Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M211470200 on January 30, 2003

J. Biol. Chem., Vol. 278, Issue 17, 15105-15115, April 25, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/17/15105    most recent
M211470200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakatani, F.
Right arrow Articles by Iwamoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakatani, F.
Right arrow Articles by Iwamoto, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification of p21WAF1/CIP1 as a Direct Target of EWS-Fli1 Oncogenic Fusion Protein*

Fumihiko Nakatani, Kazuhiro TanakaDagger, Riku Sakimura, Yoshihiro Matsumoto, Tomoya Matsunobu, Xu Li, Masuo Hanada, Takamitsu Okada, and Yukihide Iwamoto

From the Department of Orthopedic Surgery, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan

Received for publication, November 11, 2002, and in revised form, January 29, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Translocation t(11;22) is a karyotypic abnormality detected in over 90% of Ewing's family tumors. This translocation results in the EWS-Fli1 fusion gene, which has been shown to be a potent, single-step transforming gene. We reported previously that suppression of the EWS-Fli1 fusion protein altered the expression of G1 regulatory cyclins and cyclin-dependent kinase inhibitors both at mRNA and protein levels, resulting in G1 growth arrest in Ewing's family tumor cell lines. These data suggest that the G1 regulatory molecules may be targets of the EWS-Fli1 fusion protein, which functions as an aberrant transcription factor. By using electrophoretic mobility shift assays, we show here the direct association of EWS-Fli1 fusion protein with ETS consensus sequences, which are in the promoter of the p21WAF1/CIP1 gene. Reporter gene assays revealed that the activity of the p21WAF1/CIP1 promoter is negatively regulated by EWS-Fli1 fusion protein through at least two ETS-binding sites in the promoter. EWS-Fli1 interacted with p300 cotransactivator and suppressed its histone acetyltransferase activity, which may explain the down-regulation of p21WAF1/CIP1 by EWS-Fli1. In the presence of a histone deacetylase inhibitor, the histone acetyltransferase activity of the Ewing's family tumor cell was recovered resulting in the induction of p21, and the cell growth was dramatically inhibited. These results demonstrated that p21WAF1/CIP1 might be one of the direct targets of EWS-Fli1, and that p21WAF1/CIP1 could serve as a target for a molecularly based therapy for Ewing's family tumors.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Aberrant functions of transcription factors by structural alterations are frequent and crucial mechanisms for the development of malignant phenotypes. Chromosomal rearrangement is a major cause of structural alterations of transcription factors leading to aberrant functions. Translocation t(11;22) is a common chromosomal abnormality detected in Ewing's family tumors (EFT),1 including Ewing's sarcoma (ES) and primitive neuroectodermal tumor (1). This translocation results in the EWS-Fli1 fusion gene, made up of the 5' half of the EWS gene, containing a glutamine-rich repeat on chromosome 22, fused to the 3' half of the Fli1 gene on chromosome 11, which harbors an ETS-like DNA binding domain. Recent studies (2) demonstrated that EWS-Fli1 fusion protein, created by the chimeric gene, acts as an aberrant transcription factor. Murine fibroblasts stably transfected with the EWS-Fli1 gene formed colonies in soft agar and gained tumorigenicity (3). These observations suggest that the chimeric gene is a potent, single-step transforming gene. However, little is known about the mechanisms involved in the transformation of the chimeric gene, and the biological significance of EWS-Fli1 is not fully understood. Targeting the EWS-Fli1 fusion gene by stable transfection with an antisense expression plasmid resulted in the loss of tumorigenicity of EFT cells (4). We reported that treatment with EWS-Fli1 antisense oligonucleotides inhibited proliferation of various EFT cell lines and arrested the cell cycle at the G1 phase (5). We also demonstrated that the expression levels of G1 cyclins, including cyclin D1 and cyclin E, were markedly decreased by the reduction of the EWS-Fli1 fusion protein. On the other hand, the expression of two important cyclin-dependent kinase inhibitors for the G1-S transition, p21 and p27, was dramatically increased both at mRNA and protein levels after the treatment with EWS-Fli1 antisense oligonucleotides (6).

Among these G1 regulatory molecules, p21WAF1/CIP1 is a member of universal cyclin-dependent kinase inhibitors and plays critical roles in the regulation of G1-S transition (7). p21 can induce differentiations of normal and transformed cells and can suppress the growth of malignant cells in vitro and in vivo (8). The expression of p21WAF1/CIP1 is positively regulated by wild type p53, a tumor suppressor gene product. p53 binds to p53-responsive elements located at 1.3 and 2.2 kb upstream of the first exon of the human p21WAF1/CIP1 gene and transactivates p21WAF1/CIP1 promoter activity (9). In addition to p53, a variety of factors, including Sp1, Sp3, C/EBPs, and the STAT family, regulates transcription of the p21WAF1/CIP1 gene. These transcription factors are often activated by various signals and promoted to bind to specific cis-acting elements with transcriptional coactivators such as p300/CBP. Recent studies (10-12) suggest that p300 has acetyltransferase activity of histone or nonhistone chromatin-associated proteins and transcriptional activator proteins, resulting in the transcriptional activation of target genes.

Macleod et al. (13) reported a potent ETS-binding sequence overlapping with a p53-binding site in the p21WAF1/CIP1 promoter region. Funaoka et al. (14) also identified another ETS-binding site adjacent to the p53-responsive element in the upstream promoter region of the p21WAF1/CIP1 gene. Based on such evidence, we hypothesized that the p21WAF1/CIP1 gene might be a candidate as the direct target of EWS-Fli1 fusion protein. In the present study, we first examined whether EWS-Fli1 fusion protein could modulate the p21WAF1/CIP1 promoter activity. We found that the reduced expression of EWS-Fli1 fusion protein enhanced the p21WAF1/CIP1 promoter activity in EFT cells and that the forced expression of EWS-Fli1 suppressed the p21WAF1/CIP1 promoter activity in murine fibroblast cells. Electromobility shift assays revealed that EWS-Fli1 fusion protein bound to the ETS consensus sequences in the p21WAF1/CIP1 promoter. These data strongly suggest that p21WAF1/CIP1 is the direct target of EWS-Fli1. Furthermore, EWS-Fli1 interacts with p300 in vivo and inhibited the p21 induction via suppression of the histone acetyltransferase activity of p300. These observations may explain, at least in part, the mechanism of p21 suppression by EWS-Fli1.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- EWS-Fli1 antisense and sense phosphorothioate oligodeoxynucleotides purified by high performance liquid chromatography were purchased from Kurabo Industries Ltd. (Osaka, Japan). The sequence of the antisense oligonucleotides was ATCCGTGGACGCCATTTTCTCTCCT (5), and the corresponding sense sequence was used as a control. Sodium butyrate, a histone deacetylase inhibitor, was purchased from Wako Pure Chemical Industries, Ltd. (Tokyo, Japan).

Cell Lines and Culture Conditions-- Human ES cell lines, SK-N-MC and RDES, were obtained from the American Type Culture Collection (Manassas, VA). PNKT-1, a human primitive neuroectodermal tumor cell line, was established and characterized in our laboratory (15). EFT cells were maintained in Dulbecco's modified Eagle's medium (Nissui Pharmaceuticals Co., Tokyo, Japan) supplemented with 10% fetal bovine serum, 100 µg/ml penicillin, and 100 µg/ml streptomycin and incubated at 37 °C in a humidified atmosphere containing 5% CO2 in air. Murine fibroblast Swiss 3T3 cells were purchased from Clontech and grown in Dulbecco's modified Eagle's medium containing 10% calf serum.

Animals-- 6-Week-old athymic Balb/c nu/nu mice were obtained from Japan SLC Co., Ltd. (Hamamatsu, Japan). Throughout the experiments, the mice were maintained in a laminar flow cabinet under specific pathogen-free conditions and received standard feed and water ad libitum. All experiments on animals were done in accordance with guidelines of the Animal Center of Kyushu University.

Oligonucleotide Administration to Tumor-bearing Nude Mice-- SK-N-MC cells harvested from 60% confluent monolayer cultures were resuspended in PBS at 2 × 107 viable cells/ml and subcutaneously inoculated into athymic mice (0.5 × 107 viable cells/mouse). Seven days after the tumor inoculation, when the subcutaneous tumor had grown to a visible size, 0.1 or 0.2 ml of PBS containing 1 mM antisense or sense oligonucleotides was injected into the established tumors. Twenty four hours later, additional injections were given at the same dosages. The animals were killed 24 h after the last oligomer inoculation, and subcutaneous tumors were excised and subjected to further analyses.

RNA Extraction and Quantitative Real Time RT-PCR-- Total RNA was isolated from SK-N-MC tumors injected with sense or antisense oligonucleotides using Isogen (Wako) and from SK-N-MC cells treated with various concentrations of sodium butyrate using an RNA-easy kit (Qiagen, Hilden, Germany). One microgram of total RNA was subjected to reverse transcription reaction using SuperScript II reverse transcriptase (Invitrogen). Real time PCR was performed as described by Heid et al. (16). The amplification primers and fluorogenic hybridization probes of both human p21WAF1/CIP1 and GAPDH were custom-synthesized using Pre-developed TaqMan Assay Reagents (Applied Biosystems, Foster City, CA). As for EWS-Fli1, amplification primers and fluorogenic hybridization probes were designed using Primer Express software (Applied Biosystems). Quantitative real time RT-PCR was carried out using an Applied Biosystems 7700 Sequence Detector. The relative p21WAF1/CIP1 or EWS-Fli1 expression data were calculated by dividing the quantity of transcripts of p21WAF1/CIP1 or EWS-Fli1 by those of GAPDH, respectively.

Western Blot Analysis-- Western blottings were carried out as described (17) with several modifications. Cells were harvested and solubilized in a Nonidet P-40-based lysis buffer (20 mM Tris (pH 7.4), 250 mM NaCl, 1.0% Nonidet P-40, 1 mM EDTA, 50 mg/ml leupeptin, and 1 mM phenylmethylsulfonyl fluoride). After incubation on ice for 5 min, the cell lysates were clarified by centrifugation at 14,000 rpm for 30 min at 4 °C. The protein quantity was determined by Bradford protein assays (Bio-Rad) and fractionated on pre-cast 4-12% gradient MOPS polyacrylamide gels (NOVEX, San Diego, CA). After transfer to nitrocellulose membranes, the membranes were pretreated with TBS containing 5% dry milk and 0.05% Triton X-100 (TBST) for 1 h at room temperature and then incubated with antibodies to Fli1, ETS1, ETS2, ERG, PU.1, p300, PCAF, TAFII p250 (Santa Cruz Biotechnology, Santa Cruz, CA), p21, actin (Pharmingen), or acetylated histone H3 and H4 (Upstate Biotechnology, Inc., Lake Placid, NY) for 1 h at room temperature. After several washes in TBST, the filter was treated with horseradish peroxidase-conjugated secondary antibodies (BIOSOURCE, Illinois) at room temperature for 1 h. After the final wash with TBST, immunoreactivity of the blots was detected using an enhanced chemiluminescence (ECL) detection system (Amersham Biosciences).

Plasmids-- The full-length p21WAF1/CIP1 promoter-luciferase reporter construct (pGl2-p21-H2320) was generated by subcloning the p21WAF1/CIP1 promoter fragment (-2320 to +75) into the HindIII site of the pGl2 basic vector (Promega, Madison, WI), as described (18, 19). The deletion reporter constructs were generated as described (20). Briefly, digestion of pGl2-p21-H2320 with SacI or SmaI and re-ligation yielded plasmid pGl2-p21-S2260 or pGl2-p21-Sm60, respectively. Digestion of pGl2-p21-H2320 or pGl2-p21-S2260 with NsiI and PstI and re-ligation yielded plasmid pGl2-p21-H-N/P or pGl2-p21-S-N/P, respectively. Mutagenized reporter construct, Mut-EBS1 or Mut-EBS2, was the same as pGl2-p21-H2320 except for mutation at ETS-binding site 1 (EBS1) or ETS-binding site 2 (EBS2), respectively. Double-Mut had mutations at both ETS-binding sites. The mutations were created by PCR using mutated primers. pCMV-HA p300, an expression vector for human p300 protein, was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY)

Luciferase Assay-- EFT cell lines were seeded into each well of 6-well plates (1 × 105 cells/well) (Falcon Labware) 1 day before transfection. Twenty four hours later, transfection was done using FuGENE 6 (Roche Molecular Biochemicals) according to the manufacturer's protocol. Briefly, each well was transfected with 1.0 µg of each reporter construct and 0.5 µg of pRL-SV40 (Promega) using 3 µl of FuGENE 6. Twenty four hours after the transfection, 10 or 20 µM of sense or antisense oligonucleotides were added to the media followed by 48 h of incubation. Then the cells were solubilized using passive lysis buffer (Promega), according to the manufacturer's protocol, and were subjected to luciferase assay. Swiss 3T3 cells were cotransfected with 1.0 µg of each reporter construct and various doses of expression vectors for EWS-Fli1 (kindly provided by Dr. C. T. Denny), Fli1, and EWS-Fli1 with a deleted ETS binding domain (Delta Ets) or mock plasmid vector. pCMV-HA 300 expression vector was used to express HA-tagged p300. Twenty four hours after the cotransfection, luciferase assays were done. pGl2-Control and pRL-SV40 were used as a positive control and an internal control for normalization of transfection efficiency, respectively. Luciferase activity was assayed using Dual-luciferase Reporter Assay Systems (Promega) and a Microlumat Plus LB 96V (EG & G Berthold, Germany).

Electromobility Shift Assays (EMSAs)-- The p21WAF1/CIP1 promoter contains two known ETS-binding sites. Oligonucleotides containing each of the wild type or mutated ETS-binding sites were synthesized as complementary sequences to form double-stranded DNA and end-labeled with [alpha -32P]dCTP (10 mCi/ml, Amersham Biosciences) for EMSA. Sequences of the two ETS-binding sites of the p21WAF1/CIP1 promoter were as follows (mutated nucleotides are underlined): wild type 5'-ETS-binding site (EBS1wt), 5'-GGGTTTCTGGCCATCAGGAACATGTCCCAACATGTTGAGCTC-3'; mutated 5'-ETS-binding site (EBS1mt), 5'-GGGTTTCTGGCCATCTAGAACATGTCCCAACATGTTGAGCTC-3'; wild type 3'-ETS-binding site (EBS2wt), 5'-GGCAGCTGCGTTAGAGGAATAAGACTGGGCATGTCTGGGCAG-3'; mutated 3'-ETS-binding site (EBS2mt), 5'-GGCAGCTGCGTTATCTAGATAAGACTGGGCATGTCTGGGCAG-3'. Nuclear extracts were prepared using a modified method of Dignam et al. (21). In brief, 1.0 × 107 EFT cells were harvested and washed in PBS, suspended in 200 µl of cold buffer A (10 mM HEPES (pH 7.9), 50 mM NaCl, 1 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride), and then incubated for 20 min on ice prior to the addition of 200 µl of cold buffer B (buffer A with 0.1% Nonidet P-40). The cells were gently pipetted and incubated on ice for another 20 min. The nuclei were pelleted (5,000 × g, 2 min) and washed in buffer A, and nuclear proteins were extracted in 25 µl of buffer C (400 mM NaCl, 20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). The tubes were placed on ice for at least 30 min, followed by centrifugation at 4 °C for 10 min. The supernatant was recovered, snap-frozen in liquid nitrogen, and stored at -80 °C until use. EMSAs were performed as described (2). Briefly, nuclear extracts of EFT cell lines were incubated in 10 µl of reaction mixtures (75 mM KCl, 10 mM Tris (pH 7.5), 1 mM dithiothreitol, 1 mM EDTA, 250 ng of poly(dI-dC), and 4% Ficoll) for 15 min at room temperature. The 32P-labeled EBS1wt or EBS2wt oligonucleotides (50 fmol, 50,000 cpm) were added to the reactions followed by incubation at room temperature for 15 min. The DNA-protein complexes were fractionated with electrophoresis in 4% nondenaturing polyacrylamide gels at 110 V for 3-4 h at 4 °C in 0.25× TBE buffer (25 mM Tris, 25 mM boric acid, 0.5 mM EDTA (pH 8.3)) with 48 µM beta -mercaptoethanol. Gels were dried, and data were processed using a Bio-Image analyzer (Fuji Photo Film, Tokyo, Japan).

In Vivo Coimmunoprecipitation-- Nuclear extracts from SK-N-MC cells were prepared as described above. After the final centrifugation, the salt concentration was reduced to 75 mM NaCl. Protein quantities were determined using Bradford protein assays (Bio-Rad). The nuclear extracts were divided into 3 aliquots, followed by the addition of rabbit antiserum against human p300 (Santa Cruz Biotechnology), rabbit polyclonal antibody against Fli1 (Santa Cruz Biotechnology), or normal mouse polyclonal IgG (Santa Cruz Biotechnology). After incubation on ice for 2 h, protein A-G-Sepharose beads (Santa Cruz Biotechnology) were added to the reactions, which were then shaken on a rotary shaker at 4 °C for 8 h. The beads were washed five times with PBS, boiled, and subjected to electrophoresis on 4-12% MOPS or 3-7% Tris acetate gradient pre-cast polyacrylamide gels (NOVEX), according to the molecular weight of target proteins. After the transfer to nitrocellulose membranes, the filers were subjected to Western blot analysis as described above.

Immunofluorescence-- Swiss 3T3 cells, cultured on poly-L-lysine-coated coverslips, were cotransfected with FLAG-tagged EWS-Fli1 and HA-tagged p300 expression constructs, using LipofectAMINE PLUS reagents (Invitrogen) as instructed. Forty eight hours after the transfection, the cells were fixed with 4% paraformaldehyde in PBS for 30 min. After a PBS wash, the cells were permeabilized for 10 min in 0.5% Triton X-100 in PBS followed by a PBS wash, and FLAG-tagged EWS-Fli1 were detected with Cy3-conjugated FLAG-M2 monoclonal antibody (Sigma) diluted 1:200 in PBS containing 1% bovine serum albumin. After three PBS washes for 5 min, the cells were incubated with FITC-conjugated anti-HA monoclonal antibody (Roche Diagnostics Co.) diluted 1:100 in PBS containing 1% bovine serum albumin for 1 h at room temperature to detect HA-tagged p300. After a 5-min wash in PBS, the coverslips were mounted with a Vectashield 100 (Vector Laboratories, Peterborough, UK) on glass slides, and then the specimens were observed under a confocal microscope with argon and krypton lasers. Control experiments were carried out to ensure there was no bleed through between green (FITC) and red (Cy3) signals.

Immunoprecipitated Histone Acetyltransferase Activity Assay-- Histone acetyltransferase activity of p300, PCAF, and TAFII p250 was measured using an immunoprecipitation-HAT assay kit (Upstate Biotechnology, Inc.), according to the manufacturer's protocol. Briefly, SK-N-MC cells were exposed to sense or antisense oligonucleotides of EWS-Fli1 for 48 h. Swiss 3T3 cells were transiently transfected with various doses of expression vectors for EWS-Fli1, Fli1, Delta Ets, or mock plasmid vector as described above. A nuclear extract of each sample was divided into 4 aliquots, followed by the addition of mouse monoclonal antibody to p300 (Upstate Biotechnology, Inc.), PCAF, TAFII p250 (Santa Cruz Biotechnology), or normal mouse IgG (Santa Cruz Biotechnology). After incubation on ice for 2 h, 20 µl of protein G-Sepharose beads (Santa Cruz Biotechnology) were added to the reactions and shaken on a rotary shaker at 4 °C for 4 h. The collected beads were washed three times with ice-cold PBS and incubated with HAT assay mixtures consisting of core histones and 100 µM [3H]acetyl-CoA (0.5 µCi/µl) at 30 °C for 30 min. The supernatant of each sample was placed on P81 square papers and washed six times for 15 min with 50 mM Na2HPO4 (pH 9.0). The squares were equilibrated with scintillation fluid overnight and read in a scintillation counter.

Nonradioactive Histone Acetyltransferase Activity Assay-- SK-N-MC cells were treated with antisense or sense oligonucleotides of EWS-Fli1 or sodium butyrate for 48 h. Each nuclear extract was harvested as described above and subjected to the assays. Nonradioactive HAT assays were done using a HAT assay kit (Upstate Biotechnology, Inc.), according to the manufacturer's protocol. Briefly, each nuclear extract was mixed with 100 µM acetyl-CoA, and 1× HAT assay buffer was incubated on an enzyme-linked immunosorbent assay plate precoated with histone H3 for 30 min. After several washes with PBS, acetylated histones were detected using an anti-acetyl-lysine rabbit polyclonal antibody followed by the horseradish peroxidase-based colorimetric assay.

Chromatin Immunoprecipitation Assay-- Chromatin immunoprecipitation assays were performed with a chromatin immunoprecipitation assay kit (Upstate Biotechnology, Inc.), according to the manufacturer's protocol. Briefly, SK-N-MC cells were incubated with 10 µM sense or antisense oligonucleotides of EWS-Fli1 for 48 h. Formaldehyde was then added to the medium at a final concentration of 1% for 10 min at 37 °C. The cells were harvested, suspended with SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.3)), and incubated on ice for 10 min. Lysates were sonicated, and debris was removed from the samples by centrifugation for 10 min at 10,000 × g. An aliquot of each chromatin solution (40 µl) was set aside and designated as the input fractions. Supernatants were diluted 10-fold in immunoprecipitation buffer and precleared with Sepharose A/G plus agarose beads that had been preabsorbed with salmon sperm DNA. The precleared chromatin solution was incubated with anti-acetylated human H3 or H4 histone or normal rabbit IgG for 16 h at 4 °C. The immune complexes were then collected with the addition of Sepharose A/G plus agarose beads, followed by several washes with appropriate buffers, according to the manufacturer's protocol. Each sample was eluted with freshly prepared 1% SDS and 0.1 M NaHCO3 and then histone-DNA cross-links were reversed with the addition of 5 M NaCl. Chromatin-associated proteins were digested with proteinase K (10 mg/ml), and the immunoprecipitated DNA was recovered by phenol/chloroform extraction and ethanol precipitation and analyzed by PCR. Amplification protocol consisted of 25 cycles at 96 °C for 30 s, 67 °C for 30 s, and 72 °C for 30 s using the primer pair 5'-GGAACTCGGCCAGGCTCAGCTGCTCCGCGC-3' and 5'-GCGAATCCGCGCCCAGCTCCGGCTCCACAAGG-3' to amplify -179 to +44 of the p21WAF1/CIP1 promoter. PCR products were resolved and visualized with ethidium bromide. Images were recorded and quantified using NIH image software.

Cell Growth Analysis-- For the cell growth study, SK-N-MC cells were seeded at a density of 3 × 104 cells in 35-mm culture dishes (Falcon). Two days after the cell preparation, sodium butyrate at various concentrations was added to the media. The number of viable cells in each dish was counted every 24 h for 5 days using trypan blue dye exclusion tests. The cell growth study was carried out in triplicate and repeated at least three times.

RT-PCR-- Two micrograms of total RNA extracted from SK-N-MC cells treated with various concentrations of sodium butyrate were subjected to reverse transcription reaction, using a Ready-to-Go cDNA synthesis kit (Amersham Biosciences). The sequences of the primers used for PCR were described previously (22). PCRs were performed in a final volume of 50 µl for 30 cycles. Each PCR cycle consisted of a heat denaturation step at 94 °C for 1 min, a primer annealing step at 55 °C for 30 s, and an extension step at 72 °C for 1 min. The PCR was performed within the linear range of amplification determined in a preliminary study. The PCR products were analyzed in 1.5% agarose gel (Sigma).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Effects of the Antisense Oligonucleotides on p21WAF1/CIP1 Expression in EFT Tumors in Nude Mice-- We have reported previously (5) that intra-tumor injections of antisense oligonucleotides led to a significant inhibition of EFT tumor growth. Thus, we first examined whether the antisense oligonucleotide treatment could induce p21WAF1/CIP1 expression along with the down-regulation of EWS-Fli1 in vivo. Quantitative PCR analysis showed that, with the down-regulation of EWS-Fli1 mRNA expression, antisense oligonucleotide injections significantly up-regulated the p21WAF1/CIP1 mRNA expression up to ~42-fold over that of the control in a dose-dependent manner (Fig. 1, A and B). Consistent with these data, treatment with 200 nmol of antisense oligonucleotides up-regulated p21 protein expression in the tumor (Fig. 1, C and D). These data indicate that antisense oligonucleotide treatment of the xenografts inhibited EWS-Fli1 expression along with the induction of p21WAF1/CIP1 expression.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of antisense oligonucleotides against EWS-Fli1 on p21WAF1/CIP1 expression in the EFT tumors established in nude mice. SK-N-MC cells were subcutaneously inoculated into nude mice (5 × 106 viable cells/mouse). Seven days later, 100 or 200 nmol of antisense oligonucleotides against EWS-Fli1 were injected into the tumors. Twenty four hours later, the same amounts of oligonucleotides were injected into the tumors. As a control, 200 nmol of sense oligonucleotides were also injected. Twenty four hours after the final inoculations, tumors were excised, and the expression of EWS-Fli1 and p21WAF1/CIP1 was evaluated using quantitative PCR (A and B) and Western blotting (C and D). AS and S represent antisense oligonucleotides and sense oligonucleotides, respectively.

Specific Effect of the Antisense Oligonucleotides on EWS-Fli1-- We next examined the specificity of antisense oligonucleotides of EWS-Fli1 in EFT cell lines. As shown in Fig. 2, antisense oligonucleotides specifically down-regulated EWS-Fli1 and did not alter the expression of other major ETS transcription families, ETS1, ETS2, ERG, and PU.1. Furthermore, endogenous full-length Fli1 and EWS was not detected in all EFT cell lines tested (data not shown). These data indicate that antisense oligonucleotides specifically down-regulate the expression of EWS-Fli1 protein in EFT cells.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 2.   Specific effect of antisense oligonucleotides on EWS-Fli1. EFT cell lines were cultured in the presence of 10 µM sense or antisense oligonucleotides of EWS-Fli1 for 48 h. Total cell lysates were extracted from cells and subjected to Western blot analyses using anti-Fli1, ETS1, ETS2, ERG, PU.1, p21, and actin antibodies. NT, S, and AS represent no treatment, sense oligonucleotide, and antisense oligonucleotide treatment, respectively.

Effect of the Antisense Oligonucleotides on Activities of the p21WAF1/CIP1 Promoter-- In the reporter gene assay, SK-N-MC cells transfected with the p21WAF1/CIP1 promoter-luciferase reporter construct exhibited very low luciferase activity. However, treatment of the cells with antisense oligonucleotides dose-dependently enhanced p21WAF1/CIP1 promoter activities in the cells up to ~3.8-fold that in the sense-treated cells. In other EFT cell lines, PNKT-1 and RD-ES, treatment with antisense oligonucleotides also increased p21WAF1/CIP1 promoter activities up to 3.2- and 2.8-fold compared with findings in sense-treated cells, respectively (Fig. 3B). The expression level of EWS-Fli1 in each EFT cell line varied (5). SK-N-MC cells have the strongest expression of EWS-Fli1 in all cell lines tested, followed by PNKT-1. These data suggest that the effects of antisense oligonucleotides on up-regulation of p21WAF1/CIP1 promoter activity may be due to down-regulation of EWS-Fli1 expression.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Effects of EWS-Fli1 expression on p21WAF1/CIP1 promoter activity. A, diagram of the p21WAF1/CIP1 promoter. The p21WAF1/CIP1 promoter contains two ETS-binding sequences adjacent to the p53 response elements, designated as ETS-binding site 1 and ETS-binding site 2. Ets-binding sites are shown in boldface type, and the p53 response elements are underlined. Numbering of nucleotides was done according to Ref. 18. B, effects of antisense oligonucleotides on the p21WAF1/CIP1 promoter activity. Full-length p21WAF1/CIP1 promoter-reporter construct pGl2-p21-H2320 was transfected into EFT cells. The cells were then challenged with antisense (5 or 10 µM) or sense (10 µM) oligonucleotides for 48 h and harvested for the luciferase assays. NT, S, and AS represent no treatment, sense oligonucleotide, and antisense oligonucleotide treatment, respectively. C, effects of EWS-Fli1 and Fli1 on the p21WAF1/CIP1 promoter activity. pGl2-p21-H2320 was cotransfected with the expression vectors for Fli1, EWS-Fli1-deleted ETS binding domain (Delta Ets) or full-length EWS-Fli1 into Swiss 3T3 cells. The cells were harvested 24 h after the transfection and assayed for luciferase activity. The experiments were repeated at least three times with different plasmid preparations. Bars represent S.E.

Down-regulation of the p21WAF1/CIP1 Promoter Activities by EWS-Fli1 in Swiss 3T3 Cells-- The expression vector of Fli1 (Friend leukemia integration 1) was constructed using pcDNA3.1 (Invitrogen) and then examined for its effect on the p21WAF1/CIP1 promoter activity by cotransfection with full-length p21WAF1/CIP1 promoter-reporter constructs into Swiss 3T3 cells. Enforced expression of Fli1 significantly induced p21WAF1/CIP1 promoter activity, thus indicating that Fli1 might transactivate the p21WAF1/CIP1 gene. On the other hand, EWS-Fli1 cotransfected with the full-length reporter construct reduced promoter activity to 35% that of the control, thereby indicating that the fusion protein down-regulates transcription of the p21WAF1/CIP1 gene (Fig. 3C). As shown in Fig. 3C, the effect of Fli1 on p21WAF1/CIP1 promoter activity correlated with the expression level of Fli1 proteins, whereas the expression levels of EWS-Fli1 inversely correlated with the p21WAF1/CIP1 promoter activity. In addition, this suppression caused by EWS-Fli1 was attenuated by the deletion of the ETS binding domain from EWS-Fli1. This evidence was consistent with the effects of antisense oligonucleotides on activities of the p21WAF1/CIP1 promoter. Taken together, these data strongly suggest that EWS-Fli1 suppresses the p21WAF1/CIP1 promoter activity in EFT cells.

Deletion Analysis of p21WAF1/CIP1 Promoter in SK-N-MC Cell-- To determine the functional role of ETS-binding sequences in the p21WAF1/CIP1 promoter, deletion analysis of the promoter was carried out. Deletion of a 68-bp fragment containing EBS1 from the 5' end of the full-length promoter (pGl2-p21-S2260) resulted in 250% increases in promoter activities in SK-N-MC cells. Solo deletion of an internal fragment of 1874 bp (pGl2-p21-H-N/P), including EBS2, had little effect on the promoter activity. However, deletion of both the 68-bp fragment and the internal fragment (pGl2-p21-S-N/P) increased activity of the promoter to over 5-fold that of the full-length promoter (Fig. 4B).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4.   Effects of deletion and mutation on p21WAF1/CIP1 promoter activity in EFT cells. A, schema of the deletion constructs of the human p21WAF1/CIP1 promoter. White boxes indicate EBS1 and EBS2. H, HindIII; S, SacI; N, NsiI; P, PstI; Sm, SmaI. B, p21WAF1/CIP1 promoter activities from deleted constructs in SK-N-MC cells. SK-N-MC cells were transfected with each deleted promoter-reporter construct and harvested 48 h after the transfection and subjected to luciferase assays. C, sequences of the substitution mutations in Mut-EBS1 and Mut-EBS2 are shown. Ets-binding sites are shown in boldface type, and mutated nucleotides are underlined. D, promoter activity of the mutation constructs with sense or antisense oligonucleotides treatment in SK-N-MC cells. E, effects of EWS-Fli1 and Fli1 on the mutation constructs of p21WAF1/CIP1 promoter. Each mutation construct was cotransfected with the expression vectors for Fli1, EWS-Fli1-deleted ETS binding domain (Delta Ets), or full-length EWS-Fli1 into Swiss 3T3 cells. The cells were harvested 24 h after the transfection and assayed for luciferase activity. These experiments were repeated at least three times with different plasmid preparations. Bars represent S.E.

Mutation Analysis of the p21WAF1/CIP1 Promoter-- Because the p53 gene is truncated in the SK-N-MC cell (23), the influence of p53 on the p21WAF1/CIP1 promoter could be ruled out. However, there remained the possibility that results of the promoter activity analyses using deletion constructs might be affected by deletion of other protein-binding sequences, including p53-binding elements. To examine specific influence of the ETS-binding sites in the p21WAF1/CIP1 promoter, mutation constructs of the p21WAF1/CIP1 promoter were generated as indicated in Fig. 4C. These constructs had mutations only in ETS-binding sites and did not affect p53 bindings (data not shown). We performed mutation analysis of the p21WAF1/CIP1 promoter using these mutated constructs combined with sense or antisense oligonucleotide treatment. With the addition of sense oligonucleotides, results of the mutation analysis of the p21WAF1/CIP1 promoter were almost the same as seen in cases of deletion promoter constructs (Fig. 4D). Mutation in EBS2 alone had little effect on activity of the p21WAF1/CIP1 promoter in SK-N-MC cells. In contrast, mutation in EBS1 enhanced the p21WAF1/CIP1 promoter activity by 205% over that of the control. Moreover, introduction of the mutation in EBS2 clearly enhanced the effect of mutation in EBS1. On the other hand, with antisense oligonucleotide treatment, all of the mutated promoter activity was induced to ~4-5-fold over that of the sense-treated wild type promoter construct, regardless of the sites and numbers of the mutations (Fig. 4D).

We then cotransfected EWS-Fli1, Fli1, or the control vector with each mutation promoter construct in Swiss 3T3 cells and assayed for luciferase activity. EWS-Fli1-transfected Swiss 3T3 showed similar changes with the mutated promoter activity using SK-N-MC cells as shown in Fig. 4E. On the other hand, cotransfection of the mock vector with all sets of mutated promoter constructs did not change their promoter activities. Mutation of EBS1 resulted in a 68% decrease in promoter activities in the Fli1-transfected Swiss 3T3. Solo mutation of EBS2 had little effect on the promoter activity. However, mutation of both ETS-binding sites attenuated the effect of the Fli1 transfection and reduced its activity to the same as the mock transfected-H2320 (Fig. 4E).

These data strongly suggest that both EWS-Fli1 and Fli1 specifically affect p21WAF1/CIP1 promoter activity through both ETS-binding sites with converse effects.

Direct Binding of EWS-Fli1 to ETS-binding Sites in the p21WAF1/CIP1 Promoter-- Many transcription factors bind DNA in a sequence-specific manner. Because the ETS DNA binding domain of Fli1 remains intact in all types of EWS-Fli1 fusion proteins (1), we hypothesized that EWS-Fli1 fusion protein might directly bind the ETS-binding sites in the p21WAF1/CIP1 promoter, resulting in the suppression of p21WAF1/CIP1 expression. To confirm this hypothesis, EMSAs were performed. As shown in Fig. 5, A and B, EMSAs demonstrated that proteins in SK-N-MC nuclear extracts bound to both of the ETS-binding sites in the p21WAF1/CIP1 promoter. This protein-DNA binding disappeared when EMSA was performed using nuclear extracts from the antisense oligonucleotide-treated SK-N-MC cells. In addition, this binding was also greatly attenuated by addition of the Fli1 antibody, which disrupts the binding capacity of EWS-Fli1 fusion protein, whereas addition of a normal immunoglobulin showed no effect on the protein binding. In competition binding assays, a molar excess of unlabeled wild type sequences inhibited the protein-DNA complex formation, whereas cold sequences harboring mutations at ETS-binding sites did not affect the binding. These data strongly suggested that the EWS-Fli1 protein binds directly to the p21WAF1/CIP1 promoter at the ETS-binding sites in a sequence-specific manner.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5.   The binding of EWS-Fli1 to ETS binding consensus sequences in the p21WAF1/CIP1 promoter. A, gel shift assay was done, as described under the "Experimental Procedures," using labeled oligonucleotides containing EBS1 and nuclear extracts from SK-N-MC cells. The arrow indicates the EWS-Fli1 protein-DNA complexes. The arrowhead represents free probes. B, a gel shift analysis was done using labeled oligonucleotides containing EBS2 as described in A. wt, wild type; mt, mutant.

Interaction between EWS-Fli1 and p300 in Vivo-- We next explored the mechanism of p21WAF1/CIP1 down-regulation by EWS-Fli1. p300/CBP is a transcriptional coactivator known to interact both with a wide variety of transcription factors and with components of the basal transcriptional machinery, including PCAF, TBP, TFIIB, TFIIE, and TFIIF (24). With regard to the regulation of p21WAF1/CIP1 expression, p300/CBP cooperates with Sp1 and/or Sp3 and up-regulates p21WAF1/CIP1 transcriptions (25). Furthermore, Fujimura et al. (26) have shown that EWS-ATF1, a fusion protein detected in the clear cell sarcoma, associates with p300/CBP and interferes with its function. These studies prompted us to determine whether EWS-Fli1 might also associate with p300/CBP and alter its function, resulting in the negative regulation of p21WAF1/CIP1 transcription. To demonstrate the interaction between EWS-Fli1 and p300, we performed in vivo coimmunoprecipitation assays. As shown in Fig. 6A, endogenous p300 coprecipitated with endogenous EWS-Fli1. Furthermore, ectopic expression of HA-tagged p300 coprecipitated with FLAG-tagged EWS-Fli1 (Fig. 6B). However, we detected no interaction between FLAG-tagged full-length Fli1 and HA-tagged p300 (data not shown). These data demonstrate that EWS-Fli1, in contrast to Fli1, might bind to p300 and form complexes in EFT cells. Thus, it is conceivable that EWS-Fli1 might down-regulate p21 through the modulation of p300 functions. Immunofluorescence of Swiss 3T3 cells, cotransfected with FLAG-EWS-Fli1 and HA-p300, were detected using anti-FLAG-Cy3 and anti-HA-FITC. As shown in Fig. 6C, we found that FLAG-EWS-Fli1 colocalizes with HA-p300 in the nucleus. These results also support the idea that EWS-Fli1 interacts with p300/CBP in vivo.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 6.   Interaction of EWS-Fli1 with p300 in vivo. A, nuclear extracts of SK-N-MC cells were immunoprecipitated (IP) with IgG, p300, or Fli1 antibodies. WB, Western blot. The immunoprecipitated proteins were separated in a 4-12% gradient gel and blotted with either Fli1 or p300 polyclonal antibodies. N.E. represents 10% of input of the nuclear extract. B, Swiss 3T3 cells were cotransfected with FLAG-tagged EWS-Fli1 and HA-tagged p300. Nuclear extracts were prepared 48 h after the transfections and immunoprecipitated with either IgG, anti-FLAG, or anti-HA antibodies. Each immunoprecipitated protein was electrophoresed and blotted with either anti-FLAG antibodies or anti-HA antibodies. C, localization of EWS-Fli1 and p300 in vivo. Swiss 3T3 cells were cotransfected with FLAG-tagged EWS-Fli1 and HA-tagged p300 on coverslips. Immunofluorescence was done using anti-FLAG-Cy3 and anti-HA-FITC 48 h after the transfections. a, FLAG-EWS-Fli1 (red); b, HA-FITC; c, both images were merged. Nucleus was counter-stained with 4,6-diamidino-2-phenylindole (DAPI).

EWS-Fli1 Inhibits the p300-mediated Transactivation of the p21WAF1/CIP1 Gene-- To examine the functional interaction between EWS-Fli1 and p300, we studied the effect of EWS-Fli1 and p300 on the activity of the p21WAF1/CIP1 promoter in Swiss 3T3 cells. The expression vector for p300 was cotransfected with the p21WAF1/CIP1 promoter-reporter construct and expression vector for EWS-Fli1 or Fli1 protein. As shown in Fig. 7A, EWS-Fli1 strongly suppressed the p300-mediated transactivation of the p21WAF1/CIP1 promoter in a dose-dependent manner. Furthermore, increasing amounts of p300 abolished the inhibitory effect of EWS-Fli1, suggesting that EWS-Fli1 might suppress p21WAF1/CIP1 promoter activity via p300-dependent mechanism. On the other hand, overexpression of p300 did not modulate the Fli1-mediated up-regulation of the p21WAF1/CIP1 promoter activity, and Fli1 could not override the p300-mediated enhancement of p21WAF1/CIP1 transcription (Fig. 7B). Taken together, these experiments provide the evidence that p300 and Fli1 might enhance the p21WAF1/CIP1 promoter activity independently.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   A, inhibition of p300-mediated activity of the p21WAF1/CIP1 promoter by EWS-Fli1. Swiss 3T3 cells were transiently transfected with 1 µg of the reporter construct H2320 along with EWS-Fli1 and p300 expression vectors. The cells were harvested 24 h after the transfection and assayed for luciferase activity. These experiments were repeated at least three times with different plasmid preparations. Bars represent S.E. B, Swiss 3T3 cells were transiently transfected with 1 µg of the reporter construct H2320 along with Fli1 and p300 expression vectors. The cells were harvested 24 h after the transfection and assayed for luciferase activity. These experiments were repeated at least three times with different plasmid preparations. Bars represent S.E. A Renilla luciferase expression vector, RL-SV40, was used as an internal control for transfection efficiency.

To confirm the possibility that EWS-Fli1 acts as a repressor of p300, we examined whether forced expression of p300 could restore the activity of the p21WAF1/CIP1 promoter in EFT cells. As illustrated in Fig. 8, ectopic expression of p300 dramatically up-regulated the p21WAF1/CIP1 promoter activities in all EFT cells tested in a dose-dependent manner, suggesting that the excess of p300 might not be interfered with by EWS-Fli1 and may restore p21WAF1/CIP1 expression. In addition, Western blot analyses showed that p21 protein expressions were increased by the forced expression of p300 protein. These findings suggest that the balance of the expression level between p300 and EWS-Fli1 might control the p21WAF1/CIP1 transcription in EFT cells.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of p300 overexpression on p21WAF1/CIP1 promoter activity in EFT. EFT cells were transiently cotransfected with 1 µg of the reporter construct H2320 and p300 expression vector or control vector. Forty eight hours after the transfection, cells were harvested and subjected to luciferase activity assay and Western blotting (WB).

Repression of p300-mediated Histone Deacetylation Activity by EWS-Fli1-- p300/CBP is known to form a large complex with other basal transcription factors, and it transactivates various target genes including p21WAF1/CIP1 through the acetylation of histone tails of the nucleosomes. Therefore, we next examined the effect of EWS-Fli1 on the histone acetyltransferase (HAT) activity of p300, PCAF, and TAF II p250. The HAT activity of p300 was determined by in vitro acetylation of the core histone with the endogenous p300, immunoprecipitated from nuclear extracts of SK-N-MC cells or mouse embryonal fibroblast transfected with various doses of EWS-Fli1, Fli1, or EWS-Fli1 deleted with the ETS binding domain (Delta Ets). In the presence of the antisense oligonucleotides, p300 precipitants exhibited ~3.2-fold HAT activity compared with that of the sense-treated immunoprecipitants (Fig. 9B), whereas antisense or sense oligonucleotide treatment did not modify the expression of p300, PCAF, or TAFII p250 in EFT cell lines (Fig. 9A). Furthermore, the overexpression of EWS-Fli1 dose-dependently inhibited the p300-mediated HAT activity in Swiss 3T3 cells, whereas Fli1 and Delta Ets did not modify the p300-mediated HAT activity (Fig. 9C). As for the activities of another major histone acetyltransferase, PCAF were slightly enhanced by the antisense oligonucleotide treatment. On the other hand, TAFII p250-mediated HAT activity was not influenced by EWS-Fli1 (Fig. 9B). This evidence strongly indicates that EWS-Fli1 might bind to the ETS-binding consensus sequences in the p21WAF1/CIP1 promoter and inhibits the acetyltransferase activity of p300, which may partly explain the negative regulation of p21WAF1/CIP1 in EFT cells. On the other hand, Fli1 does not modify the p300-mediated HAT activity, which is in line with the fact that Fli1 does not associate with p300. Thus, Fli1 might transactivate p21WAF1/CIP1 expression unrelated to the HAT activity of p300.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 9.   Suppression of the p300-mediated histone acetyltransferase activity by EWS-Fli1. A, EFT cell lines were cultured in the presence of 10 µM sense or antisense oligonucleotides of EWS-Fli1 for 48 h. Total cell lysates were extracted from cells and subjected to Western blot analyses using antibodies to p300, PCAF, and TAFII p250. NT, S, and AS represent no treatment, sense oligonucleotide, and antisense oligonucleotide treatment, respectively. B, SK-N-MC cells were treated with 10 µM sense or antisense oligonucleotides of EWS-Fli1 for 48 h. Nuclear extracts of each sample were immunoprecipitated with anti-p300, anti-PCAF, or anti-TAFII p250 monoclonal antibody, and then each was subjected to histone acetyltransferase (HAT) activity assays, as described under "Experimental Procedures." C, each nuclear extract from Swiss 3T3 cells transfected with mock, EWS-Fli1, Fli1, or Delta Ets was subjected to p300-immunoprecipitated HAT activity assays. These experiments were repeated at least three times. Bars represent S.E.

To assess directly whether the suppression of p21WAF1/CIP1 by EWS-Fli1 correlates with changes in the status of histone acetylation in EFT cells, we next performed chromatin immunoprecipitation assays using antibodies to acetylated histone H3 or H4. As shown in Fig. 10A, acetylated chromatin was increased by antisense oligonucleotide treatment compared with that of the sense oligonucleotide treatment. We also found that antisense treatment significantly increased the acetylation status of both H3 and H4 histone on the p21WAF1/CIP1 promoter (Fig. 10B). Taken together, these data strongly indicate that EWS-Fli1 inhibits p21WAF1/CIP1 gene expression via modulation of acetylation status of endogenous p21WAF1/CIP1 gene in EFT cells.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 10.   EWS-Fli1 modifies histone acetylation status on p21WAF1/CIP1 gene. A, Western blot (WB) analysis of acetylated histone H3 (AcH3) and H4 (AcH4) in SK-N-MC cells. The antisense oligonucleotides up-regulate the acetylation status of histone H3 and H4. B, relative histone acetylation levels were determined by quantification of Western blot images shown in A using NIH Image software and by correction with the internal control (actin). The data were represented as ratios of relative acetylation of H3 or H4 in the presence of antisense (AS) or sense (S) oligonucleotides versus the absence of oligonucleotide treatment (NT). C, representative data of chromatin immunoprecipitation assay. Soluble chromatin preparation from cell cultures treated with sense or antisense oligonucleotides were immunoprecipitated with the antibody against acetylated histone H3 (Ac-H3), H4 (Ac-H4), or normal rabbit immunoglobulin (IgG) and analyzed by PCR. Aliquots of the chromatin were also analyzed before immunoprecipitation (Input). D, the relative acetylation status of histone on the p21WAF1/CIP1 gene was determined by quantification of the PCR product shown in C using NIH Image software and by correction with the input data. Each column represents a ratio of relative acetylation of H3 or H4 in the presence of antisense (AS) or sense (S) oligonucleotides versus the absence of oligonucleotide treatment (NT).

Inhibition of the Proliferation of SK-N-MC Cells by Sodium Butyrate-- Recently, it has been revealed that histone deacetylase inhibitors (HDACIs), including sodium butyrate, can induce p21WAF1/CIP1 expression and inhibit G1-S phase transition, resulting in growth arrest and differentiation of various malignant tumor cell lines (27-30). As EWS-Fli1 interferes p300-mediated HAT activities, we herein examined the effect of sodium butyrate on the proliferation of SK-N-MC cells. After application of various concentrations of butyrate, the number of viable cells was determined using trypan blue at various time intervals. As shown in Fig. 11A, the growth inhibitory effect of butyrate was dose-dependent in the range of 0.625 to 5 mM. The cell viability was not significantly affected by butyrate treatment in this range of concentration. However, 10 mM butyrate was to the same extent cytocidal as reported previously (31) using other cell lines.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 11.   Effect of sodium butyrate on p21WAF1/CIP1 expression, histone acetylation activity, and growth of SK-N-MC cells. A, effects of sodium butyrate on growth of SK-N-MC cells. Various concentrations of butyrate were applied to SK-N-MC cells. After various time intervals, the number of viable cells was counted using trypan blue. The growth inhibitory effect of butyrate was dose-dependent in the range of 0.625-5 mM of the concentration. Closed circles, control; open circles, 0.625 mM; closed squares, 1.25 mM; open squares, 5 mM. Bars represent S.E. B, SK-N-MC cells were treated with various concentrations of butyrate. mRNA and total cell lysates were extracted from cells and subjected to RT-PCR and Western blot analyses. C, the time course study of sodium butyrate treatment on SK-N-MC cells. SK-N-MC cells were treated with 5.0 mM butyrate. mRNA and total cell lysates were extracted from the cells and subjected to RT-PCR and Western blot analyses. D, SK-N-MC cells were incubated with 10 µM sense or antisense oligonucleotides or various doses of sodium butyrate. Forty eight hours after the treatment, nuclear extracts of each sample were subjected to assay for histone acetylation activity.

Induction of p21WAF1/CIP1 mRNA and Protein Expression in SK-N-MC Cells by Sodium Butyrate-- To determine whether butyrate-induced growth arrest of EFT cells was related to the p21WAF1/CIP1 expression, the butyrate-treated cells were subjected to RT-PCR and Western blot analyses. In untreated SK-N-MC cells, p21WAF1/CIP1 expression was too weak to be detected (Fig. 11B, 2nd lane), as we reported previously (6). However, treatment of cells with butyrate for 24 h induced p21WAF1/CIP1 expression in a dose-dependent manner both at mRNA and protein levels (Fig. 11B), in accordance with the finding that butyrate dose-dependently inhibited the growth of SK-N-MC cells. In the time course study, 5.0 mM butyrate induced p21WAF1/CIP1 mRNA and protein expression within 6 h after the treatment, and the expression levels reached a plateau at around 24 h (Fig. 11C). On the other hand, butyrate did not induce expression of other major cyclin-dependent kinase inhibitors, including p27KIP1 and p16INK4A. Furthermore, application of sodium butyrate did not modify the expression of cyclin D, cyclin E, nor EWS-Fli1 itself (data not shown). Therefore, treatment with sodium butyrate specifically enhances p21WAF1/CIP1 expression both at mRNA and protein levels, which may partly explain the growth inhibitory effect of sodium butyrate on SK-N-MC cells.

Effect of Sodium Butyrate on the HAT Activity in EFT Cells-- Because EWS-Fli1 suppressed the p300-mediated HAT activity in EFT cells, we then investigated whether the application of HDACIs could restore the balance of HAT and HDAC in EFT cells. Nuclear extracts of SK-N-MC cells, treated with antisense or sense oligonucleotides against EWS-Fli1 or each dose of sodium butyrate, were incubated with histone H3 peptide and acetyl-CoA. Then acetylated histone H3 was examined using indirect enzyme-linked immunosorbent assay kits. As shown in Fig. 11D, the antisense oligonucleotide treatment up-regulated the overall HAT activity in SK-N-MC cells to ~3.8-fold over that of the control. Sodium butyrate also dose-dependently enhanced HAT activity in SK-N-MC cells up to 8.5-fold over that of the control, meaning HDACIs could rescue hypoacetylation status in EFT cells. Taken together, these findings strongly support the idea that HDACIs could serve as novel molecularly based drugs for EFTs.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The EWS-Fli1 fusion product is considered to affect the expression of cell cycle-regulating molecules involved in the control of G1-S transition (5, 6). Among these molecules, the expression of p21 was not detected in EFT clinical samples (6). On the other hand, it has been reported that EFT usually expresses wild type p53 despite highly malignant phenotypes of the tumor (23, 32). This contradiction led us to determine whether EWS-Fli1 fusion protein might affect the p21WAF1/CIP1 promoter activity through a p53-independent pathway.

The cell cycle checkpoints play crucial roles in the maintenance of cell homeostasis. Disruption of cell cycle control mechanisms leads to malignant transformation. Recent intense studies (33, 34) on cell cycle regulation have revealed that p21 modulates cyclin-dependent kinase activity and causes cell cycle arrest at the G1 phase (9), which allows for damaged DNA to be repaired before entering S phase. Despite the important roles of p21 as a cell cycle regulator (35), inactivating mutations of this gene are rare in tumor cells, and p21WAF1/CIP1 knock-out mice did not exhibit increased rates of spontaneous tumor until at least 7 months of age (36). Therefore, the potential role of p21WAF1/CIP1 in tumor development has remained controversial. Recently, however, Martin-Caballero et al. (37) showed that p21WAF1/CIP1-deficient mice have spontaneous tumors at an average age of 16 months, whereas control animals remain tumor-free for over 2 years. Furthermore, several studies (38, 39) demonstrate that down-regulation of p21 leads to the anchorage-independent growth of tumor cells, which may partly explain the role of p21 in tumor development. These findings are consistent with the recent findings that the ETS binding domain of EWS-Fli1 is necessary for promotion of the anchorage-independent growth of EFT cells (40).

The main finding of this study is that the fusion transcription factor EWS-Fli1 directly associates with the p21WAF1/CIP1 gene promoter through ETS-binding sites and suppresses p21WAF1/CIP1 expression. Despite cumulating evidence indicating that EWS-Fli1 might transform cells by acting as an aberrant transcription factor, only a few target genes have been identified, including manic fringe (41), EWS-Fli1-activated transcript-2 (EAT-2) (42), and mE2-C (a cyclin-selective ubiquitin-conjugating enzyme) (43). Hahm (44) showed that the transforming growth factor-beta II receptor was found to be directly down-regulated by EWS-Fli1 fusion protein. We obtained evidence that p21WAF1/CIP1 promoter activity is clearly suppressed by EWS-Fli1 through the two known ETS-binding sequences in the promoter. EMSAs revealed that EWS-Fli1 fusion protein directly binds to both the ETS-binding sites in a sequence-specific manner. The upstream ETS-binding site on the p21WAF1/CIP1 promoter (EBS1) seemed to be more important in suppressing p21WAF1/CIP1 expression, but the downstream ETS-binding site (EBS2) had the potential to enhance the suppression. These data indicate that p21WAF1/CIP1 is one of the direct targets of EWS-Fli1 fusion protein. This direct inhibition of the p21WAF1/CIP1 expression by EWS-Fli1 may explain, at least in part, the transforming potential of EWS-Fli1. Down-regulation of the transforming growth factor-beta II receptor by EWS-Fli1 (44) may indirectly affect p21WAF1/CIP1 expression in EFT cells. However, in our study, the down-regulation of EWS-Fli1 did not affect the expression of the transforming growth factor-beta II receptor in SK-N-MC, PNKT-1, and RD-ES (data not shown).

Transcriptional regulation plays crucial roles in carcinogenesis, and gene regulation is mediated through a balance between activator and repressor factors. Several models for the negative regulatory mechanisms have been proposed (e.g. competition, quenching, and direct repression of the transcription complex). However, compared with transcriptional activation, precise mechanisms involved in transcriptional repression are poorly understood. In case of negative regulation of the p21WAF1/CIP1 promoter, both ETS-binding consensus sequences are located so close to p53-binding elements that the competitive binding of EWS-Fli1 with p53 might explain the inhibition of p21WAF1/CIP1 expression. However, EFT cell lines including SK-N-MC and RD-ES, which we used in the present experiments, have truncation or mutation in the p53 gene (23). Thus, we concluded that this model of negative regulation is unlikely. Furthermore, the expression of endogenous Fli1 was not detectable in EFT cell lines used in the experiments. There is little possibility that inhibition of p21WAF1/CIP1 expression by EWS-Fli1 is due to the dominant-negative effect against Fli1. On the other hand, a variety of factors were reported to form complexes and activate or repress transcription of p21WAF1/CIP1 (45, 46). Therefore, we presumed that EWS-Fli1 might associate with other transcription factors or cofactors, resulting in the negative regulation of p21WAF1/CIP1 transcription. One of the mechanisms of transcriptional repression involves inhibition of transcriptional cofactors such as p300/CBP and PCAF through modulation of acetyltransferase activities (47). Deacetylation of histones prevents disassembly of nucleosomes, which makes DNAs inaccessible to transcriptional activators (47). p300/CBP has HAT activity and acetylates the target chromatin and/or transcriptional factors to facilitate a transcriptional response (10, 12). Furthermore, recent studies (26, 48) revealed that EWS-ATF1 and SYT-SSX chimeric protein, associated with clear cell sarcoma and synovial sarcoma, respectively, interacts with p300/CBP and obliterates its functions. The COOH-terminal region of EWS, which is truncated in EWS-Fli1, has been shown to form a complex with p300/CBP and function as a transcriptional activator in conjunction with p300/CBP (49). However, they only showed the interactions of p300/CBP with EWS deletion constructs and not with EWS-Fli1 constructs. The COOH terminus of Fli1 might modulate the conformation of EWS protein and enable EWS-Fli1 to associate with p300/CBP. More recently, Araya et al. (50) demonstrated that CBP interacts with the NH2-terminal domain of EWS, which is retained in the EWS-Fli1 fusion protein. Hence, we hypothesized that EWS-Fli1 might associate with p300/CBP, resulting in the repression of p300-mediated HAT activity, which explains the mechanism of p21WAF1/CIP1 suppression by EWS-Fli1. The coimmunoprecipitation and immunofluorescence assays revealed that EWS-Fli1 interacts with p300 in vivo. EWS-Fli1 inhibited p300-mediated activation of the p21WAF1/CIP1 promoter in the Swiss 3T3 cell. Overexpression of p300 in EFT cell lines enhanced the activity of the p21WAF1/CIP1 promoter and the expression of p21 protein, indicating that EWS-Fli1 might inhibit the p300-mediated activation of the p21WAF1/CIP1 promoter in EFT cells. Furthermore, histone acetyltransferase activity assays revealed that EWS-Fli1 suppressed the p300-mediated HAT activity in vitro. Similar mechanisms were observed in E1A and ETS family oncoprotein PU.1, which inhibits acetyltransferase activity of p300 and CBP, respectively (51, 52). PCAF-mediated HAT activity was slightly suppressed by EWS-Fli1. This may be explained by the interaction between p300/CBP and PCAF (12). By using chromatin immunoprecipitation assays, we also demonstrated that the acetylation of histone on the endogenous p21WAF1/CIP1 gene was suppressed by EWS-Fli1 in EFT cells. This evidence indicates that EWS-Fli1 interacts with p300/CBP and inhibits the acetyltransferase activity of p300, which may partly explain the negative regulation of p21WAF1/CIP1 in EFT cells.

Despite the advances in multimodal therapy or application of high dose chemotherapy followed by peripheral blood stem cell transfusion techniques (53), the 5-year survival rate of metastatic cases of EFT is still below 30% (54). Several gene-targeting therapies have been considered for this highly malignant tumor, including the introduction of virus vector encoding antisense-EWS-Fli1 or treatment of antisense oligonucleotides against EWS-Fli1 (4, 5). However, the use of a virus has to overcome a number of obstacles including development of reproducible procedures for the efficient and safe delivery of the virus to the cells and tissues. Although the antisense oligonucleotide treatment would be beneficial, the therapy requires huge amounts of oligonucleotides. Recently, there have been intense studies on HDACIs, which remodel chromatin structures through the inhibition of intrinsic HDACs. HDACIs can reactivate gene expression and inhibit the growth and survival of tumor cells, and most HDACIs induce p21WAF1/CIP1 expression through the Sp1 and/or Sp3 sites in its promoter (31, 55). Because EWS-Fli1 protein directly down-regulates the expression of p21WAF1/CIP1 at the promoter level, agents activating the p21WAF1/CIP1 promoter may prove effective for molecular targeting therapies against EFTs. Furthermore, because EWS-Fli1 inhibits the p300-mediated HAT activity, application of HDACIs could restore a balance between HAT and HDAC activities in EFT cells. Therefore, we first examined the effect of sodium butyrate, one of the HDACIs, on the proliferation of EFT cells in vitro. The proliferation of SK-N-MC cells was greatly inhibited by sodium butyrate in a dose-dependent manner. The treatment of sodium butyrate also induced expression of p21WAF1/CIP1 both at mRNA and protein levels in SK-N-MC cells. Furthermore, HAT activity, which was suppressed by EWS-Fli1, was counterbalanced by treatment with sodium butyrate. We have also proved that HDACIs have anti-tumor activities on EFT in vivo (data not shown). These findings underscore the potential of HDACIs as promising agents for the treatment of EFT.

In conclusion, we demonstrated that EWS-Fli1 fusion protein directly binds to the p21WAF1/CIP1 promoter through ETS-binding sites and negatively regulates p21WAF1/CIP1 gene expression by inhibiting p300-mediated HAT activity. This novel mechanism may partly explain the unlimited growth of EFT cells in the presence of EWS-Fli1 fusion protein.

    ACKNOWLEDGEMENT

We thank Christopher T. Denny for the pFLAG-CMV-EWS-Fli1 construct.

    FOOTNOTES

* This work was supported by Grants-in-aid for Scientific Research 14207057 and 12557125 from the Japan Society for the Promotion of Science, a grant-in-aid for Cancer Research from the Ministry of Health, Labor, and Welfare, Japan, and a grant-in-aid for cancer research from the Fukuoka Cancer Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Orthopedic Surgery, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Tel.: 81-92-642-5488; Fax: 81-92-642-5507; E-mail: tanaka@ortho.med.kyushu-u.ac.jp.

Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M211470200

    ABBREVIATIONS

The abbreviations used are: EFT, Ewing's family tumors; ES, Ewing's sarcoma; CBP, CREB-binding protein; PBS, phosphate-buffered saline; RT, reverse transcriptase; MOPS, 4-morpholinepropanesulfonic acid; EMSA, electromobility shift assay; HA, hemagglutinin; FITC, fluorescein isothiocyanate; HDACIs, histone deacetylase inhibitors; HDAC, histone deacetylase; HAT, histone acetyltransferase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Delattre, O., Zucman, J., Plougastel, B., Desmaze, C., Melot, T., Peter, M., Kovar, H., Joubert, I., de Jong, P., Rouleau, G., Aurias, A., and Thomas, G. (1992) Nature 359, 162-165[CrossRef][Medline] [Order article via Infotrieve]
2. May, W. A., Lessnick, S. L., Braun, B. S., Klemsz, M., Lewis, B. C., Lunsford, L. B., Hromas, R., and Denny, C. T. (1993) Mol. Cell. Biol. 13, 7393-7398[Abstract/Free Full Text]
3. May, W. A., Gishizky, M. L., Lessnick, S. L., Lunsford, L. B., Lewis, B. C., Delattre, O., Zucman, J., Thomas, G., and Denny, C. T. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 5752-5756[Abstract/Free Full Text]
4. Ouchida, M., Ohno, T., Fujimura, Y., Rao, V. N., and Reddy, E. S. (1995) Oncogene 11, 1049-1054[Medline] [Order article via Infotrieve]
5. Tanaka, K., Iwakuma, T., Harimaya, K., Sato, H., and Iwamoto, Y. (1997) J. Clin. Invest. 99, 239-247[Medline] [Order article via Infotrieve]
6. Matsumoto, Y., Tanaka, K., Nakatani, F., Matsunobu, T., Matsuda, S., and Iwamoto, Y. (2001) Br. J. Cancer 84, 768-775[CrossRef][Medline] [Order article via Infotrieve]
7. Xiong, Y., Hannon, G. J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D. (1993) Nature 366, 701-704[CrossRef][Medline] [Order article via Infotrieve]
8. Gartel, A. L., Serfas, M. S., and Tyner, A. L. (1996) Proc. Soc. Exp. Biol. Med. 213, 138-149[CrossRef][Medline] [Order article via Infotrieve]
9. el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817-825[CrossRef][Medline] [Order article via Infotrieve]
10. Bannister, A. J., and Kouzarides, T. (1996) Nature 384, 641-643[CrossRef][Medline] [Order article via Infotrieve]
11. Munshi, N., Merika, M., Yie, J., Senger, K., Chen, G., and Thanos, D. (1998) Mol. Cell 2, 457-467[CrossRef][Medline] [Order article via Infotrieve]
12. Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H., and Nakatani, Y. (1996) Cell 87, 953-959[CrossRef][Medline] [Order article via Infotrieve]
13. Macleod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein, B., and Jacks, T. (1995) Genes Dev. 9, 935-944[Abstract/Free Full Text]
14. Funaoka, K., Shindoh, M., Yoshida, K., Hanzawa, M., Hida, K., Nishikata, S., Totsuka, Y., and Fujinaga, K. (1997) Biochem. Biophys. Res. Commun. 236, 79-82[CrossRef][Medline] [Order article via Infotrieve]
15. Tanaka, K., Iwamoto, Y., Noguchi, Y., Oda, Y., and Sugioka, Y. (1995) Lab. Invest. 72, 237-248[Medline] [Order article via Infotrieve]
16. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996) Genome Res. 6, 986-994[Abstract/Free Full Text]
17. Tanaka, K., Iwamoto, Y., Ito, Y., Ishibashi, T., Nakabeppu, Y., Sekiguchi, M., and Sugioka, Y. (1995) Cancer Res. 55, 2927-2935[Abstract/Free Full Text]
18. el-Deiry, W. S., Tokino, T., Waldman, T., Oliner, J. D., Velculescu, V. E., Burrell, M., Hill, D. E., Healy, E., Rees, J. L., Hamilton, S. R., Kinzler, K. W., and Vogelstein, B. (1995) Cancer Res. 55, 2910-2919[Abstract/Free Full Text]
19. Okamoto, T., Izumi, H., Imamura, T., Takano, H., Ise, T., Uchiumi, T., Kuwano, M., and Kohno, K. (2000) Oncogene 19, 6194-6202[CrossRef][Medline] [Order article via Infotrieve]
20. Beier, F., Taylor, A. C., and LuValle, P. (1999) J. Biol. Chem. 274, 30273-30279[Abstract/Free Full Text]
21. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
22. Wong, H., and Riabowol, K. (1996) Exp. Gerontol. 31, 311-325[CrossRef][Medline] [Order article via Infotrieve]
23. Kovar, H., Auinger, A., Jug, G., Aryee, D., Zoubek, A., Salzer-Kuntschik, M., and Gadner, H. (1993) Oncogene 8, 2683-2690[Medline] [Order article via Infotrieve]
24. Goodman, R. H., and Smolik, S. (2000) Genes Dev. 14, 1553-1577[Free Full Text]
25. Xiao, H., Hasegawa, T., and Isobe, K. (2000) J. Biol. Chem. 275, 1371-1376[Abstract/Free Full Text]
26. Fujimura, Y., Siddique, H., Lee, L., Rao, V. N., and Reddy, E. S. (2001) Oncogene 20, 6653-6659[CrossRef][Medline] [Order article via Infotrieve]
27. Leder, A., and Leder, P. (1975) Cell 5, 319-322[CrossRef][Medline] [Order article via Infotrieve]
28. Graham, K. A., and Buick, R. N. (1988) J. Cell. Physiol. 136, 63-71[CrossRef][Medline] [Order article via Infotrieve]
29. Saito, H., Morizane, T., Watanabe, T., Kagawa, T., Miyaguchi, S., Kumagai, N., and Tsuchiya, M. (1991) Int. J. Cancer 48, 291-296[Medline] [Order article via Infotrieve]
30. Dong, Q. G., Gong, L. L., Wang, H. J., and Wang, E. Z. (1993) Anti-Cancer Drugs 4, 617-627[Medline] [Order article via Infotrieve]
31. Nakano, K., Mizuno, T., Sowa, Y., Orita, T., Yoshino, T., Okuyama, Y., Fujita, T., Ohtani-Fujita, N., Matsukawa, Y., Tokino, T., Yamagishi, H., Oka, T., Nomura, H., and Sakai, T. (1997) J. Biol. Chem. 272, 22199-22206[Abstract/Free Full Text]
32. de Alava, E., Antonescu, C. R., Panizo, A., Leung, D., Meyers, P. A., Huvos, A. G., Pardo-Mindan, F. J., Healey, J. H., and Ladanyi, M. (2000) Cancer (Phila.) 89, 783-792[CrossRef]
33. Ko, L. J., and Prives, C. (1996) Genes Dev. 10, 1054-1072[Free Full Text]
34. Sherr, C. J. (1996) Science 274, 1672-1677[Abstract/Free Full Text]
35. Sherr, C. J., and Roberts, J. M. (1999) Genes Dev. 13, 1501-1512[Free Full Text]
36. Deng, C., Zhang, P., Harper, J. W., Elledge, S. J., and Leder, P. (1995) Cell 82, 675-684[CrossRef][Medline] [Order article via Infotrieve]
37. Martin-Caballero, J., Flores, J. M., Garcia-Palencia, P., and Serrano, M. (2001) Cancer Res. 61, 6234-6238[Abstract/Free Full Text]
38. Fang, F., Orend, G., Watanabe, N., Hunter, T., and Ruoslahti, E. (1996) Science 271, 499-502[Abstract]
39. Wu, R. C., and Schonthal, A. H. (1997) J. Biol. Chem. 272, 29091-29098[Abstract/Free Full Text]
40. Welford, S. M., Hebert, S. P., Deneen, B., Arvand, A., and Denny, C. T. (2001) J. Biol. Chem. 276, 41977-41984[Abstract/Free Full Text]
41. May, W. A., Arvand, A., Thompson, A. D., Braun, B. S., Wright, M., and Denny, C. T. (1997) Nat. Genet. 17, 495-497[CrossRef][Medline] [Order article via Infotrieve]
42. Thompson, A. D., Braun, B. S., Arvand, A., Stewart, S. D., May, W. A., Chen, E., Korenberg, J., and Denny, C. (1996) Oncogene 13, 2649-2658[Medline] [Order article via Infotrieve]
43. Arvand, A., Bastians, H., Welford, S. M., Thompson, A. D., Ruderman, J. V., and Denny, C. T. (1998) Oncogene 17, 2039-2045[CrossRef][Medline] [Order article via Infotrieve]
44. Hahm, K. B. (1999) Nat. Genet. 23, 481[Medline] [Order article via Infotrieve]
45. Gartel, A. L., and Tyner, A. L. (1999) Exp. Cell Res. 246, 280-289[CrossRef][Medline] [Order article via Infotrieve]
46. Fang, J. Y., and Lu, Y. Y. (2002) World J. Gastroenterol. 8, 400-405[Medline] [Order article via Infotrieve]
47. Hamamori, Y., Sartorelli, V., Ogryzko, V., Puri, P. L., Wu, H. Y., Wang, J. Y., Nakatani, Y., and Kedes, L. (1999) Cell 96, 405-413[CrossRef][Medline] [Order article via Infotrieve]
48. Eid, J. E., Kung, A. L., Scully, R., and Livingston, D. M. (2000) Cell 102, 839-848[CrossRef][Medline] [Order article via Infotrieve]
49. Rossow, K. L., and Janknecht, R. (2001) Cancer Res. 61, 2690-2695[Abstract/Free Full Text]
50. Araya, N., Hirota, K., Shimamoto, Y., Miyagishi, M., Yoshida, E., Ishida, J., Kaneko, S., Kaneko, M., Nakajima, T., and Fukamizu, A. (2002) J. Biol. Chem. 278, 5427-5432[Medline] [Order article via Infotrieve]
51. Chakravarti, D., Ogryzko, V., Kao, H. Y., Nash, A., Chen, H., Nakatani, Y., and Evans, R. M. (1999) Cell 96, 393-403[CrossRef][Medline] [Order article via Infotrieve]
52. Hong, W., Kim, A. Y., Ky, S., Rakowski, C., Seo, S. B., Chakravarti, D., Atchison, M., and Blobel, G. A. (2002) Mol. Cell. Biol. 22, 3729-3743[Abstract/Free Full Text]
53. Tanaka, K., Matsunobu, T., Sakamoto, A., Matsuda, S., and Iwamoto, Y. (2002) J. Orthop. Sci. 7, 477-482[CrossRef][Medline] [Order article via Infotrieve]
54. Ahrens, S., Hoffmann, C., Jabar, S., Braun-Munzinger, G., Paulussen, M., Dunst, J., Rube, C., Winkelmann, W., Heinecke, A., Gobel, U., Winkler, K., Harms, D., Treuner, J., and Jurgens, H. (1999) Med. Pediatr. Oncol. 32, 186-195[CrossRef][Medline] [Order article via Infotrieve]
55. Sowa, Y., Orita, T., Hiranabe-Minamikawa, S., Nakano, K., Mizuno, T., Nomura, H., and Sakai, T. (1999) Ann. N. Y. Acad. Sci. 886, 195-199[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
L. J. Embree, M. Azuma, and D. D. Hickstein
Ewing Sarcoma Fusion Protein EWSR1/FLI1 Interacts with EWSR1 Leading to Mitotic Defects in Zebrafish Embryos and Human Cell Lines
Cancer Res., May 15, 2009; 69(10): 4363 - 4371.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. P. Lin, M. K. Pandey, F. Jin, S. Xiong, M. Deavers, J. M. Parant, and G. Lozano
EWS-FLI1 Induces Developmental Abnormalities and Accelerates Sarcoma Formation in a Transgenic Mouse Model
Cancer Res., November 1, 2008; 68(21): 8968 - 8975.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Ban, I. M. Bennani-Baiti, M. Kauer, K.-L. Schaefer, C. Poremba, G. Jug, R. Schwentner, O. Smrzka, K. Muehlbacher, D. N.T. Aryee, et al.
EWS-FLI1 Suppresses NOTCH-Activated p53 in Ewing's Sarcoma
Cancer Res., September 1, 2008; 68(17): 7100 - 7109.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Liu, H. Cheng, W. Kwan, J. M. Lubieniecka, and T. O. Nielsen
Histone deacetylase inhibitors induce growth arrest, apoptosis, and differentiation in clear cell sarcoma models
Mol. Cancer Ther., June 1, 2008; 7(6): 1751 - 1761.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Carrillo, E. Garcia-Aragoncillo, D. Azorin, N. Agra, A. Sastre, I. Gonzalez-Mediero, P. Garcia-Miguel, A. Pestana, S. Gallego, D. Segura, et al.
Cholecystokinin Down-Regulation by RNA Interference Impairs Ewing Tumor Growth
Clin. Cancer Res., April 15, 2007; 13(8): 2429 - 2440.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
Y. Iwamoto
Diagnosis and Treatment of Ewing's Sarcoma
Jpn. J. Clin. Oncol., February 1, 2007; 37(2): 79 - 89.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Sakimura, K. Tanaka, S. Yamamoto, T. Matsunobu, X. Li, M. Hanada, T. Okada, T. Nakamura, Y. Li, and Y. Iwamoto
The Effects of Histone Deacetylase Inhibitors on the Induction of Differentiation in Chondrosarcoma Cells
Clin. Cancer Res., January 1, 2007; 13(1): 275 - 282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. Yang, W. Wei, M. Menconi, and P.-O. Hasselgren
Dexamethasone-induced protein degradation in cultured myotubes is p300/HAT dependent
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R337 - R334.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Mateo-Lozano, P. C. Gokhale, V. A. Soldatenkov, A. Dritschilo, O. M. Tirado, and V. Notario
Combined Transcriptional and Translational Targeting of EWS/FLI-1 in Ewing's Sarcoma.
Clin. Cancer Res., November 15, 2006; 12(22): 6781 - 6790.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. M. Tirado, S. Mateo-Lozano, J. Villar, L. E. Dettin, A. Llort, S. Gallego, J. Ban, H. Kovar, and V. Notario
Caveolin-1 (CAV1) Is a Target of EWS/FLI-1 and a Key Determinant of the Oncogenic Phenotype and Tumorigenicity of Ewing's Sarcoma Cells.
Cancer Res., October 15, 2006; 66(20): 9937 - 9947.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Kawamura-Saito, Y. Yamazaki, K. Kaneko, N. Kawaguchi, H. Kanda, H. Mukai, T. Gotoh, T. Motoi, M. Fukayama, H. Aburatani, et al.
Fusion between CIC and DUX4 up-regulates PEA3 family genes in Ewing-like sarcomas with t(4;19)(q35;q13) translocation
Hum. Mol. Genet., July 1, 2006; 15(13): 2125 - 2137.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Matsunobu, K. Tanaka, T. Nakamura, F. Nakatani, R. Sakimura, M. Hanada, X. Li, T. Okada, Y. Oda, M. Tsuneyoshi, et al.
The Possible Role of EWS-Fli1 in Evasion of Senescence in Ewing Family Tumors
Cancer Res., January 15, 2006; 66(2): 803 - 811.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Riggi, L. Cironi, P. Provero, M.-L. Suva, K. Kaloulis, C. Garcia-Echeverria, F. Hoffmann, A. Trumpp, and I. Stamenkovic
Development of Ewing's Sarcoma from Primary Bone Marrow-Derived Mesenchymal Progenitor Cells
Cancer Res., December 15, 2005; 65(24): 11459 - 11468.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. M. Tirado, S. Mateo-Lozano, and V. Notario
Roscovitine Is an Effective Inducer of Apoptosis of Ewing's Sarcoma Family Tumor Cells In vitro and In vivo
Cancer Res., October 15, 2005; 65(20): 9320 - 9327.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Hu-Lieskovan, J. Zhang, L. Wu, H. Shimada, D. E. Schofield, and T. J. Triche
EWS-FLI1 Fusion Protein Up-regulates Critical Genes in Neural Crest Development and Is Responsible for the Observed Phenotype of Ewing's Family of Tumors
Cancer Res., June 1, 2005; 65(11): 4633 - 4644.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. J. Rorie and B. E. Weissman
The Ews/Fli-1 Fusion Gene Changes the Status of p53 in Neuroblastoma Tumor Cell Lines
Cancer Res., October 15, 2004; 64(20): 7288 - 7295.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Matsunobu, K. Tanaka, Y. Matsumoto, F. Nakatani, R. Sakimura, M. Hanada, X. Li, Y. Oda, I. Naruse, H. Hoshino, et al.
The Prognostic and Therapeutic Relevance of p27kip1 in Ewing's Family Tumors
Clin. Cancer Res., February 1, 2004; 10(3): 1003 - 1012.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/17/15105    most recent
M211470200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nakatani, F.
Right arrow Articles by Iwamoto, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakatani, F.
Right arrow Articles by Iwamoto, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement