![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 19, 16474-16477, May 9, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Adolf Butenandt-Institute, Department of Biochemistry,
Laboratory for Alzheimer's and Parkinson's Disease Research,
Ludwig-Maximilians-University, Schillerstrasse 44, 80336 Munich,
Germany
Received for publication, March 4, 2003, and in revised form, March 18, 2003
cDNA Constructs--
To down-regulate endogenous Nct by RNA
interference (RNAi), oligonucleotides corresponding to Nct-1045
(6) were cloned into the pSUPER vector (14). Nct deletions (Del
1-5, Fig. 1a) were constructed by
oligonucleotide-directed mutagenesis using PCR. Silencer mutations
(aaagggaaattcccggtccaatt;
the mutations are underlined) were introduced (which do not affect the
amino acid sequence) in the constructs to escape RNAi. All constructs were verified by DNA sequencing.
Cell Culture, Cell Lines, RNAi, and Transfections--
Human
embryonic kidney (HEK) 293 cells and mouse embryonic fibroblast cells
were cultured as described (6). A stable Nct knock-down cell line was
generated by stably co-transfecting HEK 293 cells overexpressing
Swedish mutant APP (15) with pSUPER/Nct-1045 and pcDNA3.1/Hygro( Antibodies--
The polyclonal and monoclonal antibodies against
the large cytoplasmic loop domain of PS1 (3027 and BI.3D7), the PS1 N
terminus (PS1N), PEN-2 (1638), the APP C terminus (6687), and
A Protein Analysis--
Cell lysates were prepared using
STEN-lysis buffer (50 mM Tris (pH 7.6), 150 mM
NaCl, 2 mM EDTA, 1% Nonidet P-40). After a clarifying
spin, cell lysates were subjected to immunoblot analysis. Where
indicated Nonidet P-40 was substituted with DDM (0.7%), CHAPS (2%),
or SDS (1%). For analysis of Trypsin Resistance Assay--
Cells were lysed as detailed above
in the presence of 0.7% DDM or 1% SDS. Following a clarifying spin,
cell lysates were incubated with the indicated amounts of trypsin in
150 mM sodium citrate (pH 6.4), 150 mM NaCl, 5 mM EDTA, 5 µg/ml pepstatin for 30 min at 30 °C.
Proteolysis was stopped by the addition of 10-fold excess amounts of
soybean trypsin inhibitor, and samples were subjected to immunoblot analysis.
In an attempt to identify the functionally important
domains of Nct, we generated a set of deletions within the ectodomain (Fig. 1a). These cDNA
constructs were investigated in a HEK 293 cell line stably expressing
Swedish mutant APP (15) and a pSUPER-based Nct-1045 (6) small
interfering RNA-encoding vector, which stably knocks down endogenous
Nct expression by RNAi (Fig. 1b; lane 2). RNAi-mediated inhibition of Nct expression results in reduced PS1 CTF
formation, reduced PEN-2 and APH-1aL (8) expression, the accumulation
of the APP C-terminal fragments (APP-CTFs), and reduced A Our findings demonstrate that trypsin resistance of the Nct
ectodomain is associated with Taken together our findings provide the first insights into the
assembly and maturation of the We thank Dr. C. Kaether for helpful
discussions, Dr. R. Agami for the pSUPER vector, Dr. R. Nixon for the
monoclonal antibody PS1N, Dr. B. De Strooper for PS1/2 deficient mouse
embryonic fibroblast cells, and Drs. G. Yu, Y. Gu, and P. St George
Hyslop for Nct cDNA constructs and the APH-1aL antibody.
*
This work was supported by the Deutsche
Forschungsgemeinschaft (Priority Program "Cellular Mechanisms
of Alzheimer's Disease") and the European Community (DIADEM
Project).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence may be addressed. Tel.: 49-89-5996-471/472;
Fax: 49-89-5996-415; E-mail: chaass@pbm.med.uni-muenchen.de.
Published, JBC Papers in Press, March 18, 2003, DOI 10.1074/jbc.C300095200
The abbreviations used are:
AD, Alzheimer
disease;
APP,
ACCELERATED PUBLICATION
-Secretase Activity Is Associated with a Conformational
Change of Nicastrin*
, and
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-Secretase is a high molecular weight
multicomponent protein complex with an unusual intramembrane-cleaving
aspartyl protease activity.
-Secretase is intimately associated with
Alzheimer disease because it catalyzes the proteolytic cleavage, which
leads to the liberation of amyloid
-peptide. At least presenilin
(PS), Nicastrin (Nct), APH-1, and PEN-2 are constituents of the
-secretase complex, with PS apparently providing the active site of
-secretase. Expression of
-secretase complex components is
tightly regulated, however little is known about the assembly of the
complex. Here we demonstrate that Nct undergoes a major conformational
change during the assembly of the
-secretase complex. The
conformational change is directly associated with
-secretase
function and involves the entire Nct ectodomain. Loss of function
mutations generated by deletions failed to undergo the conformational
change. Furthermore, the conformational alteration did not occur in the
absence of PS. Our data thus suggest that
-secretase function
critically depends on the structural "activation" of Nct.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-Secretase plays a fundamental role in Alzheimer disease
(AD)1 by catalyzing the final
proteolytic cleavage, which leads to the formation of amyloid-
peptide (A
), the major component of the diseases defining senile
plaques (1). By genetic and biochemical approaches several components
of the
-secretase complex have been identified. In addition to the
presenilins (PS1 and PS2) (reviewed in Ref. 1), APH-1a/b, PEN-2, and
nicastrin (Nct) (2-4) were recently identified. Apparently all four
proteins assemble into a large 500-600-kDa complex (5-9), which
displays the intramembranous proteolytic activity required for the
cleavage of the
-amyloid precursor protein (APP) and other
substrates such as Notch (for review see Ref. 1). Formation of the
-secretase complex is coordinately regulated (2, 6-13) and depends
on the presence of all known complex components. Although there is considerable evidence that PS constitutes the active site of
-secretase (reviewed in Ref. 1), very little is known about the
function of the individual PS binding partners. Previously we and
others demonstrated that maturation of Nct is associated with
-secretase complex assembly (6, 11-13). In addition, a conserved
DYIGS motif is apparently involved in Nct function (3). Here we
demonstrate that a major conformational change, which requires that the
entire ectodomain of Nct is directly associated with
-secretase
complex formation and function. The structural alteration fails to
occur in Nct loss of function mutations as well as in the absence of presenilins.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
)
(Invitrogen) and selection for hygromycin (100 µg/ml) resistance.
This cell line was stably transfected with the indicated wt and mutant
Nct constructs or the empty vector (pcDNA6) by Lipofectamine 2000 (Invitrogen) according to the instructions of the manufacturer using
selection for blasticidin (10 µg/ml) resistance. To inhibit
mannosidase I, cells were cultured in the presence of the indicated
amounts of kifunensine (Calbiochem) or vehicle for 48 h at
37 °C.
(1-42) (3926) were described previously (see
Refs. 6 and 7 and citations therein). The polyclonal antibody N1660
against the C terminus of Nct and monoclonal antibody 6E10 against A
(1-17) were obtained from Sigma and Senetek, respectively, the
anti-APH-1aL (O2C2) antibody was described previously (9).
-secretase complexes DDM-solubilized
membrane fractions were subjected to co-immunoprecipitation as
described (7). Cell surface biotinylation was carried out as described
(16). For deglycosylation, cell lysates were incubated with 50 milliunits/ml endoglycosidase H (endo H) for 16 h at 37 °C in
200 mM sodium citrate (pH 5.8), 0.5 mM
phenylmethylsulfonyl fluoride, 100 mM 2-mercaptoethanol,
0.1% SDS) followed by immunoblot analysis. For detection of secreted
A
following kifunensine treatment, media were replaced, conditioned
for 3 h, and analyzed for A
by combined
immunoprecipitation/immunoblotting using antibodies 3926/6E10.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
generation
(Fig. 1b). These observations are due to the inhibition of
the
-secretase activity upon down-regulation of Nct (6). Expression
of a wt Nct cDNA with a cluster of silent mutations conferring RNAi
resistance led to the formation of mature Nct (Fig. 1b),
which has previously been shown to be associated with the functional
-secretase complex (6, 11-13). In addition, an accumulation of
large amounts of immature Nct due to its overexpression (6, 12, 17) was
observed (Fig. 1b). In contrast, all deletion constructs
apparently formed only one Nct polypeptide (Fig. 1b), indicating a failure of maturation. To investigate if the Nct deletion
variants undergo complex glycosylation like wt Nct, cell lysates were
treated with endo H. As shown in Fig. 1c, only mature Nct
(endogenous and exogenous) was endo H-resistant, whereas immature Nct
and all deleted variants failed to become endo H-resistant. Exogenous
expression of wt Nct restored PS1 CTF formation and PEN-2 and APH-1aL
expression and allowed full
-secretase function as monitored by the
significantly reduced levels of APP-CTFs accompanied by robust A
generation (Fig. 1b). In contrast to wt Nct, none of the
deletion constructs restored PS1 CTF formation and PEN-2 or APH-1aL
expression (Fig. 1b). Moreover, the deletion constructs did
not allow the formation of a
-secretase activity, because none of
them reduced APP-CTF formation or increased A
production (Fig.
1b). Thus, all deletions within the ectodomain failed to restore
-secretase function. This suggests an important role of not
only the conserved DYIGS motif but the entire ectodomain in
-secretase complex assembly and activity. The lack of a specific functional subdomain of Nct thus indicates that correct folding of the
entire ectodomain is required for Nct function. The primary structure
of Nct suggests a rather large luminal domain, which according to our
findings plays a pivotal role in Nct function. To investigate if the
luminal domain of functional Nct adopts a conformation, which is
different from non-functional Nct, cell lysates were treated with
increasing amounts of trypsin to monitor unmasking or masking of
cleavage sites (18). Interestingly, the mature form of Nct, which is
predominantly found in the mature
-secretase complex (6, 12, 13,
17), was selectively trypsin-resistant whereas immature Nct remained
trypsin-sensitive even at the lowest concentration (Fig.
2a). Mature Nct showed resistance up to concentrations of as much as 500 µg/ml trypsin (Fig.
2a and data not shown). In contrast to mature Nct, APP, which is also a type I transmembrane glycoprotein, was sensitive to
trypsin (Fig. 2a). Furthermore, the
-secretase complex
components PS1 NTF, PS1 CTF, and APH-1aL were all fully sensitive to
trypsin digestion (Fig. 2a), whereas PEN-2 was found to be
less sensitive (data not shown). Because APH-1aL and the PS fragments
are trypsin-sensitive, Nct is not simply protected by these
-secretase complex components. In addition, the very small PEN-2 is
unlikely to protect the large Nct ectodomain. Thus, Nct appears to
undergo a conformational change independent of APH-1aL, PS, and also
PEN-2. After demonstrating the selective trypsin resistance of mature
Nct, the deletion variants (Fig. 1a), which all fail to
restore
-secretase activity (Fig. 1b), were investigated.
Interestingly, none of them displayed trypsin resistance (Fig.
2b). This suggests that assembly of a biologically active
-secretase complex is associated with the formation of a
trypsin-resistant Nct variant. To further support this hypothesis, we
analyzed Nct in mouse embryonic fibroblast cells derived from a PS1/2
gene knock-out. Because of the absence of PS in these cells no
-secretase complex can be formed. As we and others have previously
shown these cells are also deficient in Nct maturation (7, 11, 13).
Thus, fibroblasts derived from a PS1/2 gene knock-out are ideally
suited to investigate the association of trypsin-resistant Nct with
-secretase complex formation. Interestingly, immature Nct in
PS1/2
/
cells was degraded by trypsin, whereas mature
Nct in the corresponding PS1/2+/+ control cells was fully
trypsin-resistant (Fig. 2c). Thus, the conversion of
trypsin-sensitive to a trypsin-resistant Nct is indeed tightly
associated with
-secretase complex formation. Furthermore, the
selectivity of trypsin resistance of mature Nct versus
immature/non-functional Nct suggests a major conformational change of
Nct during
-secretase complex assembly and maturation. However, the
selective resistance of mature Nct does not exclude the possibility
that proteases could not interact with mature Nct due to the rather
large and abundant sugar side chains added during maturation. Indeed,
16 putative glycosylation sites are present in the ectodomain (3). To
denature and unfold mature Nct, cells were lysed in the presence of 1%
SDS, and lysates were then digested with increasing amounts of trypsin.
Under these conditions mature Nct became sensitive to trypsin
digestion, whereas non-denatured mature Nct extracted under conditions
which preserve the
-secretase complex remained protease-resistant
(Fig. 3a). However,
glycosylation could protect even partially denatured mature Nct and
thus indirectly prevent trypsin-mediated degradation. To exclude this
possibility we blocked complex glycosylation by incubating
untransfected HEK 293 cells (expressing endogenous Nct) in the presence
of kifunensine, which potently inhibits mannosidase I (19). As shown in
Fig. 3b, treatment with kifunensine strongly blocked
maturation of Nct as manifested by the appearance of a novel Nct
species (termed immature-like Nct, see below) migrating at lower
molecular weight. However, in contrast to the immature form of Nct, the
immature-like species observed upon kifunensine treatment was still
trypsin-resistant like the mature fully glycosylated Nct variant (Fig.
3c). These data suggest that a conformational change of Nct
associated with trypsin resistance must take place upon assembly and/or
maturation of the
-secretase complex. To investigate if the
-secretase complex is still active upon inhibition of mannosidase I,
A
was isolated before and after kifunensine treatment. Consistent
with Herreman et al. (13), A
production was not inhibited
by kifunensine (Fig. 3d). Moreover, expression levels of PS1
CTFs and PEN-2 were not significantly reduced by kifunensine treatment
(Fig. 3e, left panel) demonstrating that kifunensine does not interfere with the assembly of the
-secretase complex. Furthermore, immature-like Nct and PEN-2 co-immunoprecipitated with PS1 upon kifunensine treatment for 2 days (Fig. 3e,
right panel). Finally, cell surface biotinylation revealed
that immature-like Nct reaches the plasma membrane in cells treated
with kifunensine (Fig. 3f) like endogenous Nct in
untreated cells (13, 16).

View larger version (51K):
[in a new window]
Fig. 1.
The entire ectodomain of Nct is required for
its function in
-secretase-mediated APP
processing. a, schematic representation of Nct and the
ectodomain deletion mutants generated. SP denotes the
putative signal peptide and TM the transmembrane domain.
Dotted boxes indicate conserved regions including the DYIGS
motif-containing region (3). Potential glycosylation sites are
indicated with black circles. b, Nct ectodomain
deletion mutants are functionally inactive. HEK 293 cells stably
co-expressing Swedish mutant APP (sw) and Nct-1045 small
interfering RNA were stably transfected with the indicated cDNA
constructs encoding wt Nct, Nct ectodomain deletion mutants (harboring
silent mutations to escape RNAi; note that Del 3 escapes RNAi due to
deletion of the RNAi-targeted region) or a vector control. Cell lysates
were analyzed for levels of Nct (mature (m) and immature
(im) forms), and PS1 CTF and APP-CTFs (generated by
-secretase (CTF
) and
-secretase (CTF
)) by immunoblotting
with antibodies N1660 (Nct), 3027 (PS1), and 6687 (APP). PEN-2 and
APH-1aL levels were analyzed from membrane fractions of the same cells
by immunoblotting with antibodies 1638 (PEN-2) and O2C2 (APH-1aL). A
was analyzed from conditioned media by combined
immunoprecipitation/immunoblotting with antibodies 3926/6E10.
c, Nct ectodomain deletion mutants are endo H-sensitive.
Cell lysates were incubated with (+) or without (
) endo H and
analyzed for Nct as in B.

View larger version (40K):
[in a new window]
Fig. 2.
Mature Nct is trypsin-resistant.
a, DDM-extracted HEK 293 cells stably transfected with wt
Nct (as detailed in Fig. 1b) were treated with the indicated
amounts of trypsin and analyzed for Nct, APP, PS1 (CTF and NTF), and
APH-1aL as in Fig. 1b. The PS1 NTF was analyzed with
antibody PS1N. Note that mature Nct is resistant to trypsin whereas
immature Nct and mature and immature forms of APP are degraded even at
the lowest concentration of trypsin. The polypeptide migrating at 85 kDa is an intermediate degradation product of immature Nct. Other
-secretase complex components such as the PS1 NTF and CTF and
APH-1aL were fully sensitive to trypsin. b, all Nct deletion
mutants are sensitive to trypsin. CHAPS-extracted HEK 293 cells stably
transfected with wt Nct and the indicated Nct deletion mutants (as
detailed in Fig. 1b) were incubated with (+) or without (
)
100 µg/ml trypsin and analyzed for Nct as in Fig. 1b.
c, Nct not associated with the
-secretase complex is
trypsin-sensitive whereas mature Nct assembled into the
-secretase
complex is resistant. Cell lysates of PS1/2+/+ or
PS1/2
/
mouse embryonic fibroblast cells were subjected
to trypsin treatment as in b and analyzed for Nct as in Fig.
1b. Consistent with our previous results (7) immature Nct
accumulates in the PS1/2
/
cells, whereas both mature
and immature Nct is detected in PS1/2+/+ control cells.
Mature Nct in PS1/2+/+ control cells is trypsin-resistant
whereas immature Nct in PS1/2
/
cells is
trypsin-sensitive.

View larger version (44K):
[in a new window]
Fig. 3.
A conformational change of Nct is
associated with its resistance to trypsin degradation and
-secretase complex assembly. a, SDS
unfolds Nct and makes it sensitive to trypsin. HEK 293 cells stably
transfected with wt Nct (as detailed in Fig. 1b) were
extracted with DDM (which leaves the
-secretase complex intact (6,
7)) or SDS, subjected to trypsin treatment and analyzed for Nct as in
Fig. 1b. b, inhibition of Nct maturation by
blocking mannosidase I does not affect
-secretase complex
formation/activity. HEK 293 cells were incubated in the presence of the
indicated amounts of kifunensine, and lysates were analyzed as in
a. Note that treatment with kifunensine results in the
formation of a Nct species, which co-migrates with immature Nct
(immature-like (iml) Nct). c, immature-like Nct
generated by kifunensine treatment is trypsin-resistant. Lysates from
kifunensine-treated HEK 293 cells were incubated with 20 µg/ml
trypsin and analyzed as in a. d, generation of
secreted A
upon kifunensine treatment. Conditioned media of HEK 293 cells pretreated with kifunensine were collected, and A
production
was analyzed as in Fig. 1b. e, immature-like Nct
generated by kifunensine treatment forms a complex with PS1 and PEN-2.
DDM-extracted membrane fractions of HEK 293 cells were
immunoprecipitated with antibody 3027 (PS1-C) and analyzed
by immunoblotting as in Fig. 1b, except that PS1 CTF was
analyzed using antibody BI.3D7. Direct immunoblotting (left
panel) confirmed that the expression of PS1 and PEN-2 is not
affected by kifunensine treatment. Moreover, kifunensine treatment does
not result in accumulation of APP CTFs as observed upon inhibition of
Nct expression. f, immature-like Nct generated by
kifunensine treatment is transported to the plasma membrane.
Kifunensine-treated HEK 293 cells were surface-biotinylated. After
streptavidin precipitation, biotinylated Nct was identified by
immunoblotting as in Fig. 1b. Note that without kifunensine
exclusively mature Nct is biotinylated, whereas after kifunensine the
immature-like Nct is preferentially surface-biotinylated.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-secretase complex assembly,
maturation, and activity. Thus, we conclude that
-secretase activity
requires a conformational alteration of Nct. Immature and all
functionally inactive deletion mutations fail to undergo the
conformational switch required for
-secretase activity and remain
trypsin-sensitive. Complex glycosylation does not protect by itself
against proteolytic degradation, because its inhibition by kifunensine
does not affect the protease resistance and function of Nct. In
addition, binding of Nct to other
-secretase complex components does
not protect from trypsin degradation, because APH-1aL and the PS1 NTF
and CTF are all sensitive to trypsin as well, whereas mature Nct is selectively resistant. Thus, non-functional Nct is structurally "activated" by a conformational alteration. The conformational alteration may be similar to that of the sterol regulatory
element-binding protein-activating protein (SCAP) (18). In the latter
case cholesterol addition leads to a conformational change of SCAP,
which unmasks additional cleavage sites of trypsin. Moreover, similar
to the loss of function mutations of Nct (Fig. 1), mutations in SCAP also affect its conformational alteration as monitored by trypsin sensitivity (18). A successful conformational change of Nct requires
the presence of the complete luminal domain. All ectodomain deletions
analyzed not only lead to a loss of function but also fail to undergo
the conformational alteration of Nct upon
-secretase complex
assembly and maturation. Previously, a deletion of the DYIGS motif was
shown to affect A
production (3). This is fully confirmed by our
findings, which demonstrate that the same deletion (deletion construct
3 in Fig. 1a) does not restore
-secretase activity in a
Nct knock-down background. However, not only the deletion of the DYIGS
motif but all other deletions investigated within the ectodomain
inhibit the formation of biologically active Nct and consequently a
functional
-secretase complex. Certainly, this does not exclude the
possibility that smaller deletions and point mutations may be tolerated.
-secretase complex. Not only PS may
exist as a "premature" variant (the PS holoprotein) but also Nct.
In the case of Nct, "activation" is associated with a rather
substantial conformational alteration that is required for
-secretase assembly and activity.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence may be addressed. Tel.: 49-89-5996-480;
Fax: 49-89-5996-415; E-mail: hsteiner@pbm.med.uni-muenchen.de.
![]()
ABBREVIATIONS
-amyloid precursor protein;
A
, amyloid-
;
PS, presenilin;
RNAi, RNA interference;
wt, wild type;
DDM, n-dodecyl-
-D-maltoside;
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid;
endo
H, endoglycosidase H;
HEK, human embryonic kidney;
CTF, C-terminal
fragment;
NTF, N-terminal fragment;
SCAP, sterol regulatory
element-binding protein-activating protein.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Haass, C.,
and Steiner, H.
(2002)
Trends Cell Biol.
12,
556-562[CrossRef][Medline]
[Order article via Infotrieve]
2.
Francis, R.,
McGrath, G.,
Zhang, J.,
Ruddy, D. A.,
Sym, M.,
Apfeld, J.,
Nicoll, M.,
Maxwell, M.,
Hai, B.,
Ellis, M. C.,
Parks, A. L.,
Xu, W.,
Li, J.,
Gurney, M.,
Myers, R. L.,
Himes, C. S.,
Hiebsch, R.,
Ruble, C.,
Nye, J. S.,
and Curtis, D.
(2002)
Dev. Cell
3,
85-97[CrossRef][Medline]
[Order article via Infotrieve]
3.
Yu, G.,
Nishimura, M.,
Arawaka, S.,
Levitan, D.,
Zhang, L.,
Tandon, A.,
Song, Y. Q.,
Rogaeva, E.,
Chen, F.,
Kawarai, T.,
Supala, A.,
Levesque, L., Yu, H.,
Yang, D. S.,
Holmes, E.,
Milman, P.,
Liang, Y.,
Zhang, D. M.,
Xu, D. H.,
Sato, C.,
Rogaev, E.,
Smith, M.,
Janus, C.,
Zhang, Y.,
Aebersold, R.,
Farrer, L. S.,
Sorbi, S.,
Bruni, A.,
Fraser, P.,
and St George-Hyslop, P.
(2000)
Nature
407,
48-54[CrossRef][Medline]
[Order article via Infotrieve]
4.
Goutte, C.,
Tsunozaki, M.,
Hale, V. A.,
and Priess, J. R.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
775-779 5.
Esler, W. P.,
Kimberly, W. T.,
Ostaszewski, B. L.,
Ye, W.,
Diehl, T. S.,
Selkoe, D. J.,
and Wolfe, M. S.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
2720-2725 6.
Edbauer, D.,
Winkler, E.,
Haass, C.,
and Steiner, H.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
8666-8671 7.
Steiner, H.,
Winkler, E.,
Edbauer, D.,
Prokop, S.,
Basset, G.,
Yamasaki, A.,
Kostka, M.,
and Haass, C.
(2002)
J. Biol. Chem.
277,
39062-39065 8.
Lee, S. F.,
Shah, S.,
Li, H., Yu, C.,
Han, W.,
and Yu, G.
(2002)
J. Biol. Chem.
277,
45013-45019 9.
Gu, Y.,
Chen, F.,
Sanjo, N.,
Kawarai, T.,
Hasegawa, H.,
Duthie, M.,
Li, W.,
Ruan, X.,
Luthra, A.,
Mount, H. T.,
Tandon, A.,
Fraser, P. E.,
and St George-Hyslop, P.
(2002)
J. Biol. Chem.
278,
7374-7380 10.
Hu, Y.,
Ye, Y.,
and Fortini, M. E.
(2002)
Dev. Cell
2,
69-78[CrossRef][Medline]
[Order article via Infotrieve]
11.
Leem, J. Y.,
Vijayan, S.,
Han, P.,
Cai, D.,
Machura, M.,
Lopes, K. O.,
Veselits, M. L.,
Xu, H.,
and Thinakaran, G.
(2002)
J. Biol. Chem.
277,
19236-19240 12.
Kimberly, W. T.,
LaVoie, M. J.,
Ostaszewski, B. L.,
Ye, W.,
Wolfe, M. S.,
and Selkoe, D. J.
(2002)
J. Biol. Chem.
277,
35113-35117 13.
Herreman, A.,
Van Gassen, G.,
Bentahir, M.,
Nyabi, O.,
Craessaerts, K.,
Mueller, U.,
Annaert, W.,
and De Strooper, B.
(2003)
J. Cell Sci.
116,
1127-1136 14.
Brummelkamp, T. R.,
Bernards, R.,
and Agami, R.
(2002)
Science
296,
550-553 15.
Citron, M.,
Oltersdorf, T.,
Haass, C.,
McConlogue, L.,
Hung, A. Y.,
Seubert, P.,
Vigo-Pelfrey, C.,
Lieberburg, I.,
and Selkoe, D. J.
(1992)
Nature
360,
672-674[CrossRef][Medline]
[Order article via Infotrieve]
16.
Kaether, C.,
Lammich, S.,
Edbauer, D.,
Ertl, M.,
Rietdorf, J.,
Capell, A.,
Steiner, H.,
and Haass, C.
(2002)
J. Cell Biol.
158,
551-561 17.
Yang, D. S.,
Tandon, A.,
Chen, F., Yu, G., Yu, H.,
Arawaka, S.,
Hasegawa, H.,
Duthie, M.,
Schmidt, S. D.,
Ramabhadran, T. V.,
Nixon, R. A.,
Mathews, P. M.,
Gandy, S. E.,
Mount, H. T.,
St George-Hyslop, P.,
and Fraser, P. E.
(2002)
J. Biol. Chem.
277,
28135-28142 18.
Brown, A. J.,
Sun, L.,
Feramisco, J. D.,
Brown, M. S.,
and Goldstein, J. L.
(2002)
Mol. Cell
10,
237-245[CrossRef][Medline]
[Order article via Infotrieve]
19.
Elbein, A. D.,
Tropea, J. E.,
Mitchell, M.,
and Kaushal, G. P.
(1990)
J. Biol. Chem.
265,
15599-15605
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
L. Chavez-Gutierrez, A. Tolia, E. Maes, T. Li, P. C. Wong, and B. de Strooper Glu332 in the Nicastrin Ectodomain Is Essential for {gamma}-Secretase Complex Maturation but Not for Its Activity J. Biol. Chem., July 18, 2008; 283(29): 20096 - 20105. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Spasic and W. Annaert Building {gamma}-secretase - the bits and pieces J. Cell Sci., February 15, 2008; 121(4): 413 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Haberkant, O. Schmitt, F.-X. Contreras, C. Thiele, K. Hanada, H. Sprong, C. Reinhard, F. T. Wieland, and B. Brugger Protein-sphingolipid interactions within cellular membranes J. Lipid Res., January 1, 2008; 49(1): 251 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kim, B. Kleizen, R. Choy, G. Thinakaran, S. S. Sisodia, and R. W. Schekman Biogenesis of {gamma}-secretase early in the secretory pathway J. Cell Biol., December 3, 2007; 179(5): 951 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Spasic, A. Tolia, K. Dillen, V. Baert, B. De Strooper, S. Vrijens, and W. Annaert Presenilin-1 Maintains a Nine-Transmembrane Topology throughout the Secretory Pathway J. Biol. Chem., September 8, 2006; 281(36): 26569 - 26577. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Olry, P. Chastagner, A. Israel, and C. Brou Generation and Characterization of Mutant Cell Lines Defective in {gamma}-Secretase Processing of Notch and Amyloid Precursor Protein J. Biol. Chem., August 5, 2005; 280(31): 28564 - 28571. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kim, H. Ki, H.-S. Park, and K. Kim Presenilin-1 D257A and D385A Mutants Fail to Cleave Notch in Their Endoproteolyzed Forms, but Only Presenilin-1 D385A Mutant Can Restore Its {gamma}-Secretase Activity with the Compensatory Overexpression of Normal C-terminal Fragment J. Biol. Chem., June 10, 2005; 280(23): 22462 - 22472. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Urano, I. Hayashi, N. Isoo, P. C. Reid, Y. Shibasaki, N. Noguchi, T. Tomita, T. Iwatsubo, T. Hamakubo, and T. Kodama Association of active {gamma}-secretase complex with lipid rafts J. Lipid Res., May 1, 2005; 46(5): 904 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-w. Zhang, W.-j. Luo, H. Wang, P. Lin, K. S. Vetrivel, F. Liao, F. Li, P. C. Wong, M. G. Farquhar, G. Thinakaran, et al. Nicastrin Is Critical for Stability and Trafficking but Not Association of Other Presenilin/{gamma}-Secretase Components J. Biol. Chem., April 29, 2005; 280(17): 17020 - 17026. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. J. Wrigley, I. Schurov, E. J. Nunn, A. C. L. Martin, E. E. Clarke, S. Ellis, T. P. Bonnert, M. S. Shearman, and D. Beher Functional Overexpression of {gamma}-Secretase Reveals Protease-independent Trafficking Functions and a Critical Role of Lipids for Protease Activity J. Biol. Chem., April 1, 2005; 280(13): 12523 - 12535. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Niimura, N. Isoo, N. Takasugi, M. Tsuruoka, K. Ui-Tei, K. Saigo, Y. Morohashi, T. Tomita, and T. Iwatsubo Aph-1 Contributes to the Stabilization and Trafficking of the {gamma}-Secretase Complex through Mechanisms Involving Intermolecular and Intramolecular Interactions J. Biol. Chem., April 1, 2005; 280(13): 12967 - 12975. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Capell, D. Beher, S. Prokop, H. Steiner, C. Kaether, M. S. Shearman, and C. Haass {gamma}-Secretase Complex Assembly within the Early Secretory Pathway J. Biol. Chem., February 25, 2005; 280(8): 6471 - 6478. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kim and S. S. Sisodia A Sequence within the First Transmembrane Domain of PEN-2 Is Critical for PEN-2-mediated Endoproteolysis of Presenilin 1 J. Biol. Chem., January 21, 2005; 280(3): 1992 - 2001. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shirotani, D. Edbauer, S. Prokop, C. Haass, and H. Steiner Identification of Distinct {gamma}-Secretase Complexes with Different APH-1 Variants J. Biol. Chem., October 1, 2004; 279(40): 41340 - 41345. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Edbauer, C. Kaether, H. Steiner, and C. Haass Co-expression of Nicastrin and Presenilin Rescues a Loss of Function Mutant of APH-1 J. Biol. Chem., September 3, 2004; 279(36): 37311 - 37315. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Prokop, K. Shirotani, D. Edbauer, C. Haass, and H. Steiner Requirement of PEN-2 for Stabilization of the Presenilin N-/C-terminal Fragment Heterodimer within the {gamma}-Secretase Complex J. Biol. Chem., May 28, 2004; 279(22): 23255 - 23261. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Capell, C. Kaether, D. Edbauer, K. Shirotani, S. Merkl, H. Steiner, and C. Haass Nicastrin Interacts with {gamma}-Secretase Complex Components via the N-terminal Part of Its Transmembrane Domain J. Biol. Chem., December 26, 2003; 278(52): 52519 - 52523. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aguzzi and C. Haass Games Played by Rogue Proteins in Prion Disorders and Alzheimer's Disease Science, October 31, 2003; 302(5646): 814 - 818. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Morais, A. S. Crystal, D. S. Pijak, D. Carlin, J. Costa, V. M.-Y. Lee, and R. W. Doms The Transmembrane Domain Region of Nicastrin Mediates Direct Interactions with APH-1 and the {gamma}-Secretase Complex J. Biol. Chem., October 31, 2003; 278(44): 43284 - 43291. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Farmery, L. O. Tjernberg, S. E. Pursglove, A. Bergman, B. Winblad, and J. Naslund Partial Purification and Characterization of {gamma}-Secretase from Post-mortem Human Brain J. Biol. Chem., June 27, 2003; 278(27): 24277 - 24284. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||