 |
INTRODUCTION |
Reciprocal chromosomal translocations in specific types of
leukemia have consistently led to the isolation of genes important for
the oncogenic process (1). An atypical chronic form of myeloproliferative disease
(MPD)1 was described some
years ago (2) that is associated with T-cell leukemia/lymphoma and
peripheral blood eosinophilia. Cytogenetic analysis of bone marrow
aspirated from these patients showed a consistent reciprocal chromosome
translocation t(8;13)(p11;q12). In some cases this rearrangement was
the only cytogenetic abnormality. In our initial studies we identified
the position of the translocation breakpoints using fluorescent
in situ hybridization (3) and then used somatic cell hybrids
to clearly define the location of the breakpoints on both chromosomes
(4, 5). The 8p11 translocation breakpoint was subsequently shown to
interrupt the FGFR1 gene, and in all of the patients reported so far,
these breakpoints cluster within intron 8. The chromosome breakpoint in
13q12 was reported by several groups to involve a zinc
finger-containing gene, ZNF198 (also called RAMP8 and FIM), where the
breakpoint is consistently located in intron 17. Despite some
discrepancies in early reports (6, 7), the full-length structure of the ZNF198 gene and the nature of the fusion gene were resolved (8, 9),
which demonstrated that the chimeric gene resulted from an in-frame
fusion of the ZNF198 zinc finger motif and proline-rich domain (PRD)
with the intracellular domain containing the tyrosine kinase region of
FGFR1.
ZNF198 is a widely expressed gene and is predicted to encode a
1377-amino acid nuclear protein with a molecular mass of 155 kDa
(7-10). Prominent features of ZNF198 are the five zinc finger motifs
and a PRD within the central portion of the protein and an acidic
domain at the C-terminal end of the protein. The zinc finger motif is
unusual in that its structure is characteristic of protein-protein
interactions rather than a transcription factor. Despite these motifs,
the function of this protein is unknown.
FGFR1 is a transmembrane receptor protein-tyrosine kinase belonging to
the fibroblast growth factor receptor family (11). Through fusion of
the cytoplasmic kinase domain to the ZNF198, the resulting chimeric
protein, ZNF198/FGFR1 (hereafter termed FUS) is assumed to exert
signaling functions accounting for the oncogenic event in myeloid cells
(12). Stable expression of FUS in Ba/F3 cells confirmed the
growth-promoting activity by providing the cells with IL-3-independent
survival (13) or even proliferation (14). The same cells indicated an
elevated signaling that included the phosphatidylinositol 3-kinase and
p38 mitogen-activated protein kinase pathways (14, 15). The signaling
specificity of the fusion kinase has been proposed based on the known
function of FGFR1 (11, 16). However, the type of signaling could not be
accurately predicted because the ligand-activated FGFR1 functions at
the plasma membrane, whereas the fusion kinase acts as a cytoplasmic and, to some extent, nuclear protein. The analysis of another fusion
kinase that contains the cytoplasmic domain of FGFR1, FOP/FGFR1, demonstrated the capability of the kinase to act in Ba/F3 cells via
pathways that include STAT1 and STAT3, ERK, and phosphatidylinositol 3-kinase/Akt (17). The constitutive activity of FGFR1 kinase, whether
as part of ZNF198/FGFR1, FOP/FGFR1, or Bcr/FGFR1, has been attributed
to the oligomerizing activity provided by each of the N-terminal fusion
partners (9, 13, 15, 18)
Because the expression of ZNF198/FGFR1 in Ba/F3 cells displayed some of
the properties associated with the action of hematopoietic cytokine
receptors, we investigated the range of signaling that is executed by
the fusion kinase and whether this signaling is identifiable by the
specificity of transcriptional regulation of cytokine-responsive genes.
By using various experimental cell models we have identified a
signaling capacity that is comparable with that of IL-6 cytokines.
 |
MATERIALS AND METHODS |
Constructs--
The various expression vectors for constructs
containing ZNF198 and FGFR1 sequences are described in Fig. 1. The
full-length ZNF198 cDNA was amplified from a fetal bone marrow
cDNA library (Clontech), and ZNF198/FGFR1 (FUS)
cDNA was amplified from a patient RNA sample (4). The cDNAs
were inserted into the pcDNA3 vector. The ATG codon from each of
these constructs was modified to ATCC and then cloned into the pEGFPc2
vector using BglII/SalI sites yielding GFP-ZNF198
and GFP-FUS, respectively (19). The full-length FGFR1 gene was
amplified from HEK 293 cDNA using a BamHI-modified FGFR1 forward primer (AAAGGATCCATGTGGAGCTGGAAGTGCC) and a
NotI-modified FGFR1 reverse primer
(ATTTGATAGCGGCCGCTCAGCGGCGTTTGAGTCC) and then cloned into the
BamHI/NotI sites of pcDNA3. To generate
GFP-FUS lacking the PRD, GFP-FUS(
PRD), the ZNF198-
PRD portion was
amplified by using the KpnI/ZNF198 forward primer
(CGGGGTACCCCGATCCTGGCAGGAGACGTTTTT) and the XbaI/ZNF198
reverse primer (TGCTCTAGAGCAGTCATTTTGGTTCGAGATGTCTG). The FGFR1 portion
was amplified using the XbaI/FGFR1 forward primer (TGCTCTAGAGCAGTGTCTGCTGACTCCAGTGCATCCATGAAC) and the
BamHI/FGFR1 reverse primer
(CGCGGATCCGCGTCAGCGGCGTTTGAGTCCGCCATTGG) and cloned into the
KpnI/BamHI sites of the pEGFPc2 vector. FUS
lacking exons 7-17 (
7-17), thus devoid of the distal four zinc
fingers and the PRD, was derived by the in-frame fusion of ZNF198 exons
1-7 with FGFR1 exons 9-17 using NheI-modified primers. The
C-terminally truncated ZNF198 gene, ZF1, which represents the
portion of ZNF198 that is present in FUS, was generated using
forward (ATGGACACAAGTTCAGTGGGA) and reverse primers
(CCTTTTTTTTAGATCGAGGTCTG) and cloned into the pcDNA3.1 GFP-CT TOPO
vector (Invitrogen). The Bcr/FGFR1 chimeric kinase, as described by
Demiroglu et al. (15), was generated using the
KpnI Bcr1 forward primer
(GGGGTACCCCATGGTGGACCCGGTGGGCTTCGCGGAGGCG) and the XbaI BcR1
reverse primer (TGCTCTAGAGCAAATATTCAGCTTCTGGAAGAGGTCGCC) in combination
with the XbaI FGFR1 forward primer
(TGCTCTAGAGCAGTGTCTGCTGACTCCAGTGCATCCATG) and the NotI FGFR1
reverse primer (ATAAGAATGCGGCCGACTAAACTATTCAGCGGCGTTTGAGT). The
PCR products were digested with the respective enzymes and inserted
into the pcDNA3 expression vector. All of the constructs were
verified by sequencing.
The expression vectors used for the following proteins were: v-Src in
the pDC vector (20); p190Bcr/Abl (5.2-kb EcoRI
fragment of pGDp190Bcr/Abl) and p210Bcr/Abl (6.7-kb EcoRI
fragment of pGDp210Bcr/Abl) (21) subcloned into pSV-Sport1, v-FMS (22),
and v-Abl (23) in the pGD vector (provided by Richard Van Etten, The
Center for Blood Research, Harvard Medical School, Boston, MA); SOCS1
and SOCS3 in the pcDNA1 vector; and STAT1, STAT3, STAT4, STAT5B, and STAT6 in the pDC vector (24, 25). The following reporter gene constructs were applied: the STAT5-sensitive p(8xHRRE)-CAT, the STAT3-sensitive p(5xHPX-IL-6RE)-CAT, and the cytokine-, growth factor-,
and glucocorticoid receptor-sensitive p(3xCytRE)-GRE-AGP-CAT (26).
Cells and Transfection--
Human hepatoma HepG2, breast
carcinoma MCF7, 293, and COS-7 cells were cultured in Dulbecco's
modified Eagle's medium containing 10% fetal calf serum and
antibiotics. HepG2 and 293 cells were transfected using the calcium
phosphate precipitation technique (20, 27) and MCF7 and COS-7 cells
with FuGENE 6 (Roche Molecular Biochemicals). Transfection efficiency
was assessed by co-transfection with the expression vector for either
GFP or red fluorescent protein (Clontech)
and quantified by digital florescent image analysis as described
previously (20). To determine signaling function, transfected cultures
were subdivided and seeded into 24-well culture plates. After a 24-h
recovery period, the cells were treated with cytokines (generally 100 ng/ml), basic FGF (R & D; 10 ng/ml in the presence of 100 units of
heparin), or kinase inhibitor as indicated in the legend to the
appropriate figures. Depending on whether the signal initiation by
cytokines or the induction of CAT reporter genes was being analyzed,
the length of treatment ranged from 15 min to 24 h. For immunoblot
analysis, the cells were extracted within the culture wells with RIPA
buffer (50 µl/cm2 monolayer). CAT activity was determined
in serially diluted cell extracts and normalized as described
previously (20). 293 cells stably expressing GFP-FUS, FUS, FGFR1, or
GFP were generated by transfecting the cells with the expression vector
for these proteins. Transfectants were selected by culturing in the
presence of 1 mg/ml G-418 for 3-5 weeks (two to four passages). The
resulting cultures of proliferating cells were considered "pools"
of stably transfected 293 cells. Subclonal lines were established using the limited dilution technique. Identification of protein-expressing cell cultures and clones relied on detection of the proteins and tyrosine phosphorylation by immunoblotting and GFP fluorescence, where
applicable. The stability of transgene expression in the individual
clones were tested by additional rounds of subcloning.
Immunoblot Analysis--
Aliquots of whole cell lysates (10-30
µg of protein) were separated on 6-12% SDS-polyacrylamide gels. The
proteins were transferred to protean membranes (Schleicher & Schuell).
Wherever possible, replicates of the sample series were electrophoresed
on separate gels for identification of multiple antigens (29). This
approach circumvented the problem of incomplete removal of antibodies
during the process of sequential immunoblotting of the same membrane. The membranes were reacted with antibodies to STAT1, STAT3, STAT4, STAT5, STAT6, ERK1, ERK2, the C-terminal epitope of FGFR1 (Santa Cruz
Biotechnology), PY-STAT3, PY-STAT5, P-ERK (New England Biolabs, Inc.),
GFP (Covance Babco), or the N-terminal half of ZNF198 (19) and followed
with secondary antibodies (ICN Biomedicals, Inc., Aurora, OH) in
phosphate-buffered saline containing 0.1% Tween, 5% milk, or 3%
bovine serum albumin. The immunoreactions were visualized using
enhanced chemiluminescene according to the manufacturer's instructions
(Amersham Biosciences). Different time exposures (seconds to 30 min) of
x-ray film (XAR-5, Kodak) to the luminescent patterns were made for
optimal detection of quantitative signal differences. Digital
densitometry of the patterns were analyzed with the ImageQuant program
(Molecular Dynamics).
Size Fractionation of Cell Lysate--
MCF7 cells (1 × 107 in a 15-cm-diameter culture dish) were transfected with
GFP-ZNF198, FUS, GFP-FUS, or FUS(
7-17). After 36 h, the cells
were washed with Tris-buffered saline, scraped, and collected by
centrifugation. The cell pellet was resuspended on ice in 300 µl of
extraction buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Nonidet P-40, 1 mM
Na2VO4, 1 mM phenylmethylsulfonyl
fluoride, 1 mM EGTA, 1 µg/ml of each, aprotinin, and
leupeptin) and disrupted by sonication for 3 s. The cell extract was cleared by ultracentrifugation for 60 min at 100,000 × g. A 200-µl aliquot of the supernatant extract was
directly applied onto a Superose 12 column and separated by FPLC
(Pharmacia Corp.) in extraction buffer at a flow rate of 0.4 ml/min.
Eluant was collected in 0.2-ml fractions. Aliquots of 5 µl from these
fractions were analyzed by Western blotting for FGFR, ZNF198, GFP, and
phosphotyrosine. Purified thyroglobulin, monomeric and dimeric
bovine serum albumin, and chymotrypsinogen were used to size calibrate
the chromatographic separation.
 |
RESULTS |
Expression of Chimeric Kinase Constructs--
The expression
vector containing the cDNAs encoding ZNF198, FUS (ZNF198/FGFR1),
and FGFR1, as shown in Fig. 1, were
transfected into MCF7 cells to determine their expression levels and to
verify that the correct sized proteins were produced. The Western blot assays confirmed the immune detectable presence of the ZNF198 (Fig.
2A) and the FGFR1 epitopes
(Fig. 2B) in bands corresponding to the expected full-length
proteins. Strong expression was seen for the 155-kDa FUS, the 172-kDa
GFP-tagged FUS, and 177-kDa GFP-tagged ZNF198. Expression of
FUS(
7-17) protein, lacking most of the zinc finger motif, was also
detected, but at a relatively low level. Of note is that the turnover
of the untagged, but not the GFP-tagged, FUS protein led to the
accumulation of a stable breakdown product of ~40 kDa that contained
the FGFR1 epitope (Fig. 2B,
FUS). The relative
amount and the molecular size of the degradation product detectable in
the transfected cells were dependent on the cell line. Among the cell
lines tested in this study, the degradation product was most abundant
in MCF7 cells and lowest in 293 cells (see Fig. 11). When the same cell
extracts were probed with an antiphosphotyrosine (anti-PY) antibody,
the full-length constructs containing the FGFR1 kinase domain were
phosphorylated (Fig. 2C). The comparison of immunoblot
signals for FGFR1 and phosphotyrosine indicated that both the untagged
and GFP-tagged FUS were highly phosphorylated. In contrast, the
tyrosine phosphorylation of the overexpressed FGFR1 and FUS(
7-17)
was low, and no phosphorylation was detectable for ZNF198. The relative
expression of the transfected vectors and relative level of
phosphorylation of the different proteins, as seen in MCF7 (Fig. 2),
were also observed in other cells lines (see below), ruling out
appreciable cell type-specific effects on expression and action of
these proteins.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic presentation of the cDNA
constructs of the derivatives from ZNF198 and FGFR1 that were
used in this study. ZN-F, zinc finger motif;
IgC2, immunoglobulin-like C2 type domain; TM,
transmembrane domain.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of transfected constructs in MCF7
cells. MCF7 cells in 6-well plates were transfected with the
expression vector for the cDNA encoding the proteins listed at the
top (4 µg of DNA/well). The cells were extracted 36 h later.
Aliquots of each extract (10 µg protein) were electrophoresed on
three separate gels. The blots with transferred proteins were reacted
with anti-ZNF198 (A), anti-FGFR1 (B), or
anti-phosphotyrosine (C). The positions of the
co-electrophoresed molecular size markers are indicated on the
left, and the positions of the transfected proteins are
indicated on the right. The bands representing
the predicted full-length proteins are also labeled by a solid
dot to the left. The band in the FUS lane marked with
an open circle indicates the proteolytic breakdown product
of FUS at ~40 kDa. WB, Western blotting.
|
|
The detailed morphology of adherent MCF7 and HepG2 cells facilitated
the visualization of the subcellular localization of the transfected
proteins (Fig. 3). GFP-ZNF198 was
localized in both cell types primarily to the nucleus with higher
concentrations in distinct subnuclear structures, including PML bodies.
This pattern did not alter during the extended period of culturing. In
contrast, GFP-FUS revealed a temporal change in distribution. During
the first 12-24 h the FUS appeared to be predominantly cytoplasmic.
During the subsequent culture period, GFP-FUS became more broadly
distributed within the cells, with local accumulation at numerous sites
within the cytoplasm. These accumulations gave the cells a "spotty"
appearance (Fig. 3, GFP-FUS, 36 h). At later time
points, there was also a detectable staining of the nucleus. The
subcellular distribution of GFP-FUS and GFP-ZNF198 is distinct from
that of GFP (Fig. 3, GFP). GFP showed the uniform
cytoplasmic and nuclear distribution. A virtually identical subcellular
distribution as seen for the transfected ZNF198 and FUS was observed
with other cell types, including COS-7, NIH3T3 (data not presented),
and 293 cells (Fig. 4B and
Ref. 13).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
Subcellular localization of GFP-tagged FUS,
GFP, and ZNF198. MCF7 and HepG2 cells were transfected with the
expression vector for GFP-ZNF198, GFP-FUS, or GFP. Fluorescent images
of the transfected cells were taken, at 40× magnification, 16 and
36 h after transfection.
|
|

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 4.
Generation of 293 cells stably expressing
GFP-FUS, FUS, FGFR1, or GFP. Cultures of 293 cells were
transfected with the expression vector for GFP-FUS, FUS, FGFR1, or GFP.
Stable integrants (Pools) were selected by proliferation in
G-418. Clonal lines of GFP-FUS positive cells (Clones 1-12)
were isolated and subjected to a second round of subcloning to confirm
the homogeneity of the expression pattern. A, cell extracts
from the parental 293 cells and clones 1 and 8 of GFP-FUS were analyzed
by Western blotting (WB) for immune detectable
phosphotyrosine (PY) and GFP epitopes. The position of the
full-length GFP-FUS is indicated. B, a phase and fluorescent
image of the culture of GFP-FUS 293 cells, clone 8, was taken at 20×
magnification (left two panels) and is compared with the
fluorescent image of 293 GFP pool cells (right panel).
C, the culture morphology of parental 293 cells, GFP-FUS
clones 1 and 8, 293 FUS pool, and 293 FGFR1 pool, is recorded by phase
microscopy at 10× magnification.
|
|
Phenotypic Changes in Cell Expressing FUS--
To assess the
effects of FUS on proliferation and cellular phenotype, we established
293 cell lines stably expressing FUS. During these experiments, several
important aspects about the ability of cells to support expression of
FUS became evident. Although cells, which were initially selected for
resistance to G-418, showed prominent FUS and GFP-FUS expression as
detectable by immunoblotting and, in the latter case, by fluorescent
microscopy, with serial passage of the pool cultures, the percentage of
FUS-expressing and GFP-positive cells in the population declined. In
contrast, 293 cells transfected with the expression vector for GFP,
GFP-ZNF198, or FGFR1 and selected for G-418 resistance maintained long
term protein expression. This observation suggested that the expression of the active FUS kinase interfered with growth selection. The difficulty in isolating stable clonal lines was best illustrated by
following the visual expression of GFP-FUS. Generally, the intensely
green fluorescent cells present after transfection lost adhesion to the
culture substratum and either apoptosed or, in a few instances
(~1 × 10
3 of the GFP-positive cells), formed
slowly growing spheres. From this we concluded that high level
expression of FUS was cytotoxic and thus prevented the recovery of
stable lines with high expression levels. Among the cells that
maintained adherence, more than 90% of the clonal lines generated from
these cells demonstrated unstable phenotypes. The expression of FUS was
heterogeneous, with frequent occurrence of GFP-FUS proteins being
truncated to forms ranging in size from 28 to 60 kDa. In all of those
cells, the subcellular distribution of GFP changed to an evenly
distributed pattern, the same distribution observed in cells expressing
normal GFP, as shown in Fig. 4B (right panel). On
a few occasions, however, we were able to recover truly stable
subclonal lines that expressed the full-length fusion kinase in all
cells (Fig. 4, A and B, left panels).
From the initially transfected culture of 1 × 106
cells, we succeeded in establishing 12 individual subclonal lines expressing full-length GFP-FUS (numbered 1-12). Our attempt to isolate
stable lines expressing untagged FUS by sequential screening of clones
for kinase expression by immunoblotting proved to be nonproductive.
Although we could determine expression of FUS in pool and few initial
clones, the FUS expression in these cells proved to be instable and,
without the benefit of a vital marker, we were unable to recover the
stable subclonal line.
The GFP-FUS cell lines differ in their level of kinase expression with
the highest level recorded for Clone 1 and lowest for Clone 8 (Fig.
4A). The expression of GFP-FUS as detected using the
anti-GFP immune reaction (Fig. 4A, right panel)
or the anti-FGFR1 immune reaction (not shown) correlated with the
immune reaction with anti-phosphotyrosine (Fig. 4A,
left panel). These cells also demonstrated a close
correlation of FUS expression with altered culture morphology. With
increasing expression of GFP-FUS, the cells formed more tightly
interacting cell clusters with reduced adherence to the tissue culture
substratum (Fig. 4C, left three panels). A
similar change of culture morphology with prominent clusters and
release of cell aggregates was noted in the pool cultures expressing
FUS but not in the pool cultures expressing FGFR1 (Fig. 4C,
right two panels).
Although the GFP-tagged ZNF198 in stably transfected cells localized to
subnuclear structures (13, 19), GFP-FUS in stably expressing 293 cells,
as in transiently transfected cells, was distributed throughout the
cells. Higher concentrations in certain cytoplasmic structures,
however, led to a punctuate appearance of the cells (Fig.
4B, center panel). This pattern differed from the
uniform distribution of GFP that is seen in stably GFP-transfected 293 cells (Fig. 4B, right panel). Interestingly, a
similar punctuate pattern of subcellular distribution was seen in cells
transfected with the truncated version of ZNF198, ZF1-GFP, consisting
of the N-terminal part of FUS but lacking the FGFR1 portion (see Fig. 10). From these results we concluded that the region of the normal ZNF198 responsible for nuclear localization of the protein resides in
the C-terminal portion where the nuclear localization sequence has been
described (13) and that the N-terminal portion determines the
cytoplasmic localization and the accumulation into aggregates.
FUS Activates Specific STAT Proteins--
The transfected FUS is a
constitutively active protein-tyrosine kinase that shows a high level
of autophosphorylation (Figs. 2C and 4A). One of
the consequences of FUS expression is the phosphorylation and
activation of the STAT proteins. The STAT specificity of this action
was determined in the 293 cell lines stably expressing FUS (Fig.
5, A and B, example
of Clone 8; others not presented). The cells showed a constitutively
elevated tyrosine phosphorylation of many cellular proteins beside FUS
(Fig. 5A). The same cells had a detectable tyrosine
phosphorylation of STAT1, STAT3, and STAT5 (Fig. 5B). The
expression level of STAT4 and STAT 6 was low in 293 cells, and thus
their activation by FUS could not be determined. To compare the action
of FUS on STATs with that of an internal reference, we selected the
effect of a short term (15 min) treatment of the cells with LIF as a
marker. The repertoire of STAT-activating cytokine receptors in 293 cells is very limited, with LIF receptor being the only effective
member of the receptors for IL-6 cytokines. Although total cell lysates
of LIF-treated parental 293 cells did not reveal an enhanced tyrosine
phosphorylation of cellular proteins that approached the level seen in
FUS-expressing cells (Fig. 5A), the activation of STAT3 was
still prominently detectable (Fig. 5B). There was no further
increase of active STAT3 in FUS-transfected cells following LIF
treatment, suggesting that the activation of this pathway was already
maximally induced by FUS. LIF treatment was not appreciably effective
on STAT1 and STAT5 in 293 cells, indicating that FUS exerted a broader
spectrum of signaling than the LIF receptor.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of FUS expression on signaling
proteins. A and B, cultures of parental 293 cells and GFP-FUS 293 cells, clone 8, in a 6-well plate were treated
for 15 min with medium alone (Control) or medium containing
either LIF or phorbol 12-myristate 13-acetate. Aliquots of the cell
extracts (10 µg protein) were analyzed on identical sets of replicate
Western blots (WB) for phosphotyrosine-containing proteins
(A) and of the individual proteins (B).
C, pool cultures of growth selected 293 cells transfected
with GFP, GFP-FUS, FUS, or FGFR1 were extracted and analyzed for the
immunodetectable level of FGFR1 epitope (top panel),
phosphotyrosine (PY; center panel), or
phosphotyrosine STAT3 and total STAT3 (bottom panel). The
positions of the antigens are indicated on the left.
|
|
In FUS-expressing cells, as well as after LIF treatment, the level of
phosphorylated ERK was minimally enhanced over background. As a
reference for high level activation of the ERK pathway, we used the
effect of a 15-min treatment with phorbol ester. In both parental and
FUS-expressing 293 cells, phorbol 12-myristate 13-acetate activated ERK
to a level that exceeded severalfold that of control or LIF-treated
cells (Fig. 5B). This finding suggests that FUS, like LIF
treatment, was activating ERK to a submaximal level. Although the
activation of the phosphatidylinositol 3-kinase/Akt pathway has been
associated with the action of FGF receptors (29), in FUS-expressing
cells, the level of phosphorylated Akt was essentially the same as in
untreated parental cells (Fig. 5B).
FUS was effective in activating STAT signaling, although an increased
expression of STAT proteins was not evident (Fig. 5B for
STAT3; others not shown). A 2-3-fold increase in the expression of LIF
receptor
and a 5-fold increase of EGFR were consistently seen in
the different FUS-expressing clones. Despite these increases, a higher
signaling through those receptors was not detectable in the presence of
the prominent FUS signaling (Fig. 5B for LIF; not shown for
EGF).
To compare the signaling activity of GFP-FUS with that of the untagged
FUS and FGFR1 in 293 cells, we also analyzed the kinase expression and
STAT3 phosphorylation in pool cultures of growth-selected 293 cells
transfected with the vectors for those proteins (Fig. 5C).
In this analysis, the pool culture expressing GFP served as a control.
Although the cultures represented homogenous population of cells, the
average expression of the FGFR1 epitope was approximately the same
(Fig. 5C, top panel). The comparison of the
anti-FGFR1 signal to that of anti-phosphotyrosine (Fig. 5C,
middle panel) confirmed the similar strong
autophosphorylation of the two FUS forms and the rather low level
phosphorylation of FGFR1. Proportional to the level of
autophosphorylation was the phosphorylation of STAT3 (Fig.
5C, bottom panel).
Because STAT4 and STAT6 are relevant for hematopoietic cells, but these
forms are expressed at low level in 293 cells, we investigated the STAT
specificity of FUS in the setting of overexpression of each STAT
isoform in COS-7 cells. Co-transfection of FUS and the individual STAT
isoforms indicated that FUS mediated phosphorylation of STAT1, STAT3,
and STAT5 (Fig. 6A). STAT4 and
STAT6 were not detectably modified even though the cells showed high
level expression of each of the transfected STAT proteins (Fig.
6B). This restricted pattern of STAT activation
distinguishes FUS from other oncogenic protein-tyrosine kinases, such
as v-Src or Bcr/Abl that are capable of mediating phosphorylation of
every STAT isoform (20, 30). The qualitative pattern of STAT1, 3, and 5 recruitment by FUS is the same as that identified for the
ligand-activated OSM receptor (20, 31).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 6.
STAT specificity of FUS and FGFR1.
A, COS7 cells were transfected with the combination of
expression vector (2 µg each) for GFP-FUS and the individual STAT
isoforms as indicated at the top. Aliquots of the cell extracts were
analyzed in duplicates by Western blotting (WB) for FGFR1
and phosphotyrosine-containing proteins. B, the expression
of the individual STAT isoforms in the transfected cells was compared
with that in the control vector transfected cells. C,
similar to A, COS7 cells were transfected with the
combination of the expression vector for FGFR1 and the individual STAT
proteins. The cell extracts were analyzed for the level of FGFR1 and
phosphotyrosine-containing proteins. In each panel, the positions of
the transfected and phosphorylated proteins are indicated on the
right.
|
|
Although the normal membrane form of FGFR1 was prominently expressed in
transfected cells and showed both basal level and FGF-enhanced
autophosphorylation, the signaling function, as evident by the tyrosine
phosphorylation of cellular proteins, was much lower than that by FUS
(Figs. 2C and 5C). To assess whether the STAT
specificity of FGFR1 was qualitatively the same as that found for FUS,
we applied the same approach of co-transfection as carried out with FUS
but using the combination of expression vectors for FGFR1 and the
individual isoforms of STATs (Fig. 6C). The results indicate
that FGFR1 and FUS have the same qualitative profile of STAT activation
but differ in their level of activity.
FUS Induces Transcription of STAT-responsive Genes--
The strong
STAT activation by FUS predicted an effective regulation of genes that
are responsive to cytokines that signal through those STAT proteins. To
test this prediction, we employed the assay system of transiently
transfected HepG2 cells. The assay relied on the induction of reporter
gene constructs that are under the control of STAT-specific response
elements. HepG2 cells are optimal for assessing transcriptional gene
regulation because these cells not only accommodate signaling by many
different hematopoietin receptors but also support high level
transcriptional induction (26). Expression of FUS alone was sufficient,
through the endogenous STAT proteins, to induce the expression of
STAT-specific reporter gene constructs (Fig.
7). A comparison of untagged FUS and
GFP-tagged FUS did not reveal any detectable qualitative or
quantitative difference in regulatory activity between the two kinase
versions (data not presented). The magnitude of induction by FUS
through the STAT3- and STAT5-specific elements, as well as through the cytokine response element, was similar to that achieved by the signals
from the endogenous receptors for IL-6 or OSM. The action of FUS was
also comparable with the gene-inducing effects by other oncogenic
tyrosine kinases that engage STATs, such as the membrane localized
v-FMS (Fig. 7A, right panel) or the cytoplasmic
v-Src (21).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 7.
FUS induces gene expression. HepG2 cells
were transfected with the CAT reporter constructs (15 µg/ml),
p(8xHRRE)-CAT (A, and B, left panel),
p(5xHPX-IL-6RE)-CAT (B, center panel), and
p(3xCytRE)-GRE-AGP-CAT (B, right panel) together
with an empty expression vector, or expression vector for FUS, v-FMS,
or FGFR1 (each 5 µg/ml) as indicated at the tops of the
panels. The subcultures of the transfected cells were
treated for 24 h with the medium alone (Control) or
medium containing the factors listed at the bottom.
A, the CAT activity detected by thin layer chromatography of
the reaction mixture from one representative transfection experiment is
shown in the lower panels, and the PhosphorImager
quantification of the fold stimulation values relative to the untreated
vector control culture is reproduced in upper panels.
B, the normalized values (means ± S.D.) of three
independently performed experiments are reproduced.
|
|
The same reporter gene regulatory assay carried out with transfection
of the normal membrane form of FGFR1 showed a regulatory activity for
FGFR1 that was only a fraction of that of FUS (Fig. 7B). The
difference in activity was consistent with the difference in STAT
recruitment by the two kinases (Figs. 5C and
6C).
Effect of Kinase Inhibitors on FUS Action--
The tyrosine kinase
activity of FUS was not detectably attenuated by Iressa or Imatinib
(Gleevec), the specific inhibitors for EGFR kinase, or the Bcr/Abl
fusion kinase, respectively (Fig. 8A). The inhibitors were,
however, effective in muting the kinase activity of overexpressed EGFR
and p190Bcr/Abl. The JAK-dependent signaling by
hematopoietic cytokine receptors is controlled in part by a negative
feedback mechanism that involves the STAT-inducible SOCS-1 and -3 (32).
In co-transfection experiments, we could demonstrate that neither
SOCS-1 nor SOCS-3 attenuated the gene regulatory action of FUS, whereas
both inhibitors could suppress signaling by the OSM receptor (Fig.
8B). Similar co-transfection experiments, but using the
combination of FGFR1 and SOCS1 or SOCS3, indicated that the signaling
activity of FGFR1, like that of FUS, was not sensitive to the SOCS
feedback regulatory pathway (data not presented). In 293 cells stably
expressing GFP-FUS, we noted that FUS, probably through STAT
activation, was effective in elevating the immunodetectable expression
level of SOCS3 (data not shown). However, based on the finding in Fig.
8B, it is expected that induced SOCS3 is unable to interfere
with FUS kinase action.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 8.
FUS is insensitive to kinase inhibitors.
A, MCF7 cells were transfected with expression vectors for
human EGFR, p190 Bcr/Abl, or FUS. Subcultures of the transfected cells
were treated for 6 h with 1 µM Gleevec or Iressa,
and in the case of EGFR-transfected cells, the Iressa treatment is
followed by 15 min of exposure to EGF. The cell extracts were analyzed
by immunoblotting for the presence of phosphotyrosine-containing
proteins. The position of the kinases is indicated. B, HepG2
cells were transfected with p(8xHRRE)-CAT (15 µg/ml), with either
vector or FUS (0.5 µg/ml) alone, or together with expression vector
for SOCS1 or SOCS3 (5 µg/ml). The subcultures were treated for
24 h with or without OSM as indicated at the bottom.
The induction of the reporter gene relative to the untreated vector
control is reproduced (means ± S.D. of three separate
experiments). W.B., Western blotting.
|
|
The Zinc Finger Domain of ZNF198 Mediates the Oligomerization of
FUS--
The activation of the FGFR kinase in its native membrane
receptor form is accomplished through ligand-induced dimerization of
the receptor. Because FUS is a constitutively active FGFR1 kinase, it
is assumed that the ZNF198 domain must act as an activator, such as
promoting oligomerization of the fusion protein (9, 13, 14). To test in
what form FUS proteins are present in transfected cells, we performed
FLPC analysis of lysates of FUS-expressing MCF7 cells (Fig.
9). The proteins extracted under
nondenaturating conditions were size fractionated on a Superose 12 column. Western blot analysis of the individual fractions for proteins
reacting with the anti-FGFR1 antibody (Fig. 9, upper panel)
and with antiphosphotyrosine (not shown) demonstrated that, in each
case, the FUS protein was primarily detected in fractions that eluted
slightly ahead of the 300-kDa thyroglobulin marker. Only a very minor
fraction of FUS protein eluted at the 150-kDa position expected for the
monomeric FUS protein. In separate experiments (not shown) we confirmed that GFP-FUS also eluted as a dimeric complex of ~350 kDa.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 9.
FUS is a dimeric complex. MCF7 cells
were transfected with the expression vector for either FUS or
FUS( 7-17). The cell extracts were prepared and separated on
Superose 12 FPLC as described under "Materials and Methods." Equal
aliquots of the fractions were separated on denaturating gels and
immunoblotted for the presence of anti-FGFR1-reactive proteins. The
position of FUS, the degraded FUS, and FUS( 7-17) are indicated
by solid arrows. The positions of three nonspecific,
cross-reactive cell proteins are marked by open arrows at
the left. The positions of the molecular size markers for
the FPLC separation are given at the top, and those for the
SDS gels are given on the right.
|
|
As already mentioned above (Fig. 2B), untagged FUS was
subject to proteolytic degradation in the transfected MCF7 cells,
resulting in the accumulation of a 40-kDa product that lacked most of
the ZNF198 portion but still retained the FGFR1 domain (Fig. 9,
FUS). This fragment was eluted on the Superose 12 column
as a monomeric protein and detectable in fractions 33-38 in Fig. 9
(upper panel). These data indicated that full-length FUS is
present in a complex that consist of at least a FUS dimer. The distinct
elution profile of both FUS and the
FUS degradation product further
support the interpretation that the zinc finger domain was required for
dimerization. An equivalent FPLC analysis of the extract from cells
expressing the full-length ZNF198 demonstrated that this protein was
also eluted with a mass of ~400 kDa (data not shown).
To demonstrate that the zinc finger domain but not the N-terminal
domain of ZNF198 was necessary for dimerization, we analyzed FUS with
an internal deletion of exons 7-17 of ZNF198, FUS(
7-17) (Fig. 1).
As already shown in Fig. 2C, under condition of high expression, FUS(
7-17) showed low level auto-tyrosine
phosphorylation, suggesting an activation by oligomerization. Size
separation of extracts from FUS(
7-17)-transfected cells revealed,
however, that all immune-detectable FUS protein migrated as a monomeric protein (Fig. 9, lower panel). We concluded from this
observation that the zinc finger domain of ZNF198 was necessary for
forming stable FUS complexes, and by this interaction the full kinase and signaling function of FUS was obtained. The low kinase activity detected with FUS(
7-17) was attributed to either a low affinity or
nonspecific interaction that became effective under condition of
overexpression. In separate experiments (not shown), we determined that
induction of co-transfected CAT reporter gene constructs could only be
detected in transfected cells expressing FUS(
7-17) at high levels.
Because the ZNF198 portion of FUS also contains a PRD that has been
suggested to be responsible for FUS oligomerization (14), we assessed
the contribution of PRD to the signaling function of FUS by deletion.
GFP-FUS lacking the PRD, GFP-FUS(
PRD), was generated (Fig. 1) and
transfected into 293 and HepG2 cells to determine expression and
signaling. The results from those experiments (data not presented)
indicated that GFP-FUS(
PRD) behaved indistinguishably from GFP-FUS
in respect to subcellular localization, with accumulation in
cytoplasmic structures, expression level and tyrosine phosphorylation, activation of STAT proteins, and induction of STAT-responsive gene
constructs. We concluded from these findings that it is the zinc
fingers and not the PRD that are responsible for the activation of the
FUS kinase.
ZNF198 Has Competitive Inhibitory Activity on FUS--
The ability
of ZNF198 to direct complex formation suggested that, in cells
co-expressing ZNF198 and FUS, heterodimers could be formed between the
two proteins and that these heterodimers might be less active than the
FUS homodimer. The predominant nuclear localization of ZNF198 would
suggest a restricted capability of that protein to interact with
cytoplasmic FUS. An alternative scenario would suggest that the
heterodimers were directed to the nucleus by the nuclear localization
signal of ZNF198. By using co-transfection of FUS and ZNF198, either as
a normal or GFP-tagged version, we could not detect any appreciable
ZNF198-dependent relocation of FUS to the nucleus or any
FUS-dependent retention of ZNF198 in the cytoplasm.
Nevertheless, using phosphotyrosine analysis of the two proteins, we
could identify that FUS and ZNF198 were able to interact, resulting in
the tyrosine phosphorylation of ZNF198 (Fig.
10A). By including ZNF198
overexpression in the reporter gene regulation assay, we also could
discern a modest attenuating effect of ZNF198 on the FUS action
on transcription (Fig. 10C).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 10.
The activity of FUS is attenuated by
ZNF198. A, MCF7 cells were transfected with the
expression vector for GFP-ZNF198 or FUS either alone or together (2 µg each). The cells were extracted 36 h later and analyzed by
immunoblotting for the level of proteins reacting with anti-ZNF198,
FGFR1, and phosphotyrosine (PY). B, MCF7 cells
were transfected with the expression vector for red fluorescent protein
(RFP, 1 µg/ml) and ZF1-GFP (3 µg). The fluorescent image
of a cells expressing both proteins was taken 36 h after
transfection. C, HepG2 cells were transfected with
p(8xHRRE)-CAT (15 µg/ml), with either vector or FUS (1 µg/ml)
alone, or together with the expression vectors for GFP-ZNF198 or
ZF1-GFP (1-5 µg/ml). The expression of the reporter gene, relative
to the untreated vector control, is presented (mean ± S.D. of
three separate experiments). W.B., Western blotting.
|
|
To enhance the cytoplasmic presence of the oligomerizing function of
ZNF198 and thus to increase heteromer formation with FUS, we generated
a C-terminally truncated version of ZNF198, ZF1 (Fig. 1). This protein,
lacking the nuclear localization elements, proved to be extremely
unstable, which prevented the accumulation of sufficient protein from
being effective as a FUS-interacting partner. When GFP was added to the
C terminus, however, the resulting protein, ZF1-GFP, gained sufficient
stability to be detected as a cytoplasmic protein (Fig. 10B)
and to have a moderating effect on FUS action (Fig. 10C).
These data document the oligomerizing function of the N-terminal half
of ZNF198 but also highlight the fact that the use of this function is
curtailed by the prominent control of subcellular localization and
turnover of the ZNF198 protein.
Oligomerization of FGFR1 by ZNF198 and the Bcr Domain Generates
Similar but Not Identical Signaling Function--
Our characterization
of FUS demonstrated a highly efficient FGFR1 kinase activity controlled
by the ZNF198 zinc finger domain. This activity was also proposed to
promote the malignant phenotype in hematopoietic cells (12). Because a
number of other oligomerization mechanisms have been found to result in
FGFR1 activation, we assessed whether the type of oligomerization would
affect the specificity of signaling. Recently, the chimeric kinase
Bcr/FGFR1 has been identified as another oncogenic version of FGFR1
(15, 18). Considering that the N-terminal portion of Bcr is directing
the formation of a tetrameric complex (33), we investigated whether signaling activity of FUS and Bcr/FGFR1 reflected that difference in
oligomerization function. An expression vector for untagged Bcr/FGFR1
was generated (Fig. 1). The expression of this kinase in transfected
293 cells was comparable with that of the untagged FUS (Fig.
11A, left panel).
One notable difference was that Bcr/FGFR1 did not give rise to a
degradation product as found for FUS. The relative level of
autophosphorylation appeared to be similar between the two kinases,
although at high expression levels, FUS was more effective in mediating
the tyrosine phosphorylation of other cellular proteins (Fig.
11A, right panel). The recruitment of signaling pathways, however, was reproducibly different (Fig. 11B).
Bcr/FGFR1 produced a lower phosphorylation of STAT1, STAT3, and ERK
compared with FUS but exhibited a phosphorylation of STAT5 equivalent
to FUS. The functional difference was confirmed at the level of
transcriptional activation of STAT-specific reporter gene constructs
(Fig. 11C). Bcr/FGFR1 was as effective as FUS in activating
the STAT5-responsive HRRE construct but could only induce the
STAT3-specific reporter to about one-third of that of FUS. In contrast,
FGFR1 transfection was severalfold less effective as either fusion
kinase in inducing expression of the two reporter gene constructs (Fig.
11C). This finding suggests that the oligomerization
reaction not only enabled activation of the FGFR kinase but also
determined to some extent the quantitative manifestation of the kinase
function toward signal transduction pathways.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 11.
Difference in signaling by FUS and
Bcr/FGFR1. A, 293 cells were transfected with a
decreasing dose of the expression vector for FUS or Bcr/FGFR1 (4-0.04
µg/well). The cell extracts of the cells 36 h after transfection
were analyzed by immunoblotting for the level of proteins detectable
with anti-FGFR1 or anti-phosphotyrosine (PY). The positions
of the full-length FUS and Bcr/FGFR1 are indicated. The position of the
~65-kDa fragment of FUS ( FUS) is given on the
left. B, the extracts from the cells transfected
with 4 µg of the expression vector in A were analyzed for
the level of the signaling proteins listed at the right. Note, the
antibodies against the tyrosine-phosphorylated STAT proteins also
cross-react with the kinases. C, HepG2 cells were
transfected with the CAT reporter constructs (15 µg/ml),
p(8xHRRE)-CAT (left panel), or p(5xHPX-IL-6RE)-CAT
(right panel) and decreasing amount of expression vectors
carrying FUS, Bcr/FGFR1, or FGFR1 (from 5 to 0.02 µg/ml). The
expression of the reporter genes relative to the untreated vector
control is presented (mean ± S.D. of three separate experiments).
W.B., Western blotting.
|
|
 |
DISCUSSION |
Structural chromosome rearrangements are one of the hallmarks of
human leukemias (1). In many cases these rearrangements are specific
for a particular type of leukemia and as such have been used as
diagnostic markers. The consequence of these rearrangements is often to
generate constitutive activation of genes that are thought to promote
the malignant phenotype (35). Many of these chimeric genes are fusion
kinases, which are presumably responsible for the activation of
specific pathways that lead to loss of the normal controls for growth
and differentiation in the particular tumor precursor cell. This is the
case with FUS (2), which has been identified in a rare variant form of
MPD. To date, no other cancer has been reported that carries this
rearrangement, although several variant forms have been described, all
of which result in the constitutive activation of the FGFR1 kinase
domain (34). Unfortunately, no tumor cell lines carrying this
rearrangement are available, which makes it impossible to study the
function of FUS in the same cell lineage in which it was identified.
Although Ba/F3 cells have been traditionally used in functional studies
for fusion kinases, they are highly evolved mouse cells and do not
permit a comprehensive analysis of the signaling function of the kinase
(13-15). In the absence of a representative model cell for this MPD,
therefore, we have used a series of well characterized cell lines that
have allowed us to characterize the signaling capabilities of FUS under
controlled conditions to understand more about its function. From these
studies it became clear that FUS signaling through STAT pathways was
more prominent than reported by others (15, 17, 35). The data also
compared the STAT activation profile to that of the normal FGFR1 as
well as cytokine receptors, which also operate through the STAT
pathway. We were able to show that the STAT signaling by FUS is
remarkably similar in specificity to those of IL-6 cytokines, in
particular to OSM. Although FUS would be expected to function in a
manner similar to FGFR1, because of the embedded FGFR1 kinase in FUS, in fact FUS showed increased phosphorylation of many other cellular proteins as well as having a greater capability to activate the same
target genes. Despite the broad range of phosphorylation of cellular
proteins noted in FUS-expressing cells, FUS differs from some other
oncogenic kinases, such as Src or Bcr/Abl, in its inability to activate
STAT4 and 6, demonstrating a substrate-specific action for this kinase
(20, 30).
The difference between FUS and both IL-6 cytokine receptors and
endogenous FGFR1 in regard to the phosphorylation of cellular proteins
is probably related to the fact that FUS is no longer localized to the
plasma membrane and so presumably has a broader access to substrates.
This enhanced range of targets in turn may be related to the oncogenic
activity of FUS. The greater effectiveness of FUS, compared with
cytokine receptors, in modifying cellular proteins may also be assisted
by the fact that activity of FUS, like that of Src, Fms, or Abl, but
unlike that of hematopoietin receptors is not attenuated by the
negative feedback mechanism through the STAT-inducible SOCS members.
It is important to consider that FUS is being ectopically expressed in
the experimental systems we have used. How the level of FUS expression
relates to that seen in the MPD is not clear, and because of the
paucity of FUS-expressing cells from MPD patients, it cannot be
determined experimentally as yet. The ability of FUS to elicit a strong
signaling action, however, is not limited to cells expressing high
levels as achieved in transiently transfected COS7 or 293 cells.
Subclones of stably transfected 293 cells, which express very different
levels of FUS, demonstrated prominent phosphorylation of cellular
proteins (Figs. 4A and 5A) Similarly, HepG2 cells
transfected with low amounts of FUS expression vectors showed
appreciable transcriptional activation of genes (Fig. 11C). Clearly, a high level overexpression is cytostatic or even cytotoxic. In cases of massive overexpression of FUS, the transfected cells undergo apoptosis within a few days following transfection. Within the
cells that have been selected for stable expression and probably also
in myeloid cells carrying the translocation, there must be a threshold
FUS level that can be tolerated. In many of the transfected cells,
exclusion or inactivation of FUS was a frequent event, again attesting
to the toxic consequences to the cell. Morphological changes are also
manifested at sublethal level of FUS expression, as was seen in pools
of transfected cells and in subclones of 293 GFP-FUS cells (Fig.
4C). Expression of FUS also affects motility and adhesion,
which results in the development of poorly attached cells that form
dense clusters in the cultures. This phenotype is comparable with that
seen for v-Src-expressing cells, where the focal adhesion kinase
complex, which control cytoskeleton organization, is dysregulated (36).
Analysis of the phosphorylated proteins using anti- PY antibodies in
FUS-expressing cells clearly identifies proteins in the 130-kDa size
range (Fig. 5A), which include proteins involved in the
focal adhesion kinase complexes (data not presented). These data
suggest that FUS expression may affect cell architecture by altering
cytoskeletal organization. The other unusual observation is that,
within some of the cells used, there is an active degradation of the
FUS protein that is determined by structural information contained in
ZNF198 portion. This observation implies that cells have an endogenous
mechanism that recognizes ZNF198 motifs, as part of cytoplasmic
proteins, and tags the proteins that harbor those motifs for
proteolytic fragmentation. In the case of FUS, the degradation also
relieves some of the inhibitory activity of FUS expression. The
biochemistry of the degradation process remains to be defined.
Early studies have suggested, using immunoprecipitation of
epitope-tagged constructs, that the zinc finger domain serves as a
protein-protein interaction motif to activate the kinase (6, 9, 13).
Using FPLC analysis we have demonstrated dimerization of the fusion
gene and further that this dimerization is lost when the zinc finger,
but not the PRD, is removed. These observations are at variance with a
previous report (14) suggesting that the PRD alone could be responsible
for the dimerization of FUS. In the report by Xiao et al.
(14), however, the fusion kinase construct used was significantly
smaller (87 kDa) than the native fusion kinase in MPD (155 kDa). It is
therefore likely that properties of this smaller fusion protein
significantly affect its function because we have clearly demonstrated
that the PRD is unnecessary for dimerization in the context of the
full-length fusion kinase.
The presence of normal and rearranged proteins in the same
hematopoietic cell (ZNF198 is ubiquitously expressed) raises the question whether heterodimers can be formed that affect the normal function of either gene product. Here we have shown that FUS and ZNF198
can form heterodimers and that this interaction results in the
phosphorylation of ZNF198. Further, the presence of ZNF198 in the
complex suppresses the functional properties of FUS. Exactly what the
consequences of this association are for oncogenicity is not clear
because the localization of FUS, as a result of this heterotypic
dimerization, does not result in significantly increased nuclear
localization of FUS. Furthermore, we have shown that reduction of FUS
activity to relatively low levels still elicits a signaling response
from the homomeric FUS.
Several groups have now reported that, in some cases of this MPD, the
FGFR1 kinase domain is fused with the Bcr gene that is usually
associated with the Bcr/Abl fusion kinase in AML, as well as the
FOP/FGFR1 fusion kinase gene associated with a t(6;8)(q27;p11) rearrangement (9, 12, 33). Both latter fusion genes are also thought to
operate through constitutive activation of the kinase function
following dimerization. When Bcr is fused with FGFR1, we have
demonstrated that, indeed, the N-terminal half of Bcr protein can
substitute for the ZNF198 zinc finger motif to oligomerize and activate
the kinase. This Bcr/FGFR1 protein, however, although expressed at
comparative levels to FUS, is not as efficient in our assays in
mediating phosphorylation of other proteins in the cell, including
STAT1 and 3 and ERK (Fig. 11). Whether this altered efficiency leads to
a milder form of the disease cannot be discerned from the case reports
available from the relatively few patients with the variant forms of
the fusion kinase gene described so far.
The general suggestion for the mode of action of FUS has been that
unlike the FGFR1 kinase, which is restricted to the membrane fraction
of the cells, FUS localizes to the cytoplasm, which is responsible for
the oncogenic events in the expressing cells. Much of the support for
this concept has come from transient transfection assays (13, 14, 35),
often in nonhuman cells such as Ba/F3 and COS. Here we have
demonstrated that although the fusion protein is predominantly in the
cytoplasm during the first 24 h after transfection, this same
protein can be found in the nucleus several days later. In stably
transfected cells, the protein appears to be generally distributed
throughout the cell and often concentrated in subcellular compartments
within the cytoplasm when highly overexpressed. Thus, although the
majority of the FUS protein is located in the cytoplasm, it is not
clear to what extent the cytoplasmic FUS alone accounts for the
transforming process (13). Given that the FUS protein is also found in
the nucleus in cells stably expressing it, the oncogenic mechanism may
be assisted by the action of FUS located in the nucleus. The
characterization of other FGFR1-containing fusion gene products with
altered subcellular localization and the analysis of FUS-transgenic
mice are underway to provide more definitive answers.