JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.C300095200 on March 18, 2003

J. Biol. Chem., Vol. 278, Issue 19, 16474-16477, May 9, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/16474    most recent
C300095200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirotani, K.
Right arrow Articles by Haass, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirotani, K.
Right arrow Articles by Haass, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

ACCELERATED PUBLICATION
gamma -Secretase Activity Is Associated with a Conformational Change of Nicastrin*

Keiro Shirotani, Dieter Edbauer, Anja Capell, Julia Schmitz, Harald SteinerDagger, and Christian Haass§

From the Adolf Butenandt-Institute, Department of Biochemistry, Laboratory for Alzheimer's and Parkinson's Disease Research, Ludwig-Maximilians-University, Schillerstrasse 44, 80336 Munich, Germany

Received for publication, March 4, 2003, and in revised form, March 18, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

gamma -Secretase is a high molecular weight multicomponent protein complex with an unusual intramembrane-cleaving aspartyl protease activity. gamma -Secretase is intimately associated with Alzheimer disease because it catalyzes the proteolytic cleavage, which leads to the liberation of amyloid beta -peptide. At least presenilin (PS), Nicastrin (Nct), APH-1, and PEN-2 are constituents of the gamma -secretase complex, with PS apparently providing the active site of gamma -secretase. Expression of gamma -secretase complex components is tightly regulated, however little is known about the assembly of the complex. Here we demonstrate that Nct undergoes a major conformational change during the assembly of the gamma -secretase complex. The conformational change is directly associated with gamma -secretase function and involves the entire Nct ectodomain. Loss of function mutations generated by deletions failed to undergo the conformational change. Furthermore, the conformational alteration did not occur in the absence of PS. Our data thus suggest that gamma -secretase function critically depends on the structural "activation" of Nct.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

gamma -Secretase plays a fundamental role in Alzheimer disease (AD)1 by catalyzing the final proteolytic cleavage, which leads to the formation of amyloid-beta peptide (Abeta ), the major component of the diseases defining senile plaques (1). By genetic and biochemical approaches several components of the gamma -secretase complex have been identified. In addition to the presenilins (PS1 and PS2) (reviewed in Ref. 1), APH-1a/b, PEN-2, and nicastrin (Nct) (2-4) were recently identified. Apparently all four proteins assemble into a large 500-600-kDa complex (5-9), which displays the intramembranous proteolytic activity required for the cleavage of the beta -amyloid precursor protein (APP) and other substrates such as Notch (for review see Ref. 1). Formation of the gamma -secretase complex is coordinately regulated (2, 6-13) and depends on the presence of all known complex components. Although there is considerable evidence that PS constitutes the active site of gamma -secretase (reviewed in Ref. 1), very little is known about the function of the individual PS binding partners. Previously we and others demonstrated that maturation of Nct is associated with gamma -secretase complex assembly (6, 11-13). In addition, a conserved DYIGS motif is apparently involved in Nct function (3). Here we demonstrate that a major conformational change, which requires that the entire ectodomain of Nct is directly associated with gamma -secretase complex formation and function. The structural alteration fails to occur in Nct loss of function mutations as well as in the absence of presenilins.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

cDNA Constructs-- To down-regulate endogenous Nct by RNA interference (RNAi), oligonucleotides corresponding to Nct-1045 (6) were cloned into the pSUPER vector (14). Nct deletions (Del 1-5, Fig. 1a) were constructed by oligonucleotide-directed mutagenesis using PCR. Silencer mutations (aaagggaaattcccggtccaatt; the mutations are underlined) were introduced (which do not affect the amino acid sequence) in the constructs to escape RNAi. All constructs were verified by DNA sequencing.

Cell Culture, Cell Lines, RNAi, and Transfections-- Human embryonic kidney (HEK) 293 cells and mouse embryonic fibroblast cells were cultured as described (6). A stable Nct knock-down cell line was generated by stably co-transfecting HEK 293 cells overexpressing Swedish mutant APP (15) with pSUPER/Nct-1045 and pcDNA3.1/Hygro(-) (Invitrogen) and selection for hygromycin (100 µg/ml) resistance. This cell line was stably transfected with the indicated wt and mutant Nct constructs or the empty vector (pcDNA6) by Lipofectamine 2000 (Invitrogen) according to the instructions of the manufacturer using selection for blasticidin (10 µg/ml) resistance. To inhibit mannosidase I, cells were cultured in the presence of the indicated amounts of kifunensine (Calbiochem) or vehicle for 48 h at 37 °C.

Antibodies-- The polyclonal and monoclonal antibodies against the large cytoplasmic loop domain of PS1 (3027 and BI.3D7), the PS1 N terminus (PS1N), PEN-2 (1638), the APP C terminus (6687), and Abeta (1-42) (3926) were described previously (see Refs. 6 and 7 and citations therein). The polyclonal antibody N1660 against the C terminus of Nct and monoclonal antibody 6E10 against Abeta (1-17) were obtained from Sigma and Senetek, respectively, the anti-APH-1aL (O2C2) antibody was described previously (9).

Protein Analysis-- Cell lysates were prepared using STEN-lysis buffer (50 mM Tris (pH 7.6), 150 mM NaCl, 2 mM EDTA, 1% Nonidet P-40). After a clarifying spin, cell lysates were subjected to immunoblot analysis. Where indicated Nonidet P-40 was substituted with DDM (0.7%), CHAPS (2%), or SDS (1%). For analysis of gamma -secretase complexes DDM-solubilized membrane fractions were subjected to co-immunoprecipitation as described (7). Cell surface biotinylation was carried out as described (16). For deglycosylation, cell lysates were incubated with 50 milliunits/ml endoglycosidase H (endo H) for 16 h at 37 °C in 200 mM sodium citrate (pH 5.8), 0.5 mM phenylmethylsulfonyl fluoride, 100 mM 2-mercaptoethanol, 0.1% SDS) followed by immunoblot analysis. For detection of secreted Abeta following kifunensine treatment, media were replaced, conditioned for 3 h, and analyzed for Abeta by combined immunoprecipitation/immunoblotting using antibodies 3926/6E10.

Trypsin Resistance Assay-- Cells were lysed as detailed above in the presence of 0.7% DDM or 1% SDS. Following a clarifying spin, cell lysates were incubated with the indicated amounts of trypsin in 150 mM sodium citrate (pH 6.4), 150 mM NaCl, 5 mM EDTA, 5 µg/ml pepstatin for 30 min at 30 °C. Proteolysis was stopped by the addition of 10-fold excess amounts of soybean trypsin inhibitor, and samples were subjected to immunoblot analysis.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In an attempt to identify the functionally important domains of Nct, we generated a set of deletions within the ectodomain (Fig. 1a). These cDNA constructs were investigated in a HEK 293 cell line stably expressing Swedish mutant APP (15) and a pSUPER-based Nct-1045 (6) small interfering RNA-encoding vector, which stably knocks down endogenous Nct expression by RNAi (Fig. 1b; lane 2). RNAi-mediated inhibition of Nct expression results in reduced PS1 CTF formation, reduced PEN-2 and APH-1aL (8) expression, the accumulation of the APP C-terminal fragments (APP-CTFs), and reduced Abeta generation (Fig. 1b). These observations are due to the inhibition of the gamma -secretase activity upon down-regulation of Nct (6). Expression of a wt Nct cDNA with a cluster of silent mutations conferring RNAi resistance led to the formation of mature Nct (Fig. 1b), which has previously been shown to be associated with the functional gamma -secretase complex (6, 11-13). In addition, an accumulation of large amounts of immature Nct due to its overexpression (6, 12, 17) was observed (Fig. 1b). In contrast, all deletion constructs apparently formed only one Nct polypeptide (Fig. 1b), indicating a failure of maturation. To investigate if the Nct deletion variants undergo complex glycosylation like wt Nct, cell lysates were treated with endo H. As shown in Fig. 1c, only mature Nct (endogenous and exogenous) was endo H-resistant, whereas immature Nct and all deleted variants failed to become endo H-resistant. Exogenous expression of wt Nct restored PS1 CTF formation and PEN-2 and APH-1aL expression and allowed full gamma -secretase function as monitored by the significantly reduced levels of APP-CTFs accompanied by robust Abeta generation (Fig. 1b). In contrast to wt Nct, none of the deletion constructs restored PS1 CTF formation and PEN-2 or APH-1aL expression (Fig. 1b). Moreover, the deletion constructs did not allow the formation of a gamma -secretase activity, because none of them reduced APP-CTF formation or increased Abeta production (Fig. 1b). Thus, all deletions within the ectodomain failed to restore gamma -secretase function. This suggests an important role of not only the conserved DYIGS motif but the entire ectodomain in gamma -secretase complex assembly and activity. The lack of a specific functional subdomain of Nct thus indicates that correct folding of the entire ectodomain is required for Nct function. The primary structure of Nct suggests a rather large luminal domain, which according to our findings plays a pivotal role in Nct function. To investigate if the luminal domain of functional Nct adopts a conformation, which is different from non-functional Nct, cell lysates were treated with increasing amounts of trypsin to monitor unmasking or masking of cleavage sites (18). Interestingly, the mature form of Nct, which is predominantly found in the mature gamma -secretase complex (6, 12, 13, 17), was selectively trypsin-resistant whereas immature Nct remained trypsin-sensitive even at the lowest concentration (Fig. 2a). Mature Nct showed resistance up to concentrations of as much as 500 µg/ml trypsin (Fig. 2a and data not shown). In contrast to mature Nct, APP, which is also a type I transmembrane glycoprotein, was sensitive to trypsin (Fig. 2a). Furthermore, the gamma -secretase complex components PS1 NTF, PS1 CTF, and APH-1aL were all fully sensitive to trypsin digestion (Fig. 2a), whereas PEN-2 was found to be less sensitive (data not shown). Because APH-1aL and the PS fragments are trypsin-sensitive, Nct is not simply protected by these gamma -secretase complex components. In addition, the very small PEN-2 is unlikely to protect the large Nct ectodomain. Thus, Nct appears to undergo a conformational change independent of APH-1aL, PS, and also PEN-2. After demonstrating the selective trypsin resistance of mature Nct, the deletion variants (Fig. 1a), which all fail to restore gamma -secretase activity (Fig. 1b), were investigated. Interestingly, none of them displayed trypsin resistance (Fig. 2b). This suggests that assembly of a biologically active gamma -secretase complex is associated with the formation of a trypsin-resistant Nct variant. To further support this hypothesis, we analyzed Nct in mouse embryonic fibroblast cells derived from a PS1/2 gene knock-out. Because of the absence of PS in these cells no gamma -secretase complex can be formed. As we and others have previously shown these cells are also deficient in Nct maturation (7, 11, 13). Thus, fibroblasts derived from a PS1/2 gene knock-out are ideally suited to investigate the association of trypsin-resistant Nct with gamma -secretase complex formation. Interestingly, immature Nct in PS1/2-/- cells was degraded by trypsin, whereas mature Nct in the corresponding PS1/2+/+ control cells was fully trypsin-resistant (Fig. 2c). Thus, the conversion of trypsin-sensitive to a trypsin-resistant Nct is indeed tightly associated with gamma -secretase complex formation. Furthermore, the selectivity of trypsin resistance of mature Nct versus immature/non-functional Nct suggests a major conformational change of Nct during gamma -secretase complex assembly and maturation. However, the selective resistance of mature Nct does not exclude the possibility that proteases could not interact with mature Nct due to the rather large and abundant sugar side chains added during maturation. Indeed, 16 putative glycosylation sites are present in the ectodomain (3). To denature and unfold mature Nct, cells were lysed in the presence of 1% SDS, and lysates were then digested with increasing amounts of trypsin. Under these conditions mature Nct became sensitive to trypsin digestion, whereas non-denatured mature Nct extracted under conditions which preserve the gamma -secretase complex remained protease-resistant (Fig. 3a). However, glycosylation could protect even partially denatured mature Nct and thus indirectly prevent trypsin-mediated degradation. To exclude this possibility we blocked complex glycosylation by incubating untransfected HEK 293 cells (expressing endogenous Nct) in the presence of kifunensine, which potently inhibits mannosidase I (19). As shown in Fig. 3b, treatment with kifunensine strongly blocked maturation of Nct as manifested by the appearance of a novel Nct species (termed immature-like Nct, see below) migrating at lower molecular weight. However, in contrast to the immature form of Nct, the immature-like species observed upon kifunensine treatment was still trypsin-resistant like the mature fully glycosylated Nct variant (Fig. 3c). These data suggest that a conformational change of Nct associated with trypsin resistance must take place upon assembly and/or maturation of the gamma -secretase complex. To investigate if the gamma -secretase complex is still active upon inhibition of mannosidase I, Abeta was isolated before and after kifunensine treatment. Consistent with Herreman et al. (13), Abeta production was not inhibited by kifunensine (Fig. 3d). Moreover, expression levels of PS1 CTFs and PEN-2 were not significantly reduced by kifunensine treatment (Fig. 3e, left panel) demonstrating that kifunensine does not interfere with the assembly of the gamma -secretase complex. Furthermore, immature-like Nct and PEN-2 co-immunoprecipitated with PS1 upon kifunensine treatment for 2 days (Fig. 3e, right panel). Finally, cell surface biotinylation revealed that immature-like Nct reaches the plasma membrane in cells treated with kifunensine (Fig. 3f) like endogenous Nct in untreated cells (13, 16).


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 1.   The entire ectodomain of Nct is required for its function in gamma -secretase-mediated APP processing. a, schematic representation of Nct and the ectodomain deletion mutants generated. SP denotes the putative signal peptide and TM the transmembrane domain. Dotted boxes indicate conserved regions including the DYIGS motif-containing region (3). Potential glycosylation sites are indicated with black circles. b, Nct ectodomain deletion mutants are functionally inactive. HEK 293 cells stably co-expressing Swedish mutant APP (sw) and Nct-1045 small interfering RNA were stably transfected with the indicated cDNA constructs encoding wt Nct, Nct ectodomain deletion mutants (harboring silent mutations to escape RNAi; note that Del 3 escapes RNAi due to deletion of the RNAi-targeted region) or a vector control. Cell lysates were analyzed for levels of Nct (mature (m) and immature (im) forms), and PS1 CTF and APP-CTFs (generated by beta -secretase (CTFbeta ) and alpha -secretase (CTFalpha )) by immunoblotting with antibodies N1660 (Nct), 3027 (PS1), and 6687 (APP). PEN-2 and APH-1aL levels were analyzed from membrane fractions of the same cells by immunoblotting with antibodies 1638 (PEN-2) and O2C2 (APH-1aL). Abeta was analyzed from conditioned media by combined immunoprecipitation/immunoblotting with antibodies 3926/6E10. c, Nct ectodomain deletion mutants are endo H-sensitive. Cell lysates were incubated with (+) or without (-) endo H and analyzed for Nct as in B.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   Mature Nct is trypsin-resistant. a, DDM-extracted HEK 293 cells stably transfected with wt Nct (as detailed in Fig. 1b) were treated with the indicated amounts of trypsin and analyzed for Nct, APP, PS1 (CTF and NTF), and APH-1aL as in Fig. 1b. The PS1 NTF was analyzed with antibody PS1N. Note that mature Nct is resistant to trypsin whereas immature Nct and mature and immature forms of APP are degraded even at the lowest concentration of trypsin. The polypeptide migrating at 85 kDa is an intermediate degradation product of immature Nct. Other gamma -secretase complex components such as the PS1 NTF and CTF and APH-1aL were fully sensitive to trypsin. b, all Nct deletion mutants are sensitive to trypsin. CHAPS-extracted HEK 293 cells stably transfected with wt Nct and the indicated Nct deletion mutants (as detailed in Fig. 1b) were incubated with (+) or without (-) 100 µg/ml trypsin and analyzed for Nct as in Fig. 1b. c, Nct not associated with the gamma -secretase complex is trypsin-sensitive whereas mature Nct assembled into the gamma -secretase complex is resistant. Cell lysates of PS1/2+/+ or PS1/2-/- mouse embryonic fibroblast cells were subjected to trypsin treatment as in b and analyzed for Nct as in Fig. 1b. Consistent with our previous results (7) immature Nct accumulates in the PS1/2-/- cells, whereas both mature and immature Nct is detected in PS1/2+/+ control cells. Mature Nct in PS1/2+/+ control cells is trypsin-resistant whereas immature Nct in PS1/2-/- cells is trypsin-sensitive.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3.   A conformational change of Nct is associated with its resistance to trypsin degradation and gamma -secretase complex assembly. a, SDS unfolds Nct and makes it sensitive to trypsin. HEK 293 cells stably transfected with wt Nct (as detailed in Fig. 1b) were extracted with DDM (which leaves the gamma -secretase complex intact (6, 7)) or SDS, subjected to trypsin treatment and analyzed for Nct as in Fig. 1b. b, inhibition of Nct maturation by blocking mannosidase I does not affect gamma -secretase complex formation/activity. HEK 293 cells were incubated in the presence of the indicated amounts of kifunensine, and lysates were analyzed as in a. Note that treatment with kifunensine results in the formation of a Nct species, which co-migrates with immature Nct (immature-like (iml) Nct). c, immature-like Nct generated by kifunensine treatment is trypsin-resistant. Lysates from kifunensine-treated HEK 293 cells were incubated with 20 µg/ml trypsin and analyzed as in a. d, generation of secreted Abeta upon kifunensine treatment. Conditioned media of HEK 293 cells pretreated with kifunensine were collected, and Abeta production was analyzed as in Fig. 1b. e, immature-like Nct generated by kifunensine treatment forms a complex with PS1 and PEN-2. DDM-extracted membrane fractions of HEK 293 cells were immunoprecipitated with antibody 3027 (PS1-C) and analyzed by immunoblotting as in Fig. 1b, except that PS1 CTF was analyzed using antibody BI.3D7. Direct immunoblotting (left panel) confirmed that the expression of PS1 and PEN-2 is not affected by kifunensine treatment. Moreover, kifunensine treatment does not result in accumulation of APP CTFs as observed upon inhibition of Nct expression. f, immature-like Nct generated by kifunensine treatment is transported to the plasma membrane. Kifunensine-treated HEK 293 cells were surface-biotinylated. After streptavidin precipitation, biotinylated Nct was identified by immunoblotting as in Fig. 1b. Note that without kifunensine exclusively mature Nct is biotinylated, whereas after kifunensine the immature-like Nct is preferentially surface-biotinylated.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our findings demonstrate that trypsin resistance of the Nct ectodomain is associated with gamma -secretase complex assembly, maturation, and activity. Thus, we conclude that gamma -secretase activity requires a conformational alteration of Nct. Immature and all functionally inactive deletion mutations fail to undergo the conformational switch required for gamma -secretase activity and remain trypsin-sensitive. Complex glycosylation does not protect by itself against proteolytic degradation, because its inhibition by kifunensine does not affect the protease resistance and function of Nct. In addition, binding of Nct to other gamma -secretase complex components does not protect from trypsin degradation, because APH-1aL and the PS1 NTF and CTF are all sensitive to trypsin as well, whereas mature Nct is selectively resistant. Thus, non-functional Nct is structurally "activated" by a conformational alteration. The conformational alteration may be similar to that of the sterol regulatory element-binding protein-activating protein (SCAP) (18). In the latter case cholesterol addition leads to a conformational change of SCAP, which unmasks additional cleavage sites of trypsin. Moreover, similar to the loss of function mutations of Nct (Fig. 1), mutations in SCAP also affect its conformational alteration as monitored by trypsin sensitivity (18). A successful conformational change of Nct requires the presence of the complete luminal domain. All ectodomain deletions analyzed not only lead to a loss of function but also fail to undergo the conformational alteration of Nct upon gamma -secretase complex assembly and maturation. Previously, a deletion of the DYIGS motif was shown to affect Abeta production (3). This is fully confirmed by our findings, which demonstrate that the same deletion (deletion construct 3 in Fig. 1a) does not restore gamma -secretase activity in a Nct knock-down background. However, not only the deletion of the DYIGS motif but all other deletions investigated within the ectodomain inhibit the formation of biologically active Nct and consequently a functional gamma -secretase complex. Certainly, this does not exclude the possibility that smaller deletions and point mutations may be tolerated.

Taken together our findings provide the first insights into the assembly and maturation of the gamma -secretase complex. Not only PS may exist as a "premature" variant (the PS holoprotein) but also Nct. In the case of Nct, "activation" is associated with a rather substantial conformational alteration that is required for gamma -secretase assembly and activity.

    ACKNOWLEDGEMENTS

We thank Dr. C. Kaether for helpful discussions, Dr. R. Agami for the pSUPER vector, Dr. R. Nixon for the monoclonal antibody PS1N, Dr. B. De Strooper for PS1/2 deficient mouse embryonic fibroblast cells, and Drs. G. Yu, Y. Gu, and P. St George Hyslop for Nct cDNA constructs and the APH-1aL antibody.

    FOOTNOTES

* This work was supported by the Deutsche Forschungsgemeinschaft (Priority Program "Cellular Mechanisms of Alzheimer's Disease") and the European Community (DIADEM Project).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence may be addressed. Tel.: 49-89-5996-480; Fax: 49-89-5996-415; E-mail: hsteiner@pbm.med.uni-muenchen.de.

§ To whom correspondence may be addressed. Tel.: 49-89-5996-471/472; Fax: 49-89-5996-415; E-mail: chaass@pbm.med.uni-muenchen.de.

Published, JBC Papers in Press, March 18, 2003, DOI 10.1074/jbc.C300095200

    ABBREVIATIONS

The abbreviations used are: AD, Alzheimer disease; APP, beta -amyloid precursor protein; Abeta , amyloid-beta ; PS, presenilin; RNAi, RNA interference; wt, wild type; DDM, n-dodecyl-beta -D-maltoside; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; endo H, endoglycosidase H; HEK, human embryonic kidney; CTF, C-terminal fragment; NTF, N-terminal fragment; SCAP, sterol regulatory element-binding protein-activating protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Haass, C., and Steiner, H. (2002) Trends Cell Biol. 12, 556-562[CrossRef][Medline] [Order article via Infotrieve]
2. Francis, R., McGrath, G., Zhang, J., Ruddy, D. A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M. C., Parks, A. L., Xu, W., Li, J., Gurney, M., Myers, R. L., Himes, C. S., Hiebsch, R., Ruble, C., Nye, J. S., and Curtis, D. (2002) Dev. Cell 3, 85-97[CrossRef][Medline] [Order article via Infotrieve]
3. Yu, G., Nishimura, M., Arawaka, S., Levitan, D., Zhang, L., Tandon, A., Song, Y. Q., Rogaeva, E., Chen, F., Kawarai, T., Supala, A., Levesque, L., Yu, H., Yang, D. S., Holmes, E., Milman, P., Liang, Y., Zhang, D. M., Xu, D. H., Sato, C., Rogaev, E., Smith, M., Janus, C., Zhang, Y., Aebersold, R., Farrer, L. S., Sorbi, S., Bruni, A., Fraser, P., and St George-Hyslop, P. (2000) Nature 407, 48-54[CrossRef][Medline] [Order article via Infotrieve]
4. Goutte, C., Tsunozaki, M., Hale, V. A., and Priess, J. R. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 775-779[Abstract/Free Full Text]
5. Esler, W. P., Kimberly, W. T., Ostaszewski, B. L., Ye, W., Diehl, T. S., Selkoe, D. J., and Wolfe, M. S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 2720-2725[Abstract/Free Full Text]
6. Edbauer, D., Winkler, E., Haass, C., and Steiner, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 8666-8671[Abstract/Free Full Text]
7. Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G., Yamasaki, A., Kostka, M., and Haass, C. (2002) J. Biol. Chem. 277, 39062-39065[Abstract/Free Full Text]
8. Lee, S. F., Shah, S., Li, H., Yu, C., Han, W., and Yu, G. (2002) J. Biol. Chem. 277, 45013-45019[Abstract/Free Full Text]
9. Gu, Y., Chen, F., Sanjo, N., Kawarai, T., Hasegawa, H., Duthie, M., Li, W., Ruan, X., Luthra, A., Mount, H. T., Tandon, A., Fraser, P. E., and St George-Hyslop, P. (2002) J. Biol. Chem. 278, 7374-7380[Abstract/Free Full Text]
10. Hu, Y., Ye, Y., and Fortini, M. E. (2002) Dev. Cell 2, 69-78[CrossRef][Medline] [Order article via Infotrieve]
11. Leem, J. Y., Vijayan, S., Han, P., Cai, D., Machura, M., Lopes, K. O., Veselits, M. L., Xu, H., and Thinakaran, G. (2002) J. Biol. Chem. 277, 19236-19240[Abstract/Free Full Text]
12. Kimberly, W. T., LaVoie, M. J., Ostaszewski, B. L., Ye, W., Wolfe, M. S., and Selkoe, D. J. (2002) J. Biol. Chem. 277, 35113-35117[Abstract/Free Full Text]
13. Herreman, A., Van Gassen, G., Bentahir, M., Nyabi, O., Craessaerts, K., Mueller, U., Annaert, W., and De Strooper, B. (2003) J. Cell Sci. 116, 1127-1136[Abstract/Free Full Text]
14. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002) Science 296, 550-553[Abstract/Free Full Text]
15. Citron, M., Oltersdorf, T., Haass, C., McConlogue, L., Hung, A. Y., Seubert, P., Vigo-Pelfrey, C., Lieberburg, I., and Selkoe, D. J. (1992) Nature 360, 672-674[CrossRef][Medline] [Order article via Infotrieve]
16. Kaether, C., Lammich, S., Edbauer, D., Ertl, M., Rietdorf, J., Capell, A., Steiner, H., and Haass, C. (2002) J. Cell Biol. 158, 551-561[Abstract/Free Full Text]
17. Yang, D. S., Tandon, A., Chen, F., Yu, G., Yu, H., Arawaka, S., Hasegawa, H., Duthie, M., Schmidt, S. D., Ramabhadran, T. V., Nixon, R. A., Mathews, P. M., Gandy, S. E., Mount, H. T., St George-Hyslop, P., and Fraser, P. E. (2002) J. Biol. Chem. 277, 28135-28142[Abstract/Free Full Text]
18. Brown, A. J., Sun, L., Feramisco, J. D., Brown, M. S., and Goldstein, J. L. (2002) Mol. Cell 10, 237-245[CrossRef][Medline] [Order article via Infotrieve]
19. Elbein, A. D., Tropea, J. E., Mitchell, M., and Kaushal, G. P. (1990) J. Biol. Chem. 265, 15599-15605[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Chavez-Gutierrez, A. Tolia, E. Maes, T. Li, P. C. Wong, and B. de Strooper
Glu332 in the Nicastrin Ectodomain Is Essential for {gamma}-Secretase Complex Maturation but Not for Its Activity
J. Biol. Chem., July 18, 2008; 283(29): 20096 - 20105.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Spasic and W. Annaert
Building {gamma}-secretase - the bits and pieces
J. Cell Sci., February 15, 2008; 121(4): 413 - 420.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. Haberkant, O. Schmitt, F.-X. Contreras, C. Thiele, K. Hanada, H. Sprong, C. Reinhard, F. T. Wieland, and B. Brugger
Protein-sphingolipid interactions within cellular membranes
J. Lipid Res., January 1, 2008; 49(1): 251 - 262.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
J. Kim, B. Kleizen, R. Choy, G. Thinakaran, S. S. Sisodia, and R. W. Schekman
Biogenesis of {gamma}-secretase early in the secretory pathway
J. Cell Biol., December 3, 2007; 179(5): 951 - 963.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Spasic, A. Tolia, K. Dillen, V. Baert, B. De Strooper, S. Vrijens, and W. Annaert
Presenilin-1 Maintains a Nine-Transmembrane Topology throughout the Secretory Pathway
J. Biol. Chem., September 8, 2006; 281(36): 26569 - 26577.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Olry, P. Chastagner, A. Israel, and C. Brou
Generation and Characterization of Mutant Cell Lines Defective in {gamma}-Secretase Processing of Notch and Amyloid Precursor Protein
J. Biol. Chem., August 5, 2005; 280(31): 28564 - 28571.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Kim, H. Ki, H.-S. Park, and K. Kim
Presenilin-1 D257A and D385A Mutants Fail to Cleave Notch in Their Endoproteolyzed Forms, but Only Presenilin-1 D385A Mutant Can Restore Its {gamma}-Secretase Activity with the Compensatory Overexpression of Normal C-terminal Fragment
J. Biol. Chem., June 10, 2005; 280(23): 22462 - 22472.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
Y. Urano, I. Hayashi, N. Isoo, P. C. Reid, Y. Shibasaki, N. Noguchi, T. Tomita, T. Iwatsubo, T. Hamakubo, and T. Kodama
Association of active {gamma}-secretase complex with lipid rafts
J. Lipid Res., May 1, 2005; 46(5): 904 - 912.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-w. Zhang, W.-j. Luo, H. Wang, P. Lin, K. S. Vetrivel, F. Liao, F. Li, P. C. Wong, M. G. Farquhar, G. Thinakaran, et al.
Nicastrin Is Critical for Stability and Trafficking but Not Association of Other Presenilin/{gamma}-Secretase Components
J. Biol. Chem., April 29, 2005; 280(17): 17020 - 17026.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. D. J. Wrigley, I. Schurov, E. J. Nunn, A. C. L. Martin, E. E. Clarke, S. Ellis, T. P. Bonnert, M. S. Shearman, and D. Beher
Functional Overexpression of {gamma}-Secretase Reveals Protease-independent Trafficking Functions and a Critical Role of Lipids for Protease Activity
J. Biol. Chem., April 1, 2005; 280(13): 12523 - 12535.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Niimura, N. Isoo, N. Takasugi, M. Tsuruoka, K. Ui-Tei, K. Saigo, Y. Morohashi, T. Tomita, and T. Iwatsubo
Aph-1 Contributes to the Stabilization and Trafficking of the {gamma}-Secretase Complex through Mechanisms Involving Intermolecular and Intramolecular Interactions
J. Biol. Chem., April 1, 2005; 280(13): 12967 - 12975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Capell, D. Beher, S. Prokop, H. Steiner, C. Kaether, M. S. Shearman, and C. Haass
{gamma}-Secretase Complex Assembly within the Early Secretory Pathway
J. Biol. Chem., February 25, 2005; 280(8): 6471 - 6478.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-H. Kim and S. S. Sisodia
A Sequence within the First Transmembrane Domain of PEN-2 Is Critical for PEN-2-mediated Endoproteolysis of Presenilin 1
J. Biol. Chem., January 21, 2005; 280(3): 1992 - 2001.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Shirotani, D. Edbauer, S. Prokop, C. Haass, and H. Steiner
Identification of Distinct {gamma}-Secretase Complexes with Different APH-1 Variants
J. Biol. Chem., October 1, 2004; 279(40): 41340 - 41345.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Edbauer, C. Kaether, H. Steiner, and C. Haass
Co-expression of Nicastrin and Presenilin Rescues a Loss of Function Mutant of APH-1
J. Biol. Chem., September 3, 2004; 279(36): 37311 - 37315.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Prokop, K. Shirotani, D. Edbauer, C. Haass, and H. Steiner
Requirement of PEN-2 for Stabilization of the Presenilin N-/C-terminal Fragment Heterodimer within the {gamma}-Secretase Complex
J. Biol. Chem., May 28, 2004; 279(22): 23255 - 23261.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Capell, C. Kaether, D. Edbauer, K. Shirotani, S. Merkl, H. Steiner, and C. Haass
Nicastrin Interacts with {gamma}-Secretase Complex Components via the N-terminal Part of Its Transmembrane Domain
J. Biol. Chem., December 26, 2003; 278(52): 52519 - 52523.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. Aguzzi and C. Haass
Games Played by Rogue Proteins in Prion Disorders and Alzheimer's Disease
Science, October 31, 2003; 302(5646): 814 - 818.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. A. Morais, A. S. Crystal, D. S. Pijak, D. Carlin, J. Costa, V. M.-Y. Lee, and R. W. Doms
The Transmembrane Domain Region of Nicastrin Mediates Direct Interactions with APH-1 and the {gamma}-Secretase Complex
J. Biol. Chem., October 31, 2003; 278(44): 43284 - 43291.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Farmery, L. O. Tjernberg, S. E. Pursglove, A. Bergman, B. Winblad, and J. Naslund
Partial Purification and Characterization of {gamma}-Secretase from Post-mortem Human Brain
J. Biol. Chem., June 27, 2003; 278(27): 24277 - 24284.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/16474    most recent
C300095200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirotani, K.
Right arrow Articles by Haass, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation