Originally published In Press as doi:10.1074/jbc.M212591200 on February 20, 2003
J. Biol. Chem., Vol. 278, Issue 18, 16230-16236, May 2, 2003
VE-cadherin-induced Cdc42 Signaling
Regulates Formation of Membrane Protrusions in Endothelial Cells*
Panos
Kouklis
,
Maria
Konstantoulaki, and
Asrar B.
Malik
From the Department of Pharmacology, The University of Illinois
College of Medicine, Chicago, Illinois 60612
Received for publication, December 10, 2002, and in revised form, February 19, 2003
 |
ABSTRACT |
The cytoplasmic domain of cadherins and the
associated catenins link the cytoskeleton with signal transduction
pathways. To study the signaling function of non-junctional
VE-cadherin, which can form during the loss VE-cadherin homotypic
adhesion, wild type VE-cadherin or VE-cadherin cytoplasmic domain
(
EXD) was expressed in sub-confluent endothelial cells. We observed
that Cdc42 was activated in transfected cells and that these cells also
developed Cdc42-dependent >70-µm-long plasma membrane
protrusions. The formation of these structures required actin
polymerization, and they developed specifically in endothelial cells as
compared with epithelial cells. Expression of the VE-cadherin
cytoplasmic domain lacking the
-catenin binding site also induced
Cdc42 activation; thus, its activation cannot be ascribed to
-catenin binding. However, these cells were not able to form the
protrusions. These results suggest that the cytoplasmic domain of
non-junctional VE-cadherin can serve as a scaffold involved in Cdc42
activation at the endothelial plasma membrane.
-Catenin and the
associated
-catenin may serve as support sites for actin
polymerization, leading to formation of long plasma membrane
protrusions. Thus, non-junctional VE-cadherin actively participates in
inside-out signaling at the plasma membrane, leading to the development
of endothelial membrane protrusions.
 |
INTRODUCTION |
Cadherin molecules are membrane receptors involved in cell-cell
adhesion (1, 2). They form a large family of proteins with tissue
specificity that associates in a homophilic manner. They are
indispensable in tissue formation during development, and in addition
to adhesion, they serve morphogenetic functions (3-6). Classical
cadherins are anchored to actin cytoskeleton by
-catenin, which
binds to
-catenin (7). Catenins have multiple functions in signal
transduction and transcription regulation (8) and, thus, they are
directly involved in the transduction of proliferation signals (6, 9,
10).
tk;2Endothelium forms a semi-permeable barrier that regulates the
flux of liquid and solutes (11, 12) as well as leukocyte transmigration
from the microvasculature to sites of injury and infection (13-15).
Adherens junctions formed between endothelial cells contain
VE-cadherin, which is specifically expressed in the endothelium (16).
Direct involvement of VE-cadherin to endothelial barrier function was
demonstrated by VE-cadherin blocking antibodies in cell-culture and
mouse models (17). In a different situation, VE-cadherin/catenins
reorganize during polymorphonuclear or monocyte transmigration
through the endothelial monolayer (18). VE-cadherin targeting revealed
that in addition to its role in cell-cell adhesion, it is required for
transduction of the vascular endothelial growth factor proliferation
pathway through
-catenin association to phosphatidylinositol
3-kinase, which is downstream of vascular endothelial growth
factor receptor 2. Ablation of VE-cadherin interferes with endothelial
proliferation and causes apoptosis (6). However, it is remarkable that
the VE-cadherin function was not compensated despite the presence of
N-cadherin, which also associates with
-catenin and is expressed in
endothelial cells. Thus, it is possible that the cytoplasmic domain of
VE-cadherin serves functions that are not completely understood.
Although VE-cadherin is classified as a "classical" cadherin in
respect to its primary structure, the cytoplasmic tail is unique among the members of this subgroup (19). To study the role of VE-cadherin in
signaling mechanisms in endothelial cells, wild type VE-cadherin or the
cytoplasmic domain of VE-cadherin mutant was expressed in sub-confluent
endothelial cells. The cytoplasmic domain of cadherins has been
characterized in a variety of studies as the "dominant negative
mutant" for cell-cell adhesion, since its expression blocked cell
adhesion in cells of epithelial, neuronal, muscle, and endothelial
origin (20-24).1 In
endothelial cells a chimera between interleukin 2 receptor extracellular domain and VE-cadherin cytoplasmic domain interfered with
proliferation by titrating-out
-catenin from its downstream effectors, and its stable expression in tissue culture cells led to
down-regulation of endogenous VE-cadherin and defects in proliferation (25).
In the present study, we observed that non-junctional VE-cadherin
induced through its cytoplasmic domain the activation of Cdc42 and the
formation of >70-µm-long plasma membrane protrusions. Cdc42
activation was shown to be necessary for the formation of these
protrusions. We further demonstrated that Cdc42 activation was not
dependent upon
-catenin association to VE-cadherin. Two critical
factors were required for the formation of the protrusions, (a) membrane localization of VE-cadherin and (b)
association of
-catenin with its cytoplasmic domain. Furthermore,
the formation of membrane protrusions was endothelial-specific since it
did not occur in epithelial cells. These results suggest a novel role of VE-cadherin cytoplasmic domain in the formation of membrane protrusions, which may be involved in the restoration of endothelial junctional barrier function after the loss of homotypic VE-cadherin adhesion.
 |
MATERIALS AND METHODS |
Cell Culture--
Human microvascular endothelial cells
(HMECs)2 were gifts from Dr.
E. W. Ades (26) (NIAID, National Institutes of Health, Atlanta, GA). HMECs were cultured in MCDB 131 (Invitrogen)
supplemented with 5% fetal bovine serum (Hyclone Laboratories, Logan,
UT). Primary human pulmonary arterial endothelial cells were cultured in EBM 2 (endothelial basal medium) complete medium (BioWhittaker, Walkerville, MD). Bovine lung microvascular endothelial cells, purchased were from VEC Technologies (Renssalaer, NY), were grown in
MCDB 131 medium supplemented with 5% fetal bovine serum and endothelial cell growth supplement (Sigma-Aldrich). Alveolar epithelial cells A549 were grown in Dulbecco's modified Eagle's medium
(Invitrogen) supplemented with 10% fetal bovine serum.
Antibodies--
A monoclonal antibody against VE-cadherin was
from Chemicon (Temecula, CA), and a goat polyclonal antibody was from
Research Diagnostics (Flanders, NJ). Rabbit polyclonal anti-FLAG and
anti-Myc-tag monoclonal were from Zymed Laboratories
Inc. (San Franscisco, CA). Mouse monoclonal anti-FLAG (M2) was
from Sigma-Aldrich. Monoclonal antibodies for
-catenin, p120, and
Rac were from Transduction Laboratories (Lexington, KY). Rabbit
anti-Cdc42 was from Santa Cruz (Santa Cruz, CA). Horseradish
peroxidase-conjugated secondary antibodies were from Jackson
Laboratories (West Grove, PA). For immunofluorescence experiments, we
used either fluorescein isothiocyanate and Texas Red (Jackson
Laboratories) or Alexa 488 and Alexa 568 (Molecular Probes, Eugene,
OR)-conjugated antibodies. Actin was visualized with Alexa
488-conjugated phalloidin (Molecular Probes).
Drugs--
Latrunculin A was purchased from Molecular Probes.
VE-cadherin Constructs and Transfections--
VE-cadherin-
EXD
mutants with and without FLAG tag (DYKDDDDK) were constructed by PCR
(plasmid pcDNA3-VEC-
EXD). The octapeptide sequence encoding for
the FLAG-tag sequence replaced the VE-cadherin extracellular domain by
PCR. The human wt VE-cadherin cDNA inserted in the EcoRI
site of the pcDNA3 vector was used (plasmid pcDNA3-VEC) as the
template. We used either primer D-FL containing the FLAG encoding sequence as sense primers
(GAGTCGCAAGAATGCCGACTACAAGGACGACGATGACAAGACCTTCTGCGAGGATATGG) or primer
D that lacks the FLAG encoding sequence
(GTGAGTCGCAAGAATGCCACCTTCTGCGAGGATATGG). Antisense primer 2002 (ACCTTCTGCGAGGATATGG) was used in both cases. PCR products were
digested with BsmI/BstEII, and these fragments were inserted in the BsmI (partial)/BstEII site
of pcDNA3-VEC. The mutant version with FLAG (termed
EXD) was
used generally except where indicated
EXD without FLAG.
To construct VE-cadherin-
EXD-
cat mutant, the
plasmid pcDNA3- VEC-
EXD was digested with
HindIII and Bpu10I (partial digestion and
Klenow-blunt). This fragment was inserted in the
HindIII/ EcoRV site of pcDNA3 (plasmid
pcDNA3-VEC-
EXD-
cat). To make the
VE-cadherin-
EXD-
p120 construct, residues 645-654 were deleted by
PCR. We used as the sense primer TGGTCACCATGGACACCACCAGCTACGATG. To
make the VE-cadherin-
EXD-G/A construct we substituted residues GGG
(649-651) with AAA by PCR using as sense primer
TGGTCACCTACGACGAGGAGGCAGCAGCAGAGATG. For both PCR reactions, we used as
the antisense primer TACAGCTCAGCCAGCATCTTAAAC. PCR products containing
the deletion or substitution were cloned in the TA cloning vector
(Invitrogen) and digested with BstEII/BlpI fragments to replace the wild type BstEII/BlpI
sequence from the VE-cadherin-
EXD construct. All PCR products were
verified by sequencing.
Transfection--
Endothelial cells were transfected by
electroporation or liposome-mediated DNA transfer (Qiagen, Valencia,
CA). For electroporation, 106 cells were seeded in a
100-mm2 dish the day before transfection. After 20-24 h,
cells were trypsinized and re-suspended in 300 µl of medium. Plasmid
DNA (10 µg) mixed with 14 µg of salmon sperm DNA was added, and
cells were electroporated in 0.4-cm cuvettes (Gene Pulser II, Bio-Rad).
The conditions were set at 180-mV voltage and 950-millifarad
capacitance. To obtain confluent monolayers, 50 µl of transfected
cells were applied directly on a gelatinized coverslip and left for
1 h to adhere. Medium was added, and cells were fixed after
48 h. We typically observed 30% transfection efficiency with
liposomes and 40% efficiency with electroporation.
Immunofluroscence Microscopy--
Cells were grown on 1%
gelatin (Sigma-Aldrich)-coated coverslips. They were fixed and stained
as described previously (Kouklis et al. (29)). The
stained cells were visualized either with Nikon Diaphot 200 or Zeiss
Pascal confocal microscopes.
Protein Assay--
Protein concentrations of cell extracts were
quantified using the BCA protein assay from Pierce.
Immunoprecipitation and Western Blotting--
Endothelial cells
were washed, scraped with phosphate-buffered saline, and pelleted in
3 × 103 rpm. Total cell extracts were made using
immunoprecipitation buffer containing 20 mM Tris-Cl, pH
7.4, 150 mM NaCl, 1 mM EDTA, 1 mM
EGTA, 1% Triton X-100, and 0.5% Nonidet P-40 supplemented with
Complete protease inhibitor mixture (Roche Molecular Biochemicals). Cells were incubated for 10 min in 4 °C in a shaker and centrifuged in 14 × 103 rpm for 5 min to remove insoluble
material. The supernatant was used for immunoprecipitation and
Western-blotting experiments (thereafter called "extract").
Extracts were pre-cleared with 2 µg of mouse IgG (Jackson
Laboratories) and incubated with 2-3 µg of the first antibody for
2 h in 4 °C before the addition of 20 µl of protein
A/G-agarose (incubation for 1 h in 4 °C). Immunoprecipitates were subjected to SDS-PAGE and Western blot analysis. Nitrocellulose membranes were blocked with TBST buffer (20 mM Tris, pH
7.4, 150 mM NaCl, 0.1% Tween 20) containing 1% gelatin
(from cold water skin fish, Sigma-Aldrich), incubated for 1 h with
primary antibodies, washed with TBST, and incubated for 1 h with
horseradish peroxidase-conjugated secondary antibodies. For anti-Cdc42
antibodies, membranes were blocked with TBST containing 5% nonfat milk
and incubated at room temperature for 3 h. The horseradish
peroxidase signal was developed using Super Signal (Pierce).
p21-activated Kinase Binding Assay--
BL21 bacterial
cultures (20 ml) transformed with GST-PBD expression construct (a gift
from Dr. G. Bokoch, Scripps) were induced with 2 mM
isopropyl-1-thio-
-D-galactopyranoside for 3 h,
lysed with 0.2 mg/ml lysozyme, and extracted in 1% Triton X-100,
phosphate-buffered saline with protease inhibitors (Complete, Roche
Molecular Biochemicals). The supernatant was incubated for 45 min at
room temperature with 120 µl of glutathione-Sepharose beads (Amersham
Biosciences). The beads were washed 3× with phosphate-buffered saline
and 2× with MLB buffer (25 mM HEPES, pH 7.5, 250 mM NaCl, 5% IGEPAL CA-630, 10 mM
MgCl2, 1 mM EDTA, 2% glycerol, and protease
inhibitors). GST-bound beads (20 µl) were incubated with HMEC
extracts (200-300 µg of total protein) in 400 µl of MLB buffer
O/N at 4 °C. The beads were washed thoroughly with MLB buffer
and boiled in 50 µl of SDS-PAGE loading buffer for subsequent Western
blot analysis.
 |
RESULTS |
Expression of VE-cadherin Cytoplasmic Domain or wt VE-cadherin
Induces Cdc42 Activation--
Human VE-cadherin cDNA (a gift of
Dr. E. Dejana, Mario Negri Institute, Milan, Italy) was used to
generate the VE-cadherin extracellular domain deletion mutant (
EXD)
(Fig. 1A). Sequences encoding
the signal peptide (SP), pre-peptide (PP), and
the transmembrane domain (TM) were not deleted so that the
mutant could be inserted in membrane. We also constructed mutants
identical to
EXD with the exception that the residues involved in
the binding of
-catenin (
EXD-
cat) or p120 (
EXD-G/A and
EXD-
p120) were deleted (Fig. 1A). In
EXD-
cat,
residues 743-784 were deleted including SLSS, a highly conserved motif
in all cadherin molecules involved in association of
-catenin with
cadherins (27) (Fig. 1A). Substitution of GGG residues to
AAA (AA 649-651) in
EXD-G/A and deletion of residues 645-654 in
EXD-
p120 at the juxtamembrane domain removed the p120 binding
site (28) (Fig. 1A). To determine expression and correct
size of the mutants, HMEC were transfected with
EXD,
EXD-G/A,
EXD-
p120, or
EXD-
cat, and Triton X-100 extracts from
transfected cells were analyzed by Western blotting with anti-FLAG
monoclonal antibody. This antibody reacted specifically with 34-36-kDa
bands in the
EXD-,
EXD-
p120-, and
EXD-G/A-transfected cells
and a 29-kDa band in
EXD-
cat-transfected cells (Fig. 1B). No reaction was detected in mock-transfected control
cells (Fig. 1B).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1.
Construction of VE-cadherin mutants and their
expression in endothelial cells. A, EXD,
extracellular domain of VE-cadherin was deleted, and the sequence
encoding for the FLAG epitope was inserted in its position.
EXD- cat, 42 C-terminal residues of
VE-cadherin, which includes the -catenin binding domain, were
removed from the EXD construct. EXD-G/A, AAA (residues
649-651) were replaced with GGG in the EXD construct.
EXD- p120, residues 645-654 were removed
from the EXD construct. VE-cadherin domains: SP, signal
peptide sequence; PP, pre-peptide sequence; CR,
cadherin repeat; TM, transmembrane domain; CD,
cytoplasmic domain. B, immunoblots of protein extracts from
HMEC transfected with VEC- EXD, VEC- EXD- cat, VEC- EXD-G/A,
and VEC- EXD- p120. At 24 h after transfection, HMEC were
extracted using 1% TX-100 in phosphate-buffered saline buffer, and the
soluble fraction was separated by SDS-PAGE. Polyacrylamide gels were
either stained with Coomassie Brilliant Blue (CBB) or
transferred on nitrocellulose for immunoblotting analysis using a FLAG
antibody. Extracts from control ( ) and EXD-, EXD- cat
( cat)-, EXD-G/A-, and EXD- p120-transfected
HMECs were analyzed. In these extracts 34-36-kDa bands in EXD-,
EXD-G/A-, and EXD- p120- and ~29-kDa bands in
EXD- cat-transfected cells reacted specifically with anti-FLAG
antibody.
|
|
HMEC were transiently transfected with wt VE-cadherin,
EXD, or
EXD-
cat mutants. Cells were harvested 24 h after
transfection, and extracts were tested for Cdc42 activation using the
GST-PBD pull-down assay. HMEC cell extracts were incubated with GST-PBD coupled to glutathione-Sepharose beads. Beads were washed and analyzed
by Western blotting for Cdc42 binding. We observed that active Cdc42
was bound to PBD in extracts from HMECs transfected with wt
VE-cadherin, -
EXD, or -
EXD-
cat (Fig.
2). Cdc42 activation remained at the
basal level in mock-transfected cells (Fig. 2, GST-PBD). In
control experiments, GST beads did not associate with Cdc42 under the
same conditions (Fig. 2, GST).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 2.
Cdc42 activation in HMECs transfected with wt
VE-cadherin or VE-cadherin cytoplasmic domain mutants. GST- PBD or
GST control beads were incubated with extracts from subconfluent HMEC
transfected with VE-cadherin, VE-cadherin- EXD, or
VE-cadherin- EXD- cat as well as mock-transfected cells.
Complexes were separated in PAGE and immunoblotted with anti-Cdc42
antibodies. GST-PBD beads precipitate Cdc42 in extracts from
VE-cadherin, EXD, and EXD- cat but not from mock-transfected
cells. Control GST beads showed specificity of PBD binding to activated
Cdc42. Immunoblots of corresponding extracts were analyzed by
anti-Cdc42 to ensure equal amounts of proteins in the extracts
(lower panel). The experiments were repeated three times
with similar results.
|
|
Formation of Membrane Protrusions in Endothelial Cells Expressing
VE-cadherin Cytoplasmic Domain (
EXD) or wt VE-cadherin--
At
18-24 h post-transfection of HMECs, the expressed proteins localized
at the plasma membrane and the cytoplasm in vesicular structures. We
observed that an unusually high percentage of transfected endothelial
cells developed very long extensions with a striking cell shape change
(Fig. 3A). These extensions
typically showed branching patterns. All cells from randomly selected
fields (a total of 50-100 cells/experiment) were photographed to
measure protrusion lengths. Cells with extensions greater than 70 µm
were scored as positive. Long extensions were evident in ~60% of
cells transfected with
EXD and ~30% of cells transfected with
wild type VE-cadherin (Fig. 3B). As controls, we transfected
HMEC with the cytoplasmic domain of another endothelial adherens
junction protein, desmoplakin, known to associate with intermediate
filaments (29); only 9% of these cells showed protrusions. Moreover,
only 4% of mock-transfected HMEC showed such protrusions (data not shown). To rule out the possibility that cell shape changes were the
result of a transfection artifact, we determined the earliest point
that the protrusions were seen in relation to
EXD expression. Protrusions were observed as early as 3 h post-transfection at a
time when expression of transfected
EXD was barely detectable (Fig.
3A). Mutant molecules localized at the plasma membrane, and
protrusions reached maximum length within 6 h (as in Fig. 7C). We also expressed
EXD in HMEC using retrovirus
infection with identical results (data not shown), indicating the
development of the protrusion was not secondary to the method used.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of VE-cadherin cytoplasmic domain
induces membrane protrusions in endothelial cells. A,
endothelial (HMECs, bovine lung microvascular endothelial cells
(BLMVEC), human pulmonary arterial endothelial cells
(HPAE)) and epithelial (A531) cells were transfected with
VE-cadherin EXD mutant, fixed at 18-24 h post-transfection (except
top left panel, where they were fixed at 3 h) and
stained with anti-FLAG. Endothelial cells displayed morphological
changes in response to expression of EXD mutant. Note that
protrusions are evident just 3 h post-transfection, when the
amount of expressed protein is barely above background level. Under the
same conditions transfected epithelial cells showed no such changes.
EXD-transfected HMEC treated with 200 nM latrunculin
(LAT) failed to form membrane protrusions. Cells were
double-stained with anti-FLAG and phalloidin. Epithelial
(epith) and latrunculin-treated endothelial cells are the
same magnification. The bar represents 10 µm. Experiments
were repeated 3-8 times with similar results. B, percentage
of endothelial cells forming membrane protrusions after expression of
VE-cadherin (wt VEC) or VE-cadherin cytoplasmic domain
( EXD). Three different endothelial cell types (HMECs
(HM), human pulmonary (HP) arterial endothelial
cells, and bovine lung (BL) microvascular endothelial
cells) were transfected with plasmids expressing EXD, wt VE-cadherin
(wt VEC), and desmoplakin tail domain (DP-T) as
the negative control. Between 50-80 transfected cells per experiment
were captured on-screen, and the size of the membrane protrusions was
measured for each individual transfected cell. Cells with membrane
protrusions greater than 70 µm (3 times longer than average cell
body) were scored as positive. Numbers represent the results
of 3-8 transfection experiments.
|
|
To extend these observations to other endothelial cells, we repeated
the same transfection experiments in primary endothelial cells, human
pulmonary arterial endothelial cells, and BMVEC (Fig. 3A);
in both cases, membrane extensions formed 24 h after transfection of wt VE-cadherin and -
EXD. Endothelial cells transfected with
EXD mutant were treated with the actin polymerization inhibitor, latrunculin A (30), and cells were fixed 24 h post-transfection. Latrunculin A in all cases prevented the formation of membrane protrusions (Fig. 3A), indicating the requirement of actin
polymerization in the response.
We also transfected alveolar epithelial cells (A531, a type II alveolar
epithelial cell line) with
EXD to study protrusion formation in
non-endothelial cells. No cell shape change or membrane extensions were
observed in these cells (Fig. 3A), demonstrating the
importance of cellular background in the mechanism of the response.
Membrane Protrusions in Endothelial Cells Expressing VE-cadherin
Cytoplasmic Domain Require Cdc42--
In HMEC co-transfected with
dominant-negative mutant N17Cdc42 and
EXD mutant we observed that
co-expression of N17Cdc42 inhibited the formation of protrusions (Fig.
4). We also co-transfected HMECs with
dominant-negative mutants of Rac1 (N17Rac) or RhoA (N14RhoA) and the
EXD mutant. N17Rac co-expression resulted in shorter and thinner
protrusions in contrast to the inhibition seen with Cdc42 dominant
negative mutant (Fig. 4). N14RhoA co-expression had no effect on the
EXD-induced protrusion formation (Fig. 4).

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 4.
Cdc42 dominant negative mutant inhibits
protrusion formation induced by VE-cadherin cytoplasmic domain
( EXD) in endothelial cells. HMEC were
double-transfected with FLAG-tagged EXD and a plasmid expressing
Myc-tagged N17Cdc42 (upper panel). Transfected cells were
visualized in double immunofluorescence with anti-Myc recognizing
N17Cdc42 and anti-FLAG recognizing EXD. VEC- EXD without the FLAG
tag was co-transfected with N17Rac (middle panel) or N19Rho
(lower panel), both FLAG-tagged. Transfected cells were
double-stained with anti-FLAG recognizing Rho and Rac mutants and
anti-VE-cadherin recognizing VE-cadherin cytoplasmic domain.
EXD-transfected cells were easily identified due to high expression
levels of EXD mutant in comparison to endogenous VE-cadherin. Note
that expression of the Cdc42 dominant negative mutant inhibited
membrane protrusion formation, whereas the effect of Rac dominant
negative mutant was less dramatic; Rho dominant negative mutant had no
effect. The experiments were repeated at least six times with similar
results.
|
|
To quantify the degree of inhibition caused by co-expression of
dominant negative mutants of Rho, Rac, and Cdc42 along with
EXD we
measured protrusion lengths in a large number (90-120) of
double-transfected cells (Fig. 5).
Expression of N17Cdc42 blocked protrusion formation in 100% of
double-transfected cells, whereas ~56% of N19Rho-expressing cells
developed protrusions, a percentage very similar to
EXD-alone
transfected cells. N17Rac blocked protrusion formation to a certain
degree but not entirely, i.e. ~20% of N17Rac-expressing cells formed protrusions of >70 µm. In addition, a significant percentage of double-transfected cells (~15%) formed slightly shorter protrusions (60-70 µm) in these cells.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 5.
Quantification of membrane protrusions formed
in HMEC co-expressing EXD and either Rho or
Rac or Cdc42 dominant negative mutants. HMEC were processed as in
Fig. 4. All double-transfected cells from randomly selected areas were
captured, and the length of the protrusions was calculated using NIH
Image 1.63 software. Cells with membrane protrusions >70 µm were
scored as positive. The experiments were repeated 3 times, and 30-40
cells were evaluated in each experiment.
|
|
Differential Roles of
-Catenin and p120 in Mediating Endothelial
Cell Shape Change--
Expression of wt VE-cadherin and VE-cadherin
cytoplasmic domain had profound effects on endothelial cell shape as
shown above. Because the cadherin cytoplasmic domain associates with
- and p120-catenins, we investigated the possible roles of these
interactions in cell shape change. We generated VE-cadherin cytoplasmic
domain mutants
EXD-
cat lacking the binding site for
-catenin and
EXD-G/A and
EXD-
p120 lacking the binding site
for p120. wt VE-cadherin,
EXD, or
EXD-
cat were transfected
in HMEC, and their association with
-catenin was determined by
immunoprecipitation and Western blotting. We showed that
-catenin
associated with VE-cadherin and -
EXD and did not associate with the
EXD-
cat mutant (Fig.
6A). Also, extracts from HMEC
transfected with
EXD,
EXD-
cat,
EXD-G/A, or
EXD-
p120 were immunoprecipitated with anti-FLAG monoclonal
antibody, and p120 association with VE-cadherin mutants was determined
by Western blot analysis. p120 associated specifically with
EXD and
EXD-
cat but not with either
EXD-G/A or
EXD-
p120
mutants (Fig. 7A). Double
immunofluorescence showed that
EXD co-localized with endogenous
-catenin at the plasma membrane and cytoplasmic vesicular structures
in transfected cells (Fig. 6B).
EXD-transfected cells
also appeared morphologically different from the
EXD-
cat-transfected cells. The latter formed random,
spike-like projections over the entire cell membrane surface (similar
to filopodia) that were clearly thinner than the membrane protrusions
induced by the
EXD mutant (Fig. 6C). Interestingly, the
EXD-
cat mutant did not block adherens junction formation (Fig.
6C,
cat; arrow).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 6.
Role of -catenin in
formation of endothelial membrane protrusions. A,
association of -catenin with VE-cadherin cytoplasmic mutants. HMECs
were transfected with plasmids expressing EXD- cat or EXD
(lanes  cat and EXD). Cells
were lysed, and the mutants were immunoprecipitated (ip)
with anti-FLAG monoclonal antibody (M2). Immunoprecipitates were
subjected to Western blot (WB) analysis using
anti- -catenin antibody. Lane extr, HMEC extract;
lane VEC, mock-transfected HMEC immunoprecipitated with
anti-VE-cadherin antibody. Note that EXD- cat did not associate
with -catenin. B, HMECs were transfected with EXD
mutant, fixed 24 h post-transfection, and double-stained with
anti-FLAG and anti- -catenin antibodies. Transfected cells formed
membrane protrusions, and EXD co-localized in the plasma membrane
and in vesicular structures with endogenous -catenin (the
bar is 10 µm). C, HMECs transfected with
EXD- cat, fixed 24 h post-transfection, and double-stained
with anti-FLAG and anti- -catenin antibodies. EXD- cat
induced the formation of thin filopodia-like structures
(arrowheads) that were morphologically different from
EXD-induced membrane protrusions (compare with EXD-expressing
cells). Note the formation of adherens junctions in
EXD- cat-expressing cells (arrow) (the
bar is 10 µm). D, expression V12Cdc42 mutant in
HMEC induced formation of filopodia with a similar morphology as
EXD- cat-expressing cells (arrowhead). E,
HMECs were double-transfected with FLAG-tagged EXD- cat and
Myc-tagged N17Cdc42. Co-expression of N17Cdc42 blocked cell shape
changes in double-transfected cells. All experiments above were
repeated at least three times.
|
|

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 7.
Plasma membrane localization of cadherin
cytoplasmic domain but not p120 association is required for membrane
protrusion formation. A, HMEC were transfected with
EXD- cat, EXD, EXD-G/A, or EXD- p120
(lanes  cat, EXD,
G/A, and p120). Cells were lysed, and the
mutants were immunoprecipitated (ip) with M2 monoclonal
antibody. Immunoprecipitates were subjected to Western blot analysis
using anti-p120 antibody. Note that EXD-G/A and EXD- p120 did
not associate with p120. B, HMEC were transfected with
EXD, fixed 24 h post-transfection, and double-stained with
anti-FLAG and anti-p120 antibodies. C, HMECs transfected
with EXD-G/A, fixed 6 h post-transfection, and double-stained
with anti-FLAG and anti-p120 antibodies. EXD-G/A induced protrusions
similar to EXD. Arrowheads indicate EXD-G/A, and the
arrow shows p120 localization at the membrane. D,
HMECs transfected with EXD- p120 fixed after 24 h and
double-stained with anti-FLAG and anti-p120 antibodies. EXD- p120
localized exclusively in the cytoplasm with no apparent cell shape
changes in the transfected cells. All of the above experiments were
repeated at least three times.
|
|
Because Cdc42 was activated in
EXD-
cat-transfected endothelial
cells (Fig. 2), we compared cell shape changes induced by expression of
EXD-
cat and the activated mutant of Cdc42. Transfection of
HMEC with the constitutively active Cdc42 mutant (V12Cdc42) induced a
large number of filopodia (Fig. 6D). Expression of
EXD-
cat and V12Cdc42 induced similar filopodia structures
secondary to the activation of Cdc42. No striking cell shape changes
were observed when
EXD-
cat was co-transfected with N17Cdc42
(Fig. 6E), indicating that Cdc42 is involved in filopodia
formation induced by
EXD-
cat. N17Cdc42 was also shown to
co-localize with
EXD-
cat at distinct plasma membrane sites as
shown by confocal microscopy (Fig. 6E).
Mutant
EXD-G/A did not associate with p120 (Fig. 7A). To
study the localization of
EXD-G/A with endogenous p120, cells were fixed at 6 h post-transfection when mutant expression level was low and examined by confocal microscopy. The mutant localized at
membrane patches distinct from p120 and cytoplasmic vesicular structures similar to
EXD (Fig. 7, B and C).
Importantly, at this time point,
EXD-G/A-transfected cells also
developed long protrusions similar to those after expression of
EXD;
thus, formation of these protrusions is independent of p120 binding to
the VE-cadherin cytoplasmic domain. Quantification of the effect of
EXD-G/A expression in protrusion formation showed that ~55% of
EXD-G/A-transfected cells developed protrusions (data not shown).
We generated an additional deletion mutant (
EXD-
p120) of
VE-cadherin cytoplasmic domain lacking the entire domain for p120 binding (residues 645-654) (28). We observed that
EXD-
p120 localized exclusively in the cytoplasm and that membrane protrusions did not develop in these cells (Fig. 7D). This finding
suggests the importance of membrane localization in the mechanism of
protrusion formation.
 |
DISCUSSION |
Activation of Cdc42 by VE-cadherin Cytoplasmic Domain Signal
Formation of Endothelial Membrane Protrusions--
We expressed wt
VE-cadherin or VE-cadherin cytoplasmic domain mutant in subconfluent
endothelial cells. We showed that expression of either of these
constructs induced Cdc42 activation and that the expressed cadherins
localized at the plasma membrane. These findings suggest that the
non-junctional VE-cadherin and especially its cytoplasmic domain was
involved in Cdc42 activation. Rho GTPases have been implicated in
formation of actin-driven membrane rearrangements (31). Cdc42 in
particular is considered as an important GTPase, signaling the
formation of filopodia (32, 33). We showed that expression of wt
VE-cadherin and VE-cadherin cytoplasmic domain induced the formation of
membrane protrusions. Co-expression experiments using dominant negative
mutants of Rho, Rac, or Cdc42 along with
EXD mutant demonstrated
that formation of these protrusions was predominantly the result of
Cdc42 activation. It is not clear how the cytoplasmic domain of
VE-cadherin activates Cdc42. The guanine exchange factor Tiam1 is
localized at the cell-cell junctions of epithelial cells and promotes
invasiveness of T lymphoma cells across the epithelial barrier (34). It
is possible that a similar guanine exchange factor may be localized at
the VE-cadherin cytoplasmic domain that enables activation of Cdc42 in
close proximity to the plasma membrane.
To rule out the possibility that formation of membrane protrusions
induced by the VE-cadherin cytoplasmic domain is not restricted to a
transformed endothelial cell line, we also studied two primary endothelial cells with similar results. Development of long membrane protrusions was clearly evident within 3 h after transfection of
the
EXD mutant; that is, at a time when mutant expression was barely
detected. Thus, it is unlikely that the protrusions were the result of
massive overexpression of the transfected mutant. In a control
experiment, the expression of desmoplakin, a vimentin binding protein
(35), did not affect endothelial cell morphology. In another control
experiment expression of VE-cadherin cytoplasmic domain in type II
alveolar epithelial cells (A531 cells) also failed to induce membrane
protrusions, implying that the effect is endothelial cell-specific. The
latter finding is consistent with observations in cultured epithelial
cells that expression of E- or N-cadherin
EXD mutant failed to
induce a cell shape change (23, 36). It is well established that
cadherin and associated catenins mediate outside-in signaling (6, 9, 10). In the present study, we show that non-junctional VE-cadherin induces signaling initiated inside endothelial cells, which in turn
induces a cell shape change involving formation of membrane protrusion
that may restore junctional integrity after the loss of homotypic
VE-cadherin adhesion.
Different Roles of
-Catenin and p120 in Induction of Membrane
Protrusions in Endothelial Cells--
- and p120-catenins associate
directly with cadherins at well conserved cytoplasmic domains (37, 38).
Because their association with VE-cadherin may be important in the
formation of membrane protrusions, we studied their role by expressing
the two VE-cadherin cytoplasmic domain mutants lacking either
-catenin or p120 binding sites. An extended domain of 100 residues
in cadherin cytoplasmic domain was identified in mediating association
with
-catenin (39), but a short conserved motif, SLSS, is required
for this association (27, 39). Expression of a construct
(
EXD-
cat) in which this motif was deleted abolished the
binding of this mutant to
-catenin without affecting the p120
association; thus, it is likely that
EXD-
cat mutant was
inserted in the membrane in its proper conformation. We showed that the
expression of
EXD-
cat induced the activation of Cdc42 in
endothelial cells, but interestingly, this mutant resulted in the
formation of thin, needle-like structures resembling filopodia, similar
to those induced by expression of the constitutively active Cdc42
mutant. Therefore, VE-cadherin lacking the
-catenin binding site is
unable to induce formation of the characteristic membrane protrusions
seen with the expression of cytoplasmic domain of VE-cadherin. It is
known that
-catenin mediates the association of actin cytoskeleton
with cadherin through the actin binding proteins
-catenin (38),
-actinin, and vinculin (40); thus,
-catenin plays a crucial role
as a linker regulating interaction of cadherin with actin. The
differences in cell shape change induced by
EXD versus
EXD-
cat can be explained by the absence of
-catenin/
-catenin association in the latter case. Thus actin may
fail to bind to VE-cadherin-catenin complex in an appropriate manner to
form the characteristic long membrane protrusions.
Because it is possible that p120 may also contribute to the formation
of membrane protrusions, we expressed a VE-cadherin mutant that was
unable to associate with p120. Substitution of GGG to AAA (residues
649-651) abolished p120 binding to VE-cadherin (mutant
EXD-G/A),
consistent with studies using E-cadherin (28). Interestingly, the
expression of
EXD-G/A mutant resulted in a similar phenotype as
EXD, indicating that the p120-VE-cadherin association is not
essential for protrusion formation. In other studies we compared the
results of the
EXD-G/A mutant with another mutant,
EXD-
p120,
lacking 10 residues at the p120 binding domain. This deletion mutant
did not localize at the membrane, and it also failed to induce the cell
shape change. Thus, these results suggest that sorting of VE-cadherin
at the membrane is required for the formation of membrane protrusions.
In previous studies, expression of p120 was shown to induce membrane
protrusions in fibroblasts and epithelial cells (a "dendritic" or
"branching" phenotype) (41, 42). The expression of cytosolic p120
inhibited RhoA activity in both studies. Noren et al. (42) show that p120 expression resulted in Rac1 and Cdc42 activation and
that p120 co-precipitated with the guanine exchange factor vav2,
suggesting a direct role of cytosolic p120 in Rac1 and Cdc42 activation. Anastasiadis et al. (41) propose that the
branching phenotype could be the result of RhoA inhibition and the
resultant loss of stress fibers and re-organization of ERM family
proteins in the cortical cytoskeleton. Both studies suggest that
p120-activated signaling was initiated in the cytoplasm. Our results in
endothelial cells show that VE-cadherin is involved in Cdc42 activation
at the plasma membrane, but they do not rule out a parallel regulation of GTPases in the cytoplasm induced by p120.
In the present study, we provide evidence for the an important role of
VE-cadherin in the formation of long protrusions in endothelial cells.
Our data show that membrane protrusions form as a result of actin
polymerization through Cdc42 activation and the anchorage of the newly
synthesized actin filaments to the VE-cadherin cytoplasmic domain.
Actin-binding proteins associated with VE-cadherin-
-catenin complex
are necessary for the extension of actin cytoskeleton after Cdc42
activation. The dual role of VE-cadherin cytoplasmic domain in Cdc42
activation and formation of actin cytoskeleton extensions may be
important in the reassembly of adherens junctions and restoration of
endothelial barrier function upon the loss of adherens junctional integrity.
 |
ACKNOWLEDGEMENTS |
We would like to thank X. P. Du for
helpful discussions, E. Dejana for providing the human VE-cadherin
cDNA, T. Kozasa and T. Voyno-Yasenetskaya for Rho, Rac, and Cdc42
dominant negative mutants, and G. Bokoch for GST-PBD.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
A Parker B. Francis Fellow in Pulmonary Research. To whom
correspondence should be addressed: Dept. of Pharmacology, 835 S. Wolcott Ave., M/C 868, Chicago, IL 60612. Tel.: 312-355-0238; Fax:
312-996-1225; E-mail: pkouklis@uic.edu.
Published, JBC Papers in Press, February 20, 2003, DOI 10.1074/jbc.M212591200
1
P. Kouklis and A. B. Malik,
unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
HMEC, human
microvascular endothelial cell;
wt, wild type;
GST, glutathione
S-transferase.
 |
REFERENCES |
| 1.
|
Tepass, U.,
Truong, K.,
Godt, D.,
Ikura, M.,
and Peifer, M.
(2000)
Nat. Rev. Mol. Cell Biol.
1,
91-100[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Takeichi, M.
(1995)
Curr. Opin. Cell Biol.
7,
619-627[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Riethmacher, D.,
Brinkmann, V.,
and Birchmeier, C.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
855-859[Abstract/Free Full Text]
|
| 4.
|
Radice, G. L.,
Rayburn, H.,
Matsunami, H.,
Knudsen, K. A.,
Takeichi, M.,
and Hynes, R. O.
(1997)
Dev. Biol.
181,
64-78[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Radice, G. L.,
Ferreira-Cornwell, M. C.,
Robinson, S. D.,
Rayburn, H.,
Chodosh, L. A.,
Takeichi, M.,
and Hynes, R. O.
(1997)
J. Cell Biol.
139,
1025-1032[Abstract/Free Full Text]
|
| 6.
|
Carmeliet, P.,
Lampugnani, M. G.,
Moons, L.,
Breviario, F.,
Compernolle, V.,
Bono, F.,
Balconi, G.,
Spagnuolo, R.,
Oostuyse, B.,
Dewerchin, M.,
Zanetti, A.,
Angellilo, A.,
Mattot, V.,
Nuyens, D.,
Lutgens, E.,
Clotman, F.,
de Ruiter, M. C.,
Gittenberger-de Groot, A.,
Poelmann, R.,
Lupu, F.,
Herbert, J. M.,
Collen, D.,
and Dejana, E.
(1999)
Cell
98,
147-157[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Gumbiner, B. M.
(2000)
J. Cell Biol.
148,
399-404[Abstract/Free Full Text]
|
| 8.
|
Ben-Ze'ev, A.
(1999)
Ann. N. Y. Acad. Sci.
886,
37-47[Abstract/Free Full Text]
|
| 9.
|
Hoschuetzky, H.,
Aberle, H.,
and Kemler, R.
(1994)
J. Cell Biol.
127,
1375-1380[Abstract/Free Full Text]
|
| 10.
|
Pece, S.,
Chiariello, M.,
Murga, C.,
and Gutkind, J. S.
(1999)
J. Biol. Chem.
274,
19347-19351[Abstract/Free Full Text]
|
| 11.
|
Dudek, S. M.,
and Garcia, J. G.
(2001)
J. Appl. Physiol.
91,
1487-1500[Abstract/Free Full Text]
|
| 12.
|
Dejana, E.,
Lampugnani, M. G.,
Martinez-Estrada, O.,
and Bazzoni, G.
(2000)
Int. J. Dev. Biol.
44,
743-748[Medline]
[Order article via Infotrieve]
|
| 13.
|
Allport, J. R.,
Muller, W. A.,
and Luscinskas, F. W.
(2000)
J. Cell Biol.
148,
203-216[Abstract/Free Full Text]
|
| 14.
|
Del Maschio, A.,
Zanetti, A.,
Corada, M.,
Rival, Y.,
Ruco, L.,
Lampugnani, M. G.,
and Dejana, E.
(1996)
J. Cell Biol.
135,
497-510[Abstract/Free Full Text]
|
| 15.
|
Gotsch, U.,
Borges, E.,
Bosse, R.,
Boggemeyer, E.,
Simon, M.,
Mossmann, H.,
and Vestweber, D.
(1997)
J. Cell Sci.
110,
583-588[Abstract]
|
| 16.
|
Navarro, P.,
Ruco, L.,
and Dejana, E.
(1998)
J. Cell Biol.
140,
1475-1484[Abstract/Free Full Text]
|
| 17.
|
Corada, M.,
Liao, F.,
Lindgren, M.,
Lampugnani, M. G.,
Breviario, F.,
Frank, R.,
Muller, W. A.,
Hicklin, D. J.,
Bohlen, P.,
and Dejana, E.
(2001)
Blood
97,
1679-1684[Abstract/Free Full Text]
|
| 18.
|
Luscinskas, F. W.,
Ma, S.,
Nusrat, A.,
Parkos, C. A.,
and Shaw, S. K.
(2002)
Immunol. Rev.
186,
57-67[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Nollet, F.,
Kools, P.,
and van Roy, F.
(2000)
J. Mol. Biol.
299,
551-572[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Kintner, C.
(1992)
Cell
69,
225-236[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Dufour, S.,
Saint-Jeannet, J. P.,
Broders, F.,
Wedlich, D.,
and Thiery, J. P.
(1994)
J. Cell Biol.
127,
521-535[Abstract/Free Full Text]
|
| 22.
|
Fujimori, T.,
and Takeichi, M.
(1993)
Mol. Biol. Cell
4,
37-47[Abstract]
|
| 23.
|
Zhu, A. J.,
and Watt, F. M.
(1996)
J. Cell Sci.
109,
3013-3023[Abstract]
|
| 24.
|
Nieman, M. T.,
Kim, J. B.,
Johnson, K. R.,
and Wheelock, M. J.
(1999)
J. Cell Sci.
112,
1621-1632[Abstract]
|
| 25.
|
Venkiteswaran, K.,
Xiao, K.,
Summers, S.,
Calkins, C. C.,
Vincent, P. A.,
Pumiglia, K.,
and Kowalczyk, A. P.
(2002)
Am. J. Physiol. Cell Physiol.
283,
811-821
|
| 26.
|
Ades, E. W.,
Candal, F. J.,
Swerlick, R. A.,
George, V. G.,
Summers, S.,
Bosse, D. C.,
and Lawley, T. J.
(1992)
J. Invest. Dermatol.
99,
683-690[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Lickert, H.,
Bauer, A.,
Kemler, R.,
and Stappert, J.
(2000)
J. Biol. Chem.
275,
5090-5095[Abstract/Free Full Text]
|
| 28.
|
Thoreson, M. A.,
Anastasiadis, P. Z.,
Daniel, J. M.,
Ireton, R. C.,
Wheelock, M. J.,
Johnson, K. R.,
Hummingbird, D. K.,
and Reynolds, A. B.
(2000)
J. Cell Biol.
148,
189-202[Abstract/Free Full Text]
|
| 29.
|
Kouklis, P. D.,
Hutton, E.,
and Fuchs, E.
(1994)
J. Cell Biol.
127,
1049-1060[Abstract/Free Full Text]
|
| 30.
|
Spector, I.,
Shochet, N. R.,
Kashman, Y.,
and Groweiss, A.
(1983)
Science
219,
493-495[Abstract/Free Full Text]
|
| 31.
|
Nobes, C. D.,
and Hall, A.
(1995)
Cell
81,
53-62[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Kim, S. H.,
Li, Z.,
and Sacks, D. B.
(2000)
J. Biol. Chem.
275,
36999-37005[Abstract/Free Full Text]
|
| 33.
|
Noren, N. K.,
Niessen, C. M.,
Gumbiner, B. M.,
and Burridge, K.
(2001)
J. Biol. Chem.
276,
33305-33308[Abstract/Free Full Text]
|
| 34.
|
Hordijk, P. L.,
ten Klooster, J. P.,
van der Kammen, R. A.,
Michiels, F.,
Oomen, L. C.,
and Collard, J. G.
(1997)
Science
278,
1464-14666[Abstract/Free Full Text]
|
| 35.
|
Stappenbeck, T. S.,
Bornslaeger, E. A.,
Corcoran, C. M.,
Luu, H. H.,
Virata, M. L.,
and Green, K. J.
(1993)
J. Cell Biol.
123,
691-705[Abstract/Free Full Text]
|
| 36.
|
Hertig, C. M.,
Eppenberger-Eberhardt, M.,
Koch, S.,
and Eppenberger, H. M.
(1996)
J. Cell Sci.
109,
1-10[Abstract]
|
| 37.
|
Lampugnani, M. G.,
Corada, M.,
Caveda, L.,
Breviario, F.,
Ayalon, O.,
Geiger, B.,
and Dejana, E.
(1995)
J. Cell Biol.
129,
203-217[Abstract/Free Full Text]
|
| 38.
|
Ozawa, M.,
Baribault, H.,
and Kemler, R.
(1989)
EMBO J.
8,
1711-1717[Medline]
[Order article via Infotrieve]
|
| 39.
|
Huber, A. H.,
and Weis, W. I.
(2001)
Cell
105,
391-402[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Weiss, E. E.,
Kroemker, M.,
Rudiger, A. H.,
Jockusch, B. M.,
and Rudiger, M.
(1998)
J. Cell Biol.
141,
755-764[Abstract/Free Full Text]
|
| 41.
|
Anastasiadis, P. Z.,
Moon, S. Y.,
Thoreson, M. A.,
Mariner, D. J.,
Crawford, H. C.,
Zheng, Y.,
and Reynolds, A. B.
(2000)
Nat. Cell Biol.
2,
637-644[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Noren, N. K.,
Liu, B. P.,
Burridge, K.,
and Kreft, B.
(2000)
J. Cell Biol.
150,
567-580[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg 