|
Originally published In Press as doi:10.1074/jbc.M211470200 on January 30, 2003
J. Biol. Chem., Vol. 278, Issue 17, 15105-15115, April 25, 2003
Identification of p21WAF1/CIP1 as a Direct Target of
EWS-Fli1 Oncogenic Fusion Protein*
Fumihiko
Nakatani,
Kazuhiro
Tanaka ,
Riku
Sakimura,
Yoshihiro
Matsumoto,
Tomoya
Matsunobu,
Xu
Li,
Masuo
Hanada,
Takamitsu
Okada, and
Yukihide
Iwamoto
From the Department of Orthopedic Surgery, Graduate School of
Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku,
Fukuoka 812-8582, Japan
Received for publication, November 11, 2002, and in revised form, January 29, 2003
 |
ABSTRACT |
Translocation t(11;22) is a karyotypic
abnormality detected in over 90% of Ewing's family tumors. This
translocation results in the EWS-Fli1 fusion gene,
which has been shown to be a potent, single-step transforming gene. We
reported previously that suppression of the EWS-Fli1 fusion protein
altered the expression of G1 regulatory cyclins and
cyclin-dependent kinase inhibitors both at mRNA and protein levels, resulting in G1 growth arrest in Ewing's
family tumor cell lines. These data suggest that the G1
regulatory molecules may be targets of the EWS-Fli1 fusion protein,
which functions as an aberrant transcription factor. By using
electrophoretic mobility shift assays, we show here the direct
association of EWS-Fli1 fusion protein with ETS consensus
sequences, which are in the promoter of the p21WAF1/CIP1 gene.
Reporter gene assays revealed that the activity of the p21WAF1/CIP1 promoter is negatively regulated by EWS-Fli1
fusion protein through at least two ETS-binding sites in the promoter.
EWS-Fli1 interacted with p300 cotransactivator and suppressed its
histone acetyltransferase activity, which may explain the
down-regulation of p21WAF1/CIP1 by EWS-Fli1. In the presence of
a histone deacetylase inhibitor, the histone acetyltransferase activity
of the Ewing's family tumor cell was recovered resulting in the
induction of p21, and the cell growth was dramatically inhibited. These
results demonstrated that p21WAF1/CIP1 might be one of the
direct targets of EWS-Fli1, and that p21WAF1/CIP1 could serve
as a target for a molecularly based therapy for Ewing's family tumors.
 |
INTRODUCTION |
Aberrant functions of transcription factors by structural
alterations are frequent and crucial mechanisms for the development of
malignant phenotypes. Chromosomal rearrangement is a major cause of
structural alterations of transcription factors leading to aberrant
functions. Translocation t(11;22) is a common chromosomal abnormality detected in Ewing's family tumors (EFT),1
including Ewing's sarcoma (ES) and primitive neuroectodermal tumor (1). This translocation results in
the EWS-Fli1 fusion gene, made up of the 5' half of the
EWS gene, containing a glutamine-rich repeat on chromosome
22, fused to the 3' half of the Fli1 gene on chromosome 11, which harbors an ETS-like DNA binding domain. Recent studies (2)
demonstrated that EWS-Fli1 fusion protein, created by the chimeric
gene, acts as an aberrant transcription factor. Murine fibroblasts
stably transfected with the EWS-Fli1 gene formed colonies in
soft agar and gained tumorigenicity (3). These observations suggest
that the chimeric gene is a potent, single-step transforming gene.
However, little is known about the mechanisms involved in the
transformation of the chimeric gene, and the biological significance of
EWS-Fli1 is not fully understood. Targeting the EWS-Fli1
fusion gene by stable transfection with an antisense expression plasmid
resulted in the loss of tumorigenicity of EFT cells (4). We reported
that treatment with EWS-Fli1 antisense oligonucleotides
inhibited proliferation of various EFT cell lines and arrested the cell
cycle at the G1 phase (5). We also demonstrated that the
expression levels of G1 cyclins, including cyclin D1 and
cyclin E, were markedly decreased by the reduction of the EWS-Fli1
fusion protein. On the other hand, the expression of two important
cyclin-dependent kinase inhibitors for the G1-S
transition, p21 and p27, was dramatically increased both at mRNA
and protein levels after the treatment with EWS-Fli1 antisense oligonucleotides (6).
Among these G1 regulatory molecules, p21WAF1/CIP1
is a member of universal cyclin-dependent kinase inhibitors
and plays critical roles in the regulation of G1-S
transition (7). p21 can induce differentiations of normal and
transformed cells and can suppress the growth of malignant cells
in vitro and in vivo (8). The expression of p21WAF1/CIP1 is positively regulated by wild type p53, a
tumor suppressor gene product. p53 binds to p53-responsive elements
located at 1.3 and 2.2 kb upstream of the first exon of the human
p21WAF1/CIP1 gene and transactivates p21WAF1/CIP1
promoter activity (9). In addition to p53, a variety of factors, including Sp1, Sp3, C/EBPs, and the STAT family, regulates
transcription of the p21WAF1/CIP1 gene. These transcription
factors are often activated by various signals and promoted to bind to
specific cis-acting elements with transcriptional coactivators such as
p300/CBP. Recent studies (10-12) suggest that p300 has
acetyltransferase activity of histone or nonhistone
chromatin-associated proteins and transcriptional activator proteins,
resulting in the transcriptional activation of target genes.
Macleod et al. (13) reported a potent ETS-binding sequence
overlapping with a p53-binding site in the p21WAF1/CIP1
promoter region. Funaoka et al. (14) also identified another ETS-binding site adjacent to the p53-responsive element in the upstream
promoter region of the p21WAF1/CIP1 gene. Based on such
evidence, we hypothesized that the p21WAF1/CIP1 gene might be
a candidate as the direct target of EWS-Fli1 fusion protein. In the
present study, we first examined whether EWS-Fli1 fusion protein could
modulate the p21WAF1/CIP1 promoter activity. We found that
the reduced expression of EWS-Fli1 fusion protein enhanced the
p21WAF1/CIP1 promoter activity in EFT cells and that the
forced expression of EWS-Fli1 suppressed the p21WAF1/CIP1
promoter activity in murine fibroblast cells. Electromobility shift
assays revealed that EWS-Fli1 fusion protein bound to the ETS consensus
sequences in the p21WAF1/CIP1 promoter. These data strongly
suggest that p21WAF1/CIP1 is the direct target of EWS-Fli1.
Furthermore, EWS-Fli1 interacts with p300 in vivo and
inhibited the p21 induction via suppression of the histone
acetyltransferase activity of p300. These observations may explain, at
least in part, the mechanism of p21 suppression by EWS-Fli1.
 |
EXPERIMENTAL PROCEDURES |
Materials--
EWS-Fli1 antisense and sense
phosphorothioate oligodeoxynucleotides purified by high performance
liquid chromatography were purchased from Kurabo Industries Ltd.
(Osaka, Japan). The sequence of the antisense oligonucleotides was
ATCCGTGGACGCCATTTTCTCTCCT (5), and the corresponding sense sequence was
used as a control. Sodium butyrate, a histone deacetylase inhibitor,
was purchased from Wako Pure Chemical Industries, Ltd. (Tokyo, Japan).
Cell Lines and Culture Conditions--
Human ES cell lines,
SK-N-MC and RDES, were obtained from the American Type Culture
Collection (Manassas, VA). PNKT-1, a human primitive neuroectodermal
tumor cell line, was established and characterized in our laboratory
(15). EFT cells were maintained in Dulbecco's modified Eagle's medium
(Nissui Pharmaceuticals Co., Tokyo, Japan) supplemented with 10% fetal
bovine serum, 100 µg/ml penicillin, and 100 µg/ml streptomycin and
incubated at 37 °C in a humidified atmosphere containing 5%
CO2 in air. Murine fibroblast Swiss 3T3 cells were
purchased from Clontech and grown in Dulbecco's modified Eagle's
medium containing 10% calf serum.
Animals--
6-Week-old athymic Balb/c nu/nu mice were
obtained from Japan SLC Co., Ltd. (Hamamatsu, Japan). Throughout the
experiments, the mice were maintained in a laminar flow cabinet under
specific pathogen-free conditions and received standard feed and water ad libitum. All experiments on animals were done in
accordance with guidelines of the Animal Center of Kyushu University.
Oligonucleotide Administration to Tumor-bearing Nude
Mice--
SK-N-MC cells harvested from 60% confluent monolayer
cultures were resuspended in PBS at 2 × 107 viable
cells/ml and subcutaneously inoculated into athymic mice (0.5 × 107 viable cells/mouse). Seven days after the tumor
inoculation, when the subcutaneous tumor had grown to a visible size,
0.1 or 0.2 ml of PBS containing 1 mM antisense or sense
oligonucleotides was injected into the established tumors. Twenty four
hours later, additional injections were given at the same dosages. The
animals were killed 24 h after the last oligomer inoculation, and
subcutaneous tumors were excised and subjected to further analyses.
RNA Extraction and Quantitative Real Time RT-PCR--
Total RNA
was isolated from SK-N-MC tumors injected with sense or antisense
oligonucleotides using Isogen (Wako) and from SK-N-MC cells treated
with various concentrations of sodium butyrate using an RNA-easy kit
(Qiagen, Hilden, Germany). One microgram of total RNA was subjected to
reverse transcription reaction using SuperScript II reverse
transcriptase (Invitrogen). Real time PCR was performed as described by
Heid et al. (16). The amplification primers and fluorogenic
hybridization probes of both human p21WAF1/CIP1 and
GAPDH were custom-synthesized using Pre-developed TaqMan Assay Reagents (Applied Biosystems, Foster City, CA). As for
EWS-Fli1, amplification primers and fluorogenic
hybridization probes were designed using Primer Express software
(Applied Biosystems). Quantitative real time RT-PCR was carried out
using an Applied Biosystems 7700 Sequence Detector. The relative
p21WAF1/CIP1 or EWS-Fli1 expression data were
calculated by dividing the quantity of transcripts of
p21WAF1/CIP1 or EWS-Fli1 by those of
GAPDH, respectively.
Western Blot Analysis--
Western blottings were carried out as
described (17) with several modifications. Cells were harvested and
solubilized in a Nonidet P-40-based lysis buffer (20 mM
Tris (pH 7.4), 250 mM NaCl, 1.0% Nonidet P-40, 1 mM EDTA, 50 mg/ml leupeptin, and 1 mM
phenylmethylsulfonyl fluoride). After incubation on ice for 5 min, the
cell lysates were clarified by centrifugation at 14,000 rpm for 30 min
at 4 °C. The protein quantity was determined by Bradford protein
assays (Bio-Rad) and fractionated on pre-cast 4-12% gradient MOPS
polyacrylamide gels (NOVEX, San Diego, CA). After transfer to
nitrocellulose membranes, the membranes were pretreated with TBS
containing 5% dry milk and 0.05% Triton X-100 (TBST) for
1 h at room temperature and then incubated with antibodies to
Fli1, ETS1, ETS2, ERG, PU.1, p300, PCAF, TAFII p250 (Santa Cruz
Biotechnology, Santa Cruz, CA), p21, actin (Pharmingen), or acetylated
histone H3 and H4 (Upstate Biotechnology, Inc., Lake Placid, NY) for
1 h at room temperature. After several washes in TBST, the filter
was treated with horseradish peroxidase-conjugated secondary antibodies
(BIOSOURCE, Illinois) at room temperature for
1 h. After the final wash with TBST, immunoreactivity of the blots
was detected using an enhanced chemiluminescence (ECL) detection system
(Amersham Biosciences).
Plasmids--
The full-length p21WAF1/CIP1
promoter-luciferase reporter construct (pGl2-p21-H2320) was generated
by subcloning the p21WAF1/CIP1 promoter fragment ( 2320 to
+75) into the HindIII site of the pGl2 basic vector
(Promega, Madison, WI), as described (18, 19). The deletion reporter
constructs were generated as described (20). Briefly, digestion of
pGl2-p21-H2320 with SacI or SmaI and re-ligation
yielded plasmid pGl2-p21-S2260 or pGl2-p21-Sm60, respectively.
Digestion of pGl2-p21-H2320 or pGl2-p21-S2260 with NsiI and
PstI and re-ligation yielded plasmid pGl2-p21-H-N/P or pGl2-p21-S-N/P, respectively. Mutagenized reporter construct, Mut-EBS1
or Mut-EBS2, was the same as pGl2-p21-H2320 except for mutation at
ETS-binding site 1 (EBS1) or ETS-binding site 2 (EBS2), respectively.
Double-Mut had mutations at both ETS-binding sites. The mutations were
created by PCR using mutated primers. pCMV-HA p300, an expression
vector for human p300 protein, was purchased from Upstate
Biotechnology, Inc. (Lake Placid, NY)
Luciferase Assay--
EFT cell lines were seeded into each well
of 6-well plates (1 × 105 cells/well) (Falcon
Labware) 1 day before transfection. Twenty four hours later,
transfection was done using FuGENE 6 (Roche Molecular Biochemicals)
according to the manufacturer's protocol. Briefly, each well was
transfected with 1.0 µg of each reporter construct and 0.5 µg of
pRL-SV40 (Promega) using 3 µl of FuGENE 6. Twenty four hours after
the transfection, 10 or 20 µM of sense or antisense
oligonucleotides were added to the media followed by 48 h of
incubation. Then the cells were solubilized using passive lysis buffer
(Promega), according to the manufacturer's protocol, and were
subjected to luciferase assay. Swiss 3T3 cells were cotransfected with
1.0 µg of each reporter construct and various doses of expression vectors for EWS-Fli1 (kindly provided by Dr. C. T. Denny), Fli1, and EWS-Fli1 with a deleted ETS binding domain ( Ets) or mock plasmid
vector. pCMV-HA 300 expression vector was used to express HA-tagged
p300. Twenty four hours after the cotransfection, luciferase assays
were done. pGl2-Control and pRL-SV40 were used as a positive control
and an internal control for normalization of transfection efficiency,
respectively. Luciferase activity was assayed using Dual-luciferase
Reporter Assay Systems (Promega) and a Microlumat Plus LB 96V
(EG & G Berthold, Germany).
Electromobility Shift Assays (EMSAs)--
The
p21WAF1/CIP1 promoter contains two known ETS-binding sites.
Oligonucleotides containing each of the wild type or mutated
ETS-binding sites were synthesized as complementary sequences to form
double-stranded DNA and end-labeled with [ -32P]dCTP
(10 mCi/ml, Amersham Biosciences) for EMSA. Sequences of the two
ETS-binding sites of the p21WAF1/CIP1 promoter were as
follows (mutated nucleotides are underlined): wild type
5'-ETS-binding site (EBS1wt),
5'-GGGTTTCTGGCCATCAGGAACATGTCCCAACATGTTGAGCTC-3'; mutated
5'-ETS-binding site (EBS1mt),
5'-GGGTTTCTGGCCATCTAGAACATGTCCCAACATGTTGAGCTC-3'; wild type
3'-ETS-binding site (EBS2wt),
5'-GGCAGCTGCGTTAGAGGAATAAGACTGGGCATGTCTGGGCAG-3'; mutated
3'-ETS-binding site (EBS2mt),
5'-GGCAGCTGCGTTATCTAGATAAGACTGGGCATGTCTGGGCAG-3'. Nuclear extracts were prepared using a modified method of Dignam et al. (21). In brief, 1.0 × 107 EFT cells
were harvested and washed in PBS, suspended in 200 µl of cold buffer
A (10 mM HEPES (pH 7.9), 50 mM NaCl, 1 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride), and then incubated for
20 min on ice prior to the addition of 200 µl of cold buffer B
(buffer A with 0.1% Nonidet P-40). The cells were gently pipetted and
incubated on ice for another 20 min. The nuclei were pelleted (5,000 × g, 2 min) and washed in buffer A, and nuclear
proteins were extracted in 25 µl of buffer C (400 mM
NaCl, 20 mM HEPES (pH 7.9), 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride). The tubes were placed on ice for at
least 30 min, followed by centrifugation at 4 °C for 10 min. The
supernatant was recovered, snap-frozen in liquid nitrogen, and stored
at 80 °C until use. EMSAs were performed as described (2).
Briefly, nuclear extracts of EFT cell lines were incubated in 10 µl
of reaction mixtures (75 mM KCl, 10 mM Tris (pH
7.5), 1 mM dithiothreitol, 1 mM EDTA, 250 ng of
poly(dI-dC), and 4% Ficoll) for 15 min at room temperature. The
32P-labeled EBS1wt or EBS2wt oligonucleotides (50 fmol,
50,000 cpm) were added to the reactions followed by incubation at room
temperature for 15 min. The DNA-protein complexes were fractionated
with electrophoresis in 4% nondenaturing polyacrylamide gels at 110 V
for 3-4 h at 4 °C in 0.25× TBE buffer (25 mM Tris, 25 mM boric acid, 0.5 mM EDTA (pH 8.3)) with 48 µM -mercaptoethanol. Gels were dried, and data were
processed using a Bio-Image analyzer (Fuji Photo Film, Tokyo, Japan).
In Vivo Coimmunoprecipitation--
Nuclear extracts from SK-N-MC
cells were prepared as described above. After the final centrifugation,
the salt concentration was reduced to 75 mM NaCl. Protein
quantities were determined using Bradford protein assays (Bio-Rad). The
nuclear extracts were divided into 3 aliquots, followed by the addition
of rabbit antiserum against human p300 (Santa Cruz Biotechnology),
rabbit polyclonal antibody against Fli1 (Santa Cruz Biotechnology), or normal mouse polyclonal IgG (Santa Cruz Biotechnology). After incubation on ice for 2 h, protein A-G-Sepharose beads (Santa Cruz
Biotechnology) were added to the reactions, which were then shaken on a
rotary shaker at 4 °C for 8 h. The beads were washed five times
with PBS, boiled, and subjected to electrophoresis on 4-12% MOPS or
3-7% Tris acetate gradient pre-cast polyacrylamide gels (NOVEX),
according to the molecular weight of target proteins. After the
transfer to nitrocellulose membranes, the filers were subjected to
Western blot analysis as described above.
Immunofluorescence--
Swiss 3T3 cells, cultured on
poly-L-lysine-coated coverslips, were cotransfected with
FLAG-tagged EWS-Fli1 and HA-tagged p300 expression constructs, using
LipofectAMINE PLUS reagents (Invitrogen) as instructed. Forty eight
hours after the transfection, the cells were fixed with 4%
paraformaldehyde in PBS for 30 min. After a PBS wash, the cells were
permeabilized for 10 min in 0.5% Triton X-100 in PBS followed by a PBS
wash, and FLAG-tagged EWS-Fli1 were detected with Cy3-conjugated
FLAG-M2 monoclonal antibody (Sigma) diluted 1:200 in PBS containing 1%
bovine serum albumin. After three PBS washes for 5 min, the cells were
incubated with FITC-conjugated anti-HA monoclonal antibody (Roche
Diagnostics Co.) diluted 1:100 in PBS containing 1% bovine
serum albumin for 1 h at room temperature to detect HA-tagged
p300. After a 5-min wash in PBS, the coverslips were mounted with a
Vectashield 100 (Vector Laboratories, Peterborough, UK) on glass
slides, and then the specimens were observed under a confocal
microscope with argon and krypton lasers. Control experiments were
carried out to ensure there was no bleed through between green (FITC)
and red (Cy3) signals.
Immunoprecipitated Histone Acetyltransferase Activity
Assay--
Histone acetyltransferase activity of p300, PCAF, and TAFII
p250 was measured using an immunoprecipitation-HAT assay kit (Upstate Biotechnology, Inc.), according to the manufacturer's protocol. Briefly, SK-N-MC cells were exposed to sense or antisense
oligonucleotides of EWS-Fli1 for 48 h. Swiss 3T3 cells were
transiently transfected with various doses of expression vectors for
EWS-Fli1, Fli1, Ets, or mock plasmid vector as described above. A
nuclear extract of each sample was divided into 4 aliquots, followed by
the addition of mouse monoclonal antibody to p300 (Upstate
Biotechnology, Inc.), PCAF, TAFII p250 (Santa Cruz Biotechnology), or
normal mouse IgG (Santa Cruz Biotechnology). After incubation on ice
for 2 h, 20 µl of protein G-Sepharose beads (Santa Cruz
Biotechnology) were added to the reactions and shaken on a rotary
shaker at 4 °C for 4 h. The collected beads were washed three
times with ice-cold PBS and incubated with HAT assay mixtures
consisting of core histones and 100 µM
[3H]acetyl-CoA (0.5 µCi/µl) at 30 °C for 30 min.
The supernatant of each sample was placed on P81 square papers and
washed six times for 15 min with 50 mM
Na2HPO4 (pH 9.0). The squares were equilibrated
with scintillation fluid overnight and read in a scintillation counter.
Nonradioactive Histone Acetyltransferase Activity
Assay--
SK-N-MC cells were treated with antisense or sense
oligonucleotides of EWS-Fli1 or sodium butyrate for 48 h. Each nuclear extract was harvested as described above and subjected
to the assays. Nonradioactive HAT assays were done using a HAT assay kit (Upstate Biotechnology, Inc.), according to the manufacturer's protocol. Briefly, each nuclear extract was mixed with 100 µM acetyl-CoA, and 1× HAT assay buffer was incubated on
an enzyme-linked immunosorbent assay plate precoated with histone H3
for 30 min. After several washes with PBS, acetylated histones were
detected using an anti-acetyl-lysine rabbit polyclonal antibody
followed by the horseradish peroxidase-based colorimetric assay.
Chromatin Immunoprecipitation Assay--
Chromatin
immunoprecipitation assays were performed with a chromatin
immunoprecipitation assay kit (Upstate Biotechnology, Inc.), according
to the manufacturer's protocol. Briefly, SK-N-MC cells were incubated
with 10 µM sense or antisense oligonucleotides of
EWS-Fli1 for 48 h. Formaldehyde was then added to the
medium at a final concentration of 1% for 10 min at 37 °C. The
cells were harvested, suspended with SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.3)), and
incubated on ice for 10 min. Lysates were sonicated, and debris was
removed from the samples by centrifugation for 10 min at 10,000 × g. An aliquot of each chromatin solution (40 µl) was set
aside and designated as the input fractions. Supernatants were diluted
10-fold in immunoprecipitation buffer and precleared with Sepharose A/G
plus agarose beads that had been preabsorbed with salmon sperm DNA. The
precleared chromatin solution was incubated with anti-acetylated human
H3 or H4 histone or normal rabbit IgG for 16 h at 4 °C. The
immune complexes were then collected with the addition of Sepharose A/G
plus agarose beads, followed by several washes with appropriate
buffers, according to the manufacturer's protocol. Each sample was
eluted with freshly prepared 1% SDS and 0.1 M
NaHCO3 and then histone-DNA cross-links were reversed with
the addition of 5 M NaCl. Chromatin-associated proteins
were digested with proteinase K (10 mg/ml), and the immunoprecipitated DNA was recovered by phenol/chloroform extraction and ethanol precipitation and analyzed by PCR. Amplification protocol consisted of
25 cycles at 96 °C for 30 s, 67 °C for 30 s, and
72 °C for 30 s using the primer pair
5'-GGAACTCGGCCAGGCTCAGCTGCTCCGCGC-3' and
5'-GCGAATCCGCGCCCAGCTCCGGCTCCACAAGG-3' to amplify 179 to +44 of
the p21WAF1/CIP1 promoter. PCR products were resolved and
visualized with ethidium bromide. Images were recorded and quantified
using NIH image software.
Cell Growth Analysis--
For the cell growth study, SK-N-MC
cells were seeded at a density of 3 × 104 cells in
35-mm culture dishes (Falcon). Two days after the cell preparation,
sodium butyrate at various concentrations was added to the media. The
number of viable cells in each dish was counted every 24 h for 5 days using trypan blue dye exclusion tests. The cell growth study was
carried out in triplicate and repeated at least three times.
RT-PCR--
Two micrograms of total RNA extracted from SK-N-MC
cells treated with various concentrations of sodium butyrate were
subjected to reverse transcription reaction, using a Ready-to-Go
cDNA synthesis kit (Amersham Biosciences). The sequences of the
primers used for PCR were described previously (22). PCRs were
performed in a final volume of 50 µl for 30 cycles. Each PCR cycle
consisted of a heat denaturation step at 94 °C for 1 min, a primer
annealing step at 55 °C for 30 s, and an extension step at
72 °C for 1 min. The PCR was performed within the linear range of
amplification determined in a preliminary study. The PCR products were
analyzed in 1.5% agarose gel (Sigma).
 |
RESULTS |
Effects of the Antisense Oligonucleotides on p21WAF1/CIP1
Expression in EFT Tumors in Nude Mice--
We have reported previously
(5) that intra-tumor injections of antisense oligonucleotides led to a
significant inhibition of EFT tumor growth. Thus, we first examined
whether the antisense oligonucleotide treatment could induce
p21WAF1/CIP1 expression along with the down-regulation of
EWS-Fli1 in vivo. Quantitative PCR analysis
showed that, with the down-regulation of EWS-Fli1 mRNA
expression, antisense oligonucleotide injections significantly
up-regulated the p21WAF1/CIP1 mRNA expression up to
~42-fold over that of the control in a dose-dependent
manner (Fig. 1, A and
B). Consistent with these data, treatment with 200 nmol of
antisense oligonucleotides up-regulated p21 protein expression in the
tumor (Fig. 1, C and D). These data indicate that
antisense oligonucleotide treatment of the xenografts inhibited
EWS-Fli1 expression along with the induction of
p21WAF1/CIP1 expression.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Effects of antisense
oligonucleotides against EWS-Fli1 on
p21WAF1/CIP1 expression in the EFT tumors
established in nude mice. SK-N-MC cells were subcutaneously
inoculated into nude mice (5 × 106 viable
cells/mouse). Seven days later, 100 or 200 nmol of antisense
oligonucleotides against EWS-Fli1 were injected into the tumors. Twenty
four hours later, the same amounts of oligonucleotides were injected
into the tumors. As a control, 200 nmol of sense oligonucleotides were
also injected. Twenty four hours after the final inoculations, tumors
were excised, and the expression of EWS-Fli1 and
p21WAF1/CIP1 was evaluated using quantitative PCR
(A and B) and Western blotting (C and
D). AS and S represent antisense
oligonucleotides and sense oligonucleotides, respectively.
|
|
Specific Effect of the Antisense Oligonucleotides on
EWS-Fli1--
We next examined the specificity of antisense
oligonucleotides of EWS-Fli1 in EFT cell lines. As shown in Fig.
2, antisense oligonucleotides
specifically down-regulated EWS-Fli1 and did not alter the expression
of other major ETS transcription families, ETS1, ETS2, ERG, and PU.1.
Furthermore, endogenous full-length Fli1 and EWS was not detected in
all EFT cell lines tested (data not shown). These data indicate that
antisense oligonucleotides specifically down-regulate the expression of
EWS-Fli1 protein in EFT cells.

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 2.
Specific effect of antisense oligonucleotides
on EWS-Fli1. EFT cell lines were cultured in the
presence of 10 µM sense or antisense oligonucleotides of
EWS-Fli1 for 48 h. Total cell lysates were extracted
from cells and subjected to Western blot analyses using anti-Fli1,
ETS1, ETS2, ERG, PU.1, p21, and actin antibodies. NT,
S, and AS represent no treatment, sense
oligonucleotide, and antisense oligonucleotide treatment,
respectively.
|
|
Effect of the Antisense Oligonucleotides on Activities of the
p21WAF1/CIP1 Promoter--
In the reporter gene assay,
SK-N-MC cells transfected with the p21WAF1/CIP1
promoter-luciferase reporter construct exhibited very low luciferase activity. However, treatment of the cells with antisense
oligonucleotides dose-dependently enhanced
p21WAF1/CIP1 promoter activities in the cells up to
~3.8-fold that in the sense-treated cells. In other EFT cell lines,
PNKT-1 and RD-ES, treatment with antisense oligonucleotides also
increased p21WAF1/CIP1 promoter activities up to 3.2- and
2.8-fold compared with findings in sense-treated cells, respectively
(Fig. 3B). The expression level of EWS-Fli1 in each EFT cell line varied (5). SK-N-MC cells have
the strongest expression of EWS-Fli1 in all cell lines tested, followed
by PNKT-1. These data suggest that the effects of antisense
oligonucleotides on up-regulation of p21WAF1/CIP1 promoter
activity may be due to down-regulation of EWS-Fli1 expression.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of EWS-Fli1 expression on
p21WAF1/CIP1 promoter activity. A, diagram of
the p21WAF1/CIP1 promoter. The p21WAF1/CIP1
promoter contains two ETS-binding sequences adjacent to the p53
response elements, designated as ETS-binding site 1 and ETS-binding
site 2. Ets-binding sites are shown in boldface type, and
the p53 response elements are underlined. Numbering of
nucleotides was done according to Ref. 18. B, effects of
antisense oligonucleotides on the p21WAF1/CIP1 promoter
activity. Full-length p21WAF1/CIP1 promoter-reporter
construct pGl2-p21-H2320 was transfected into EFT cells. The cells were
then challenged with antisense (5 or 10 µM) or sense (10 µM) oligonucleotides for 48 h and harvested for the
luciferase assays. NT, S, and AS represent no
treatment, sense oligonucleotide, and antisense oligonucleotide
treatment, respectively. C, effects of EWS-Fli1 and Fli1 on
the p21WAF1/CIP1 promoter activity. pGl2-p21-H2320 was
cotransfected with the expression vectors for Fli1, EWS-Fli1-deleted
ETS binding domain ( Ets) or full-length EWS-Fli1 into
Swiss 3T3 cells. The cells were harvested 24 h after the
transfection and assayed for luciferase activity. The experiments were
repeated at least three times with different plasmid preparations.
Bars represent S.E.
|
|
Down-regulation of the p21WAF1/CIP1 Promoter Activities
by EWS-Fli1 in Swiss 3T3 Cells--
The expression vector of Fli1
(Friend leukemia integration 1) was constructed using pcDNA3.1
(Invitrogen) and then examined for its effect on the
p21WAF1/CIP1 promoter activity by cotransfection with
full-length p21WAF1/CIP1 promoter-reporter constructs into
Swiss 3T3 cells. Enforced expression of Fli1 significantly induced
p21WAF1/CIP1 promoter activity, thus indicating that Fli1
might transactivate the p21WAF1/CIP1 gene. On the other hand,
EWS-Fli1 cotransfected with the full-length reporter construct reduced
promoter activity to 35% that of the control, thereby indicating that
the fusion protein down-regulates transcription of the
p21WAF1/CIP1 gene (Fig. 3C). As shown in Fig.
3C, the effect of Fli1 on p21WAF1/CIP1 promoter
activity correlated with the expression level of Fli1 proteins, whereas
the expression levels of EWS-Fli1 inversely correlated with the
p21WAF1/CIP1 promoter activity. In addition, this suppression
caused by EWS-Fli1 was attenuated by the deletion of the ETS binding
domain from EWS-Fli1. This evidence was consistent with the effects of
antisense oligonucleotides on activities of the p21WAF1/CIP1
promoter. Taken together, these data strongly suggest that EWS-Fli1 suppresses the p21WAF1/CIP1 promoter activity in EFT cells.
Deletion Analysis of p21WAF1/CIP1 Promoter in SK-N-MC
Cell--
To determine the functional role of ETS-binding sequences in
the p21WAF1/CIP1 promoter, deletion analysis of the promoter
was carried out. Deletion of a 68-bp fragment containing EBS1 from the
5' end of the full-length promoter (pGl2-p21-S2260) resulted in 250%
increases in promoter activities in SK-N-MC cells. Solo deletion of an
internal fragment of 1874 bp (pGl2-p21-H-N/P), including EBS2, had
little effect on the promoter activity. However, deletion of both the 68-bp fragment and the internal fragment (pGl2-p21-S-N/P) increased activity of the promoter to over 5-fold that of the full-length promoter (Fig. 4B).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of deletion and mutation on
p21WAF1/CIP1 promoter activity in EFT cells. A,
schema of the deletion constructs of the human p21WAF1/CIP1
promoter. White boxes indicate EBS1 and EBS2. H,
HindIII; S, SacI; N,
NsiI; P, PstI; Sm,
SmaI. B, p21WAF1/CIP1 promoter
activities from deleted constructs in SK-N-MC cells. SK-N-MC cells were
transfected with each deleted promoter-reporter construct and harvested
48 h after the transfection and subjected to luciferase assays.
C, sequences of the substitution mutations in Mut-EBS1 and
Mut-EBS2 are shown. Ets-binding sites are shown in boldface
type, and mutated nucleotides are underlined.
D, promoter activity of the mutation constructs with sense
or antisense oligonucleotides treatment in SK-N-MC cells. E,
effects of EWS-Fli1 and Fli1 on the mutation constructs of
p21WAF1/CIP1 promoter. Each mutation construct was
cotransfected with the expression vectors for Fli1, EWS-Fli1-deleted
ETS binding domain ( Ets), or full-length EWS-Fli1 into
Swiss 3T3 cells. The cells were harvested 24 h after the
transfection and assayed for luciferase activity. These experiments
were repeated at least three times with different plasmid preparations.
Bars represent S.E.
|
|
Mutation Analysis of the p21WAF1/CIP1
Promoter--
Because the p53 gene is truncated in the SK-N-MC cell
(23), the influence of p53 on the p21WAF1/CIP1 promoter could
be ruled out. However, there remained the possibility that results of
the promoter activity analyses using deletion constructs might be
affected by deletion of other protein-binding sequences, including
p53-binding elements. To examine specific influence of the ETS-binding
sites in the p21WAF1/CIP1 promoter, mutation constructs of
the p21WAF1/CIP1 promoter were generated as indicated in Fig.
4C. These constructs had mutations only in ETS-binding sites
and did not affect p53 bindings (data not shown). We performed mutation
analysis of the p21WAF1/CIP1 promoter using these mutated
constructs combined with sense or antisense oligonucleotide treatment.
With the addition of sense oligonucleotides, results of the mutation
analysis of the p21WAF1/CIP1 promoter were almost the same as
seen in cases of deletion promoter constructs (Fig. 4D).
Mutation in EBS2 alone had little effect on activity of the
p21WAF1/CIP1 promoter in SK-N-MC cells. In contrast, mutation
in EBS1 enhanced the p21WAF1/CIP1 promoter activity by 205%
over that of the control. Moreover, introduction of the mutation in
EBS2 clearly enhanced the effect of mutation in EBS1. On the other
hand, with antisense oligonucleotide treatment, all of the mutated
promoter activity was induced to ~4-5-fold over that of the
sense-treated wild type promoter construct, regardless of the sites and
numbers of the mutations (Fig. 4D).
We then cotransfected EWS-Fli1, Fli1, or the control vector with each
mutation promoter construct in Swiss 3T3 cells and assayed for
luciferase activity. EWS-Fli1-transfected Swiss 3T3 showed similar
changes with the mutated promoter activity using SK-N-MC cells as shown
in Fig. 4E. On the other hand, cotransfection of the mock
vector with all sets of mutated promoter constructs did not change
their promoter activities. Mutation of EBS1 resulted in a 68% decrease
in promoter activities in the Fli1-transfected Swiss 3T3. Solo mutation
of EBS2 had little effect on the promoter activity. However, mutation
of both ETS-binding sites attenuated the effect of the Fli1
transfection and reduced its activity to the same as the mock
transfected-H2320 (Fig. 4E).
These data strongly suggest that both EWS-Fli1 and Fli1 specifically
affect p21WAF1/CIP1 promoter activity through both
ETS-binding sites with converse effects.
Direct Binding of EWS-Fli1 to ETS-binding Sites in the
p21WAF1/CIP1 Promoter--
Many transcription factors bind
DNA in a sequence-specific manner. Because the ETS DNA binding domain
of Fli1 remains intact in all types of EWS-Fli1 fusion proteins (1), we
hypothesized that EWS-Fli1 fusion protein might directly bind the
ETS-binding sites in the p21WAF1/CIP1 promoter, resulting in
the suppression of p21WAF1/CIP1 expression. To confirm this
hypothesis, EMSAs were performed. As shown in Fig.
5, A and B, EMSAs
demonstrated that proteins in SK-N-MC nuclear extracts bound to both of
the ETS-binding sites in the p21WAF1/CIP1 promoter. This
protein-DNA binding disappeared when EMSA was performed using nuclear
extracts from the antisense oligonucleotide-treated SK-N-MC cells. In
addition, this binding was also greatly attenuated by addition of the
Fli1 antibody, which disrupts the binding capacity of EWS-Fli1 fusion
protein, whereas addition of a normal immunoglobulin showed no effect
on the protein binding. In competition binding assays, a molar excess
of unlabeled wild type sequences inhibited the protein-DNA complex
formation, whereas cold sequences harboring mutations at ETS-binding
sites did not affect the binding. These data strongly suggested that
the EWS-Fli1 protein binds directly to the p21WAF1/CIP1
promoter at the ETS-binding sites in a sequence-specific manner.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 5.
The binding of EWS-Fli1 to ETS binding
consensus sequences in the p21WAF1/CIP1 promoter.
A, gel shift assay was done, as described under the
"Experimental Procedures," using labeled oligonucleotides
containing EBS1 and nuclear extracts from SK-N-MC cells. The
arrow indicates the EWS-Fli1 protein-DNA complexes. The
arrowhead represents free probes. B, a gel shift
analysis was done using labeled oligonucleotides containing EBS2 as
described in A. wt, wild type; mt,
mutant.
|
|
Interaction between EWS-Fli1 and p300 in Vivo--
We next
explored the mechanism of p21WAF1/CIP1 down-regulation by
EWS-Fli1. p300/CBP is a transcriptional coactivator known to interact both with a wide variety of transcription factors and with components of the basal transcriptional machinery, including PCAF, TBP, TFIIB, TFIIE, and TFIIF (24). With regard to the regulation of
p21WAF1/CIP1 expression, p300/CBP cooperates with Sp1 and/or
Sp3 and up-regulates p21WAF1/CIP1 transcriptions (25).
Furthermore, Fujimura et al. (26) have shown that EWS-ATF1,
a fusion protein detected in the clear cell sarcoma, associates with
p300/CBP and interferes with its function. These studies prompted us to
determine whether EWS-Fli1 might also associate with p300/CBP and alter
its function, resulting in the negative regulation of
p21WAF1/CIP1 transcription. To demonstrate the interaction
between EWS-Fli1 and p300, we performed in vivo
coimmunoprecipitation assays. As shown in Fig.
6A, endogenous p300
coprecipitated with endogenous EWS-Fli1. Furthermore, ectopic
expression of HA-tagged p300 coprecipitated with FLAG-tagged EWS-Fli1
(Fig. 6B). However, we detected no interaction between
FLAG-tagged full-length Fli1 and HA-tagged p300 (data not shown). These
data demonstrate that EWS-Fli1, in contrast to Fli1, might bind to p300
and form complexes in EFT cells. Thus, it is conceivable that EWS-Fli1
might down-regulate p21 through the modulation of p300 functions.
Immunofluorescence of Swiss 3T3 cells, cotransfected with FLAG-EWS-Fli1
and HA-p300, were detected using anti-FLAG-Cy3 and anti-HA-FITC. As
shown in Fig. 6C, we found that FLAG-EWS-Fli1 colocalizes
with HA-p300 in the nucleus. These results also support the idea that
EWS-Fli1 interacts with p300/CBP in vivo.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 6.
Interaction of EWS-Fli1 with p300
in vivo. A, nuclear extracts of
SK-N-MC cells were immunoprecipitated (IP) with IgG, p300,
or Fli1 antibodies. WB, Western blot. The immunoprecipitated
proteins were separated in a 4-12% gradient gel and blotted with
either Fli1 or p300 polyclonal antibodies. N.E. represents
10% of input of the nuclear extract. B, Swiss 3T3 cells
were cotransfected with FLAG-tagged EWS-Fli1 and HA-tagged p300.
Nuclear extracts were prepared 48 h after the transfections and
immunoprecipitated with either IgG, anti-FLAG, or anti-HA antibodies.
Each immunoprecipitated protein was electrophoresed and blotted with
either anti-FLAG antibodies or anti-HA antibodies. C,
localization of EWS-Fli1 and p300 in vivo. Swiss 3T3 cells
were cotransfected with FLAG-tagged EWS-Fli1 and HA-tagged p300 on
coverslips. Immunofluorescence was done using anti-FLAG-Cy3 and
anti-HA-FITC 48 h after the transfections. a,
FLAG-EWS-Fli1 (red); b, HA-FITC; c,
both images were merged. Nucleus was counter-stained with
4,6-diamidino-2-phenylindole (DAPI).
|
|
EWS-Fli1 Inhibits the p300-mediated Transactivation of the
p21WAF1/CIP1 Gene--
To examine the functional interaction
between EWS-Fli1 and p300, we studied the effect of EWS-Fli1 and p300
on the activity of the p21WAF1/CIP1 promoter in Swiss 3T3
cells. The expression vector for p300 was cotransfected with the
p21WAF1/CIP1 promoter-reporter construct and expression
vector for EWS-Fli1 or Fli1 protein. As shown in Fig.
7A, EWS-Fli1 strongly
suppressed the p300-mediated transactivation of the
p21WAF1/CIP1 promoter in a dose-dependent manner.
Furthermore, increasing amounts of p300 abolished the inhibitory effect
of EWS-Fli1, suggesting that EWS-Fli1 might suppress
p21WAF1/CIP1 promoter activity via p300-dependent
mechanism. On the other hand, overexpression of p300 did not modulate
the Fli1-mediated up-regulation of the p21WAF1/CIP1 promoter
activity, and Fli1 could not override the p300-mediated enhancement of
p21WAF1/CIP1 transcription (Fig. 7B). Taken
together, these experiments provide the evidence that p300 and Fli1
might enhance the p21WAF1/CIP1 promoter activity
independently.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
A, inhibition of p300-mediated
activity of the p21WAF1/CIP1 promoter by EWS-Fli1. Swiss 3T3
cells were transiently transfected with 1 µg of the reporter
construct H2320 along with EWS-Fli1 and p300 expression vectors. The
cells were harvested 24 h after the transfection and assayed for
luciferase activity. These experiments were repeated at least three
times with different plasmid preparations. Bars represent
S.E. B, Swiss 3T3 cells were transiently transfected with 1 µg of the reporter construct H2320 along with Fli1 and p300
expression vectors. The cells were harvested 24 h after the
transfection and assayed for luciferase activity. These experiments
were repeated at least three times with different plasmid preparations.
Bars represent S.E. A Renilla luciferase
expression vector, RL-SV40, was used as an internal control for
transfection efficiency.
|
|
To confirm the possibility that EWS-Fli1 acts as a repressor of p300,
we examined whether forced expression of p300 could restore the
activity of the p21WAF1/CIP1 promoter in EFT cells. As
illustrated in Fig. 8, ectopic expression of p300 dramatically up-regulated the p21WAF1/CIP1 promoter
activities in all EFT cells tested in a dose-dependent manner, suggesting that the excess of p300 might not be interfered with
by EWS-Fli1 and may restore p21WAF1/CIP1 expression. In
addition, Western blot analyses showed that p21 protein expressions
were increased by the forced expression of p300 protein. These findings
suggest that the balance of the expression level between p300 and
EWS-Fli1 might control the p21WAF1/CIP1 transcription in
EFT cells.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of p300 overexpression on
p21WAF1/CIP1 promoter activity in EFT. EFT cells were
transiently cotransfected with 1 µg of the reporter construct H2320
and p300 expression vector or control vector. Forty eight hours after
the transfection, cells were harvested and subjected to luciferase
activity assay and Western blotting (WB).
|
|
Repression of p300-mediated Histone Deacetylation Activity by
EWS-Fli1--
p300/CBP is known to form a large complex with other
basal transcription factors, and it transactivates various target genes including p21WAF1/CIP1 through the acetylation of histone
tails of the nucleosomes. Therefore, we next examined the effect of
EWS-Fli1 on the histone acetyltransferase (HAT) activity of p300, PCAF,
and TAF II p250. The HAT activity of p300 was determined by in
vitro acetylation of the core histone with the endogenous p300,
immunoprecipitated from nuclear extracts of SK-N-MC cells or
mouse embryonal fibroblast transfected with various doses of
EWS-Fli1, Fli1, or EWS-Fli1 deleted with the ETS binding domain
( Ets). In the presence of the antisense oligonucleotides, p300
precipitants exhibited ~3.2-fold HAT activity compared with that of
the sense-treated immunoprecipitants (Fig.
9B), whereas antisense or
sense oligonucleotide treatment did not modify the expression of p300,
PCAF, or TAFII p250 in EFT cell lines (Fig. 9A).
Furthermore, the overexpression of EWS-Fli1 dose-dependently inhibited the p300-mediated HAT activity
in Swiss 3T3 cells, whereas Fli1 and Ets did not modify the
p300-mediated HAT activity (Fig. 9C). As for the activities
of another major histone acetyltransferase, PCAF were slightly enhanced
by the antisense oligonucleotide treatment. On the other hand, TAFII p250-mediated HAT activity was not influenced by EWS-Fli1 (Fig. 9B). This evidence strongly indicates that EWS-Fli1 might
bind to the ETS-binding consensus sequences in the
p21WAF1/CIP1 promoter and inhibits the acetyltransferase
activity of p300, which may partly explain the negative regulation of
p21WAF1/CIP1 in EFT cells. On the other hand, Fli1 does not
modify the p300-mediated HAT activity, which is in line with the fact
that Fli1 does not associate with p300. Thus, Fli1 might transactivate
p21WAF1/CIP1 expression unrelated to the HAT activity of
p300.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 9.
Suppression of the p300-mediated histone
acetyltransferase activity by EWS-Fli1. A, EFT cell
lines were cultured in the presence of 10 µM sense or
antisense oligonucleotides of EWS-Fli1 for 48 h. Total cell
lysates were extracted from cells and subjected to Western blot
analyses using antibodies to p300, PCAF, and TAFII p250.
NT, S, and AS represent no treatment,
sense oligonucleotide, and antisense oligonucleotide treatment,
respectively. B, SK-N-MC cells were treated with 10 µM sense or antisense oligonucleotides of
EWS-Fli1 for 48 h. Nuclear extracts of each sample were
immunoprecipitated with anti-p300, anti-PCAF, or anti-TAFII p250
monoclonal antibody, and then each was subjected to histone
acetyltransferase (HAT) activity assays, as described under
"Experimental Procedures." C, each nuclear extract from
Swiss 3T3 cells transfected with mock, EWS-Fli1, Fli1, or
Ets was subjected to p300-immunoprecipitated HAT activity assays.
These experiments were repeated at least three times.
Bars represent S.E.
|
|
To assess directly whether the suppression of p21WAF1/CIP1 by
EWS-Fli1 correlates with changes in the status of histone acetylation in EFT cells, we next performed chromatin immunoprecipitation assays
using antibodies to acetylated histone H3 or H4. As shown in Fig.
10A, acetylated chromatin
was increased by antisense oligonucleotide treatment compared with that
of the sense oligonucleotide treatment. We also found that antisense
treatment significantly increased the acetylation status of both H3 and
H4 histone on the p21WAF1/CIP1 promoter (Fig.
10B). Taken together, these data strongly indicate that
EWS-Fli1 inhibits p21WAF1/CIP1 gene expression via modulation
of acetylation status of endogenous p21WAF1/CIP1 gene in EFT
cells.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 10.
EWS-Fli1 modifies histone acetylation status
on p21WAF1/CIP1 gene. A, Western blot
(WB) analysis of acetylated histone H3 (AcH3) and
H4 (AcH4) in SK-N-MC cells. The antisense oligonucleotides
up-regulate the acetylation status of histone H3 and H4. B,
relative histone acetylation levels were determined by quantification
of Western blot images shown in A using NIH Image software
and by correction with the internal control (actin). The data were
represented as ratios of relative acetylation of H3 or H4 in the
presence of antisense (AS) or sense (S)
oligonucleotides versus the absence of oligonucleotide
treatment (NT). C, representative data of
chromatin immunoprecipitation assay. Soluble chromatin preparation from
cell cultures treated with sense or antisense oligonucleotides were
immunoprecipitated with the antibody against acetylated histone H3
(Ac-H3), H4 (Ac-H4), or normal rabbit
immunoglobulin (IgG) and analyzed by PCR. Aliquots of the
chromatin were also analyzed before immunoprecipitation
(Input). D, the relative acetylation status of
histone on the p21WAF1/CIP1 gene was determined by
quantification of the PCR product shown in C using NIH Image
software and by correction with the input data. Each column represents
a ratio of relative acetylation of H3 or H4 in the presence of
antisense (AS) or sense (S) oligonucleotides
versus the absence of oligonucleotide treatment
(NT).
|
|
Inhibition of the Proliferation of SK-N-MC Cells by Sodium
Butyrate--
Recently, it has been revealed that histone deacetylase
inhibitors (HDACIs), including sodium butyrate, can induce
p21WAF1/CIP1 expression and inhibit G1-S phase
transition, resulting in growth arrest and differentiation of various
malignant tumor cell lines (27-30). As EWS-Fli1 interferes
p300-mediated HAT activities, we herein examined the effect of sodium
butyrate on the proliferation of SK-N-MC cells. After application of
various concentrations of butyrate, the number of viable cells was
determined using trypan blue at various time intervals. As shown in
Fig. 11A, the growth inhibitory effect of butyrate was dose-dependent in the
range of 0.625 to 5 mM. The cell viability was not
significantly affected by butyrate treatment in this range of
concentration. However, 10 mM butyrate was to the same
extent cytocidal as reported previously (31) using other cell
lines.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 11.
Effect of sodium butyrate on
p21WAF1/CIP1 expression, histone acetylation activity, and
growth of SK-N-MC cells. A, effects of sodium butyrate
on growth of SK-N-MC cells. Various concentrations of butyrate were
applied to SK-N-MC cells. After various time intervals, the number of
viable cells was counted using trypan blue. The growth inhibitory
effect of butyrate was dose-dependent in the range of
0.625-5 mM of the concentration. Closed
circles, control; open circles, 0.625 mM;
closed squares, 1.25 mM; open
squares, 5 mM. Bars represent S.E.
B, SK-N-MC cells were treated with various concentrations of
butyrate. mRNA and total cell lysates were extracted from cells and
subjected to RT-PCR and Western blot analyses. C, the time
course study of sodium butyrate treatment on SK-N-MC cells. SK-N-MC
cells were treated with 5.0 mM butyrate. mRNA and total
cell lysates were extracted from the cells and subjected to RT-PCR and
Western blot analyses. D, SK-N-MC cells were incubated with
10 µM sense or antisense oligonucleotides or various
doses of sodium butyrate. Forty eight hours after the treatment,
nuclear extracts of each sample were subjected to assay for histone
acetylation activity.
|
|
Induction of p21WAF1/CIP1 mRNA and Protein Expression
in SK-N-MC Cells by Sodium Butyrate--
To determine whether
butyrate-induced growth arrest of EFT cells was related to the
p21WAF1/CIP1 expression, the butyrate-treated cells were
subjected to RT-PCR and Western blot analyses. In untreated SK-N-MC
cells, p21WAF1/CIP1 expression was too weak to be detected
(Fig. 11B, 2nd lane), as we reported previously (6).
However, treatment of cells with butyrate for 24 h induced
p21WAF1/CIP1 expression in a dose-dependent
manner both at mRNA and protein levels (Fig. 11B), in
accordance with the finding that butyrate dose-dependently
inhibited the growth of SK-N-MC cells. In the time course study, 5.0 mM butyrate induced p21WAF1/CIP1 mRNA and
protein expression within 6 h after the treatment, and the
expression levels reached a plateau at around 24 h (Fig.
11C). On the other hand, butyrate did not induce expression
of other major cyclin-dependent kinase inhibitors,
including p27KIP1 and p16INK4A. Furthermore,
application of sodium butyrate did not modify the expression of
cyclin D, cyclin E, nor EWS-Fli1 itself (data not shown). Therefore, treatment with sodium butyrate specifically enhances
p21WAF1/CIP1 expression both at mRNA and protein levels,
which may partly explain the growth inhibitory effect of sodium
butyrate on SK-N-MC cells.
Effect of Sodium Butyrate on the HAT Activity in EFT
Cells--
Because EWS-Fli1 suppressed the p300-mediated HAT activity
in EFT cells, we then investigated whether the application of HDACIs could restore the balance of HAT and HDAC in EFT cells. Nuclear extracts of SK-N-MC cells, treated with antisense or sense
oligonucleotides against EWS-Fli1 or each dose of sodium butyrate, were
incubated with histone H3 peptide and acetyl-CoA. Then acetylated
histone H3 was examined using indirect enzyme-linked immunosorbent
assay kits. As shown in Fig. 11D, the antisense
oligonucleotide treatment up-regulated the overall HAT activity in
SK-N-MC cells to ~3.8-fold over that of the control. Sodium butyrate
also dose-dependently enhanced HAT activity in SK-N-MC
cells up to 8.5-fold over that of the control, meaning HDACIs could
rescue hypoacetylation status in EFT cells. Taken together, these
findings strongly support the idea that HDACIs could serve as novel
molecularly based drugs for EFTs.
 |
DISCUSSION |
The EWS-Fli1 fusion product is considered to affect the expression
of cell cycle-regulating molecules involved in the control of
G1-S transition (5, 6). Among these molecules, the
expression of p21 was not detected in EFT clinical samples (6). On the other hand, it has been reported that EFT usually expresses wild type
p53 despite highly malignant phenotypes of the tumor (23, 32). This
contradiction led us to determine whether EWS-Fli1 fusion protein might
affect the p21WAF1/CIP1 promoter activity through a
p53-independent pathway.
The cell cycle checkpoints play crucial roles in the maintenance of
cell homeostasis. Disruption of cell cycle control mechanisms leads to
malignant transformation. Recent intense studies (33, 34) on cell cycle
regulation have revealed that p21 modulates cyclin-dependent kinase activity and causes cell cycle
arrest at the G1 phase (9), which allows for damaged DNA to
be repaired before entering S phase. Despite the important roles of p21
as a cell cycle regulator (35), inactivating mutations of this gene are
rare in tumor cells, and p21WAF1/CIP1 knock-out mice did not
exhibit increased rates of spontaneous tumor until at least 7 months of
age (36). Therefore, the potential role of p21WAF1/CIP1 in
tumor development has remained controversial. Recently, however, Martin-Caballero et al. (37) showed that
p21WAF1/CIP1-deficient mice have spontaneous tumors at an
average age of 16 months, whereas control animals remain tumor-free for
over 2 years. Furthermore, several studies (38, 39) demonstrate that
down-regulation of p21 leads to the anchorage-independent growth of
tumor cells, which may partly explain the role of p21 in tumor
development. These findings are consistent with the recent findings
that the ETS binding domain of EWS-Fli1 is necessary for promotion of
the anchorage-independent growth of EFT cells (40).
The main finding of this study is that the fusion transcription factor
EWS-Fli1 directly associates with the p21WAF1/CIP1 gene
promoter through ETS-binding sites and suppresses
p21WAF1/CIP1 expression. Despite cumulating evidence
indicating that EWS-Fli1 might transform cells by acting as an aberrant
transcription factor, only a few target genes have been identified,
including manic fringe (41), EWS-Fli1-activated transcript-2
(EAT-2) (42), and mE2-C (a cyclin-selective
ubiquitin-conjugating enzyme) (43). Hahm (44) showed that the
transforming growth factor- II receptor was found to be directly
down-regulated by EWS-Fli1 fusion protein. We obtained evidence that
p21WAF1/CIP1 promoter activity is clearly suppressed by
EWS-Fli1 through the two known ETS-binding sequences in the promoter.
EMSAs revealed that EWS-Fli1 fusion protein directly binds to both the
ETS-binding sites in a sequence-specific manner. The upstream
ETS-binding site on the p21WAF1/CIP1 promoter (EBS1) seemed
to be more important in suppressing p21WAF1/CIP1 expression,
but the downstream ETS-binding site (EBS2) had the potential to enhance
the suppression. These data indicate that p21WAF1/CIP1 is one
of the direct targets of EWS-Fli1 fusion protein. This direct
inhibition of the p21WAF1/CIP1 expression by EWS-Fli1 may
explain, at least in part, the transforming potential of EWS-Fli1.
Down-regulation of the transforming growth factor- II receptor by
EWS-Fli1 (44) may indirectly affect p21WAF1/CIP1 expression
in EFT cells. However, in our study, the down-regulation of EWS-Fli1
did not affect the expression of the transforming growth factor- II
receptor in SK-N-MC, PNKT-1, and RD-ES (data not shown).
Transcriptional regulation plays crucial roles in carcinogenesis, and
gene regulation is mediated through a balance between activator and
repressor factors. Several models for the negative regulatory
mechanisms have been proposed (e.g. competition, quenching, and direct repression of the transcription complex). However, compared
with transcriptional activation, precise mechanisms involved in
transcriptional repression are poorly understood. In case of negative
regulation of the p21WAF1/CIP1 promoter, both ETS-binding
consensus sequences are located so close to p53-binding elements that
the competitive binding of EWS-Fli1 with p53 might explain the
inhibition of p21WAF1/CIP1 expression. However, EFT cell
lines including SK-N-MC and RD-ES, which we used in the present
experiments, have truncation or mutation in the p53 gene
(23). Thus, we concluded that this model of negative regulation is
unlikely. Furthermore, the expression of endogenous Fli1 was not
detectable in EFT cell lines used in the experiments. There is little
possibility that inhibition of p21WAF1/CIP1 expression by
EWS-Fli1 is due to the dominant-negative effect against Fli1. On the
other hand, a variety of factors were reported to form complexes and
activate or repress transcription of p21WAF1/CIP1 (45, 46).
Therefore, we presumed that EWS-Fli1 might associate with other
transcription factors or cofactors, resulting in the negative
regulation of p21WAF1/CIP1 transcription. One of the
mechanisms of transcriptional repression involves inhibition of
transcriptional cofactors such as p300/CBP and PCAF through modulation
of acetyltransferase activities (47). Deacetylation of histones
prevents disassembly of nucleosomes, which makes DNAs inaccessible to
transcriptional activators (47). p300/CBP has HAT activity and
acetylates the target chromatin and/or transcriptional factors to
facilitate a transcriptional response (10, 12). Furthermore, recent
studies (26, 48) revealed that EWS-ATF1 and SYT-SSX chimeric protein,
associated with clear cell sarcoma and synovial sarcoma, respectively,
interacts with p300/CBP and obliterates its functions. The
COOH-terminal region of EWS, which is truncated in EWS-Fli1, has been
shown to form a complex with p300/CBP and function as a transcriptional activator in conjunction with p300/CBP (49). However, they only showed
the interactions of p300/CBP with EWS deletion constructs and not with
EWS-Fli1 constructs. The COOH terminus of Fli1 might modulate the
conformation of EWS protein and enable EWS-Fli1 to associate with
p300/CBP. More recently, Araya et al. (50) demonstrated that
CBP interacts with the NH2-terminal domain of EWS, which is
retained in the EWS-Fli1 fusion protein. Hence, we hypothesized that
EWS-Fli1 might associate with p300/CBP, resulting in the repression of
p300-mediated HAT activity, which explains the mechanism of
p21WAF1/CIP1 suppression by EWS-Fli1. The
coimmunoprecipitation and immunofluorescence assays revealed that
EWS-Fli1 interacts with p300 in vivo. EWS-Fli1 inhibited
p300-mediated activation of the p21WAF1/CIP1 promoter in the
Swiss 3T3 cell. Overexpression of p300 in EFT cell lines enhanced the
activity of the p21WAF1/CIP1 promoter and the expression of
p21 protein, indicating that EWS-Fli1 might inhibit the p300-mediated
activation of the p21WAF1/CIP1 promoter in EFT cells.
Furthermore, histone acetyltransferase activity assays revealed that
EWS-Fli1 suppressed the p300-mediated HAT activity in vitro.
Similar mechanisms were observed in E1A and ETS family oncoprotein
PU.1, which inhibits acetyltransferase activity of p300 and CBP,
respectively (51, 52). PCAF-mediated HAT activity was slightly
suppressed by EWS-Fli1. This may be explained by the interaction
between p300/CBP and PCAF (12). By using chromatin immunoprecipitation
assays, we also demonstrated that the acetylation of histone on the
endogenous p21WAF1/CIP1 gene was suppressed by EWS-Fli1 in
EFT cells. This evidence indicates that EWS-Fli1 interacts with
p300/CBP and inhibits the acetyltransferase activity of p300, which may
partly explain the negative regulation of p21WAF1/CIP1 in EFT cells.
Despite the advances in multimodal therapy or application of high dose
chemotherapy followed by peripheral blood stem cell transfusion
techniques (53), the 5-year survival rate of metastatic cases of EFT is
still below 30% (54). Several gene-targeting therapies have been
considered for this highly malignant tumor, including the introduction
of virus vector encoding antisense-EWS-Fli1 or treatment of
antisense oligonucleotides against EWS-Fli1 (4, 5). However,
the use of a virus has to overcome a number of obstacles including
development of reproducible procedures for the efficient and safe
delivery of the virus to the cells and tissues. Although the antisense
oligonucleotide treatment would be beneficial, the therapy requires
huge amounts of oligonucleotides. Recently, there have been intense
studies on HDACIs, which remodel chromatin structures through the
inhibition of intrinsic HDACs. HDACIs can reactivate gene expression
and inhibit the growth and survival of tumor cells, and most HDACIs
induce p21WAF1/CIP1 expression through the Sp1 and/or Sp3
sites in its promoter (31, 55). Because EWS-Fli1 protein directly
down-regulates the expression of p21WAF1/CIP1 at the promoter
level, agents activating the p21WAF1/CIP1 promoter may prove
effective for molecular targeting therapies against EFTs. Furthermore,
because EWS-Fli1 inhibits the p300-mediated HAT activity, application
of HDACIs could restore a balance between HAT and HDAC activities in
EFT cells. Therefore, we first examined the effect of sodium butyrate,
one of the HDACIs, on the proliferation of EFT cells in
vitro. The proliferation of SK-N-MC cells was greatly inhibited by
sodium butyrate in a dose-dependent manner. The treatment
of sodium butyrate also induced expression of p21WAF1/CIP1
both at mRNA and protein levels in SK-N-MC cells. Furthermore, HAT
activity, which was suppressed by EWS-Fli1, was counterbalanced by
treatment with sodium butyrate. We have also proved that HDACIs have
anti-tumor activities on EFT in vivo (data not shown). These findings underscore the potential of HDACIs as promising agents for the
treatment of EFT.
In conclusion, we demonstrated that EWS-Fli1 fusion protein directly
binds to the p21WAF1/CIP1 promoter through ETS-binding sites
and negatively regulates p21WAF1/CIP1 gene expression by
inhibiting p300-mediated HAT activity. This novel mechanism may partly
explain the unlimited growth of EFT cells in the presence of EWS-Fli1
fusion protein.
 |
ACKNOWLEDGEMENT |
We thank Christopher T. Denny for the
pFLAG-CMV-EWS-Fli1 construct.
 |
FOOTNOTES |
*
This work was supported by Grants-in-aid for Scientific
Research 14207057 and 12557125 from the Japan Society for the Promotion of Science, a grant-in-aid for Cancer Research from the Ministry of
Health, Labor, and Welfare, Japan, and a grant-in-aid for cancer research from the Fukuoka Cancer Society.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Orthopedic
Surgery, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Tel.: 81-92-642-5488; Fax: 81-92-642-5507; E-mail: tanaka@ortho.med.kyushu-u.ac.jp.
Published, JBC Papers in Press, January 30, 2003, DOI 10.1074/jbc.M211470200
 |
ABBREVIATIONS |
The abbreviations used are:
EFT, Ewing's family
tumors;
ES, Ewing's sarcoma;
CBP, CREB-binding protein;
PBS, phosphate-buffered saline;
RT, reverse transcriptase;
MOPS, 4-morpholinepropanesulfonic acid;
EMSA, electromobility shift assay;
HA, hemagglutinin;
FITC, fluorescein isothiocyanate;
HDACIs, histone
deacetylase inhibitors;
HDAC, histone deacetylase;
HAT, histone
acetyltransferase.
 |
REFERENCES |
| 1.
|
Delattre, O.,
Zucman, J.,
Plougastel, B.,
Desmaze, C.,
Melot, T.,
Peter, M.,
Kovar, H.,
Joubert, I.,
de Jong, P.,
Rouleau, G.,
Aurias, A.,
and Thomas, G.
(1992)
Nature
359,
162-165[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
May, W. A.,
Lessnick, S. L.,
Braun, B. S.,
Klemsz, M.,
Lewis, B. C.,
Lunsford, L. B.,
Hromas, R.,
and Denny, C. T.
(1993)
Mol. Cell. Biol.
13,
7393-7398[Abstract/Free Full Text]
|
| 3.
|
May, W. A.,
Gishizky, M. L.,
Lessnick, S. L.,
Lunsford, L. B.,
Lewis, B. C.,
Delattre, O.,
Zucman, J.,
Thomas, G.,
and Denny, C. T.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5752-5756[Abstract/Free Full Text]
|
| 4.
|
Ouchida, M.,
Ohno, T.,
Fujimura, Y.,
Rao, V. N.,
and Reddy, E. S.
(1995)
Oncogene
11,
1049-1054[Medline]
[Order article via Infotrieve]
|
| 5.
|
Tanaka, K.,
Iwakuma, T.,
Harimaya, K.,
Sato, H.,
and Iwamoto, Y.
(1997)
J. Clin. Invest.
99,
239-247[Medline]
[Order article via Infotrieve]
|
| 6.
|
Matsumoto, Y.,
Tanaka, K.,
Nakatani, F.,
Matsunobu, T.,
Matsuda, S.,
and Iwamoto, Y.
(2001)
Br. J. Cancer
84,
768-775[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Xiong, Y.,
Hannon, G. J.,
Zhang, H.,
Casso, D.,
Kobayashi, R.,
and Beach, D.
(1993)
Nature
366,
701-704[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Gartel, A. L.,
Serfas, M. S.,
and Tyner, A. L.
(1996)
Proc. Soc. Exp. Biol. Med.
213,
138-149[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
el-Deiry, W. S.,
Tokino, T.,
Velculescu, V. E.,
Levy, D. B.,
Parsons, R.,
Trent, J. M.,
Lin, D.,
Mercer, W. E.,
Kinzler, K. W.,
and Vogelstein, B.
(1993)
Cell
75,
817-825[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Bannister, A. J.,
and Kouzarides, T.
(1996)
Nature
384,
641-643[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Munshi, N.,
Merika, M.,
Yie, J.,
Senger, K.,
Chen, G.,
and Thanos, D.
(1998)
Mol. Cell
2,
457-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Ogryzko, V. V.,
Schiltz, R. L.,
Russanova, V.,
Howard, B. H.,
and Nakatani, Y.
(1996)
Cell
87,
953-959[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Macleod, K. F.,
Sherry, N.,
Hannon, G.,
Beach, D.,
Tokino, T.,
Kinzler, K.,
Vogelstein, B.,
and Jacks, T.
(1995)
Genes Dev.
9,
935-944[Abstract/Free Full Text]
|
| 14.
|
Funaoka, K.,
Shindoh, M.,
Yoshida, K.,
Hanzawa, M.,
Hida, K.,
Nishikata, S.,
Totsuka, Y.,
and Fujinaga, K.
(1997)
Biochem. Biophys. Res. Commun.
236,
79-82[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Tanaka, K.,
Iwamoto, Y.,
Noguchi, Y.,
Oda, Y.,
and Sugioka, Y.
(1995)
Lab. Invest.
72,
237-248[Medline]
[Order article via Infotrieve]
|
| 16.
|
Heid, C. A.,
Stevens, J.,
Livak, K. J.,
and Williams, P. M.
(1996)
Genome Res.
6,
986-994[Abstract/Free Full Text]
|
| 17.
|
Tanaka, K.,
Iwamoto, Y.,
Ito, Y.,
Ishibashi, T.,
Nakabeppu, Y.,
Sekiguchi, M.,
and Sugioka, Y.
(1995)
Cancer Res.
55,
2927-2935[Abstract/Free Full Text]
|
| 18.
|
el-Deiry, W. S.,
Tokino, T.,
Waldman, T.,
Oliner, J. D.,
Velculescu, V. E.,
Burrell, M.,
Hill, D. E.,
Healy, E.,
Rees, J. L.,
Hamilton, S. R.,
Kinzler, K. W.,
and Vogelstein, B.
(1995)
Cancer Res.
55,
2910-2919[Abstract/Free Full Text]
|
| 19.
|
Okamoto, T.,
Izumi, H.,
Imamura, T.,
Takano, H.,
Ise, T.,
Uchiumi, T.,
Kuwano, M.,
and Kohno, K.
(2000)
Oncogene
19,
6194-6202[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Beier, F.,
Taylor, A. C.,
and LuValle, P.
(1999)
J. Biol. Chem.
274,
30273-30279[Abstract/Free Full Text]
|
| 21.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489[Abstract/Free Full Text]
|
| 22.
|
Wong, H.,
and Riabowol, K.
(1996)
Exp. Gerontol.
31,
311-325[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Kovar, H.,
Auinger, A.,
Jug, G.,
Aryee, D.,
Zoubek, A.,
Salzer-Kuntschik, M.,
and Gadner, H.
(1993)
Oncogene
8,
2683-2690[Medline]
[Order article via Infotrieve]
|
| 24.
|
Goodman, R. H.,
and Smolik, S.
(2000)
Genes Dev.
14,
1553-1577[Free Full Text]
|
| 25.
|
Xiao, H.,
Hasegawa, T.,
and Isobe, K.
(2000)
J. Biol. Chem.
275,
1371-1376[Abstract/Free Full Text]
|
| 26.
|
Fujimura, Y.,
Siddique, H.,
Lee, L.,
Rao, V. N.,
and Reddy, E. S.
(2001)
Oncogene
20,
6653-6659[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Leder, A.,
and Leder, P.
(1975)
Cell
5,
319-322[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Graham, K. A.,
and Buick, R. N.
(1988)
J. Cell. Physiol.
136,
63-71[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Saito, H.,
Morizane, T.,
Watanabe, T.,
Kagawa, T.,
Miyaguchi, S.,
Kumagai, N.,
and Tsuchiya, M.
(1991)
Int. J. Cancer
48,
291-296[Medline]
[Order article via Infotrieve]
|
| 30.
|
Dong, Q. G.,
Gong, L. L.,
Wang, H. J.,
and Wang, E. Z.
(1993)
Anti-Cancer Drugs
4,
617-627[Medline]
[Order article via Infotrieve]
|
| 31.
|
Nakano, K.,
Mizuno, T.,
Sowa, Y.,
Orita, T.,
Yoshino, T.,
Okuyama, Y.,
Fujita, T.,
Ohtani-Fujita, N.,
Matsukawa, Y.,
Tokino, T.,
Yamagishi, H.,
Oka, T.,
Nomura, H.,
and Sakai, T.
(1997)
J. Biol. Chem.
272,
22199-22206[Abstract/Free Full Text]
|
| 32.
|
de Alava, E.,
Antonescu, C. R.,
Panizo, A.,
Leung, D.,
Meyers, P. A.,
Huvos, A. G.,
Pardo-Mindan, F. J.,
Healey, J. H.,
and Ladanyi, M.
(2000)
Cancer (Phila.)
89,
783-792[CrossRef]
|
| 33.
|
Ko, L. J.,
and Prives, C.
(1996)
Genes Dev.
10,
1054-1072[Free Full Text]
|
| 34.
|
Sherr, C. J.
(1996)
Science
274,
1672-1677[Abstract/Free Full Text]
|
| 35.
|
Sherr, C. J.,
and Roberts, J. M.
(1999)
Genes Dev.
13,
1501-1512[Free Full Text]
|
| 36.
|
Deng, C.,
Zhang, P.,
Harper, J. W.,
Elledge, S. J.,
and Leder, P.
(1995)
Cell
82,
675-684[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Martin-Caballero, J.,
Flores, J. M.,
Garcia-Palencia, P.,
and Serrano, M.
(2001)
Cancer Res.
61,
6234-6238[Abstract/Free Full Text]
|
| 38.
|
Fang, F.,
Orend, G.,
Watanabe, N.,
Hunter, T.,
and Ruoslahti, E.
(1996)
Science
271,
499-502[Abstract]
|
| 39.
|
Wu, R. C.,
and Schonthal, A. H.
(1997)
J. Biol. Chem.
272,
29091-29098[Abstract/Free Full Text]
|
| 40.
|
Welford, S. M.,
Hebert, S. P.,
Deneen, B.,
Arvand, A.,
and Denny, C. T.
(2001)
J. Biol. Chem.
276,
41977-41984[Abstract/Free Full Text]
|
| 41.
|
May, W. A.,
Arvand, A.,
Thompson, A. D.,
Braun, B. S.,
Wright, M.,
and Denny, C. T.
(1997)
Nat. Genet.
17,
495-497[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Thompson, A. D.,
Braun, B. S.,
Arvand, A.,
Stewart, S. D.,
May, W. A.,
Chen, E.,
Korenberg, J.,
and Denny, C.
(1996)
Oncogene
13,
2649-2658[Medline]
[Order article via Infotrieve]
|
| 43.
|
Arvand, A.,
Bastians, H.,
Welford, S. M.,
Thompson, A. D.,
Ruderman, J. V.,
and Denny, C. T.
(1998)
Oncogene
17,
2039-2045[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Hahm, K. B.
(1999)
Nat. Genet.
23,
481[Medline]
[Order article via Infotrieve]
|
| 45.
|
Gartel, A. L.,
and Tyner, A. L.
(1999)
Exp. Cell Res.
246,
280-289[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Fang, J. Y.,
and Lu, Y. Y.
(2002)
World J. Gastroenterol.
8,
400-405[Medline]
[Order article via Infotrieve]
|
| 47.
|
Hamamori, Y.,
Sartorelli, V.,
Ogryzko, V.,
Puri, P. L.,
Wu, H. Y.,
Wang, J. Y.,
Nakatani, Y.,
and Kedes, L.
(1999)
Cell
96,
405-413[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Eid, J. E.,
Kung, A. L.,
Scully, R.,
and Livingston, D. M.
(2000)
Cell
102,
839-848[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Rossow, K. L.,
and Janknecht, R.
(2001)
Cancer Res.
61,
2690-2695[Abstract/Free Full Text]
|
| 50.
|
Araya, N.,
Hirota, K.,
Shimamoto, Y.,
Miyagishi, M.,
Yoshida, E.,
Ishida, J.,
Kaneko, S.,
Kaneko, M.,
Nakajima, T.,
and Fukamizu, A.
(2002)
J. Biol. Chem.
278,
5427-5432[Medline]
[Order article via Infotrieve]
|
| 51.
|
Chakravarti, D.,
Ogryzko, V.,
Kao, H. Y.,
Nash, A.,
Chen, H.,
Nakatani, Y.,
and Evans, R. M.
(1999)
Cell
96,
393-403[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Hong, W.,
Kim, A. Y.,
Ky, S.,
Rakowski, C.,
Seo, S. B.,
Chakravarti, D.,
Atchison, M.,
and Blobel, G. A.
(2002)
Mol. Cell. Biol.
22,
3729-3743[Abstract/Free Full Text]
|
| 53.
|
Tanaka, K.,
Matsunobu, T.,
Sakamoto, A.,
Matsuda, S.,
and Iwamoto, Y.
(2002)
J. Orthop. Sci.
7,
477-482[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Ahrens, S.,
Hoffmann, C.,
Jabar, S.,
Braun-Munzinger, G.,
Paulussen, M.,
Dunst, J.,
Rube, C.,
Winkelmann, W.,
Heinecke, A.,
Gobel, U.,
Winkler, K.,
Harms, D.,
Treuner, J.,
and Jurgens, H.
(1999)
Med. Pediatr. Oncol.
32,
186-195[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Sowa, Y.,
Orita, T.,
Hiranabe-Minamikawa, S.,
Nakano, K.,
Mizuno, T.,
Nomura, H.,
and Sakai, T.
(1999)
Ann. N. Y. Acad. Sci.
886,
195-199[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. J. Embree, M. Azuma, and D. D. Hickstein
Ewing Sarcoma Fusion Protein EWSR1/FLI1 Interacts with EWSR1 Leading to Mitotic Defects in Zebrafish Embryos and Human Cell Lines
Cancer Res.,
May 15, 2009;
69(10):
4363 - 4371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. P. Lin, M. K. Pandey, F. Jin, S. Xiong, M. Deavers, J. M. Parant, and G. Lozano
EWS-FLI1 Induces Developmental Abnormalities and Accelerates Sarcoma Formation in a Transgenic Mouse Model
Cancer Res.,
November 1, 2008;
68(21):
8968 - 8975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ban, I. M. Bennani-Baiti, M. Kauer, K.-L. Schaefer, C. Poremba, G. Jug, R. Schwentner, O. Smrzka, K. Muehlbacher, D. N.T. Aryee, et al.
EWS-FLI1 Suppresses NOTCH-Activated p53 in Ewing's Sarcoma
Cancer Res.,
September 1, 2008;
68(17):
7100 - 7109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Liu, H. Cheng, W. Kwan, J. M. Lubieniecka, and T. O. Nielsen
Histone deacetylase inhibitors induce growth arrest, apoptosis, and differentiation in clear cell sarcoma models
Mol. Cancer Ther.,
June 1, 2008;
7(6):
1751 - 1761.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Carrillo, E. Garcia-Aragoncillo, D. Azorin, N. Agra, A. Sastre, I. Gonzalez-Mediero, P. Garcia-Miguel, A. Pestana, S. Gallego, D. Segura, et al.
Cholecystokinin Down-Regulation by RNA Interference Impairs Ewing Tumor Growth
Clin. Cancer Res.,
April 15, 2007;
13(8):
2429 - 2440.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Iwamoto
Diagnosis and Treatment of Ewing's Sarcoma
Jpn. J. Clin. Oncol.,
February 1, 2007;
37(2):
79 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Sakimura, K. Tanaka, S. Yamamoto, T. Matsunobu, X. Li, M. Hanada, T. Okada, T. Nakamura, Y. Li, and Y. Iwamoto
The Effects of Histone Deacetylase Inhibitors on the Induction of Differentiation in Chondrosarcoma Cells
Clin. Cancer Res.,
January 1, 2007;
13(1):
275 - 282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yang, W. Wei, M. Menconi, and P.-O. Hasselgren
Dexamethasone-induced protein degradation in cultured myotubes is p300/HAT dependent
Am J Physiol Regulatory Integrative Comp Physiol,
January 1, 2007;
292(1):
R337 - R334.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mateo-Lozano, P. C. Gokhale, V. A. Soldatenkov, A. Dritschilo, O. M. Tirado, and V. Notario
Combined Transcriptional and Translational Targeting of EWS/FLI-1 in Ewing's Sarcoma.
Clin. Cancer Res.,
November 15, 2006;
12(22):
6781 - 6790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Tirado, S. Mateo-Lozano, J. Villar, L. E. Dettin, A. Llort, S. Gallego, J. Ban, H. Kovar, and V. Notario
Caveolin-1 (CAV1) Is a Target of EWS/FLI-1 and a Key Determinant of the Oncogenic Phenotype and Tumorigenicity of Ewing's Sarcoma Cells.
Cancer Res.,
October 15, 2006;
66(20):
9937 - 9947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kawamura-Saito, Y. Yamazaki, K. Kaneko, N. Kawaguchi, H. Kanda, H. Mukai, T. Gotoh, T. Motoi, M. Fukayama, H. Aburatani, et al.
Fusion between CIC and DUX4 up-regulates PEA3 family genes in Ewing-like sarcomas with t(4;19)(q35;q13) translocation
Hum. Mol. Genet.,
July 1, 2006;
15(13):
2125 - 2137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Matsunobu, K. Tanaka, T. Nakamura, F. Nakatani, R. Sakimura, M. Hanada, X. Li, T. Okada, Y. Oda, M. Tsuneyoshi, et al.
The Possible Role of EWS-Fli1 in Evasion of Senescence in Ewing Family Tumors
Cancer Res.,
January 15, 2006;
66(2):
803 - 811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Riggi, L. Cironi, P. Provero, M.-L. Suva, K. Kaloulis, C. Garcia-Echeverria, F. Hoffmann, A. Trumpp, and I. Stamenkovic
Development of Ewing's Sarcoma from Primary Bone Marrow-Derived Mesenchymal Progenitor Cells
Cancer Res.,
December 15, 2005;
65(24):
11459 - 11468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. M. Tirado, S. Mateo-Lozano, and V. Notario
Roscovitine Is an Effective Inducer of Apoptosis of Ewing's Sarcoma Family Tumor Cells In vitro and In vivo
Cancer Res.,
October 15, 2005;
65(20):
9320 - 9327.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hu-Lieskovan, J. Zhang, L. Wu, H. Shimada, D. E. Schofield, and T. J. Triche
EWS-FLI1 Fusion Protein Up-regulates Critical Genes in Neural Crest Development and Is Responsible for the Observed Phenotype of Ewing's Family of Tumors
Cancer Res.,
June 1, 2005;
65(11):
4633 - 4644.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J. Rorie and B. E. Weissman
The Ews/Fli-1 Fusion Gene Changes the Status of p53 in Neuroblastoma Tumor Cell Lines
Cancer Res.,
October 15, 2004;
64(20):
7288 - 7295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Matsunobu, K. Tanaka, Y. Matsumoto, F. Nakatani, R. Sakimura, M. Hanada, X. Li, Y. Oda, I. Naruse, H. Hoshino, et al.
The Prognostic and Therapeutic Relevance of p27kip1 in Ewing's Family Tumors
Clin. Cancer Res.,
February 1, 2004;
10(3):
1003 - 1012.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|