the
Fas pathway by full-length BAP31. Is BAP31 itself a direct inhibitor of
the Fas pathway rather than simply acting as a precursor for generating
the proapoptotic caspase-8 cleavage product, p20BAP31? And, if so, does
this activity of BAP31 depend on the association of BAP31 with other
proteins located in the ER membrane?
General
The routine procedures used in this study for measuring
apoptotic cell death by microscopic examination of uptake of trypan blue, generation of cellular fractions, SDS-PAGE, immunoblotting and
development of blots by enhanced chemoluminescence, and assays to
measure release of cytochrome c from mitochondria have been documented in earlier publications (13, 21, 24, 26).
Antibodies
The following antibodies were used in this study: chicken
anti-human BAP31 (24) and anti-human TOM20 (27); rabbit polyclonal antibody raised against a recombinant A4 C terminus (amino acids 132-152); rabbit anti-human BAK (Upstate Biotechnology); mouse anti-FLAG (Sigma); rabbit polyclonal antibodies against the p18 catalytic subunit of caspase-8 (gift from D. Nicholson) and Cells and Transfections
Human KB epithelial cell lines expressing wt BAP31-FLAG or
crBAP31-FLAG were created and cultured as described previously (21).
Differentiated Bap31-null mouse embryonic stem cells
were created as described (25). Stable expression of crBAP31-FLAG in
differentiated Bap31-null cells was established by
transfection (21) using LipofectAMINE 2000 (Invitrogen) following the
manufacturer's protocol, and cells were cultured in Knockout
Dulbecco's modified Eagle's medium (Invitrogen) in the
presence of 150 µg/ml G418. Clones were isolated which expressed
crBAP31-FLAG at levels similar to the level of Bap31
expressed in wt cells. HepG2 cells were maintained in minimum essential
medium supplemented with 10% fetal calf serum and 1%
penicillin/streptomycin, at 37 °C in humidified 5% CO2.
Stable cell lines expressing pcDNA3.1/hygromycin vector, pcDNA3.1/hygromycin- A4-HA, or pcDNA3.1/neomycin-crBAP31-FLAG were created, and A4/crBAP31 double expression cell lines were created
by transfecting A4-HA into crBAP31-FLAG stable cell lines under a dual
selection strategy.
Activation of FKBPcasp8 by the Dimerizing Compound
FK1012z
The expression vectors MFpk3HAFLICE (28) and pcDNA3-GFP were
transiently cotransfected into differentiated Bap31-null or wt mouse embryonic stem cells. After 24 h, solvent (mixture of 50% ethanol and 50% dimethyl sulfoxide) containing or lacking FK1012z
(final concentration, 1.0 nM), a derivative of FK1012 prepared by olefin metathesis using a modification of the procedure described by Diver and Schreiber (29), was added. At the indicated times, cells were collected, and 25 µg of total lysates was subjected to SDS-PAGE and immunoblotting using anti-HA antibody.
Immunofluorescence
For stable cell lines, cells were grown on coverslips for
24 h. They were treated with 0.5 µg/ml For analysis of the Bap31-null cells or their derivatives,
the cells were grown on glass coverslips for 24 h. They were
transfected, using LipofectAMINE 2000, with 0.2 µg of pCMS-EGFP
(Clontech) and 0.8 µg of MFpk3HAFLICE
(28)/coverslip. 24 h later, they were treated with or without
FK1012z, and the cells were subsequently fixed at the indicated times
with 4% paraformaldehyde. Similarly, COS-1 cells were transfected with
0.5 µg of A4-HA and 0.5 µg of BAP31-FLAG coverslip for 24 h
before fixing and immunostaining. Nuclei were stained with DAPI and
fluorescence analyzed by confocal microscopy or by Nikon TE-FM Epi-fl microscopy.
Split Ubiquitin Yeast Two-hybrid Screen
pRSB(BAP31-Cub-Protein A-LexA-VP16)--
The entire coding
sequence of human BAP31 with NsiI-BsiwI
linker at the 5'-end was generated by PCR using primers
TCCGCTCGAGATGCATCTCTCTCTCTCGTACGATGAGTCTGCAGTGGACT and
TCCGCTCGAGCTCTTCCTTCTTGTCCAT. cDNA Libraries--
CUP1-NubG with linkers
SalI-EcoRI at the 5'-end and
XhoI-BglII at the 3'-end of NubG was generated by
PCR from pRS314(NubG-ALG5) (30) using oligonucleotides
TCGGCGGTGGCGGCCGCTCTAGAAC and
AACTGCAGCTCGAGGAGAGAGAGATCTCCACCAGGGATCCCTTC. The resulting PCR
products were ligated to pRS314 (NubG-ALG5 deleted) and sequenced
thoroughly. Standard protocols were employed to generate double
stranded cDNA from HeLa mRNA. Linkers containing restriction
sites BglII-XhoI or
SalI-EcoRI were added, and the resulting
cDNAs were fractionated on a 10-30% sucrose gradient. Fractions
containing cDNAs in the range of 2-13 kb were collected, ligated
to pRSN(CUP1-NubG), and transformed into HB101 to create pRSC(CUP1-cDNA-NubG) libraries, using the
SalI-EcoRI link, or pRS314(CUP1-NubG-cDNA)
libraries, using the BglII-XhoI link. Four different size-selected libraries (averaging 5 × 106
transformants/library) were generated for each orientation. Plasmid DNA
were purified and used to transform pRSB-L40.
Identification of Clones--
All yeast transformations were
done as described (31). Routinely, 20 µg of DNA of each library was
transformed into pRSB-L40 and clones were selected on
leucine/tryptophane/histidine plates in the presence of 0.2 mM CuSO4 and 5 mM 3-aminotriazole.
50 independent clones were picked from each of the eight libraries, and
their DNAs were isolated. After transformation into Escherichia
coli DH5 crBAP31--
The schematic in Fig.
1A depicts the topology of
human BAP31 in the membrane of the ER and denotes the two identical
caspase recognition sites (AAVD.G) flanking the cytosolic disposed DECC domain in the protein (21, 24). Cleavage at these sites generates the
products p27 and p20 (21; Fig. 1B). In contrast to the human protein, murine BAP31 lacks the distal caspase cleavage site and generates only the p20 product during apoptosis
(24).2 Human crBAP31-FLAG was
created by mutating the two caspase recognition aspartate residues to
alanine and inserting the FLAG epitope immediately upstream from the
canonical KKEE ER retrieval signal located at the extreme C terminus of
the protein. Human KB epithelial cell lines were established which
stably express crBAP31-FLAG at levels 2-3-fold higher than that of the
endogenous BAP31 protein (21). Upon stimulation of these crBAP31-FLAG
cells with 0.5 µg/ml agonistic antibody against Fas/CD95, in the
presence of 10 µg/ml cycloheximide (CHX) to enhance sensitivity to
Fas activation (6), caspases, including caspase-8 and caspase-3, are
activated. As a result, caspase targets such as endogenous BAP31 and
poly(ADP-ribosyl) polymerase are cleaved (21).
As documented in Fig. 1B, the time course for this
Fas-induced cleavage of endogenous BAP31 was very similar for wt
parental KB cells and KB cells expressing crBAP31-FLAG, indicating that the activity of the upstream caspase is similar in the two cell types.
Moreover, the two cell types express equivalent levels of Fas receptor
(as determined by immunoblot; not shown) and, after stimulation,
process procaspase-8/a and -8/b to a similar extent (21). In contrast
to endogenous BAP31, however, crBAP31-FLAG was not cleaved (Fig.
1B), and cells expressing crBAP31-FLAG resisted apoptotic
membrane blebbing (21) and loss of cell viability as assessed by the
uptake of trypan blue (Fig. 1C), even though caspases are
active in these cells. Caspase cleavage of the endogenous BAP31 in
crBAP31-FLAG-expressing cells generated the proapoptotic fragment, p20
BAP31 (Fig. 1B); however, this truncated p20 BAP31 product
was associated with excess crBAP31-FLAG (Fig. 1E) and remained nontoxic (21).2
In vitro, BAP31 exhibits a marked preference for cleavage by
caspase-8 rather than by caspase-3 (24). To extend this to a cellular
context, MCF-7 mammary epithelial cells lacking caspase-3 were
stimulated with TNF- Full-length BAP31 Is an Inhibitor of Caspase-8-induced Release of
Cytochrome c from Mitochondria in Intact Cells--
To test the
ability of full-length BAP31 to inhibit directly the apoptotic pathway
initiated by caspase-8, as opposed to simply binding and sequestering
the p20 cleavage product (Fig. 1E), crBAP31-FLAG was
reconstituted in mouse cells from which the Bap31 gene had been deleted (Ref. 25), and the cytochrome c release pathway was initiated by chemical activation of caspase-8. Because these Bap31-null cells do not express endogenous (i.e. cleavable)
BAP31, their resistance to caspase-8 cannot be explained by the ability of crBAP31 to sequester the proapoptotic p20 cleavage product of
endogenous Bap31 (Fig. 1, A and E). The response
of Bap31-null/crBAP31-FLAG cells was compared with that of
Bap31-null cells as control; again, the latter cannot
generate the proapoptotic cleavage product of endogenous
Bap31, which could contribute to the outcome.
MFpk3HAFLICE, a vector expressing a fusion protein in which
triplicate copies of FKBP and an HA tag replace the prodomain of
procaspase-8 (28), was transiently transfected into
Bap31-null and Bap31-null/crBAP31-FLAG cells,
together with vector expressing GFP. 24 h later, cells were
treated with the FKBP-dimerizing chemical, FK1012z, which initiates
aggregation and autoactivation of the caspase-8 fusion protein (28), or
the cells were treated with vehicle alone. Commensurate with processing
of FKBPcasp8 (Fig.
2C),
cotransfected GFP-expressing Bap31-null cells lacking
crBAP31-FLAG condensed rapidly, whereas those expressing crBAP31-FLAG
resisted this apoptotic response (Fig. 2, A and
B). Moreover, cytochrome c remained punctate in
cells expressing crBAP31 and treated with FK1012z, whereas it was found
diffuse throughout the apoptotic cells lacking crBAP31 (Fig. 2,
D and E). In both cell types, however, similar
levels and processing of ectopic MFpk3HAFLICE in response to
FK1012z were observed (Fig. 2C). Collectively, the results
show that full-length (uncleaved) BAP31 is an inhibitor of
caspase-8-driven cellular condensation and release of cytochrome
c from mitochondria. Moreover the results indicate that the
p20 cleavage product of BAP31 is not essential for these
caspase-8-initiated events but rather may provide an amplifying effect.
As expected, Bap31-null cells expressing wt BAP31, which was
cleaved and generated p20 after activation of caspase-8, were fully
sensitive to the caspase-8-initiated events (not shown).
crBAP31 Inhibits Fas-induced Cytochrome c Egress from Mitochondria
Upstream from Activation of BAX and BAK at the Mitochondrial Outer
Membrane--
Because a specific pathway has now been elucidated for
Fas-induced cytochrome c egress from mitochondria, dependent
on BID (3), the individual steps on this pathway were analyzed in crBAP31-expressing KB cells (Fig.
3A). Full-length
BID was found in loose association with mitochondria isolated from
these cells, where it remained extractable at pH 11.5 (not shown),
indicative of a peripheral rather than integral association with
membrane (33). Upon stimulation of the Fas pathway, BID was processed, and crBAP31 had little influence on this step (Fig. 3B,
top panel). Similarly, crBAP31 exerted little influence on
BAX insertion into the mitochondrial outer membrane. In the absence of
Fas ligation, negligible BAX was integrated into mitochondrial membrane
as judged by its failure to acquire resistance to alkaline extraction
(time 0, Fig. 3B, middle panel). In contrast, Fas
stimulation rapidly induced BAX membrane integration in both wt and
crBAP31-expressing cells. The inhibition of cytochrome c
release which is imposed by crBAP31 on the Fas death pathway (21; Fig.
3A), therefore, occurs downstream from stimulation-induced
insertion of BAX into mitochondrial membrane.
To examine the subsequent steps in the Fas pathway (3), we exploited
the observation that BAX undergoes a conformational change in response
to cell death stimuli in intact cells, manifesting in the acquisition
of reactivity with an antibody directed to the N terminus of the
protein (34). This acquisition of immunoreactivity in intact cells
correlates with the appearance of large oligomeric structures
containing BAX and the release of cytochrome c from mitochondria (12, 15). At a time when significant BAX membrane insertion had occurred (6 h after stimulation of Fas; Fig.
3B), a strong Fas-induced fluorescent immunoreactivity was
observed for BAX in wt but not in crBAP31-expressing KB cells (Fig.
3C). Quantification revealed that greater than 85% of wt
cells acquired BAX immunofluorescence after Fas stimulation, and this
was reduced to less than 15% for crBAP31 cells. The results of Fig. 3,
B and C, therefore, indicate that the predicted
BAX oligomerization based on immunofluorescence occurs subsequent to
BAX membrane insertion and that it is only the oligomerization step
that is inhibited by crBAP31. Similarly, a direct analysis of the
oligomeric status of BAK, which is constitutively integrated in the
mitochondrial outer membrane, in response to Fas stimulation revealed a
failure of BAK to enter into higher order structures. Mitochondria
isolated from Fas-stimulated wt KB cells and treated with the
homobifunctional chemical cross-linker bis-maleimidohexane
(11) exhibited a time-dependent shift of BAK into
oligomeric structures (Fig. 3D), with a concomitant decrease
in that fraction of monomeric BAK which can sustain intramolecular cross-linking (11) (designated BAK** in Fig. 3D).
In contrast, the induction of BAK oligomers was strongly curtailed in
Fas-stimulated cells expressing crBAP31 (Fig. 3D).
BAP31 Interacts with the Resident ER Membrane Protein, A4--
The
split ubiquitin yeast two-hybrid assay for detecting interactions
between integral membrane proteins (30, and references therein) was
adapted to include BAP31 as bait and HeLa cell cDNA expression
libraries as a source of potential BAP31-binding partners (see Fig.
4A and "Experimental
Procedures"). One directional library, harboring cDNAs tagged at
the 3'-end of coding sequences with a sequence encoding the NubG
fragment, yielded multiple hits for a cDNA encoding full-length A4,
a small (17 kDa) four-membrane-spanning integral protein of the ER
membrane which multimerizes and exhibits characteristics of an ion
channel (35; Fig. 4B). Because BAP31 is also an ER resident
protein (24), fluorescence microscopy of COS-1 cells cotransfected with
cDNAs encoding A4-HA and BAP31-FLAG revealed an extensive
colocalization of the two proteins (yellow fluorescence in
Fig. 4C). Moreover, a rabbit polyclonal antibody raised
against the cytosolic-exposed C terminus of A4 successfully precipitated the endogenous A4 protein expressed in KB epithelial cells, and an analysis of this immunoprecipitate with anti-BAP31 revealed the presence of endogenous BAP31 as well (Fig.
5A). We conclude, therefore,
that BAP31 constitutively associates with A4 in the ER membrane. Of
note, transient cotransfection analyses revealed that the
caspase-generated p20 BAP31 fragment (Fig. 1A) also can
associate with A4 (Fig. 5B), suggesting that A4 remains part
of the caspase-cleaved BAP31 complex during Fas-induced apoptosis. This was confirmed by identifying the presence of the p20 cleavage product after precipitation of endogenous A4 in Fas-stimulated cells
(data not shown).
A screen of various human cell lines identified hepatocarcinoma-derived
HepG2 cells as lacking expression of A4 (Fig.
6A). HepG2 cells are
responsive to Fas ligation, which results in cleavage of endogenous
BAP31 and death by apoptosis (not shown). Remarkably, however, HepG2
cells stably expressing crBAP31 at levels 2-3-fold higher than
endogenous BAP31 were not resistant to Fas-induced release of
cytochrome c from mitochondria or to cytoplasmic membrane blebbing (Fig. 6, C and D). To address the
question of functional interaction between BAP31 and A4 and the
requirement for this interaction to inhibit the Fas pathway, therefore,
we created HepG2 cell lines that stably express crBAP31 and A4 either
alone or in combination (Fig. 6B). Clones were
selected which expressed A4 at levels commensurate with the expression
levels seen in other cell lines (Fig. 6A). After Fas
stimulation, the cells were assessed for release of cytochrome
c from mitochondria. The results indicate a cooperative
interaction between A4 and crBAP31, where both proteins together
resisted Fas-mediated cytochrome c release more effectively than either protein alone (Fig. 6, C and D).
Moreover, the results that are presented in Fig. 6, B-D,
were also obtained for a second set of cell clones selected for similar
expression levels of crBAP31-FLAG and A4-HA. Inhibition of Fas-mediated
cytoplasmic apoptosis by full-length BAP31, therefore, depends upon the
presence of A4 protein.
Initiation of apoptosis after stimulation of the Fas/CD95 family
of death receptors involves the recruitment and autoactivation of
procaspase-8/a,b at the receptor death-inducing signaling complex, resulting in formation of the caspase-8 holoenzyme (4, 33, 36).
Cleavage of a limited number of substrates by this initiator caspase is
then sufficient to commit the cell to die unless downstream pathways
are blocked by antiapoptotic regulators. One set of substrates is the
effector procaspases including procaspase-3, at least in certain
cellular contexts (5-7). Other preferred substrates of caspase-8 which
have been identified, however, include RIP (20), BID (8-10), plectin
(22), and BAP31 (24). Cleavage of these and other potential substrates
downstream from receptor activation may induce critical proapoptotic
changes at specific cellular sites that collectively support the early
events of apoptosis progression in intact cells.
Although the p20 BAP31 caspase cleavage product itself is an inducer of
apoptosis (24),2 we have exploited Bap31-null
mouse cells (Ref. 25) to establish that full-length BAP31 is in fact a
direct inhibitor of apoptosis initiated by caspase-8 in the absence of
p20 BAP31. BAP31 cleavage, therefore, likely removes this barrier to
caspase-8-induced downstream events, permitting apoptosis progression
initiated by this caspase in the Fas death program. BAP31, therefore,
may be like other inhibitors of apoptosis such as RIP (20),
BCL-2 (38), and BCL-XL (39) whose cleavage by caspase
converts the inhibitor into an activator that contributes to but is not
essential for apoptosis progression. In MCF-7 cells, in which only
caspase-8 and not caspases-1, -2, -3, -5, -6, -7, -9, or -10 become
strongly activated in response to TNF- We showed that BAP31 associates with another resident protein of the
ER, A4, a multimeric four-membrane-spanning proteolipid protein with
reported ion channel activity (35), and that BAP31 cooperates with A4
to resist cytochrome c release from mitochondria and
cytoplasmic apoptosis in the Fas pathway. Each of the transmembrane segments of A4 is predicted to contain a charged amino acid (Fig. 4B and Ref. 35), as do transmembrane segments 1 and 3 of
BAP31 (24). A4 also exhibits overall structural similarities with the
16-kDa subunit c of proton-conducting vacuolar ATPase (35). Apoptosis
progression typically involves changes in cytoplasmic calcium and
magnesium, pH, and the redox status of the cell (40-49). One
possibility, therefore, is that the BAP31-A4 complex can resist one or
more of the pathways controlling these changes and that this inhibition
is lost upon cleavage of BAP31. This in turn may result in
sensitization of mitochondria to other caspase-8-induced events,
leading to efficient apoptosis in the Fas pathway in intact cells.
We are very grateful to Vishva Dixit, Marta
Muzio, and Claudius Vincenz for the gift of MFpk3HAFLICE; to
Stephan Heesan, Igor Stagljar, Annette Herscovics, and Michel Masaad
for the gift of split ubiquitin vectors and for advice; and to Marc
Germain for discussions.
*
This work was supported in part by the National Cancer
Institute of Canada, the Canadian Institutes of Health Research, the Deutsche Forchungsgemeinschaft through Grant SFB 388, and the Leibniz
program.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
These authors contributed equally to this work.
¶
Recipient of a Canadian Institutes of Health doctoral research award.
Published, JBC Papers in Press, January 15, 2003, DOI 10.1074/jbc.M209684200
2
B. Wang, M. Nguyen, D. G. Breckenridge,
M. Stojanovic, P. A. Clemons, S. Kuppig, and G. C. Shore, unpublished data.
The abbreviations used are:
ER, endoplasmic
reticulum;
CHX, cycloheximide;
crBAP31, caspase-resistant BAP31;
DAPI, 4,6-diamidino-2-phenylindole;
DECC, death effector-like coiled coil;
EGFP, enhanced green fluorescent protein;
GFP, green fluorescent
protein;
HA, hemagglutinin;
TNF, tumor necrosis factor;
wt, wild
type.
Uncleaved BAP31 in Association with A4 Protein at the Endoplasmic
Reticulum Is an Inhibitor of Fas-initiated Release of Cytochrome
c from Mitochondria*
§,
§,
¶,
,
,

Department of Biochemistry, McGill
University, Montreal, Quebec H3G 1Y, Canada, the
Institute of
Chemistry and Cell Biology, Harvard Medical School, Boston,
Massachusetts 02115, and the ** Department of Molecular
Immunology, Biology III, University of Freiberg and the Max Planck
Institute of Immunobiology, Freiburg 71908, Germany
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-actin (gift from P. Braun); rabbit polyclonal antibody raised against the p15
caspase cleavage product of recombinant BID and purified by affinity
selection; mouse monoclonal antibody against pigeon cytochrome
c (Pharmingen); rabbit antibody against human BAX amino acids 1-21 (Upstate Biotechnology) or amino acids 1-20 (Santa Cruz).
-human Fas-activating
antibody (Upstate Biotechnology) in the presence of 10 µg/ml
cycloheximide for the indicated times. Cells were fixed in 4%
paraformaldehyde and immunostained as described elsewhere (21). Cells
were visualized by confocal microscopy or by Nikon TE-FM Epi-fl microscopy.
wbp1 was excised from pRSB (
wbp1-Cub-PLV) (30) and replaced with BAP31 to generate
pRS305(BAP31-Cub-PLV). The yeast CUP1 promoter was created by PCR using
primers CCAATGCATTGGATCCCATTACCGACATTTG and
CCACGTACGGCTTGATATCGAATTCGT and inserted into
NsiI-BsiwI upstream of BAP31. The
resulting plasmid, termed pRSB, was integrated into the CUP1
gene of Saccharomyces cerevisiae strain L40 (MATa trp1 leu2 his3 LYS2::lexA-HIS3 URA3::lexA-lacZ),
and clones (termed pRSB-L40) were selected on leucine plates. The
expression of the BAP31-Cub-PLV fusion protein was verified by
immunoblotting using antibodies against BAP31 or horseradish
peroxidase-conjugated rabbit IgG.
, the sequences of individual clones were determined
and compared with sequences deposited in NCBI data base using BLAST.
Potential candidates were tested further for specificity by
retransformation into pRSB-L40.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (34K):
[in a new window]
Fig. 1.
Cleavage of BAP31 after stimulation of
death receptors. A, topology of BAP31 in the ER
membrane (24). The presence of charged residues in the predicted
transmembrane segments are indicated by + and
. To create crBAP31,
the caspase-recognition Asp residues were converted to Ala
(asterisks); the FLAG epitope sequence was inserted
immediately upstream from the KKEE ER retrieval signal located at the C
terminus (21). DECC, weak death effector and
overlapping coiled coil domain. The
hetero-oligomer of ectopic p28 crBAP31-FLAG and endogenous p20 BAP31 is
shown on the right. B, crBAP31 resists
Fas-induced caspase cleavage. Wild type (Wt) parental
(control) KB cells (upper panel) or KB cells expressing
crBAP31-FLAG (lower panel) were stimulated with 0.5 µg/ml
anti-Fas (
Fas) antibody in the presence of 10 µg/ml
CHX for the indicated times, and whole cell lysates were subjected to
SDS-PAGE, immunoblotted with chicken anti-BAP31 (
BAP31)
antibody, and visualized by enhanced chemiluminescence. C,
parental KB cells (Wt) or KB cells expressing crBAP31-FLAG
were stimulated for 7 h with the indicated concentrations of Fas
in the presence of 10 µg/ml CHX and analyzed for the apoptotic index
(percent trypan blue-positive apoptotic cells ± S.D. for three
independent determinations). D, MCF-7 cells were treated
with TNF-
/CHX exactly as described by Stegh et al. (22),
and at the indicated times aliquots of whole cell lysates containing
equivalent amounts of protein were subjected to SDS-PAGE and
immunoblotted with antibodies (
) against p18 caspase-8
(top two panels, showing unprocessed procaspase-8/a and -8/b
and the processing intermediates p24 and p26), anti-BAP31, which
detects full-length BAP31 as well as the p27 and p20 cleavage products
(middle two panels), and anti-BID, which also weakly detects
p15 tBID (bottom two panels). E, KB cells
expressing crBAP31-FLAG were stimulated with or without 0.5 µg/ml
anti-Fas antibody in the presence of 10 µg/ml CHX for 7 h, and
total cell lysates were subjected to immunoprecipitation
(i.p.) with anti-FLAG antibody. The resulting precipitates
were resolved by SDS-PAGE and immunoblotted with chicken
anti-BAP31.
, which leads to high levels of caspase-8 activity but low or insignificant activation of caspases-1, -2, -3, -5, -6, -7, -9, or -10 (22, 32). As shown in Fig. 1D, TNF-
stimulation of MCF-7 cells caused procaspase-8/a and -8/b to be
processed, which correlated with the detectable cleavage of both BAP31
and BID. Thus, caspase-8 generates BAP31 and BID cleavage products as
early events after TNF-
receptor activation in intact MCF-7 cells.

View larger version (34K):
[in a new window]
Fig. 2.
crBAP31 inhibits caspase-8-induced
cellular condensation and cytochrome c release from
mitochondria. A, Bap31-null mouse cells or
Bap31-null/crBAP31 cells were transfected with MFpk3FLICE
and pCMS-EGFP for 24 h after which time FK1012z (or vehicle alone,
not shown) was added. At the indicated time points, cells were fixed
and stained with DAPI. Visualization of the fluorescence for DAPI
(blue) or GFP (green) was carried out using
confocal microscopy. B, after treatment with FK1012z or
vehicle alone, green fluorescent cells that had a condensed morphology
were scored and expressed as a percent of total GFP-positive cells
(±S.D. from three independent determinations). C, immunoblotting of total cellular
lysate with anti-HA antibody to detect the HA-tagged MFpk3FLICE at the
indicated time points after the addition of FK1012z. Equivalent gel
loading was determined by probing the blot with anti-
-actin
antibody. D, similar to A except that cells were
stained with Alexa-594-conjugated anti-cytochrome c
(Cyt c), and the green (GFP) and red
(cytochrome c) fluorescence was visualized by Nikon TE-FM
Epi-fl microscopy. E, GFP-expressing cells that showed
diffuse cytochrome c staining (released, see
arrows in D) after treatment of cells with
FK1012z or vehicle alone were scored and expressed as a percent of
total green cells (±S.D. from three independent determinations).

View larger version (27K):
[in a new window]
Fig. 3.
KB cells expressing crBAP31 resist
Fas-induced apoptotic membrane fragmentation and release of
cytochrome c from mitochondria. A, wt
(parental) KB epithelial cells and KB cells stably expressing crBAP31-FLAG were stimulated with 0.5 µg/ml
anti (
)-Fas/CHX (see Fig. 1) for the indicated times, and
cytochrome c was examined by immunofluorescence microscopy,
as described under "Experimental Procedures." The images shown are
typical of multiple independent fields that were examined.
B, as in A except that the heavy membrane
fraction enriched in mitochondria was isolated (26). Aliquots
containing equivalent amounts of protein were analyzed by SDS-PAGE and
immunoblotting either directly (
Alkali) with antibody
against BID or after the mitochondrial fraction had been extracted with
0.1 M NaCO3, pH 11.5 (+Alkali) (26),
in which case the blots were probed either with antibody against BAX or
with antibody against the human mitochondrial outer membrane protein
import receptor, TOM20 (27, 37). C, parental KB
(Wt) cells or KB cells stably expressing crBAP31-FLAG were
stimulated with anti-Fas as described in A for 0 or 6 h, and the cells were analyzed by immunofluorescence microscopy
employing the conformation-sensitive antibody against BAX,
BAX-NT
(amino acids l-21) (Upstate Biotechnology). D, as in
B except that the heavy membrane fraction enriched in
mitochondria was isolated after the indicated treatments and incubated
with the chemical cross-linking agent bis-maleimidohexane
(BMH) or with vehicle (dimethyl sulfoxide (DMSO))
alone. The fractions were then subjected to SDS-PAGE and immunoblotted
with antibody against BAK. Solid squares indicate
cross-linked BAK products, and asterisks indicate BAK that
harbors an intramolecular cross-link (11). The positions of protein
size markers are also indicated (left).

View larger version (50K):
[in a new window]
Fig. 4.
Identification of the BAP31-associated
protein, A4. A, polypeptides that interact with bait
protein in the split ubiquitin yeast two-hybrid screen bring together
the C-terminal fragment of ubiquitin (Cub) and a modified
N-terminal fragment (NubG), allowing ubiquitin-activated
protease (UBP) to liberate the associated fusion protein,
Protein A-LexA promoter-binding
protein-VP16 activation domain (PLV), which
enters the nucleus and activates the expression of selectable marker
genes under the control of LexA promoter sites. B, topology
of A4 in the membrane of the ER (35). C, COS-1 cells were
transiently transfected with vectors expressing A4-HA and BAP31-FLAG,
and the fixed cells visualized by fluorescence microscopy after
staining with antibodies against A4 (green) and FLAG
(red). A representative cell in which the merged
red and green fluorescence overlap is detected in
yellow.

View larger version (34K):
[in a new window]
Fig. 5.
Endogenous BAP31 and A4 interact.
A, total cell lysates from KB epithelial cells (30) were
subjected to immunoprecipitation (i.p.) with rabbit
preimmune (lane 2) or anti-A4 (lane 3), and the
precipitates were probed by blotting with anti-A4 (upper
panel) or with anti-BAP31 (lower panel). Lane
1, a portion of the input cell lysate. B, 293T cells
were transiently cotransfected with vectors expressing the indicated
proteins, immunoprecipitations were conducted with anti-HA or anti-FLAG
as described (50), and the precipitates were blotted and probed
with the indicated antibody.

View larger version (46K):
[in a new window]
Fig. 6.
crBAP31 cooperates with A4 to inhibit
Fas-mediated apoptosis. A, cell lysates derived from
the indicated cell lines were subjected to immunoblot with antibody
against A4, BAP31, or
-actin. B, HepG2 cells stably
expressing crBAP31-FLAG, A4-HA, or crBAP31-FLAG and A4-HA were
analyzed by immunoblot using antibodies against A4 and FLAG.
C, the cells described in B were stimulated with
0.5 µg/ml anti- (
)-Fas/CHX (see Fig. 1) for the indicated
times and cytochrome c examined by immunofluorescence
microscopy, as described under "Experimental Procedures."
Representative images for crBAP31 versus
crBAP31/A4 cells are presented with arrows denoting
apoptotic cells with diffuse cytochrome c staining.
Quantification of the results for vector alone (control) or
crBAP31-FLAG and A4-HA either alone or in combination with S.D. is
shown in D.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
stimulation (22, 32), we
showed that cleavage of both BID and BAP31 correlated with processing of procaspase-8/a,b. Furthermore, in KB cells, the expression of
crBAP31-FLAG did not interfere with the apparent cleavage of BID or
insertion of BAX into mitochondrial membrane after Fas stimulation.
However, the subsequent steps of BAX and BAK oligomerization and
release of cytochrome c from the organelle were inhibited. Thus, cleavage of BAP31 at the ER appears to be required to support these caspase-8- and tBID-initiated steps at mitochondria in intact cells.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES

To whom correspondence should be addressed: Dept. of
Biochemistry, McIntyre Medical Sciences Bldg., McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec H3G 1Y6, Canada. Tel.: 514-398-7282; Fax: 514-398-7384; E-mail:
gordon.shore@mcgill.ca.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Bouillet, P.,
and Strasser, A.
(2002)
J. Cell Sci.
115,
1567-1574 2.
Bernardi, P.,
Petronilli, V.,
Di Lisa, F.,
and Forte, M.
(2001)
Trends Biochem. Sci.
26,
112-117[CrossRef][Medline]
[Order article via Infotrieve]
3.
Korsmeyer, S. J.,
Wei, M. C.,
Saito, M.,
Oh, S.,
Weiler, K. J.,
and Schlesinger, P. H.
(2000)
Cell Death Differ.
12,
1166-1173
4.
Krammer, P. H.
(2000)
Nature
407,
789-795[CrossRef][Medline]
[Order article via Infotrieve]
5.
Scaffidi, C.,
Fulda, F.,
Srinivasan, A.,
Friesen, C.,
Li, F.,
Tomaselli, K. J.,
Debatin, K. M.,
Krammer, P. H.,
and Peter, M. E.
(1998)
EMBO J.
17,
1675-1687[CrossRef][Medline]
[Order article via Infotrieve]
6.
Scaffidi, C.,
Schmitz, I.,
Zha, J.,
Korsmeyer, S. K.,
Krammer, P. H.,
and Peter, M. E.
(1999)
J. Biol. Chem.
274,
22532-22538 7.
Huang, D. C.,
Tschopp, J.,
and Strasser, A.
(2000)
Cell Death Differ.
7,
754-755[CrossRef][Medline]
[Order article via Infotrieve]
8.
Li, H.,
Zhu, H.,
Xu, C.-J.,
and Yuan, J.
(1998)
Cell
94,
491-501[CrossRef][Medline]
[Order article via Infotrieve]
9.
Luo, X.,
Budihardji, I.,
Zou, H.,
Slaughter, C.,
and Wang, X.
(1998)
Cell
84,
481-490
10.
Gross, A.,
Yin, X. M.,
Wang, K.,
Wei, M. C.,
Jockel, J.,
Milliman, C.,
Erdjument-Bromage, H.,
Tempst, P.,
and Korsmeyer, S. K.
(1999)
J. Biol. Chem.
274,
1156-1163 11.
Wei, M. C.,
Lindsten, T.,
Mootha, V. K.,
Weiler, S.,
Gross, A.,
Ashiya, M.,
Thompson, C. B.,
and Korsmeyer, S. K.
(2000)
Genes Dev.
14,
2060-2071 12.
Eskes, R.,
Desagher, S.,
Antonsson, B.,
and Martinou, J.-C.
(2000)
Mol. Cell. Biol.
20,
929-935 13.
Ruffolo, S. C.,
Breckenridge, D. G.,
Nguyen, M.,
Goping, I. S.,
Gross, A.,
Korsmeyer, S. J.,
Li, H.,
Yuan, J.,
and Shore, G. C.
(2000)
Cell Death Differ
7,
1101-1108[CrossRef][Medline]
[Order article via Infotrieve]
14.
Perez, D.,
and White, E.
(2000)
Mol. Cell
6,
53-63[CrossRef][Medline]
[Order article via Infotrieve]
15.
Antonsson, B.,
Montessuit, S.,
Sanchez, B.,
and Martinou, J. C.
(2001)
J. Biol. Chem.
276,
11615-11623 16.
Wei, M. C.,
Zong, W. X.,
Cheng, E. H.,
Lindsten, T.,
Panoutsakopoulou, V.,
Ross, A. J.,
Roth, K. A.,
MacGregor, G. R.,
Thompson, C. B.,
and Korsmeyer, S. J.
(2001)
Science
292,
727-730 17.
Saito, M.,
Korsmeyer, S. K.,
and Schlesinger, P. H.
(2000)
Nat. Cell Biol.
2,
553-555[CrossRef][Medline]
[Order article via Infotrieve]
18.
Budihardjo, I.,
Oliver, H.,
Lutter, M.,
Luo, X.,
and Wang, W.
(1999)
Annu. Rev. Cell Dev. Biol.
15,
269-290[CrossRef][Medline]
[Order article via Infotrieve]
19.
Adrain, C.,
and Martin, S. J.
(2001)
Trends Biochem. Sci.
26,
390-397[CrossRef][Medline]
[Order article via Infotrieve]
20.
Lin, Y.,
Devin, A.,
Rodriguez, Y.,
and Liu, Z. G.
(1999)
Genes Dev.
13,
2514-2526 21.
Nguyen, M.,
Breckenridge, D. G.,
Ducret, A.,
and Shore, G. C.
(2000)
Mol. Cell. Biol.
20,
6731-6740 22.
Stegh, A. H.,
Herrmann, H.,
Lampel, S.,
Weisenberg, D.,
Andra, K.,
Seper, M.,
Wiche, G.,
Krammer, P. H.,
and Peter, M. E.
(2000)
Mol. Cell. Biol.
20,
5665-5679 23.
Kim, K. M.,
Adachi, T.,
Nielsen, P. J.,
Terashima, M.,
Lamers, M. C.,
Kohler, G.,
and Reth, M.
(1994)
EMBO J.
13,
3793-3800[Medline]
[Order article via Infotrieve]
24.
Ng, F. W.,
Nguyen, M.,
Kwan, T.,
Branton, P. E.,
Nicholson, D. W.,
Cromlish, J. A.,
and Shore, G. C.
(1997)
J. Cell Biol.
139,
327-338 25.
Breckenridge, D. G.,
Nguyen, M.,
Kuppig, S.,
Reth, M.,
and Shore, G. C.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
4331-4336 26.
Goping, I. S.,
Gross, A.,
Lavoie, J. N.,
Nguyen, M.,
Jemmerson, R.,
Roth, K.,
Korsmeyer, S. J.,
and Shore, G. C.
(1998)
J. Cell Biol.
143,
207-215 27.
Goping, I. S.,
Millar, D. G.,
and Shore, G. C.
(1995)
FEBS Lett.
373,
45-50[CrossRef][Medline]
[Order article via Infotrieve]
28.
Muzio, M.,
Stockwell, B. R.,
Stennicke, H. R.,
Salvesen, G. S.,
and Dixit, V. M.
(1998)
J. Biol. Chem.
273,
2926-2930 29.
Diver, S. T.,
and Schreiber, S. L.
(1997)
J. Am. Chem. Soc.
119,
5106-5109
30.
Stagljar, I.,
Korostensky, C.,
Johnsson, N.,
and Heesen, S. T.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5187-5192 31.
Wang, B.,
Lemay, S.,
Tsai, S.,
and Veillettete, A.
(2001)
Mol. Cell. Biol.
21,
1077-1088 32.
Janicke, R. U.,
Ng, P.,
Sprengart, M. L.,
and Porter, A. G.
(1998)
J. Biol. Chem.
273,
15540-15545 33.
Fujiki, Y.,
Fowler, S.,
Shio, H.,
Hubbard, A. L.,
and Lazarow, P. B.
(1982)
J. Cell Biol.
93,
103-110 34.
Desagher, S.,
Osen-Sand, A.,
Nichols, A.,
Eskes, R.,
Montessuit, S.,
Lauper, S.,
Maundrell, K.,
Antonsson, B.,
and Martinou, J.-C.
(1999)
J. Cell Biol.
144,
891-901 35.
Breitwieser, G. E.,
McLenithan, J. C.,
Cortese, J. F.,
Shields, J. M.,
Oliva, M. M.,
Majewski, J. L.,
Machamer, C. E.,
and Yang, V. W.
(1997)
Am. J. Physiol.
272,
957-965
36.
Peter, M. E.,
and Krammer, P. H.
(1998)
Curr. Opin. Immunol.
10,
545-551[CrossRef][Medline]
[Order article via Infotrieve]
37.
McBride, H. M.,
Goping, I. S.,
and Shore, G. C.
(1996)
J. Cell Biol.
134,
307-313 38.
Cheng, E. H.,
Kirsch, D. G.,
Clem, R. J.,
Ravi, R.,
Kastan, M. B.,
Bedi, A.,
Ueno, K.,
and Hardwick, J. M.
(1997)
Science
278,
1966-1968 39.
Clem, R. J.,
Cheng, E. H.,
Karp, C. L.,
Kirsch, D. G.,
Ueno, K.,
Takahashi, A.,
Kastan, M. B.,
Griffin, D. E.,
Earnshaw, W. C.,
Veliuona, M. A.,
and Hardwick, J. M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
554-559 40.
Breckenridge, D. G.,
and Shore, G. C.
(2003)
Genetics of Apoptosis
, pp. 93-113, BIOS Scientific Publishers Ltd., Oxford
41.
Csordas, G.,
Thomas, A. P.,
and Hajnoczky, G.
(2001)
Trends Cardiovasc. Med.
11,
269-275[CrossRef][Medline]
[Order article via Infotrieve]
42.
Esser, M. T.,
Haverstick, D. M.,
Fuller, C. L.,
Gullo, C. A.,
and Braciale, V. L.
(1998)
J. Exp. Med.
187,
1057-1067 43.
Pinton, P.,
Ferrari, D.,
Rapizzi, E.,
Di Virgilio, F.,
Pozzan, T.,
and Rizzuto, R.
(2002)
Biochimie (Paris)
84,
195-201
44.
Scoltock, A. B.,
Bortner, C. D.,
St, J.,
Bird, G.,
Putney, J. W., Jr.,
and Cidlowski, J. A.
(2000)
J. Biol. Chem.
275,
30586-30596 45.
Hockenbery, D. M.,
Oltvai, Z. N.,
Yin, X. M.,
Milliman, C. L.,
and Korsmeyer, S. J.
(1993)
Cell
75,
241-251[CrossRef][Medline]
[Order article via Infotrieve]
46.
Eskes, R.,
Antonsson, B.,
Osen-Sand, A.,
Montessuit, S.,
Richter, C.,
Sadoul, R.,
Mazzei, G.,
Nichols, A.,
and Martinou, J.-C.
(1998)
J. Cell Biol.
143,
217-224 47.
Chien, M. M.,
Zahradka, K. E.,
Newell, M. K.,
and Freed, J. H.
(1999)
J. Biol. Chem.
274,
7059-7066 48.
Matsuyama, S.,
Llopis, J.,
Devereaux, Q. L.,
Tsien, R. Y.,
and Reed, J. C.
(2000)
Nature Cell Biol.
2,
318-325[CrossRef][Medline]
[Order article via Infotrieve]
49.
Nakamura, K.,
Bossy-Wetzel, E.,
Burns, K.,
Fadel, M. P.,
Lozyk, M.,
Goping, I. S.,
Opas, M.,
Bleackley, R. C.,
Green, D. R.,
and Michalak, M.
(2000)
J. Cell Biol.
150,
731-740 50.
Ng, F. W.,
and Shore, G. C.
(1998)
J. Biol. Chem.
273,
3140-3143
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
E. Szczesna-Skorupa and B. Kemper BAP31 Is Involved in the Retention of Cytochrome P450 2C2 in the Endoplasmic Reticulum J. Biol. Chem., February 17, 2006; 281(7): 4142 - 4148. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stojanovic, M. Germain, M. Nguyen, and G. C. Shore BAP31 and Its Caspase Cleavage Product Regulate Cell Surface Expression of Tetraspanins and Integrin-mediated Cell Survival J. Biol. Chem., August 26, 2005; 280(34): 30018 - 30024. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Mathai, M. Germain, and G. C. Shore BH3-only BIK Regulates BAX,BAK-dependent Release of Ca2+ from Endoplasmic Reticulum Stores and Mitochondrial Apoptosis during Stress-induced Cell Death J. Biol. Chem., June 24, 2005; 280(25): 23829 - 23836. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Maag, M. Mancini, A. Rosen, and C. E. Machamer Caspase-resistant Golgin-160 Disrupts Apoptosis Induced by Secretory Pathway Stress and Ligation of Death Receptors Mol. Biol. Cell, June 1, 2005; 16(6): 3019 - 3027. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Iyer, L. Burkle, D. Auerbach, S. Thaminy, M. Dinkel, K. Engels, and I. Stagljar Utilizing the Split-Ubiquitin Membrane Yeast Two-Hybrid System to Identify Protein-Protein Interactions of Integral Membrane Proteins Sci. Signal., March 15, 2005; 2005(275): pl3 - pl3. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Obrdlik, M. El-Bakkoury, T. Hamacher, C. Cappellaro, C. Vilarino, C. Fleischer, H. Ellerbrok, R. Kamuzinzi, V. Ledent, D. Blaudez, et al. K+ channel interactions detected by a genetic system optimized for systematic studies of membrane protein interactions PNAS, August 17, 2004; 101(33): 12242 - 12247. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Gustafsson, J. G. Tsai, S. E. Logue, M. T. Crow, and R. A. Gottlieb Apoptosis Repressor with Caspase Recruitment Domain Protects against Cell Death by Interfering with Bax Activation J. Biol. Chem., May 14, 2004; 279(20): 21233 - 21238. [Abstract] [Full Text] [PDF] |
||||