![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 16, 14565-14577, April 18, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
§,
, and
**
From the Départements de
Biochimie and de
¶ Médecine Nucléaire et Radiobiologie and
Sherbrooke Positron Emission Tomography Center,
Université de Sherbrooke, Sherbrooke, Quebec J1H 5N4, Canada
Received for publication, January 27, 2003, and in revised form, February 3, 2003
| |
ABSTRACT |
|---|
|
|
|---|
In fission yeast, the genes encoding proteins
that are components of the copper transporter family are controlled at
the transcriptional level by the Cuf1 transcription factor. Under low
copper availability, Cuf1 induces expression of the copper transporter
genes. In contrast, sufficient levels of copper inactivate Cuf1 and
expression of its target genes. Our study reveals that Cuf1 harbors a
putative copper-binding motif,
Cys-X-Cys-X3-Cys-X-Cys-X2-Cys-X2-His,
within its carboxyl-terminal region to sense changing environmental
copper levels. Binding studies reveal that the amino-terminal
174-residue segment of Cuf1 expressed as a fusion protein in
Escherichia coli specifically interacts with the
cis-acting copper transporter promoter element CuSE
(copper-signaling element). Within this region, the first 61 amino
acids of Cuf1 exhibit more overall homology to the Saccharomyces
cerevisiae Ace1 copper-detoxifying factor (from residues 1 to 63)
than to Mac1, its functional ortholog. Consistently, we demonstrate
that a chimeric Cuf1 protein bearing the amino-terminal 63-residue
segment of Ace1 complements cuf1 Copper is an essential element for aerobic life (1). The
essentiality of copper stems from its ability to undergo electronic changes, making it a redox-active metal that can serve as an electron transfer intermediate for catalytic enzyme activity (2). A variety of
enzymes that are crucial for metabolism require copper as a redox
co-factor, including cytochrome c oxidase, copper, zinc-SOD1,1 and multicopper
oxidases (3). The same redox property that makes copper indispensable
also renders it toxic when present in excess (4). Copper can react with
oxygen species to produce hydroxyl radicals that damage nucleic acids,
proteins, and membrane lipids (5). Therefore, a tight regulation of
copper homeostasis is required to counteract toxic levels of
environmental copper while maintaining sufficient copper for essential
cellular processes (6-9).
Studies in Saccharomyces cerevisiae have led to the
identification of many components of the copper homeostatic machinery (8-10). To detect and respond to elevated environmental copper levels,
S. cerevisiae cells possess the Ace1 copper-detoxifying transcription factor that can prevent the accumulation of copper to
toxic concentrations by trans-activating the expression of the copper-sequestering CUP1 and CRS5
metallothionein (MT) genes, and the copper,
zinc-SOD1 gene (11-18). The promoter element necessary for
copper-inducible transcription of the CUP1, CRS5,
and SOD1 genes is denoted MRE (metal regulatory element)
(5'-HTHXXGCTGD-3'; D = A, G, or T; H = A, C, or T;
and X = any residue) (19). Within this
recognition sequence, an invariant 5'-GCTG-3' core element is found,
whereas the region 5' to the core is known as AT-rich, with a T located
four nucleotides upstream of the first G in the GCTG core (19, 20). The
first subdomain (residues 1-40) (called the Zn2+ module)
of the DNA binding domain of Ace1 is required for proper interaction
between the transcription factor and the AT-rich minor groove of the
MREs (14, 21). The second region of the bipartite DNA binding domain
(residues 41-110) (termed copper-regulatory domain) of Ace1 contains 8 critical Cys residues, which are arranged in
Cys-X2-Cys and Cys-X-Cys
configurations (13, 22, 23). Excess copper coordinates to the copper
regulatory domain of Ace1 that consists of two lobes separated by a
cleft in which a tetra-copper center (Cu4S6) is
formed (13). Copper metallation induces a conformational change in Ace1
due to the formation of the Cu4S6 center to
make an active detoxifying factor (4, 12, 13). This enables the
cupro-Ace1 protein to interact with the MREs in a
copper-dependent manner allowing rapid activation of target gene expression via its carboxyl-terminal activation domain, which is
negatively charged (24). The Candida glabrata ACE1 gene
ortholog, named AMT1, binds MREs with similar motifs and is
essential to mount a protective response to copper toxicity (25,
26).
Another pathway by which copper homeostasis is maintained is through
the regulation of copper transport into the cell (1). Prior to uptake,
copper is reduced from Cu2+ to Cu+ by the
Fre plasma membrane Cu2+/Fe3+ ion
reductases (27-31). Once reduced, Cu+ is taken up by two
separate high affinity transport proteins encoded by the
CTR1 and CTR3 genes (32-35). The genes encoding proteins involved in high affinity copper transport, including FRE1, CTR1, and CTR3, are
transcriptionally regulated as a function of copper availability (36,
37). Furthermore, the FRE7-encoded putative reductase is
also regulated at the transcriptional level by copper (31). Under low
copper conditions, transcription of CTR1, CTR3,
and FRE1/7 is induced, whereas under copper
replete conditions, expression of these genes is inactivated (31, 36, 37). This regulation involves cis-acting copper-responsive
elements (CuREs), found at least in two copies in each of these
promoters, with the consensus sequence 5'-TTTGC(T/G)C(A/G)-3' (31, 36). Studies have identified the nuclear transcription factor Mac1 as an
essential component of the transport copper-signaling pathway (36-39).
The Mac1 amino-terminal 159 residues constitute the minimal DNA binding
domain of the protein (40). Within this domain, the first 40 residues
of Mac1 exhibit a strong homology to the Zn2+ module found
in the Ace1 copper-detoxifying transcription factor that activates
MT gene expression but very little homology outside of this
region. The carboxyl-terminal region of Mac1 harbors two Cys-rich
repeats, denoted C1 (also identified as REP-I) and C2 (also identified
as REP-II) (38, 41, 42). The Mac1 Cys-rich repeats play distinct roles
in Mac1 function (41-43). The C1 motif, Cys264-X-Cys266-X4-Cys271-X-Cys273-X2-Cys276-X2-His279,
is essential for copper-sensing, because substitutions created in
either all or individual conserved Cys and His residues resulted in
elevated and unregulated expression of the copper transport genes.
Moreover, it has been shown that the C1 motif can coordinate directly
with Cu+ ions (44). Although the C2 motif,
Cys322-X-Cys324-X4-Cys329-X-Cys331-X2-Cys334-X2-His337,
can interact with four Cu+ atoms, its partial or complete
disruption alters the ability of Mac1 to trans-activate
target gene expression, rather than its ability to sense copper
(42-44). Under conditions of copper deprivation, Mac1 is bound to
CuREs, whereas in the presence of copper Mac1 is released from its
binding sites in vivo (36). Subsequently, it was
demonstrated that the Mac1 protein can bind directly to CuREs in
vitro (37, 40, 45-47). Furthermore, it has been proposed that the
noncopper-bound form of Mac1 binds to DNA to trans-activates
copper transporter gene expression, whereas metallation of Mac1 induces
intramolecular conformational changes that inactivate the Mac1 DNA
binding activity and consequently its trans-activation
function (44).
In Schizosaccharomyces pombe, two genes,
ctr4+ and ctr5+, encode
components that are required for high affinity copper uptake (48, 49).
The Ctr4-Ctr5 copper transport system consists of two structurally
related transmembrane proteins that are physically associated and
functions as a heterodimer (49). This is supported by the observation
that, in the absence of Ctr5, Ctr4 fails to localize to the cell
surface. Conversely, in the absence of Ctr4, Ctr5 does not localize to
the cell surface (49). Co-expression of the S. pombe Ctr4
and Ctr5 in S. cerevisiae restores high affinity copper
transport to an S. cerevisiae ctr1 In this report, we mapped the functional domains of Cuf1. We determined
that the
Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342
motif (designated C-rich) within the carboxyl-terminal region of Cuf1
constitutes the copper-sensing module that serves to inactivate Cuf1
function when cells are grown under copper-replete conditions. Furthermore, we demonstrate that the conserved Cys and His residues are
not functionally equivalent with respect to their role in copper-dependent inhibition of Cuf1. The amino-terminal 174 amino acids harbor the DNA binding domain of Cuf1. Within this region, the first 61 amino acids of Cuf1 display a strong sequence identity to
Ace1 from residues 1 to 63. Expression of a chimeric Cuf1 protein bearing the first 63 amino acid residues from the amino terminus of
Ace1 suppresses the phenotypes associated with the inactivation of the
cuf1+ gene. Furthermore, S. pombe
cuf1 Yeast Strains and Culture Conditions--
The S. pombe strains used in this study were the wild type FY435
(h+ his7-366 leu1-32
ura4- Construction of cuf1 Mutant Alleles--
To create the
cuf1 mutant alleles M1, M2,
M3, M4, M5, and M6, the
plasmid pSKcuf1+S-B/4.2
(48) was used in conjunction with the Chameleon mutagenesis kit
(Stratagene, La Jolla, CA) and the oligonucleotides
5'-CAATGCGGTGATAATTATGAATGCTTAGGTTGTC-3', 5'-GTGAATGCTTAGGTTATCTTACTCATCCAACC-3',
5'-CAATGCGGTGATAATTATGAATGCTTAGGTTATCTTACTCATCC AAAC-3', 5'-GCTTAGGTTGTCTTACTTATCCAAACAATGCAACTAC-3',
5'-GCACAGGCTGATGCTGCTTATCAATACGGTGATAATTATGAATACTTAGGTTATCTTACTCATCCAAACAATGCAACTACATTAGCC-3', and 5'-
GCACAGGCTGATGCTGCTTATCAATACGGTGATAATTATGAATACTTAGGTTATCTTACTTATCCAAACAATGCAACTACATTAGCC-3', respectively (underlined letters represent nucleotide substitutions that gave rise to mutations in the Cys-rich domain). Once generated, each cuf1 mutant allele was isolated from pBluescript SK+
using SmaI and BamHI and swapped for an identical
DNA region into the pSPcuf1+S-B/4.2 plasmid
(48). All nucleotide changes were verified by DNA sequencing. To create
the cuf1 mutant allele M7, a linker containing an
XbaI site was inserted in-frame within the
cuf1+ gene at position +369 relative to the
first nucleotide of the initiator codon. Using
pSPcuf1+S-B/4.2, the linker was
introduced by the overlap extension method as described by Ho et
al. (54). The insertion converted the methionine and proline
residues at position 123 and 124 to serine and arginine, creating
pSPcuf1+XbaI123. This latter
allele was judged to be functional because of its ability to fully
complement the cuf1
The cuf1 ACE1 Derivatives--
For ectopic expression of the full-length
ACE1 gene in S. pombe cells, the
thiamine-repressible promoter system was used as described previously
(50). The ACE1 gene was isolated by PCR using primers that
corresponded to the start and stop codons of the ORF from S. cerevisiae (strain DTY1 (36)) genomic DNA. Because the primers
contained XhoI and BamHI restriction sites, the
purified DNA fragment was digested with these restriction enzymes and
cloned into the pREP3X vector (55, 56). To create a chimeric plasmid that has the first 63 codons of ACE1 fused to
cuf1+ 64 through 411, an SmaI site
was engineered by PCR mutagenesis at the junction of the two DNA
regions. Using primers designed to introduce PstI and
SmaI or SmaI and BamHI at the termini
of the upstream (base pairs 1-189 of ACE1) or downstream
(base pairs 187-1237 of cuf1+) DNA fragments,
respectively, plasmid
pSP1ACE63-64cuf1+411/4.2
was constructed via three-piece ligation by simultaneously introducing
the above-mentioned DNA fragments in the
PstI-BamHI-cut pSPcuf1+S-B/4.2 vector.
Epitope Tagging and Protein Detection--
To facilitate Cuf1
epitope tagging, two purified oligonucleotides, FLAG2TGA-up
(5'-GGGGACTACAAGGACGACGATGACAAAGGCGACTACAAGGACGACGATGACAAATGAG-3') and FLAG2TCA-low
(5'-GATCCTCATTTGTCATCGTCGTCCTTGTAGTCGCCTTTGTCATCG TCGTCCTTGTAGTCCCC-3'), encoding two copies of the FLAG epitope were
annealed pairwise to form double-stranded DNA with SmaI and BamHI ends and then ligated into the
SmaI-BamHI-cut pSK vector. The
cuf1+ ORF, in which a SmaI
restriction site was previously engineered by PCR and placed
immediately before the stop codon, was used to fuse the
cuf1+ gene in-frame with the double-FLAG
epitopes. The resulting construct was utilized to replace the wild type
cuf1+ carboxyl-terminal codons to create
FLAG2 epitope-tagged versions of all the cuf1
alleles. Immunoblot analysis was conducted as described previously
(51), except that whole cell extracts were prepared from S. pombe
cuf1 Assays--
64Cu uptake was performed as described
previously (50). Radioactive copper (250 µCi/µg 64Cu in
the form of 64CuCl2 in 0.1 M HCl)
was produced and purified at the 64Cu production facility
at the Sherbrooke Positron Emission Tomography Center.
64CuCl2 was added to 2 ml of cells to a final
concentration of 2 µM, and cultures were incubated for 10 min either at 30 °C or 0 °C. Counts obtained at 0 °C were
subtracted from the values at 30 °C to give net uptake values.
Furthermore, the values were normalized to culture density as described
previously (49). To conduct the RNase protection analyses as described
previously (50), the plasmids pSKctr4+,
pSKact1+, and pKSlacZ were used for
producing antisense RNA probes, allowing the detection of steady-state
levels of ctr4+, act1+,
and lacZ mRNAs, respectively.
Expression of the Cuf1-MBP Fusion Protein--
The DNA
containing the amino-terminal 174 codons of Cuf1 was fused in-frame to
the maltose-binding protein (MBP). To generate this fusion, the plasmid
pMAL-c2X vector (New England BioLabs, Beverly, MA) was modified
as follows. Two oligonucleotides, MBP-TAA-up (5'-AATTCGCTTAATAGCGCTAAAGCGGAA-3') and MBP-TTA-low
(5'-AGCTTTCCGCTTTAGCGCTATTAAGCG-3'), generating three STOP codons were
placed in-frame just after the codon-encoding the last amino acid of
MBP. These purified oligonucleotides were annealed to form
double-stranded DNA with EcoRI and HindIII overhangs and then cloned into the corresponding sites of pMAL-c2X. The
primers NDEMCSMBP-1
(5'-GGAATTCCATATGGCTGCAGTCTAGAGGATCCCCCGGGAAAATCGAAGAAGGTAAACTGGTAATC-3') and BGLIIMBP-2 (5'-GGCAGCAGATCTTTGTTATAAATCAGCG-3') were used to
isolate the DNA fragment containing the amino-terminal residues 2-120
of the MBP protein by PCR. The NDEMCSMBP-1 primer contained NdeI, PstI, XbaI, BamHI,
and SmaI sites, and the BGLIIMBP-2 primer contained a
BglII restriction site. The PCR product was purified, digested with NdeI and BglII, and used to replace
the equivalent DNA fragment in pMAL-c2X vector. The resulting plasmid,
denoted pMCS-MAL-c2, generated a multiple cloning site inserted
upstream from the malE gene of Escherichia coli,
which encodes the MBP protein. An in-frame fusion with the MBP protein
was constructed by cloning a 522-bp PstI-SmaI DNA
fragment containing the amino-terminal 174 codons of Cuf1 into the same
sites of pMCS-MAL-c2. Plasmid pcuf1+-MAL was
transformed into E. coli TB1. Fresh transformants of TB1
cells containing the plasmid pMCS-MAL-c2 or
pcuf1+-MAL were grown to
A600 nm of 0.5 in rich medium (1%
Bacto-Tryptone, 0.5% yeast extract, 1% NaCl, and 2% glucose)
containing 100 µg/ml ampicillin. At this early growth phase, the
cells were induced in the presence of BCS (0.2 mM) with 0.2 mM isopropyl- Electrophoretic Mobility Shift Assays--
To detect specific
DNA binding activity for Cuf1, electrophoretic mobility shift assay
binding reactions were conducted using 1× binding buffer that
contained 12.5 mM HEPES (pH 7.9), 75 mM NaCl, 4 mM MgCl2, 1 mM EDTA, 10% glycerol,
4 mM Tris-HCl (pH 7.9), 0.6 mM dithiothreitol,
10 µM ZnSO4, 0.25 µg of
poly(dI-dC)2, 0.25 µg of salmon sperm DNA, and 200 µM BCS, unless otherwise stated. Typically, ~100 ng of
affinity-purified Cuf1-MBP was incubated for 20 min at 25 °C with
~1 ng of 32P-end-labeled double-stranded oligomers as
specified in Fig. 6B. When indicated, competitors to
concentrations specified in Fig. 6A were added together with
the probe. Once incubated, the reaction mixtures were loaded onto a 4%
native polyacrylamide gel (30:0.8 acrylamide/bis ratio), which had been
pre-electrophoresed for 60 min in 0.25× TBE (44.5 mM Tris,
44.5 mM borate, and 1.25 mM EDTA) at 4 °C.
The DNA-protein complex was separated from the free probe by
electrophoresis at 4 °C and 4 watts of constant power for 2 h.
Subsequently, the gel was fixed, dried, and exposed to a Molecular
Dynamics screen.
The S. pombe Copper-sensing Transcription Factor Cuf1 Is Required
for the High Affinity Copper Transport--
Our previous studies
revealed that S. pombe cells harboring an inactivated
cuf1+ gene exhibit phenotypes linked with copper
insufficiency, including the inability to grow on respiratory carbon
sources, impaired copper, zinc-SOD1 activity, and defect in iron
mobilization (48). To directly demonstrate a role for Cuf1 in high
affinity copper transport, we measured 64Cu uptake in
cuf1 In Vivo Mapping of the Cuf1 Copper-sensing Domain--
Given the
fact that Cuf1 is a critical component of the nutritional
copper-signaling pathway in S. pombe (48, 58), we sought to
investigate the mechanism by which Cuf1 responds to changing
environmental copper concentrations. To identify the domain responsible
for sensing copper levels, we generated mutant alleles of
cuf1+ and tested the ability of these mutants to
direct ctr4+ gene expression and to allow growth
of cells harboring these mutants on synthetic medium with exogenous
CuSO4. As shown in Fig. 2,
the analysis of ctr4+ mRNA levels in a
strain expressing the wild type Cuf1 protein showed complete repression
of ctr4+ expression in the presence of both low
(1 µM) and elevated (100 µM) copper
concentrations. To assess the role in copper sensing of the
potential copper-binding motif,
Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342
(termed C-rich), within the carboxyl-terminal region of Cuf1, we first
generated the cuf1-M1 mutant allele by mutating the
Cys334 to tyrosine within this motif. In isogenic cells
expressing the cuf1-M1 allele, the basal
ctr4+ mRNA levels were strongly increased
(~10-fold) compared with the basal levels observed in the wild type
strain. Furthermore, the steady-state levels of the
ctr4+ mRNA was only repressed in response to
100 µM copper (Fig. 2B). This sustained
expression of the ctr4+ gene as a consequence of
lack of Cuf1-M1 responsiveness to copper gave rise to an increased
sensitivity to copper toxicity for cells (Fig. 2C, compare
cuf1+ and cuf1-M1 cells with
exogenous CuSO4 at 25 µM). To assess the role
of other potential metal binding cysteine and histidine residues, we
generated single or double substitutions within the C-rich motif.
Plasmids expressing the mutant proteins shown in Fig. 2A were transformed into an S. pombe cuf1
To further investigate the role of the C-rich motif in copper sensing,
we converted all of the five Cys residues to Tyr to generate Cuf1-M5.
Furthermore, the His342 residue within this latter motif
was also mutated to a tyrosine residue and combined with the
Cys328 Analysis of Cuf1 Function--
Based on alignment of protein
sequences, the amino-terminal 40 amino acids of Cuf1 show 55% identity
to a similar region known to be involved in the DNA binding activity of
S. cerevisiae Mac1, its functional ortholog (40). This
domain of Cuf1 also displays 62.5% sequence identity with a subdomain,
denoted Zn2+ module (residues 1-40), of the DNA binding
domain of Ace1 from S. cerevisiae and Amt1 from C. glabrata, which constitute a distinct class of copper sensors
required for copper detoxification (13). Because of these similarities,
we removed an amino-terminal portion of Cuf1 between residues
Cys11 to Cys46 to examine if this amino acid
segment is required for the function of the Cuf1 transcription factor
in vivo. We hypothesized that the absence of residues that
may be essential for DNA binding should disrupt the DNA-binding
function of Cuf1, and therefore result in the inactivation of
ctr4+ gene expression. As shown in Fig.
5B, cuf1
Because the Cuf1 ortholog in S. cerevisiae (Mac1) was
elegantly shown to function using a minimal DNA binding domain of 159 residues fused to its carboxyl-terminal copper-sensing activation domain (residues 252-341) (44), we ascertained whether a middle region
of Cuf1 could be removed without affecting its function. A deletion of
125 amino acids was engineered in full-length Cuf1 between residues 175 and 300 (Fig. 5A). Analogous to Mac1, the mutant protein
(Cuf1 A Chimeric Cuf1 Protein Bearing the Amino-terminal 63 Amino Acids of Ace1 Complements cuf1 Null Phenotypes--
The first 61 amino acids of Cuf1 exhibit a higher overall sequence homology to Ace1
than to Mac1 (48). Furthermore, the amino terminus of Cuf1 harbors two
Cys-X1,2-Cys sequence motifs (located between
amino acid residues 43 and 61), which are also present in the
amino-terminal residues 43-63 of Ace1 but not in Mac1. To further
investigate the function of this region, which is common to both Cuf1
and Ace1, we created a chimeric protein containing the amino-terminal
63 amino acids of Ace1 fused to the last 348 amino acids of the Cuf1
protein (Fig. 7A). The
chimeric 1Ace163-64Cuf1411
protein was expressed under the control of the S. pombe
cuf1+ promoter in the cuf1 disruptant
strain. cuf1 Copper Hypersensitivity Growth Phenotype Resulting from
Ace1 Expression in the cuf1 We have previously shown that deletion of the
cuf1+ gene (cuf1 To gain additional insight into the mechanism whereby Cuf1
differentially activates or represses target gene expression as a
function of copper availability, different mutant alleles of cuf1+ were created and transformed separately
into a cuf1 The amino-terminal 40-amino acid segment of Cuf1 harbors an extended
homology to a region similar to Mac1, as well as the Ace1/Amt1 class of
copper detoxification transcription factors. Within this region, a GRP
tripeptide, called the AT-hook motif (14, 59) (residues 37-39) known
to interact with A-T base pairs in the minor groove of AT-rich DNA, is
found. For Ace1/Amt1 copper-detoxifying factors, this AT-hook motif
plays a critical role in both DNA binding to MRE elements and
copper-responsive target gene transcription (19). Likewise, the
corresponding region of Mac1 is necessary for its interaction with
CuREs (39, 46). Based upon these studies and because of our finding
that the CuSE bears a strong sequence similarity to the Ace1 and Amt1 binding sites (MREs), we assessed the ability of the amino-terminal region encompassing the AT-hook-like motif in Cuf1 to function as a
regulatory domain in S. pombe. The data presented here
revealed that this region is required for Cuf1 function and may
constitute a functionally distinct module within the DNA binding domain
that is used to interact with the AT-rich minor groove segment found in
ctr promoter elements (51). Further studies will be needed to assess the magnitude of contribution of the cysteine residues located downstream of the AT-hook motif (residues 43 and 46) compared with the other residues of Cuf1 with respect to its DNA binding activity and ability to direct copper-dependent target gene expression.
It is intriguing that Cuf1 displays DNA binding specificity similar to
that of S. cerevisiae Ace1 and C. glabrata Amt1,
yet clearly this recognition sequence is used for copper transporter gene expression in S. pombe. We propose the following
explanations. First, the amino-terminal region of Cuf1 harbors a region
just downstream of the Zn2+ module (residues 41-61), which
exhibits extended similarity to the amino-terminal residues 41-63 of
Ace1 and Amt1 proteins. Importantly, Mac1 displays no similarity to
this same region. Within residues 41-61 of Cuf1, three arginine
residues at positions 47, 50, and 53 align with three highly conserved
basic amino acids found in Ace1 at the same positions. As expected,
these residues are also found in Amt1 but absent in Mac1. Their
presence may be essential to allow Cuf1 and Ace1/Amt1 transcription
factors to make major groove contact with the GCTG core element of the
Cuf1 CuSE and Ace1/Amt1 MRE, respectively. Lack of this conserved amino
acid segment (residues 41-61) in Mac1 may explain the observation that this transcription factor uses a distinct recognition sequence, denoted
CuRE, to mediate its action, which is independent of Ace1 in S. cerevisiae (36, 60). Consistent with this possibility, we showed
that a chimeric protein
(1Ace163-64Cuf1411),
which contains the amino-terminal 63 amino acids of S. cerevisiae Ace1 and the carboxyl-terminal 348 amino acids of
S. pombe Cuf1, functionally complemented the S. pombe
cuf1 When the full-length S. cerevisiae ACE1 gene was
ectopically expressed in the S. pombe cuf1
null phenotypes.
Furthermore, we show that Schizosaccharomyces pombe cuf1
mutant cells expressing the full-length S. cerevisiae Ace1
protein are hypersensitive to copper ions, with a concomitant up-regulation of CuSE-mediated gene expression in fission yeast. Taken
together, these studies reveal that S. cerevisiae Ace1
1-63 is functionally exchangeable with S. pombe Cuf1
1-61, and the nature of the amino acids located downstream of this
amino-terminal conserved region may be crucial in dictating the type of
regulatory response required to establish and maintain copper homeostasis.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ctr3
strain (49). This suggests that both Ctr4 and
Ctr5 are necessary and sufficient to reconstitute the S. pombe copper transport complex and direct their localization to
the plasma membrane. Recent studies have allowed us to identify a third
copper transporter from S. pombe, named Ctr6, which
localizes to the vacuolar membrane (50). Deletion of the
ctr6+ gene results in a significant reduction of
copper, zinc-SOD1 activity, suggesting a role for S. pombe
Ctr6 in delivering copper to one or more cytosolic
copper-dependent enzymes under conditions of copper
starvation (50). Like the ctr4+ and
ctr5+ genes, which encode the high affinity
heteromeric copper transport complex at the cell surface,
ctr6+ is activated at the transcriptional level
in response to copper limitation by the Cuf1 nutritional copper-sensing
transcription factor through the Cu-signaling
element (CuSE) found in the promoters of these genes (48,
51). The CuSE is defined by the consensus sequence 5'-D(T/A)DDHGCTGD-3'
(D = A, G, or T; H = A, C, or T) (51). At least a single copy
of this cis-acting element is required for activation of
gene expression in response to copper limitation (51). The CuSE element
bears a strong sequence similarity to the MRE, which is recognized by
the Ace1 copper-detoxifying transcription factor from S. cerevisiae. When a consensus MRE from S. cerevisiae is
introduced into S. pombe, transcription is induced by copper deprivation in a Cuf1-dependent manner. Furthermore, when
expressed in S. cerevisiae ace1
cells under
conditions of copper scarcity, the Cuf1 protein directs high basal
level expression of CUP1 mRNA through the MREs (51).
This activation is opposite to what is seen in S. cerevisiae
wild type (ACE1) cells. This observation suggests that Cuf1
resembles two distinct types of copper metalloregulatory transcription
factors, sharing similar DNA sequence binding specificity as the Ace1
protein, which regulates the expression of the copper detoxification
genes, while playing an essential role in coordinating the
transcriptional regulation of copper transporter gene expression in
S. pombe as the Mac1 protein in S. cerevisiae.
cells expressing the S. cerevisiae ACE1 gene are hypersensitive to copper ions, with a
concomitant up-regulation of CuSE-mediated gene expression in fission yeast.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
18 ade6-M210) (52) and the cuf1
disruption strain JSY17 (h+ his7-366
leu1-32 ura4-
18 ade6-M210
cuf1
::ura4+), unless
otherwise stated. To ascertain that the results observed were not
specific to the S. pombe strain FY435, identical experiments were carried out with the strain FY254 (h
can1-1 leu1-32 ade6-M210 ura4-D18) (kind gift of Susan
Forsburg, Salk Institute, La Jolla, CA). Four isogenic S. pombe strains, the wild type FY254, cuf1
(h
can1-1 leu1-32 ade6-M210 ura4-D18
cuf1
::ura4+) (48),
ctr4
ctr5
(h
can1-1 leu1-32 ade6-M210 ura4-D18
ctr4
::hisG
ctr5
::hisG) (49), and cuf1
ctr4
ctr5
(h
can1-1 leu1-32 ade6-M210 ura4-D18
ctr4
::hisG ctr5
::hisG
cuf1
::ura4+) were also used in
this study. S. pombe cells were grown in yeast extract plus
supplements or under selection in Edinburgh minimal medium with
necessary auxotrophic requirements (53). Under respiratory growth
conditions, yeast cells were grown in a modified yeast extract medium
plus supplements in which 2% dextrose was replaced with 3% glycerol.
Copper deprivation or copper repletion was carried out by adding the
indicated amount of BCS or CuSO4 to cells grown to
mid-logarithmic phase (A600 nm of ~1.0) in
Edinburgh minimal medium. After treatments at 30 °C for 1 h,
20-ml samples were withdrawn from the cultures for subsequent
steady-state mRNA or protein analyses (51).
growth defect in glycerol.
Subsequently, a 380-bp PstI-XbaI fragment of the cuf1+ gene up to +372 from the start codon
(residues 1-124) was isolated by PCR from
pSPcuf1+S-B/4.2. The
primer that contained an XbaI restriction site was made with
four point mutations that convert His-107, Cys-108, Cys-115, and
Cys-116 to tyrosine residues. The PCR product obtained was digested
with PstI and XbaI and cloned into the
corresponding sites of
pSPcuf1+S-B/4.2. The
resulting plasmid was designated pSPcuf1 M7
S-B/4.2. The 5' region of the
cuf1+ gene that contains the four point
mutations (His-107, Cys-108, Cys-115, and Cys-116 to tyrosine residues)
was also swapped for an identical DNA region into the pSPcuf1 M3
S-B/4.2 plasmid (instead of
pSPcuf1+S-B/4.2), creating
the cuf1 mutant allele M8.
11-46 allele was constructed by
three-piece ligation by simultaneously introducing a 1007-bp
NruI-SpeI PCR-amplified fragment containing the
cuf1+ locus starting at
977 from the
translational start codon up to +30 after the initiator codon and a
1097-bp SpeI-BamHI PCR-amplified fragment
containing the cuf1+ ORF starting at +139 to
+1237 into the NruI-BamHI-digested
pSPcuf1+N-B/2.9 vector (48).
Subsequently, the NruI-BamHI DNA fragment was
exchanged with an identical DNA region into the
pSPcuf1+S-B/4.2 plasmid. To generate
the cuf1
175-300 allele, the
pSKcuf1+ plasmid was digested with
AccI, treated with Klenow, and digested with
HincII. Removal of the central region of the
cuf1+ gene by the above-mentioned restriction
and modification enzymes created only one extra codon that encodes a
Phe residue after the amino acid Lys located at position 174. The pSK
cuf1
175-300 plasmid was digested with
PstI and BamHI and cloned into the corresponding sites of pSPcuf1+S-B/4.2, generating
a plasmid bearing a deletion of 125 codons within the middle region of
cuf1+.
cells expressing either the plasmid alone or
Cuf1-FLAG2 or mutant derivatives. Immunodetection was performed with monoclonal anti-FLAG antibody M2 (Sigma, St. Louis, MO),
monoclonal anti-PCNA antibody PC10 (Sigma, St. Louis, MO), horseradish
peroxidase-conjugated secondary antibodies (Amersham Biosciences,
Arlington Heights, IL), and developed with enhanced chemiluminescent
detection reagents.
-D-thiogalactopyranoside for
2 h at 25 °C. Subsequently, the purification of the Cuf1-MBP fusion protein in E. coli cells was carried out essentially
as described previously for the fractionation of MBP-Fep1 fusion protein (57), except that 0.2 mM BCS was used (instead of
FeCl3) to keep the affinity-purified Cuf1-MBP active.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and parental wild type strains. As shown in Fig.
1, inactivation of the
cuf1+ gene resulted in a >90% reduction in
high affinity 64Cu transport. When the cuf1
disruptant was transformed with the wild type or FLAG epitope-tagged
cuf1+ allele, high affinity copper transport was
restored to ~95-100% to that of the wild type starting strain.
Likewise, the glycerol growth defect was corrected with either Cuf1 or
Cuf1-FLAG2 under conditions where copper is absolutely
required such as respiration (Fig. 1B). These results
demonstrate that the Cuf1 transcription factor, which is known to play
an important role in copper-dependent regulation of the
copper transport genes, is essential to mount a copper uptake response
during scarce environmental copper conditions.

View larger version (38K):
[in a new window]
Fig. 1.
High affinity copper transport in
S. pombe is dependent on the presence of a
functional cuf1+ gene. A,
cuf1
cells, transformed with plasmids pSP1 (plasmid
alone,
), pSPcuf1+S-B/4.2, or
pSP1cuf1+-FLAG2S-B/4.2,
were grown to mid-logarithmic phase for copper uptake measurements.
Cells were incubated in the presence of 2 µM
64CuCl2 for 10 min. The values of radioactive
copper absorption were determined and corrected with respect to culture
density and temperature (i.e. as uptake at 30 °C
subtracted by uptake at 0 °C). Results are the mean of triplicate
samples. WT, wild type strain FY435
(cuf1+) was used as control. B,
cultures were spotted onto fermentable (glucose) and
nonfermentable (glycerol) agar media and incubated at
30 °C for 4 and 7 days, respectively.
strain. The
Cys339 (Cuf1-M2) and His342 (Cuf1-M4) residues
were changed to tyrosine. Although these individual mutations resulted
in a ~5-fold increase in the basal expression of the
ctr4+ gene, in these two mutant strains,
ctr4+ expression was down-regulated in the
presence of low or high copper concentrations (~4- to 8-fold) and
up-regulated in the presence of BCS (~4-fold). When the
Cys339
Tyr mutation was combined with
Cys334
Tyr, the mutant protein (Cuf1-M3) failed to
mediate copper-dependent repression of
ctr4+ expression in the presence of 1 µM copper. Transcription of the ctr4+ gene was only extinguished after treatment
with 100 µM copper (Fig. 2B). The
Cys334, Cys339, and His342
residues, when individually mutated, have only a partial effect on the
ability of Cuf1 to properly sense copper ions, with the greatest effect
observed upon mutation of Cys334. The increased basal level
expression of ctr4+ as a result of these
mutations rendered the cells more sensitive to 25 µM
copper (Fig. 2C).

View larger version (22K):
[in a new window]
Fig. 2.
Carboxyl-terminal Cuf1 cysteine residues are
required for copper-dependent regulation of the
ctr4+ copper-transport gene by
Cuf1. A, schematic representation of the Cuf1, Cuf1-M1,
Cuf1-M2, Cuf1-M3, and Cuf1- M4 proteins. The amino terminus of the
nutritional copper-sensing protein Cuf1 (S. pombe), from
residues 1 to 61, exhibits 51% sequence identity with the
amino-terminal 63 amino acid residues of the detoxifying copper sensor
Ace1 (S. cerevisiae). The amino acid sequence is numbered
relative to the first initiator codon. The dots (
) and
squares (
) depict positions of cysteine and histidine
residues, respectively. B, Cuf1 and mutant proteins were
assessed for their ability to inactive the ctr4+
gene expression in response to 1 and 100 µM
CuSO4 versus basal (
) or copper-starved
conditions by BCS (B, 100 µM). The
ctr4+ and act1+ (as
control) mRNA steady-state levels are indicated with
arrows. Results shown are representative of three
independent experiments. M, reference marker; C,
copper sensitivity of cuf1 mutant strains. cuf1
cells expressing the indicated cuf1 mutant allele were
spotted at a density of 3000 cells/5 µl onto Edinburgh minimal medium
containing 0 (
) or 25 µM CuSO4 and
incubated at 30 °C for 4 days.
Tyr, Cys330
Tyr,
Cys334
Tyr, Cys336
Tyr, and
Cys339
Tyr mutations, to generate the Cuf1-M6 mutant
(Fig. 3A). Cells harboring
these mutant cuf1-M5 and cuf1-M6 alleles
exhibited elevated ctr4+ mRNA levels that
were virtually unregulated by copper or copper starvation. This
resulted in sustained expression of the copper transport genes like
ctr4+ and a concomitant hypersensitivity to
exogenous copper ions (Fig. 3C and data not shown). Another
potential metal-binding His-Cys-X6-Cys-Cys motif
(residues 107-116) is located in the middle part of the amino-terminal
half of the Cuf1 protein. We examined the role of this motif in
copper-dependent regulation by generating additional mutant
alleles of cuf1+ in this region. We tested the
effects of these mutations with respect to ctr4+
gene expression and the ability to grow on medium with exogenous copper
(Fig. 4). All of the His and Cys residues
in this potential metal-binding motif were mutated to tyrosines,
generating the Cuf1-M7 mutant. Another strain (Cuf1-M8 mutant) was also
created by combining the Cys334
Tyr and
Cys339
Tyr mutations with the Cuf1-M7 mutation. As
shown in Fig. 4B, the Cuf1-M7 mutant has no effect on the
expression of the ctr4+ gene. Moreover, cells
harboring Cuf1-M7 exhibited no copper sensitivity (Fig. 4C).
Cells expressing the cuf1-M8 allele displayed a refractile response to copper ion levels similar to that observed within cuf1-M3 cells without any additional effect on the
expression of the ctr4+ gene or copper
sensitivity when grown in the presence of exogenous copper (Figs. 2 and
4, compare cuf1-M3 and cuf1-M8 cells). Taken together, these data demonstrate that the central 5 cysteine residues of the C-rich motif constitute the minimal copper-sensing module of the
transcription factor Cuf1, which is required for copper transport gene
regulation as function of changes in copper levels in fission
yeast.

View larger version (25K):
[in a new window]
Fig. 3.
Cuf1 requires the carboxyl-terminal
Cys-X-Cys-X3-Cys-X-Cys-X2-Cys-X2-His
motif for sensing copper ions and modulating gene expression.
A, anatomy of the Cuf1, Cuf1-M5, and Cuf1-M6 proteins. The
mutations in Cuf1-M5 and Cuf1-M6 corresponding to the Cys (
) and His
(
) residues in the wild type Cuf1 protein are shown. B, S. pombe cuf1
strain transformed with the wild type
cuf1+, M5, or M6 allele
was grown under low copper conditions (B), and cultures were
untreated (
) or treated with CuSO4 at final
concentrations of 1 or 100 µM for 1 h. Total RNA was
prepared from culture aliquots. ctr4+ and
act1+ mRNA levels (arrows) were
detected using RNase protection assays. Data illustrated are
representative of three independent experiments. M,
reference marker. C, the resulting transformants were
spotted (3000 cells/5 µl) onto Edinburgh minimal medium without (
)
or with exogenous CuSO4 at 25 µM. Cells were
incubated for 4 days at 30 °C.

View larger version (23K):
[in a new window]
Fig. 4.
Substitutions of His107,
Cys108, Cys115, and Cys116 amino
acids with tyrosine residues do not interfere with the
copper-dependent transcriptional response mediated by
Cuf1. A, schematic representation of the Cuf1, Cuf1-M7,
and Cuf1-M8 proteins. The four point mutations in Cuf1-M7,
His107
Tyr, Cys108
Tyr,
Cys115
Tyr, and Cys116
Tyr, are
indicated. Likewise, point mutations in Cuf1-M8 are depicted. To create
the cuf1 mutant allele M7, a linker containing an
XbaI site was inserted in-frame within the
cuf1+ gene, converting the methionine and
proline residues at position 123 and 124 to serine and arginine,
respectively. This latter allele, called
cuf1+XbaI123, accurately
reflected the function of the wild type cuf1+
allele. B, cultures of the cuf1
mutant strain
transformed with cuf1+,
cuf1+XbaI123,
cuf1-M7, or cuf1-M8 were incubated in the absence
(
) or presence of CuSO4 (1 and 100 µM) or
BCS (B) (100 µM) for 1 h followed by RNA
isolation and analysis. Results shown are representative of three
independent experiments. M, reference marker. C,
The resulting transformants were assayed for their ability to grow on
Edinburgh minimal medium without (
) or with exogenous
CuSO4 at 25 µM. Cells were incubated for 4 days at 30 °C.
mutant
cells expressing the mutant protein (Cuf1
11-46) were unable to
activate expression of the ctr4+ gene even under
conditions of copper starvation. Furthermore, these cells were unable
to grow on respiratory carbon sources, due to a failure to provide
copper to cytochrome c oxidase resulting from a defect in
high affinity copper transport (Fig. 5C). FLAG2 epitope-tagged versions of the wild type and mutant alleles were constructed, allowing us to monitor their levels of expression (Fig.
5D). Although Cuf1
11-46-FLAG2 steady-state
levels were lower compared with the levels observed for the full-length
Cuf1-FLAG2 fusion protein, the mutant protein was clearly
produced in the cuf1
strain as observed by Western
analysis (Fig. 5D).

View larger version (37K):
[in a new window]
Fig. 5.
Amino terminus of Cuf1 is required for
ctr4+ gene expression. A,
schematic representation of obliterated versions of Cuf1. For each of
these derivatives, two copies of the FLAG epitope were fused in-frame
to the carboxyl terminus of the protein. B, an S. pombe strain bearing a disrupted cuf1
allele was
transformed with an empty vector (vector alone),
cuf1+, cuf1
11-46, or
cuf1
175-300 allele. Likewise, a
FLAG2-tagged cuf1 version for each allele was
also used for transformation. Total RNA from control (
),
CuSO4 (1 and 100 µM), or BCS (B)
cultures was isolated. Shown is a representative RNase protection assay
of ctr4+ and act1+ (as
control) mRNA steady-state levels. U, untagged alleles.
C, aliquots of cultures used in B were assessed
for their ability to complement the respiratory defect associated with
the cuf1
strain by growth on glycerol. D,
whole cell extracts were prepared from aliquots of cultures used in
B and analyzed by immunoblotting. The positions of the
Cuf1-FLAG2, Cuf1
11-46-FLAG2,
Cuf1
175-300-FLAG2, and PCNA proteins are indicated with
arrows. M, reference marker.
175-300) was active and yielded copper-dependent regulation of the copper transporter gene expression (Fig.
5B). Although the ctr4+ steady-state
mRNA levels expressed from the
cuf1
175-300 allele were less abundant as
compared with the levels observed when the ctr4+
gene expression was under the control of the wild type
cuf1+ allele, the level of
ctr4+ expressed in
cuf1
175-300 cells was sufficient for
respiratory growth (Fig. 5C). The observation that a central portion of
the Cuf1 protein (residues 175-300) was dispensable for both
repression of basal expression in the presence of copper ions and
activation under copper deprivation conditions allowed us to designate
an amino-terminal portion of Cuf1 within which lies a putative DNA binding domain. Due to the inability of the Cuf1
11-46 mutant to
direct even basal level expression of the ctr4+
gene, we predicted that the amino-terminal 174-amino acid region of
Cuf1 directly interacts with the CuSEs (51). To test this hypothesis,
we expressed a Cuf1-MBP fusion protein in E. coli cells,
which contains the amino-terminal region of Cuf1 from residues 1 to 174 fused to the maltose binding protein. The polypeptide was purified to
near homogeneity using two rounds of one-step affinity chromatography
based on the affinity for maltose of MBP (57).2 To examine whether the
amino-terminal domain of Cuf1 (residues 1-174) interacts with CuSE
elements, DNA binding experiments were carried out with the purified
fusion protein. As shown in Fig. 6 by a
representative electrophoretic mobility shift assay, the wild type
32P-labeled 53-bp oligomer, which contains an inverted
repeat of the consensus CuSE sequence, forms a DNA-protein complex in
the presence of Cuf1. To determine the specificity of this complex formation, we carried out competition experiments with unlabeled oligomers using either wild type (WT) CuSE or CuSE with multiple point
mutations (M) within the 53-bp DNA fragment (Fig.
6B). Formation of the DNA-protein complex was inhibited by
incubation with excess wild type oligomer, but not by the double mutant
(M) competitor (Fig. 6A), indicating that the
complex was formed by sequence-specific interactions. Taken together,
these data reveal that the Cuf1 amino-terminal 174 amino acids are
important for the binding of Cuf1 to the CuSE and, therefore, is
required for CuSE-dependent transcription of the copper
transport genes.

View larger version (28K):
[in a new window]
Fig. 6.
The DNA binding domain of Cuf1 is found
within the amino-terminal 174 amino acid residues. A,
representative electrophoretic mobility shift analysis using
affinity-purified Cuf1-MBP. Chromatographic fractions were prepared
from cells expressing either the vector alone or the
cuf1+-MBP fusion allele. Competition
was carried out with double-stranded DNA unlabeled oligomers
corresponding to wild type (WT) and mutant (M)
CuSE elements. The amount of competitor used in each reaction is
indicated over the lanes, and the probe concentration was
~1 ng/reaction. B, bound probe DNA; F, free
probe DNA. B, sequences of the synthetic oligomers used. The
boxes marked with squares indicate that the CuSE
elements are wild type, whereas the boxes marked with
dots indicate that each of the two CuSE elements contains
five substitutions. C, Cuf1-MBP fusion protein isolated from
E. coli culture was analyzed by immunoblotting using
anti-MBP antibody. Cuf1-MBP was detected with an apparent molecular
mass of ~61.7 kDa. NS, nonspecific cross-reacting
band.
cells transformed with the vector alone
exhibited no expression or regulation by copper of the
ctr4+ gene. Moreover, as expected, these cells
were unable to grow on nonfermentable carbon sources (Fig. 7,
B and C). Expression of full-length S. pombe Cuf1 rescued these phenotypes. Fusion of residues 1-63 of
S. cerevisiae Ace1 to Cuf1 from residues 64 to 411 also
rescued the cuf1 null phenotypes. FLAG epitopes were introduced at the carboxyl-terminal region of Cuf1 and
1Ace163-64Cuf1411 to
assess their levels of expression in the complementation assay. Western
blot analysis of whole cell extracts demonstrated that the chimeric
protein was expressed at approximately the same level as compared with
the wild type protein (Fig. 7D). These data indicate that
the amino-terminal 63 amino acids found in the Ace1 protein, which
exhibited 51% identity to those of the S. pombe Cuf1
protein, can function to regulate the copper transport gene expression in fission yeast.

View larger version (27K):
[in a new window]
Fig. 7.
Fusion of the first 63 amino acids of the
S. cerevisiae Ace1 protein to the last 348 amino
acids of the S. pombe Cuf1 protein accurately
functions to regulate the ctr4+ gene
expression in response to copper availability. A,
chimeric Ace1-Cuf1 molecule composed of the indicated regions of Ace1
or Cuf1 was expressed without or with the FLAG2 epitope.
B, cells were incubated in the absence (
) or presence of
CuSO4 (1 and 100 µM) or BCS (B)
(100 µM). After total RNA extraction, the
ctr4+ steady-state mRNA levels were analyzed
by RNase protection assay. Results shown are representative of three
independent experiments. C, S. pombe cuf1
strain, transformed with the indicated construct, was spotted at a
density of 3000 cells/5 µl onto Edinburgh minimal medium containing
glucose or glycerol as the carbon source. D, protein
extracts were prepared from aliquots of cultures grown to
mid-logarithmic phase for RNase protection analysis, and then analyzed
by immunoblotting using either anti-FLAG M2 or anti-PCNA (as an
internal control) antibody. M, reference marker.
Mutant Strain--
Based on the
findings that the first 63 amino acids of Ace1 was able to functionally
substitute for residues 1-61 of Cuf1, we ascertained whether the
full-length Ace1 protein, when expressed in S. pombe cuf1
cells, displayed any phenotype known to be associated with copper
metabolism. S. pombe cuf1
cells expressing
ACE1 were hypersensitive to copper and unable to grow on
medium containing exogenous CuSO4 (Fig.
8). This phenotype appeared to be highly copper-specific, because among the twelve different metal ions tested,
only copper and silver, metals that are structurally similar to
Cu+, gave rise to this hypersensitivity (data not shown).
We have demonstrated previously that, in S. pombe,
expression of the copper transport genes is dependent on conserved
copper-signaling elements (CuSEs) that bear a strong sequence
similarity to the MREs, which are recognized by Ace1 from S. cerevisiae. Thus, this hypersensitivity may be a consequence of
the high levels of copper ion transport genes within which lie multiple
copies of MRE-like sequences upstream of their initiation transcription
sites. Upon activation by the presence of copper, Ace1 may bind to
these MRE-like sequences in S. pombe, thereby inducing the
expression of a number of genes, including ctr4+
and ctr5+ (48, 49). To assess if the
hypersensitivity to copper of fission yeast cells expressing
ACE1 is a consequence of the increased expression of the
copper transport genes, we examined the steady-state levels of a
reporter gene driven either by a functional or mutated MRE-like
elements in strains harboring ACE1. As shown in Fig. 8, a
strain harboring the ACE1 allele expressed elevated levels of lacZ mRNA in the presence of copper ions, whereas in
the absence of copper or MRE-like elements no such elevated
transcription of the lacZ gene was observed. Deletion of the
ctr4+ and ctr5+ genes
allowed the cells to grow in the presence of 5 µM copper (Fig. 8), thereby providing the cell with a slight added advantage over
cells that have both ctr4+ and
ctr5+. However, a ctr4
ctr5
mutant strain expressing the ACE1 allele was sensitive to 25 µM CuSO4 (as observed for
a strain harboring functional ctr4+ and
ctr5+ genes), therefore, providing only a
limited advantage over strains that possessed both transporters.
Therefore, although continued copper uptake by the copper transporters
in S. pombe contributed to the increased copper sensitivity
of a fission yeast strain expressing ACE1, the presence of
this allele may also influence other cellular event(s) that can
contribute to the copper sensitivity phenotype of fission yeast
cells.

View larger version (30K):
[in a new window]
Fig. 8.
Copper toxicity phenotype resulting from
ACE1 expression in S. pombe cuf1
strain. A, schematic representation of the Ace1
protein. The amino acid positions of the cysteine residues (
) are
indicated. B, cuf1
ctr4+ ctr5+ or
cuf1
ctr4
ctr5
cells
harboring the plasmids pREP3X (vector alone),
pREP3Xcuf1+, and pREP3XACE1 were
spotted onto Edinburgh minimal medium lacking leucine without copper
(
) or with exogenous CuSO4 at 5 and 25 µM.
C, shown is a representative RNase protection analysis of
aliquots of cultures incubated in the absence (
) or presence of
CuSO4 (25 and 100 µM) or BCS (B)
(100 µM) for 1 h at 30 °C. Total RNA was
extracted and then used in the RNase protection protocol to determine
ctr4+-CYC1-lacZ (51) and
act1+ mRNA levels. Wild type (WT)
DNA fragment and CuSE mutants derived from the
ctr4+ promoter were inserted in their natural
orientation in the CYC1 minimal promoter fused to
lacZ.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
) in S. pombe gave rise to cells with phenotypes consistent with defects
in high affinity copper transport (48). In this study, we clearly
demonstrate that a cuf1
disruption strain failed to carry
out significant levels of high affinity copper transport and, as a
consequence, failed to grow on respiratory carbon sources. These data
directly establish that Cuf1 has important physiological roles in high
affinity copper transport and cell growth.
strain. These mutants were designed to enable
us to dissect the structural domains of Cuf1 and designate regions that
are responsible for sensing copper, DNA binding, or
trans-activation. In Fig. 2A, we created four
mutant alleles harboring either single or double substitutions within a
putative copper-binding motif in the carboxyl terminus of Cuf1 that
contains an abundance of cysteines. This Cys328-X-Cys330-X3-Cys334-X-Cys336-X2-Cys339-X2-His342
motif (C-rich) exhibits a strong identity to a similar domain found in
two copies at the carboxyl terminus of Mac1, each motif containing also
5 Cys and 1 His residues (38, 39, 41-43). For Mac1, a single mutation
in the first Cys-rich repeat (either cysteine or histidine residue)
abrogates the ability for the protein to sense copper, whereas the
second Cys-rich repeat has been demonstrated to play a role in
trans-activation (41-43). Cells expressing mutant alleles
of Cuf1 harboring mutations in the C-rich motif displayed diverse
phenotypes with respect to ctr4+ gene
expression. Mutating the cysteine residue at position 334 to a tyrosine
(Cuf1-M1), gave rise to higher basal levels of
ctr4+ and lack of repression at low levels of
copper compared with Cuf1-M4 in which the histidine residue at position
342 was changed. Consequently, cells expressing Cuf1-M1 were more
sensitive to copper toxicity when spotted onto medium with exogenous
CuSO4. Interestingly, cells expressing the
cuf1-M4 allele gave only a modest increase of basal
expression of the copper transporter gene as compared with the levels
observed when copper transporter gene expression was under the control
of the S. cerevisiae MAC1up4 allele (42).
This may indicate differences in the utilization of amino acids that
serve to coordinate copper ions between Cuf1 and Mac1. The magnitude of
sustained expression of the ctr4+ gene detected
within each mutant strain tested parallels their sensitivity to
exogenous copper ions in the medium. However, the magnitude of the
contribution of the cysteine residue at position 334 compared with the
other residues that comprise the C-rich motif with respect to copper
sensing needs to be determined by fine mapping analysis of each amino
acid that could play a role in the handling of copper. When all the
five cysteines and one histidine residue within the C-rich motif were
mutated to tyrosines (Fig. 3), or serines (data not shown), cells
expressing this mutant exhibited sustained expression of the
ctr4+ gene, even in the presence of 100 µM copper, and a concomitant hypersensitivity to copper
ions. These data strongly suggest that the C-rich motif of Cuf1 is
responsible for sensing the presence of excess copper that leads to the
inactivation of its function, resulting in the inactivation of the
ctr4+ gene expression (Fig. 3). Mutations in
this region that interfere with this function (as in Cuf1-M5 and
Cuf1-M6) result in a high constitutive expression of the copper
transporter gene. Furthermore, these results suggest that the one or
more activation domains of the protein are not located within the Cuf1
C-rich motif.
null allele. Alternatively, other basic residues present
within the amino-terminal portion may be important for Cuf1-DNA
interactions. A comprehensive dissection of the amino-terminal domain
of Cuf1 will determine the contribution of the above-mentioned basic
residues to its DNA binding activity. Although the first 61 residues of
Cuf1 exhibit a strong homology to this same region of Ace1 and Amt1,
Cuf1 does not possess the second half of the Ace1/Amt1
copper-regulatory domain in which two highly conserved
Cys-X-Cys sequence motifs are found (13). Instead, Cuf1 has
a
His107-Cys108-X6-Cys115-Cys116
sequence motif located in the middle part of the N-terminal half of the
protein. The Cuf1-M7 molecule harboring multiple substitutions within
the
His107-Cys108-X6-Cys115-Cys116
motif conferred wild type copper-dependent gene expression,
suggesting that this latter motif is not important for the function of
Cuf1. To further delineate the DNA binding domain of Cuf1, we used a system for expression of heterologous proteins in E. coli.
Using this approach, we determined that the amino-terminal 174 amino acids of Cuf1 constitute the minimal domain required for recognition of
the CuSEs. When expressed and purified from E. coli cells, a
Cuf1-MBP fusion protein exhibited specific binding to the
5'-D(T/A)DDHGCTGD-3' (D = A, G, or T; H = A, C, or T)
sequence. Although Cuf1 activity is inhibited by copper in
vivo, the DNA binding activity of the amino-terminal 174 residues
of Cuf1 produced in E. coli, was not inhibited by copper in
an electrophoretic mobility shift analysis. This is consistent with the
proposed model in which copper inhibition of DNA binding by Cuf1, which
regulates copper transporter gene expression, requires the
carboxyl-terminal Cys-rich motif.
strain in the
presence of exogenous copper, these cells exhibited a copper-sensitive
growth phenotype. The phenotype was associated with an increase in
CuSE-mediated gene expression, suggesting that the copper transporters
may contribute to copper sensitivity by their constant action at the
cell surface. Deletion of ctr4+ and
ctr5+ genes in the cuf1
mutant
cells expressing Ace1 partially restored copper resistance. This
observation suggests the presence of additional target genes whose
expression is probably regulated through the CuSEs. These may include
genes that encode components involved in copper transport that when
constitutively expressed contribute to copper toxicity. One potential
candidate is the S. pombe FET4 gene ortholog
(SPBP26C9.03c), which has two putative CuSE sequences in its
promoter, located between positions
282 and
219 relative to the
first nucleotide of the initiator codon.2 Consistent with
this hypothesis, the FET4 gene from S. cerevisiae has been reported to encode a plasma membrane protein, which is able to
transport copper ions with low affinity within the cell (61).
S. pombe cells expressing the S. cerevisiae
ACE1 gene exhibited increased sensitivity to copper toxicity
in a manner that is reminiscent of S. cerevisiae cells that
have a dominant allele of the MAC1 gene, termed
MAC1up1 (38). Under conditions of copper repletion,
MAC1up1 encodes a Mac1 protein that constitutively
binds to and activates target gene expression. Likewise, it may be the
reason why no functional S. pombe Ace1 copper transcription
factor has been isolated from fission yeast. The presence of such a
protein would be toxic for S. pombe cells because of its
ability to recognize MRE-like sequences and activate copper transport
gene expression when cells are exposed to elevated environmental copper concentrations.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge Dr. Maria M. O. Peña for constructive comments on the manuscript. We are indebted to Drs. Stefan Zeisler and Johan E. van Lier for providing support and advice regarding the 64Cu production at the Sherbrooke Positron Emission Tomography Center. We are grateful to Serge Rodrigue for excellent technical assistance. We thank Dennis J. Thiele and Hao Zhou for the HZY4 strain.
| |
FOOTNOTES |
|---|
* This work was supported in part by the Canadian Institutes for Health Research (CIHR) Grant MOP-36450 (to S. L.). Infrastructure equipment essential for conducting this investigation was obtained through the Canada Foundation for Innovation Grant NOF-3754 (to S. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported in part by the Université de Sherbrooke Medical School.
** A New Investigator Scholar from the CIHR. To whom correspondence should be addressed: Dépt. de biochimie, Faculté de médecine, Université de Sherbrooke, 3001 12e Ave. Nord, Sherbrooke, Quebec J1H 5N4, Canada. Tel.: 819-820-6868 (ext. 15460); Fax: 819-564-5340; E-mail: Simon.Labbe@USherbrooke.ca.
Published, JBC Papers in Press, February 10, 2003, DOI 10.1074/jbc.M300861200
2 J. Beaudoin and S. Labbé, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: SOD, superoxide dismutase; BCS, bathocuproinedisulfonic acid; Ctr, copper transporter; Cuf1, copper factor 1; CuSE, copper-signaling element; MT, metallothionein; ORF, open reading frame; PCNA, proliferating cell nuclear antigen; MRE, metal regulatory element; CuRE, copper-responsive elements; MBP, maltose-binding protein; WT, wild type.
| |
REFERENCES |
|---|
|
|
|---|