JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M300861200 on February 10, 2003

J. Biol. Chem., Vol. 278, Issue 16, 14565-14577, April 18, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/16/14565    most recent
M300861200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Beaudoin, J.
Right arrow Articles by Labbé, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Beaudoin, J.
Right arrow Articles by Labbé, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Schizosaccharomyces pombe Cuf1 Is Composed of Functional Modules from Two Distinct Classes of Copper Metalloregulatory Transcription Factors*

Jude BeaudoinDagger , Alexandre MercierDagger §, Réjean Langlois||, and Simon LabbéDagger **

From the Départements de Dagger  Biochimie and de  Médecine Nucléaire et Radiobiologie and || Sherbrooke Positron Emission Tomography Center, Université de Sherbrooke, Sherbrooke, Quebec J1H 5N4, Canada

Received for publication, January 27, 2003, and in revised form, February 3, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In fission yeast, the genes encoding proteins that are components of the copper transporter family are controlled at the transcriptional level by the Cuf1 transcription factor. Under low copper availability, Cuf1 induces expression of the copper transporter genes. In contrast, sufficient levels of copper inactivate Cuf1 and expression of its target genes. Our study reveals that Cuf1 harbors a putative copper-binding motif, Cys-X-Cys-X3-Cys-X-Cys-X2-Cys-X2-His, within its carboxyl-terminal region to sense changing environmental copper levels. Binding studies reveal that the amino-terminal 174-residue segment of Cuf1 expressed as a fusion protein in Escherichia coli specifically interacts with the cis-acting copper transporter promoter element CuSE (copper-signaling element). Within this region, the first 61 amino acids of Cuf1 exhibit more overall homology to the Saccharomyces cerevisiae Ace1 copper-detoxifying factor (from residues 1 to 63) than to Mac1, its functional ortholog. Consistently, we demonstrate that a chimeric Cuf1 protein bearing the amino-terminal 63-residue segment of Ace1 complements cuf1Delta null phenotypes. Furthermore, we show that Schizosaccharomyces pombe cuf1Delta mutant cells expressing the full-length S. cerevisiae Ace1 protein are hypersensitive to copper ions, with a concomitant up-regulation of CuSE-mediated gene expression in fission yeast. Taken together, these studies reveal that S. cerevisiae Ace1 1-63 is functionally exchangeable with S. pombe Cuf1 1-61, and the nature of the amino acids located downstream of this amino-terminal conserved region may be crucial in dictating the type of regulatory response required to establish and maintain copper homeostasis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Copper is an essential element for aerobic life (1). The essentiality of copper stems from its ability to undergo electronic changes, making it a redox-active metal that can serve as an electron transfer intermediate for catalytic enzyme activity (2). A variety of enzymes that are crucial for metabolism require copper as a redox co-factor, including cytochrome c oxidase, copper, zinc-SOD1,1 and multicopper oxidases (3). The same redox property that makes copper indispensable also renders it toxic when present in excess (4). Copper can react with oxygen species to produce hydroxyl radicals that damage nucleic acids, proteins, and membrane lipids (5). Therefore, a tight regulation of copper homeostasis is required to counteract toxic levels of environmental copper while maintaining sufficient copper for essential cellular processes (6-9).

Studies in Saccharomyces cerevisiae have led to the identification of many components of the copper homeostatic machinery (8-10). To detect and respond to elevated environmental copper levels, S. cerevisiae cells possess the Ace1 copper-detoxifying transcription factor that can prevent the accumulation of copper to toxic concentrations by trans-activating the expression of the copper-sequestering CUP1 and CRS5 metallothionein (MT) genes, and the copper, zinc-SOD1 gene (11-18). The promoter element necessary for copper-inducible transcription of the CUP1, CRS5, and SOD1 genes is denoted MRE (metal regulatory element) (5'-HTHXXGCTGD-3'; D = A, G, or T; H = A, C, or T; and X = any residue) (19). Within this recognition sequence, an invariant 5'-GCTG-3' core element is found, whereas the region 5' to the core is known as AT-rich, with a T located four nucleotides upstream of the first G in the GCTG core (19, 20). The first subdomain (residues 1-40) (called the Zn2+ module) of the DNA binding domain of Ace1 is required for proper interaction between the transcription factor and the AT-rich minor groove of the MREs (14, 21). The second region of the bipartite DNA binding domain (residues 41-110) (termed copper-regulatory domain) of Ace1 contains 8 critical Cys residues, which are arranged in Cys-X2-Cys and Cys-X-Cys configurations (13, 22, 23). Excess copper coordinates to the copper regulatory domain of Ace1 that consists of two lobes separated by a cleft in which a tetra-copper center (Cu4S6) is formed (13). Copper metallation induces a conformational change in Ace1 due to the formation of the Cu4S6 center to make an active detoxifying factor (4, 12, 13). This enables the cupro-Ace1 protein to interact with the MREs in a copper-dependent manner allowing rapid activation of target gene expression via its carboxyl-terminal activation domain, which is negatively charged (24). The Candida glabrata ACE1 gene ortholog, named AMT1, binds MREs with similar motifs and is essential to mount a protective response to copper toxicity (25, 26).

Another pathway by which copper homeostasis is maintained is through the regulation of copper transport into the cell (1). Prior to uptake, copper is reduced from Cu2+ to Cu+ by the Fre plasma membrane Cu2+/Fe3+ ion reductases (27-31). Once reduced, Cu+ is taken up by two separate high affinity transport proteins encoded by the CTR1 and CTR3 genes (32-35). The genes encoding proteins involved in high affinity copper transport, including FRE1, CTR1, and CTR3, are transcriptionally regulated as a function of copper availability (36, 37). Furthermore, the FRE7-encoded putative reductase is also regulated at the transcriptional level by copper (31). Under low copper conditions, transcription of CTR1, CTR3, and FRE1/7 is induced, whereas under copper replete conditions, expression of these genes is inactivated (31, 36, 37). This regulation involves cis-acting copper-responsive elements (CuREs), found at least in two copies in each of these promoters, with the consensus sequence 5'-TTTGC(T/G)C(A/G)-3' (31, 36). Studies have identified the nuclear transcription factor Mac1 as an essential component of the transport copper-signaling pathway (36-39). The Mac1 amino-terminal 159 residues constitute the minimal DNA binding domain of the protein (40). Within this domain, the first 40 residues of Mac1 exhibit a strong homology to the Zn2+ module found in the Ace1 copper-detoxifying transcription factor that activates MT gene expression but very little homology outside of this region. The carboxyl-terminal region of Mac1 harbors two Cys-rich repeats, denoted C1 (also identified as REP-I) and C2 (also identified as REP-II) (38, 41, 42). The Mac1 Cys-rich repeats play distinct roles in Mac1 function (41-43). The C1 motif, Cys264-X-Cys266-X4-Cys271-X-Cys273-X2-Cys276-X2-His279, is essential for copper-sensing, because substitutions created in either all or individual conserved Cys and His residues resulted in elevated and unregulated expression of the copper transport genes. Moreover, it has been shown that the C1 motif can coordinate directly with Cu+ ions (44). Although the C2 motif, Cys322-X-Cys324-X4-Cys329-X-Cys331-X2-Cys334-X2-His337, can interact with four Cu+ atoms, its partial or complete disruption alters the ability of Mac1 to trans-activate target gene expression, rather than its ability to sense copper (42-44). Under conditions of copper deprivation, Mac1 is bound to CuREs, whereas in the presence of copper Mac1 is released from its binding sites in vivo (36). Subsequently, it was demonstrated that the Mac1 protein can bind directly to CuREs in vitro (37, 40, 45-47). Furthermore, it has been proposed that the noncopper-bound form of Mac1 binds to DNA to trans-activates copper transporter gene expression, whereas metallation of Mac1 induces intramolecular conformational changes that inactivate the Mac1 DNA binding activity and consequently its trans-activation function (44).

In Schizosaccharomyces pombe, two genes, ctr4+ and ctr5+, encode components that are required for high affinity copper uptake (48, 49). The Ctr4-Ctr5 copper transport system consists of two structurally related transmembrane proteins that are physically associated and functions as a heterodimer (49). This is supported by the observation that, in the absence of Ctr5, Ctr4 fails to localize to the cell surface. Conversely, in the absence of Ctr4, Ctr5 does not localize to the cell surface (49). Co-expression of the S. pombe Ctr4 and Ctr5 in S. cerevisiae restores high affinity copper transport to an S. cerevisiae ctr1Delta ctr3Delta strain (49). This suggests that both Ctr4 and Ctr5 are necessary and sufficient to reconstitute the S. pombe copper transport complex and direct their localization to the plasma membrane. Recent studies have allowed us to identify a third copper transporter from S. pombe, named Ctr6, which localizes to the vacuolar membrane (50). Deletion of the ctr6+ gene results in a significant reduction of copper, zinc-SOD1 activity, suggesting a role for S. pombe Ctr6 in delivering copper to one or more cytosolic copper-dependent enzymes under conditions of copper starvation (50). Like the ctr4+ and ctr5+ genes, which encode the high affinity heteromeric copper transport complex at the cell surface, ctr6+ is activated at the transcriptional level in response to copper limitation by the Cuf1 nutritional copper-sensing transcription factor through the Cu-signaling element (CuSE) found in the promoters of these genes (48, 51). The CuSE is defined by the consensus sequence 5'-D(T/A)DDHGCTGD-3' (D = A, G, or T; H = A, C, or T) (51). At least a single copy of this cis-acting element is required for activation of gene expression in response to copper limitation (51). The CuSE element bears a strong sequence similarity to the MRE, which is recognized by the Ace1 copper-detoxifying transcription factor from S. cerevisiae. When a consensus MRE from S. cerevisiae is introduced into S. pombe, transcription is induced by copper deprivation in a Cuf1-dependent manner. Furthermore, when expressed in S. cerevisiae ace1Delta cells under conditions of copper scarcity, the Cuf1 protein directs high basal level expression of CUP1 mRNA through the MREs (51). This activation is opposite to what is seen in S. cerevisiae wild type (ACE1) cells. This observation suggests that Cuf1 resembles two distinct types of copper metalloregulatory transcription factors, sharing similar DNA sequence binding specificity as the Ace1 protein, which regulates the expression of the copper detoxification genes, while playing an essential role in coordinating the transcriptional regulation of copper transporter gene expression in S. pombe as the Mac1 protein in S. cerevisiae.

In this report, we mapped the functional domains of Cuf1. We determined that the Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342 motif (designated C-rich) within the carboxyl-terminal region of Cuf1 constitutes the copper-sensing module that serves to inactivate Cuf1 function when cells are grown under copper-replete conditions. Furthermore, we demonstrate that the conserved Cys and His residues are not functionally equivalent with respect to their role in copper-dependent inhibition of Cuf1. The amino-terminal 174 amino acids harbor the DNA binding domain of Cuf1. Within this region, the first 61 amino acids of Cuf1 display a strong sequence identity to Ace1 from residues 1 to 63. Expression of a chimeric Cuf1 protein bearing the first 63 amino acid residues from the amino terminus of Ace1 suppresses the phenotypes associated with the inactivation of the cuf1+ gene. Furthermore, S. pombe cuf1Delta cells expressing the S. cerevisiae ACE1 gene are hypersensitive to copper ions, with a concomitant up-regulation of CuSE-mediated gene expression in fission yeast.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Yeast Strains and Culture Conditions-- The S. pombe strains used in this study were the wild type FY435 (h+ his7-366 leu1-32 ura4-Delta 18 ade6-M210) (52) and the cuf1Delta disruption strain JSY17 (h+ his7-366 leu1-32 ura4-Delta 18 ade6-M210 cuf1Delta ::ura4+), unless otherwise stated. To ascertain that the results observed were not specific to the S. pombe strain FY435, identical experiments were carried out with the strain FY254 (h- can1-1 leu1-32 ade6-M210 ura4-D18) (kind gift of Susan Forsburg, Salk Institute, La Jolla, CA). Four isogenic S. pombe strains, the wild type FY254, cuf1Delta (h- can1-1 leu1-32 ade6-M210 ura4-D18 cuf1Delta ::ura4+) (48), ctr4Delta ctr5Delta (h- can1-1 leu1-32 ade6-M210 ura4-D18 ctr4Delta ::hisG ctr5Delta ::hisG) (49), and cuf1Delta ctr4Delta ctr5Delta (h- can1-1 leu1-32 ade6-M210 ura4-D18 ctr4Delta ::hisG ctr5Delta ::hisG cuf1Delta ::ura4+) were also used in this study. S. pombe cells were grown in yeast extract plus supplements or under selection in Edinburgh minimal medium with necessary auxotrophic requirements (53). Under respiratory growth conditions, yeast cells were grown in a modified yeast extract medium plus supplements in which 2% dextrose was replaced with 3% glycerol. Copper deprivation or copper repletion was carried out by adding the indicated amount of BCS or CuSO4 to cells grown to mid-logarithmic phase (A600 nm of ~1.0) in Edinburgh minimal medium. After treatments at 30 °C for 1 h, 20-ml samples were withdrawn from the cultures for subsequent steady-state mRNA or protein analyses (51).

Construction of cuf1 Mutant Alleles-- To create the cuf1 mutant alleles M1, M2, M3, M4, M5, and M6, the plasmid pSKcuf1+S-B/4.2 (48) was used in conjunction with the Chameleon mutagenesis kit (Stratagene, La Jolla, CA) and the oligonucleotides 5'-CAATGCGGTGATAATTATGAATGCTTAGGTTGTC-3', 5'-GTGAATGCTTAGGTTATCTTACTCATCCAACC-3', 5'-CAATGCGGTGATAATTATGAATGCTTAGGTTATCTTACTCATCC AAAC-3', 5'-GCTTAGGTTGTCTTACTTATCCAAACAATGCAACTAC-3', 5'-GCACAGGCTGATGCTGCTTATCAATACGGTGATAATTATGAATACTTAGGTTATCTTACTCATCCAAACAATGCAACTACATTAGCC-3', and 5'- GCACAGGCTGATGCTGCTTATCAATACGGTGATAATTATGAATACTTAGGTTATCTTACTTATCCAAACAATGCAACTACATTAGCC-3', respectively (underlined letters represent nucleotide substitutions that gave rise to mutations in the Cys-rich domain). Once generated, each cuf1 mutant allele was isolated from pBluescript SK+ using SmaI and BamHI and swapped for an identical DNA region into the pSPcuf1+S-B/4.2 plasmid (48). All nucleotide changes were verified by DNA sequencing. To create the cuf1 mutant allele M7, a linker containing an XbaI site was inserted in-frame within the cuf1+ gene at position +369 relative to the first nucleotide of the initiator codon. Using pSPcuf1+S-B/4.2, the linker was introduced by the overlap extension method as described by Ho et al. (54). The insertion converted the methionine and proline residues at position 123 and 124 to serine and arginine, creating pSPcuf1+XbaI123. This latter allele was judged to be functional because of its ability to fully complement the cuf1Delta growth defect in glycerol. Subsequently, a 380-bp PstI-XbaI fragment of the cuf1+ gene up to +372 from the start codon (residues 1-124) was isolated by PCR from pSPcuf1+S-B/4.2. The primer that contained an XbaI restriction site was made with four point mutations that convert His-107, Cys-108, Cys-115, and Cys-116 to tyrosine residues. The PCR product obtained was digested with PstI and XbaI and cloned into the corresponding sites of pSPcuf1+S-B/4.2. The resulting plasmid was designated pSPcuf1 M7 S-B/4.2. The 5' region of the cuf1+ gene that contains the four point mutations (His-107, Cys-108, Cys-115, and Cys-116 to tyrosine residues) was also swapped for an identical DNA region into the pSPcuf1 M3 S-B/4.2 plasmid (instead of pSPcuf1+S-B/4.2), creating the cuf1 mutant allele M8.

The cuf1Delta 11-46 allele was constructed by three-piece ligation by simultaneously introducing a 1007-bp NruI-SpeI PCR-amplified fragment containing the cuf1+ locus starting at -977 from the translational start codon up to +30 after the initiator codon and a 1097-bp SpeI-BamHI PCR-amplified fragment containing the cuf1+ ORF starting at +139 to +1237 into the NruI-BamHI-digested pSPcuf1+N-B/2.9 vector (48). Subsequently, the NruI-BamHI DNA fragment was exchanged with an identical DNA region into the pSPcuf1+S-B/4.2 plasmid. To generate the cuf1Delta 175-300 allele, the pSKcuf1+ plasmid was digested with AccI, treated with Klenow, and digested with HincII. Removal of the central region of the cuf1+ gene by the above-mentioned restriction and modification enzymes created only one extra codon that encodes a Phe residue after the amino acid Lys located at position 174. The pSK cuf1Delta 175-300 plasmid was digested with PstI and BamHI and cloned into the corresponding sites of pSPcuf1+S-B/4.2, generating a plasmid bearing a deletion of 125 codons within the middle region of cuf1+.

ACE1 Derivatives-- For ectopic expression of the full-length ACE1 gene in S. pombe cells, the thiamine-repressible promoter system was used as described previously (50). The ACE1 gene was isolated by PCR using primers that corresponded to the start and stop codons of the ORF from S. cerevisiae (strain DTY1 (36)) genomic DNA. Because the primers contained XhoI and BamHI restriction sites, the purified DNA fragment was digested with these restriction enzymes and cloned into the pREP3X vector (55, 56). To create a chimeric plasmid that has the first 63 codons of ACE1 fused to cuf1+ 64 through 411, an SmaI site was engineered by PCR mutagenesis at the junction of the two DNA regions. Using primers designed to introduce PstI and SmaI or SmaI and BamHI at the termini of the upstream (base pairs 1-189 of ACE1) or downstream (base pairs 187-1237 of cuf1+) DNA fragments, respectively, plasmid pSP1ACE63-64cuf1+411/4.2 was constructed via three-piece ligation by simultaneously introducing the above-mentioned DNA fragments in the PstI-BamHI-cut pSPcuf1+S-B/4.2 vector.

Epitope Tagging and Protein Detection-- To facilitate Cuf1 epitope tagging, two purified oligonucleotides, FLAG2TGA-up (5'-GGGGACTACAAGGACGACGATGACAAAGGCGACTACAAGGACGACGATGACAAATGAG-3') and FLAG2TCA-low (5'-GATCCTCATTTGTCATCGTCGTCCTTGTAGTCGCCTTTGTCATCG TCGTCCTTGTAGTCCCC-3'), encoding two copies of the FLAG epitope were annealed pairwise to form double-stranded DNA with SmaI and BamHI ends and then ligated into the SmaI-BamHI-cut pSK vector. The cuf1+ ORF, in which a SmaI restriction site was previously engineered by PCR and placed immediately before the stop codon, was used to fuse the cuf1+ gene in-frame with the double-FLAG epitopes. The resulting construct was utilized to replace the wild type cuf1+ carboxyl-terminal codons to create FLAG2 epitope-tagged versions of all the cuf1 alleles. Immunoblot analysis was conducted as described previously (51), except that whole cell extracts were prepared from S. pombe cuf1Delta cells expressing either the plasmid alone or Cuf1-FLAG2 or mutant derivatives. Immunodetection was performed with monoclonal anti-FLAG antibody M2 (Sigma, St. Louis, MO), monoclonal anti-PCNA antibody PC10 (Sigma, St. Louis, MO), horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences, Arlington Heights, IL), and developed with enhanced chemiluminescent detection reagents.

Assays-- 64Cu uptake was performed as described previously (50). Radioactive copper (250 µCi/µg 64Cu in the form of 64CuCl2 in 0.1 M HCl) was produced and purified at the 64Cu production facility at the Sherbrooke Positron Emission Tomography Center. 64CuCl2 was added to 2 ml of cells to a final concentration of 2 µM, and cultures were incubated for 10 min either at 30 °C or 0 °C. Counts obtained at 0 °C were subtracted from the values at 30 °C to give net uptake values. Furthermore, the values were normalized to culture density as described previously (49). To conduct the RNase protection analyses as described previously (50), the plasmids pSKctr4+, pSKact1+, and pKSlacZ were used for producing antisense RNA probes, allowing the detection of steady-state levels of ctr4+, act1+, and lacZ mRNAs, respectively.

Expression of the Cuf1-MBP Fusion Protein-- The DNA containing the amino-terminal 174 codons of Cuf1 was fused in-frame to the maltose-binding protein (MBP). To generate this fusion, the plasmid pMAL-c2X vector (New England BioLabs, Beverly, MA) was modified as follows. Two oligonucleotides, MBP-TAA-up (5'-AATTCGCTTAATAGCGCTAAAGCGGAA-3') and MBP-TTA-low (5'-AGCTTTCCGCTTTAGCGCTATTAAGCG-3'), generating three STOP codons were placed in-frame just after the codon-encoding the last amino acid of MBP. These purified oligonucleotides were annealed to form double-stranded DNA with EcoRI and HindIII overhangs and then cloned into the corresponding sites of pMAL-c2X. The primers NDEMCSMBP-1 (5'-GGAATTCCATATGGCTGCAGTCTAGAGGATCCCCCGGGAAAATCGAAGAAGGTAAACTGGTAATC-3') and BGLIIMBP-2 (5'-GGCAGCAGATCTTTGTTATAAATCAGCG-3') were used to isolate the DNA fragment containing the amino-terminal residues 2-120 of the MBP protein by PCR. The NDEMCSMBP-1 primer contained NdeI, PstI, XbaI, BamHI, and SmaI sites, and the BGLIIMBP-2 primer contained a BglII restriction site. The PCR product was purified, digested with NdeI and BglII, and used to replace the equivalent DNA fragment in pMAL-c2X vector. The resulting plasmid, denoted pMCS-MAL-c2, generated a multiple cloning site inserted upstream from the malE gene of Escherichia coli, which encodes the MBP protein. An in-frame fusion with the MBP protein was constructed by cloning a 522-bp PstI-SmaI DNA fragment containing the amino-terminal 174 codons of Cuf1 into the same sites of pMCS-MAL-c2. Plasmid pcuf1+-MAL was transformed into E. coli TB1. Fresh transformants of TB1 cells containing the plasmid pMCS-MAL-c2 or pcuf1+-MAL were grown to A600 nm of 0.5 in rich medium (1% Bacto-Tryptone, 0.5% yeast extract, 1% NaCl, and 2% glucose) containing 100 µg/ml ampicillin. At this early growth phase, the cells were induced in the presence of BCS (0.2 mM) with 0.2 mM isopropyl-beta -D-thiogalactopyranoside for 2 h at 25 °C. Subsequently, the purification of the Cuf1-MBP fusion protein in E. coli cells was carried out essentially as described previously for the fractionation of MBP-Fep1 fusion protein (57), except that 0.2 mM BCS was used (instead of FeCl3) to keep the affinity-purified Cuf1-MBP active.

Electrophoretic Mobility Shift Assays-- To detect specific DNA binding activity for Cuf1, electrophoretic mobility shift assay binding reactions were conducted using 1× binding buffer that contained 12.5 mM HEPES (pH 7.9), 75 mM NaCl, 4 mM MgCl2, 1 mM EDTA, 10% glycerol, 4 mM Tris-HCl (pH 7.9), 0.6 mM dithiothreitol, 10 µM ZnSO4, 0.25 µg of poly(dI-dC)2, 0.25 µg of salmon sperm DNA, and 200 µM BCS, unless otherwise stated. Typically, ~100 ng of affinity-purified Cuf1-MBP was incubated for 20 min at 25 °C with ~1 ng of 32P-end-labeled double-stranded oligomers as specified in Fig. 6B. When indicated, competitors to concentrations specified in Fig. 6A were added together with the probe. Once incubated, the reaction mixtures were loaded onto a 4% native polyacrylamide gel (30:0.8 acrylamide/bis ratio), which had been pre-electrophoresed for 60 min in 0.25× TBE (44.5 mM Tris, 44.5 mM borate, and 1.25 mM EDTA) at 4 °C. The DNA-protein complex was separated from the free probe by electrophoresis at 4 °C and 4 watts of constant power for 2 h. Subsequently, the gel was fixed, dried, and exposed to a Molecular Dynamics screen.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The S. pombe Copper-sensing Transcription Factor Cuf1 Is Required for the High Affinity Copper Transport-- Our previous studies revealed that S. pombe cells harboring an inactivated cuf1+ gene exhibit phenotypes linked with copper insufficiency, including the inability to grow on respiratory carbon sources, impaired copper, zinc-SOD1 activity, and defect in iron mobilization (48). To directly demonstrate a role for Cuf1 in high affinity copper transport, we measured 64Cu uptake in cuf1Delta and parental wild type strains. As shown in Fig. 1, inactivation of the cuf1+ gene resulted in a >90% reduction in high affinity 64Cu transport. When the cuf1Delta disruptant was transformed with the wild type or FLAG epitope-tagged cuf1+ allele, high affinity copper transport was restored to ~95-100% to that of the wild type starting strain. Likewise, the glycerol growth defect was corrected with either Cuf1 or Cuf1-FLAG2 under conditions where copper is absolutely required such as respiration (Fig. 1B). These results demonstrate that the Cuf1 transcription factor, which is known to play an important role in copper-dependent regulation of the copper transport genes, is essential to mount a copper uptake response during scarce environmental copper conditions.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 1.   High affinity copper transport in S. pombe is dependent on the presence of a functional cuf1+ gene. A, cuf1Delta cells, transformed with plasmids pSP1 (plasmid alone, -), pSPcuf1+S-B/4.2, or pSP1cuf1+-FLAG2S-B/4.2, were grown to mid-logarithmic phase for copper uptake measurements. Cells were incubated in the presence of 2 µM 64CuCl2 for 10 min. The values of radioactive copper absorption were determined and corrected with respect to culture density and temperature (i.e. as uptake at 30 °C subtracted by uptake at 0 °C). Results are the mean of triplicate samples. WT, wild type strain FY435 (cuf1+) was used as control. B, cultures were spotted onto fermentable (glucose) and nonfermentable (glycerol) agar media and incubated at 30 °C for 4 and 7 days, respectively.

In Vivo Mapping of the Cuf1 Copper-sensing Domain-- Given the fact that Cuf1 is a critical component of the nutritional copper-signaling pathway in S. pombe (48, 58), we sought to investigate the mechanism by which Cuf1 responds to changing environmental copper concentrations. To identify the domain responsible for sensing copper levels, we generated mutant alleles of cuf1+ and tested the ability of these mutants to direct ctr4+ gene expression and to allow growth of cells harboring these mutants on synthetic medium with exogenous CuSO4. As shown in Fig. 2, the analysis of ctr4+ mRNA levels in a strain expressing the wild type Cuf1 protein showed complete repression of ctr4+ expression in the presence of both low (1 µM) and elevated (100 µM) copper concentrations. To assess the role in copper sensing of the potential copper-binding motif, Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342 (termed C-rich), within the carboxyl-terminal region of Cuf1, we first generated the cuf1-M1 mutant allele by mutating the Cys334 to tyrosine within this motif. In isogenic cells expressing the cuf1-M1 allele, the basal ctr4+ mRNA levels were strongly increased (~10-fold) compared with the basal levels observed in the wild type strain. Furthermore, the steady-state levels of the ctr4+ mRNA was only repressed in response to 100 µM copper (Fig. 2B). This sustained expression of the ctr4+ gene as a consequence of lack of Cuf1-M1 responsiveness to copper gave rise to an increased sensitivity to copper toxicity for cells (Fig. 2C, compare cuf1+ and cuf1-M1 cells with exogenous CuSO4 at 25 µM). To assess the role of other potential metal binding cysteine and histidine residues, we generated single or double substitutions within the C-rich motif. Plasmids expressing the mutant proteins shown in Fig. 2A were transformed into an S. pombe cuf1Delta strain. The Cys339 (Cuf1-M2) and His342 (Cuf1-M4) residues were changed to tyrosine. Although these individual mutations resulted in a ~5-fold increase in the basal expression of the ctr4+ gene, in these two mutant strains, ctr4+ expression was down-regulated in the presence of low or high copper concentrations (~4- to 8-fold) and up-regulated in the presence of BCS (~4-fold). When the Cys339 right-arrow Tyr mutation was combined with Cys334 right-arrow Tyr, the mutant protein (Cuf1-M3) failed to mediate copper-dependent repression of ctr4+ expression in the presence of 1 µM copper. Transcription of the ctr4+ gene was only extinguished after treatment with 100 µM copper (Fig. 2B). The Cys334, Cys339, and His342 residues, when individually mutated, have only a partial effect on the ability of Cuf1 to properly sense copper ions, with the greatest effect observed upon mutation of Cys334. The increased basal level expression of ctr4+ as a result of these mutations rendered the cells more sensitive to 25 µM copper (Fig. 2C).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2.   Carboxyl-terminal Cuf1 cysteine residues are required for copper-dependent regulation of the ctr4+ copper-transport gene by Cuf1. A, schematic representation of the Cuf1, Cuf1-M1, Cuf1-M2, Cuf1-M3, and Cuf1- M4 proteins. The amino terminus of the nutritional copper-sensing protein Cuf1 (S. pombe), from residues 1 to 61, exhibits 51% sequence identity with the amino-terminal 63 amino acid residues of the detoxifying copper sensor Ace1 (S. cerevisiae). The amino acid sequence is numbered relative to the first initiator codon. The dots () and squares (black-square) depict positions of cysteine and histidine residues, respectively. B, Cuf1 and mutant proteins were assessed for their ability to inactive the ctr4+ gene expression in response to 1 and 100 µM CuSO4 versus basal (-) or copper-starved conditions by BCS (B, 100 µM). The ctr4+ and act1+ (as control) mRNA steady-state levels are indicated with arrows. Results shown are representative of three independent experiments. M, reference marker; C, copper sensitivity of cuf1 mutant strains. cuf1 cells expressing the indicated cuf1 mutant allele were spotted at a density of 3000 cells/5 µl onto Edinburgh minimal medium containing 0 (-) or 25 µM CuSO4 and incubated at 30 °C for 4 days.

To further investigate the role of the C-rich motif in copper sensing, we converted all of the five Cys residues to Tyr to generate Cuf1-M5. Furthermore, the His342 residue within this latter motif was also mutated to a tyrosine residue and combined with the Cys328 right-arrow Tyr, Cys330 right-arrow Tyr, Cys334 right-arrow Tyr, Cys336 right-arrow Tyr, and Cys339 right-arrow Tyr mutations, to generate the Cuf1-M6 mutant (Fig. 3A). Cells harboring these mutant cuf1-M5 and cuf1-M6 alleles exhibited elevated ctr4+ mRNA levels that were virtually unregulated by copper or copper starvation. This resulted in sustained expression of the copper transport genes like ctr4+ and a concomitant hypersensitivity to exogenous copper ions (Fig. 3C and data not shown). Another potential metal-binding His-Cys-X6-Cys-Cys motif (residues 107-116) is located in the middle part of the amino-terminal half of the Cuf1 protein. We examined the role of this motif in copper-dependent regulation by generating additional mutant alleles of cuf1+ in this region. We tested the effects of these mutations with respect to ctr4+ gene expression and the ability to grow on medium with exogenous copper (Fig. 4). All of the His and Cys residues in this potential metal-binding motif were mutated to tyrosines, generating the Cuf1-M7 mutant. Another strain (Cuf1-M8 mutant) was also created by combining the Cys334 right-arrow Tyr and Cys339 right-arrow Tyr mutations with the Cuf1-M7 mutation. As shown in Fig. 4B, the Cuf1-M7 mutant has no effect on the expression of the ctr4+ gene. Moreover, cells harboring Cuf1-M7 exhibited no copper sensitivity (Fig. 4C). Cells expressing the cuf1-M8 allele displayed a refractile response to copper ion levels similar to that observed within cuf1-M3 cells without any additional effect on the expression of the ctr4+ gene or copper sensitivity when grown in the presence of exogenous copper (Figs. 2 and 4, compare cuf1-M3 and cuf1-M8 cells). Taken together, these data demonstrate that the central 5 cysteine residues of the C-rich motif constitute the minimal copper-sensing module of the transcription factor Cuf1, which is required for copper transport gene regulation as function of changes in copper levels in fission yeast.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3.   Cuf1 requires the carboxyl-terminal Cys-X-Cys-X3-Cys-X-Cys-X2-Cys-X2-His motif for sensing copper ions and modulating gene expression. A, anatomy of the Cuf1, Cuf1-M5, and Cuf1-M6 proteins. The mutations in Cuf1-M5 and Cuf1-M6 corresponding to the Cys () and His (black-square) residues in the wild type Cuf1 protein are shown. B, S. pombe cuf1Delta strain transformed with the wild type cuf1+, M5, or M6 allele was grown under low copper conditions (B), and cultures were untreated (-) or treated with CuSO4 at final concentrations of 1 or 100 µM for 1 h. Total RNA was prepared from culture aliquots. ctr4+ and act1+ mRNA levels (arrows) were detected using RNase protection assays. Data illustrated are representative of three independent experiments. M, reference marker. C, the resulting transformants were spotted (3000 cells/5 µl) onto Edinburgh minimal medium without (-) or with exogenous CuSO4 at 25 µM. Cells were incubated for 4 days at 30 °C.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   Substitutions of His107, Cys108, Cys115, and Cys116 amino acids with tyrosine residues do not interfere with the copper-dependent transcriptional response mediated by Cuf1. A, schematic representation of the Cuf1, Cuf1-M7, and Cuf1-M8 proteins. The four point mutations in Cuf1-M7, His107 right-arrow Tyr, Cys108 right-arrow Tyr, Cys115 right-arrow Tyr, and Cys116 right-arrow Tyr, are indicated. Likewise, point mutations in Cuf1-M8 are depicted. To create the cuf1 mutant allele M7, a linker containing an XbaI site was inserted in-frame within the cuf1+ gene, converting the methionine and proline residues at position 123 and 124 to serine and arginine, respectively. This latter allele, called cuf1+XbaI123, accurately reflected the function of the wild type cuf1+ allele. B, cultures of the cuf1Delta mutant strain transformed with cuf1+, cuf1+XbaI123, cuf1-M7, or cuf1-M8 were incubated in the absence (-) or presence of CuSO4 (1 and 100 µM) or BCS (B) (100 µM) for 1 h followed by RNA isolation and analysis. Results shown are representative of three independent experiments. M, reference marker. C, The resulting transformants were assayed for their ability to grow on Edinburgh minimal medium without (-) or with exogenous CuSO4 at 25 µM. Cells were incubated for 4 days at 30 °C.

Analysis of Cuf1 Function-- Based on alignment of protein sequences, the amino-terminal 40 amino acids of Cuf1 show 55% identity to a similar region known to be involved in the DNA binding activity of S. cerevisiae Mac1, its functional ortholog (40). This domain of Cuf1 also displays 62.5% sequence identity with a subdomain, denoted Zn2+ module (residues 1-40), of the DNA binding domain of Ace1 from S. cerevisiae and Amt1 from C. glabrata, which constitute a distinct class of copper sensors required for copper detoxification (13). Because of these similarities, we removed an amino-terminal portion of Cuf1 between residues Cys11 to Cys46 to examine if this amino acid segment is required for the function of the Cuf1 transcription factor in vivo. We hypothesized that the absence of residues that may be essential for DNA binding should disrupt the DNA-binding function of Cuf1, and therefore result in the inactivation of ctr4+ gene expression. As shown in Fig. 5B, cuf1Delta mutant cells expressing the mutant protein (Cuf1Delta 11-46) were unable to activate expression of the ctr4+ gene even under conditions of copper starvation. Furthermore, these cells were unable to grow on respiratory carbon sources, due to a failure to provide copper to cytochrome c oxidase resulting from a defect in high affinity copper transport (Fig. 5C). FLAG2 epitope-tagged versions of the wild type and mutant alleles were constructed, allowing us to monitor their levels of expression (Fig. 5D). Although Cuf1Delta 11-46-FLAG2 steady-state levels were lower compared with the levels observed for the full-length Cuf1-FLAG2 fusion protein, the mutant protein was clearly produced in the cuf1Delta strain as observed by Western analysis (Fig. 5D).


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5.   Amino terminus of Cuf1 is required for ctr4+ gene expression. A, schematic representation of obliterated versions of Cuf1. For each of these derivatives, two copies of the FLAG epitope were fused in-frame to the carboxyl terminus of the protein. B, an S. pombe strain bearing a disrupted cuf1Delta allele was transformed with an empty vector (vector alone), cuf1+, cuf1Delta 11-46, or cuf1Delta 175-300 allele. Likewise, a FLAG2-tagged cuf1 version for each allele was also used for transformation. Total RNA from control (-), CuSO4 (1 and 100 µM), or BCS (B) cultures was isolated. Shown is a representative RNase protection assay of ctr4+ and act1+ (as control) mRNA steady-state levels. U, untagged alleles. C, aliquots of cultures used in B were assessed for their ability to complement the respiratory defect associated with the cuf1Delta strain by growth on glycerol. D, whole cell extracts were prepared from aliquots of cultures used in B and analyzed by immunoblotting. The positions of the Cuf1-FLAG2, Cuf1Delta 11-46-FLAG2, Cuf1Delta 175-300-FLAG2, and PCNA proteins are indicated with arrows. M, reference marker.

Because the Cuf1 ortholog in S. cerevisiae (Mac1) was elegantly shown to function using a minimal DNA binding domain of 159 residues fused to its carboxyl-terminal copper-sensing activation domain (residues 252-341) (44), we ascertained whether a middle region of Cuf1 could be removed without affecting its function. A deletion of 125 amino acids was engineered in full-length Cuf1 between residues 175 and 300 (Fig. 5A). Analogous to Mac1, the mutant protein (Cuf1Delta 175-300) was active and yielded copper-dependent regulation of the copper transporter gene expression (Fig. 5B). Although the ctr4+ steady-state mRNA levels expressed from the cuf1Delta 175-300 allele were less abundant as compared with the levels observed when the ctr4+ gene expression was under the control of the wild type cuf1+ allele, the level of ctr4+ expressed in cuf1Delta 175-300 cells was sufficient for respiratory growth (Fig. 5C). The observation that a central portion of the Cuf1 protein (residues 175-300) was dispensable for both repression of basal expression in the presence of copper ions and activation under copper deprivation conditions allowed us to designate an amino-terminal portion of Cuf1 within which lies a putative DNA binding domain. Due to the inability of the Cuf1Delta 11-46 mutant to direct even basal level expression of the ctr4+ gene, we predicted that the amino-terminal 174-amino acid region of Cuf1 directly interacts with the CuSEs (51). To test this hypothesis, we expressed a Cuf1-MBP fusion protein in E. coli cells, which contains the amino-terminal region of Cuf1 from residues 1 to 174 fused to the maltose binding protein. The polypeptide was purified to near homogeneity using two rounds of one-step affinity chromatography based on the affinity for maltose of MBP (57).2 To examine whether the amino-terminal domain of Cuf1 (residues 1-174) interacts with CuSE elements, DNA binding experiments were carried out with the purified fusion protein. As shown in Fig. 6 by a representative electrophoretic mobility shift assay, the wild type 32P-labeled 53-bp oligomer, which contains an inverted repeat of the consensus CuSE sequence, forms a DNA-protein complex in the presence of Cuf1. To determine the specificity of this complex formation, we carried out competition experiments with unlabeled oligomers using either wild type (WT) CuSE or CuSE with multiple point mutations (M) within the 53-bp DNA fragment (Fig. 6B). Formation of the DNA-protein complex was inhibited by incubation with excess wild type oligomer, but not by the double mutant (M) competitor (Fig. 6A), indicating that the complex was formed by sequence-specific interactions. Taken together, these data reveal that the Cuf1 amino-terminal 174 amino acids are important for the binding of Cuf1 to the CuSE and, therefore, is required for CuSE-dependent transcription of the copper transport genes.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6.   The DNA binding domain of Cuf1 is found within the amino-terminal 174 amino acid residues. A, representative electrophoretic mobility shift analysis using affinity-purified Cuf1-MBP. Chromatographic fractions were prepared from cells expressing either the vector alone or the cuf1+-MBP fusion allele. Competition was carried out with double-stranded DNA unlabeled oligomers corresponding to wild type (WT) and mutant (M) CuSE elements. The amount of competitor used in each reaction is indicated over the lanes, and the probe concentration was ~1 ng/reaction. B, bound probe DNA; F, free probe DNA. B, sequences of the synthetic oligomers used. The boxes marked with squares indicate that the CuSE elements are wild type, whereas the boxes marked with dots indicate that each of the two CuSE elements contains five substitutions. C, Cuf1-MBP fusion protein isolated from E. coli culture was analyzed by immunoblotting using anti-MBP antibody. Cuf1-MBP was detected with an apparent molecular mass of ~61.7 kDa. NS, nonspecific cross-reacting band.

A Chimeric Cuf1 Protein Bearing the Amino-terminal 63 Amino Acids of Ace1 Complements cuf1 Null Phenotypes-- The first 61 amino acids of Cuf1 exhibit a higher overall sequence homology to Ace1 than to Mac1 (48). Furthermore, the amino terminus of Cuf1 harbors two Cys-X1,2-Cys sequence motifs (located between amino acid residues 43 and 61), which are also present in the amino-terminal residues 43-63 of Ace1 but not in Mac1. To further investigate the function of this region, which is common to both Cuf1 and Ace1, we created a chimeric protein containing the amino-terminal 63 amino acids of Ace1 fused to the last 348 amino acids of the Cuf1 protein (Fig. 7A). The chimeric 1Ace163-64Cuf1411 protein was expressed under the control of the S. pombe cuf1+ promoter in the cuf1 disruptant strain. cuf1Delta cells transformed with the vector alone exhibited no expression or regulation by copper of the ctr4+ gene. Moreover, as expected, these cells were unable to grow on nonfermentable carbon sources (Fig. 7, B and C). Expression of full-length S. pombe Cuf1 rescued these phenotypes. Fusion of residues 1-63 of S. cerevisiae Ace1 to Cuf1 from residues 64 to 411 also rescued the cuf1 null phenotypes. FLAG epitopes were introduced at the carboxyl-terminal region of Cuf1 and 1Ace163-64Cuf1411 to assess their levels of expression in the complementation assay. Western blot analysis of whole cell extracts demonstrated that the chimeric protein was expressed at approximately the same level as compared with the wild type protein (Fig. 7D). These data indicate that the amino-terminal 63 amino acids found in the Ace1 protein, which exhibited 51% identity to those of the S. pombe Cuf1 protein, can function to regulate the copper transport gene expression in fission yeast.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   Fusion of the first 63 amino acids of the S. cerevisiae Ace1 protein to the last 348 amino acids of the S. pombe Cuf1 protein accurately functions to regulate the ctr4+ gene expression in response to copper availability. A, chimeric Ace1-Cuf1 molecule composed of the indicated regions of Ace1 or Cuf1 was expressed without or with the FLAG2 epitope. B, cells were incubated in the absence (-) or presence of CuSO4 (1 and 100 µM) or BCS (B) (100 µM). After total RNA extraction, the ctr4+ steady-state mRNA levels were analyzed by RNase protection assay. Results shown are representative of three independent experiments. C, S. pombe cuf1Delta strain, transformed with the indicated construct, was spotted at a density of 3000 cells/5 µl onto Edinburgh minimal medium containing glucose or glycerol as the carbon source. D, protein extracts were prepared from aliquots of cultures grown to mid-logarithmic phase for RNase protection analysis, and then analyzed by immunoblotting using either anti-FLAG M2 or anti-PCNA (as an internal control) antibody. M, reference marker.

Copper Hypersensitivity Growth Phenotype Resulting from Ace1 Expression in the cuf1Delta Mutant Strain-- Based on the findings that the first 63 amino acids of Ace1 was able to functionally substitute for residues 1-61 of Cuf1, we ascertained whether the full-length Ace1 protein, when expressed in S. pombe cuf1Delta cells, displayed any phenotype known to be associated with copper metabolism. S. pombe cuf1Delta cells expressing ACE1 were hypersensitive to copper and unable to grow on medium containing exogenous CuSO4 (Fig. 8). This phenotype appeared to be highly copper-specific, because among the twelve different metal ions tested, only copper and silver, metals that are structurally similar to Cu+, gave rise to this hypersensitivity (data not shown). We have demonstrated previously that, in S. pombe, expression of the copper transport genes is dependent on conserved copper-signaling elements (CuSEs) that bear a strong sequence similarity to the MREs, which are recognized by Ace1 from S. cerevisiae. Thus, this hypersensitivity may be a consequence of the high levels of copper ion transport genes within which lie multiple copies of MRE-like sequences upstream of their initiation transcription sites. Upon activation by the presence of copper, Ace1 may bind to these MRE-like sequences in S. pombe, thereby inducing the expression of a number of genes, including ctr4+ and ctr5+ (48, 49). To assess if the hypersensitivity to copper of fission yeast cells expressing ACE1 is a consequence of the increased expression of the copper transport genes, we examined the steady-state levels of a reporter gene driven either by a functional or mutated MRE-like elements in strains harboring ACE1. As shown in Fig. 8, a strain harboring the ACE1 allele expressed elevated levels of lacZ mRNA in the presence of copper ions, whereas in the absence of copper or MRE-like elements no such elevated transcription of the lacZ gene was observed. Deletion of the ctr4+ and ctr5+ genes allowed the cells to grow in the presence of 5 µM copper (Fig. 8), thereby providing the cell with a slight added advantage over cells that have both ctr4+ and ctr5+. However, a ctr4Delta ctr5Delta mutant strain expressing the ACE1 allele was sensitive to 25 µM CuSO4 (as observed for a strain harboring functional ctr4+ and ctr5+ genes), therefore, providing only a limited advantage over strains that possessed both transporters. Therefore, although continued copper uptake by the copper transporters in S. pombe contributed to the increased copper sensitivity of a fission yeast strain expressing ACE1, the presence of this allele may also influence other cellular event(s) that can contribute to the copper sensitivity phenotype of fission yeast cells.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 8.   Copper toxicity phenotype resulting from ACE1 expression in S. pombe cuf1Delta strain. A, schematic representation of the Ace1 protein. The amino acid positions of the cysteine residues () are indicated. B, cuf1Delta ctr4+ ctr5+ or cuf1Delta ctr4Delta ctr5Delta cells harboring the plasmids pREP3X (vector alone), pREP3Xcuf1+, and pREP3XACE1 were spotted onto Edinburgh minimal medium lacking leucine without copper (-) or with exogenous CuSO4 at 5 and 25 µM. C, shown is a representative RNase protection analysis of aliquots of cultures incubated in the absence (-) or presence of CuSO4 (25 and 100 µM) or BCS (B) (100 µM) for 1 h at 30 °C. Total RNA was extracted and then used in the RNase protection protocol to determine ctr4+-CYC1-lacZ (51) and act1+ mRNA levels. Wild type (WT) DNA fragment and CuSE mutants derived from the ctr4+ promoter were inserted in their natural orientation in the CYC1 minimal promoter fused to lacZ.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have previously shown that deletion of the cuf1+ gene (cuf1Delta ) in S. pombe gave rise to cells with phenotypes consistent with defects in high affinity copper transport (48). In this study, we clearly demonstrate that a cuf1Delta disruption strain failed to carry out significant levels of high affinity copper transport and, as a consequence, failed to grow on respiratory carbon sources. These data directly establish that Cuf1 has important physiological roles in high affinity copper transport and cell growth.

To gain additional insight into the mechanism whereby Cuf1 differentially activates or represses target gene expression as a function of copper availability, different mutant alleles of cuf1+ were created and transformed separately into a cuf1Delta strain. These mutants were designed to enable us to dissect the structural domains of Cuf1 and designate regions that are responsible for sensing copper, DNA binding, or trans-activation. In Fig. 2A, we created four mutant alleles harboring either single or double substitutions within a putative copper-binding motif in the carboxyl terminus of Cuf1 that contains an abundance of cysteines. This Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342 motif (C-rich) exhibits a strong identity to a similar domain found in two copies at the carboxyl terminus of Mac1, each motif containing also 5 Cys and 1 His residues (38, 39, 41-43). For Mac1, a single mutation in the first Cys-rich repeat (either cysteine or histidine residue) abrogates the ability for the protein to sense copper, whereas the second Cys-rich repeat has been demonstrated to play a role in trans-activation (41-43). Cells expressing mutant alleles of Cuf1 harboring mutations in the C-rich motif displayed diverse phenotypes with respect to ctr4+ gene expression. Mutating the cysteine residue at position 334 to a tyrosine (Cuf1-M1), gave rise to higher basal levels of ctr4+ and lack of repression at low levels of copper compared with Cuf1-M4 in which the histidine residue at position 342 was changed. Consequently, cells expressing Cuf1-M1 were more sensitive to copper toxicity when spotted onto medium with exogenous CuSO4. Interestingly, cells expressing the cuf1-M4 allele gave only a modest increase of basal expression of the copper transporter gene as compared with the levels observed when copper transporter gene expression was under the control of the S. cerevisiae MAC1up4 allele (42). This may indicate differences in the utilization of amino acids that serve to coordinate copper ions between Cuf1 and Mac1. The magnitude of sustained expression of the ctr4+ gene detected within each mutant strain tested parallels their sensitivity to exogenous copper ions in the medium. However, the magnitude of the contribution of the cysteine residue at position 334 compared with the other residues that comprise the C-rich motif with respect to copper sensing needs to be determined by fine mapping analysis of each amino acid that could play a role in the handling of copper. When all the five cysteines and one histidine residue within the C-rich motif were mutated to tyrosines (Fig. 3), or serines (data not shown), cells expressing this mutant exhibited sustained expression of the ctr4+ gene, even in the presence of 100 µM copper, and a concomitant hypersensitivity to copper ions. These data strongly suggest that the C-rich motif of Cuf1 is responsible for sensing the presence of excess copper that leads to the inactivation of its function, resulting in the inactivation of the ctr4+ gene expression (Fig. 3). Mutations in this region that interfere with this function (as in Cuf1-M5 and Cuf1-M6) result in a high constitutive expression of the copper transporter gene. Furthermore, these results suggest that the one or more activation domains of the protein are not located within the Cuf1 C-rich motif.

The amino-terminal 40-amino acid segment of Cuf1 harbors an extended homology to a region similar to Mac1, as well as the Ace1/Amt1 class of copper detoxification transcription factors. Within this region, a GRP tripeptide, called the AT-hook motif (14, 59) (residues 37-39) known to interact with A-T base pairs in the minor groove of AT-rich DNA, is found. For Ace1/Amt1 copper-detoxifying factors, this AT-hook motif plays a critical role in both DNA binding to MRE elements and copper-responsive target gene transcription (19). Likewise, the corresponding region of Mac1 is necessary for its interaction with CuREs (39, 46). Based upon these studies and because of our finding that the CuSE bears a strong sequence similarity to the Ace1 and Amt1 binding sites (MREs), we assessed the ability of the amino-terminal region encompassing the AT-hook-like motif in Cuf1 to function as a regulatory domain in S. pombe. The data presented here revealed that this region is required for Cuf1 function and may constitute a functionally distinct module within the DNA binding domain that is used to interact with the AT-rich minor groove segment found in ctr promoter elements (51). Further studies will be needed to assess the magnitude of contribution of the cysteine residues located downstream of the AT-hook motif (residues 43 and 46) compared with the other residues of Cuf1 with respect to its DNA binding activity and ability to direct copper-dependent target gene expression.

It is intriguing that Cuf1 displays DNA binding specificity similar to that of S. cerevisiae Ace1 and C. glabrata Amt1, yet clearly this recognition sequence is used for copper transporter gene expression in S. pombe. We propose the following explanations. First, the amino-terminal region of Cuf1 harbors a region just downstream of the Zn2+ module (residues 41-61), which exhibits extended similarity to the amino-terminal residues 41-63 of Ace1 and Amt1 proteins. Importantly, Mac1 displays no similarity to this same region. Within residues 41-61 of Cuf1, three arginine residues at positions 47, 50, and 53 align with three highly conserved basic amino acids found in Ace1 at the same positions. As expected, these residues are also found in Amt1 but absent in Mac1. Their presence may be essential to allow Cuf1 and Ace1/Amt1 transcription factors to make major groove contact with the GCTG core element of the Cuf1 CuSE and Ace1/Amt1 MRE, respectively. Lack of this conserved amino acid segment (residues 41-61) in Mac1 may explain the observation that this transcription factor uses a distinct recognition sequence, denoted CuRE, to mediate its action, which is independent of Ace1 in S. cerevisiae (36, 60). Consistent with this possibility, we showed that a chimeric protein (1Ace163-64Cuf1411), which contains the amino-terminal 63 amino acids of S. cerevisiae Ace1 and the carboxyl-terminal 348 amino acids of S. pombe Cuf1, functionally complemented the S. pombe cuf1Delta null allele. Alternatively, other basic residues present within the amino-terminal portion may be important for Cuf1-DNA interactions. A comprehensive dissection of the amino-terminal domain of Cuf1 will determine the contribution of the above-mentioned basic residues to its DNA binding activity. Although the first 61 residues of Cuf1 exhibit a strong homology to this same region of Ace1 and Amt1, Cuf1 does not possess the second half of the Ace1/Amt1 copper-regulatory domain in which two highly conserved Cys-X-Cys sequence motifs are found (13). Instead, Cuf1 has a His107-Cys108-X6-Cys115-Cys116 sequence motif located in the middle part of the N-terminal half of the protein. The Cuf1-M7 molecule harboring multiple substitutions within the His107-Cys108-X6-Cys115-Cys116 motif conferred wild type copper-dependent gene expression, suggesting that this latter motif is not important for the function of Cuf1. To further delineate the DNA binding domain of Cuf1, we used a system for expression of heterologous proteins in E. coli. Using this approach, we determined that the amino-terminal 174 amino acids of Cuf1 constitute the minimal domain required for recognition of the CuSEs. When expressed and purified from E. coli cells, a Cuf1-MBP fusion protein exhibited specific binding to the 5'-D(T/A)DDHGCTGD-3' (D = A, G, or T; H = A, C, or T) sequence. Although Cuf1 activity is inhibited by copper in vivo, the DNA binding activity of the amino-terminal 174 residues of Cuf1 produced in E. coli, was not inhibited by copper in an electrophoretic mobility shift analysis. This is consistent with the proposed model in which copper inhibition of DNA binding by Cuf1, which regulates copper transporter gene expression, requires the carboxyl-terminal Cys-rich motif.

When the full-length S. cerevisiae ACE1 gene was ectopically expressed in the S. pombe cuf1Delta strain in the presence of exogenous copper, these cells exhibited a copper-sensitive growth phenotype. The phenotype was associated with an increase in CuSE-mediated gene expression, suggesting that the copper transporters may contribute to copper sensitivity by their constant action at the cell surface. Deletion of ctr4+ and ctr5+ genes in the cuf1Delta mutant cells expressing Ace1 partially restored copper resistance. This observation suggests the presence of additional target genes whose expression is probably regulated through the CuSEs. These may include genes that encode components involved in copper transport that when constitutively expressed contribute to copper toxicity. One potential candidate is the S. pombe FET4 gene ortholog (SPBP26C9.03c), which has two putative CuSE sequences in its promoter, located between positions -282 and -219 relative to the first nucleotide of the initiator codon.2 Consistent with this hypothesis, the FET4 gene from S. cerevisiae has been reported to encode a plasma membrane protein, which is able to transport copper ions with low affinity within the cell (61). S. pombe cells expressing the S. cerevisiae ACE1 gene exhibited increased sensitivity to copper toxicity in a manner that is reminiscent of S. cerevisiae cells that have a dominant allele of the MAC1 gene, termed MAC1up1 (38). Under conditions of copper repletion, MAC1up1 encodes a Mac1 protein that constitutively binds to and activates target gene expression. Likewise, it may be the reason why no functional S. pombe Ace1 copper transcription factor has been isolated from fission yeast. The presence of such a protein would be toxic for S. pombe cells because of its ability to recognize MRE-like sequences and activate copper transport gene expression when cells are exposed to elevated environmental copper concentrations.

    ACKNOWLEDGEMENTS

We gratefully acknowledge Dr. Maria M. O. Peña for constructive comments on the manuscript. We are indebted to Drs. Stefan Zeisler and Johan E. van Lier for providing support and advice regarding the 64Cu production at the Sherbrooke Positron Emission Tomography Center. We are grateful to Serge Rodrigue for excellent technical assistance. We thank Dennis J. Thiele and Hao Zhou for the HZY4 strain.

    FOOTNOTES

* This work was supported in part by the Canadian Institutes for Health Research (CIHR) Grant MOP-36450 (to S. L.). Infrastructure equipment essential for conducting this investigation was obtained through the Canada Foundation for Innovation Grant NOF-3754 (to S. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported in part by the Université de Sherbrooke Medical School.

** A New Investigator Scholar from the CIHR. To whom correspondence should be addressed: Dépt. de biochimie, Faculté de médecine, Université de Sherbrooke, 3001 12e Ave. Nord, Sherbrooke, Quebec J1H 5N4, Canada. Tel.: 819-820-6868 (ext. 15460); Fax: 819-564-5340; E-mail: Simon.Labbe@USherbrooke.ca.

Published, JBC Papers in Press, February 10, 2003, DOI 10.1074/jbc.M300861200

2 J. Beaudoin and S. Labbé, unpublished data.

    ABBREVIATIONS

The abbreviations used are: SOD, superoxide dismutase; BCS, bathocuproinedisulfonic acid; Ctr, copper transporter; Cuf1, copper factor 1; CuSE, copper-signaling element; MT, metallothionein; ORF, open reading frame; PCNA, proliferating cell nuclear antigen; MRE, metal regulatory element; CuRE, copper-responsive elements; MBP, maltose-binding protein; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION