|
Originally published In Press as doi:10.1074/jbc.M213216200 on March 5, 2003
J. Biol. Chem., Vol. 278, Issue 19, 16828-16833, May 9, 2003
Decreased CCA-addition in Human Mitochondrial tRNAs Bearing a
Pathogenic A4317G or A10044G Mutation*
Yukihide
Tomari ,
Narumi
Hino ,
Takashi
Nagaike ,
Tsutomu
Suzuki§, and
Takuya
Ueda
From the Department of Integrated Biosciences, Graduate School of
Frontier Sciences, University of Tokyo, 5-1-5 Kashiwanoha,
Kashiwa, Chiba Prefecture 277-8562, Japan
Received for publication, December 27, 2002, and in revised form, February 28, 2003
 |
ABSTRACT |
Pathogenic point mutations in mitochondrial tRNA
genes are known to cause a variety of human mitochondrial diseases.
Reports have associated an A4317G mutation in the mitochondrial
tRNAIle gene with fatal infantile cardiomyopathy and
an A10044G mutation in the mitochondrial tRNAGly gene with
sudden infant death syndrome. Here we demonstrate that both mutations
inhibit in vitro CCA-addition to the respective tRNA by the
human mitochondrial CCA-adding enzyme. Structures of these two mutant
tRNAs were examined by nuclease probing. In the case of the A4317G
tRNAIle mutant, structural rearrangement of the T-arm
region, conferring an aberrantly stable T-arm structure and an
increased Tm value, was clearly observed. In the
case of the A10044G tRNAGly mutant, high nuclease
sensitivity in both the T- and D-loops suggested a weakened interaction
between the loops. These are the first reported instances of
inefficient CCA-addition being one of the apparent molecular
pathogeneses caused by pathogenic point mutations in human
mitochondrial tRNA genes.
 |
INTRODUCTION |
Mitochondrial
(mt)1 DNA mutations are known
to be associated with a variety of human diseases. More than 100 different pathogenic mutations have so far been reported, 58% of which
reside in tRNA genes (1-3). Functional analysis of mt tRNAs with such
mutations will thus be necessary to clarify the molecular pathogenesis
of mitochondrial diseases. If a mutation does not affect replication of
mtDNA or transcription of the corresponding mt tRNA, its deleterious effect in the mt tRNA gene can be assigned to the post-transcriptional level, including maturation, modification, folding, stability, aminoacylation, association with translation factors, and/or various functions on the ribosome.
A novel taurine-containing uridine modification was recently identified
(4), which was found to be absent in two mutant mt tRNAs:
tRNALeu(UUR) with either an A3243G or U3271C point mutation
and tRNALys with an A8344G point mutation. These mutant
tRNAs were respectively obtained from human pathogenic cells of two
mitochondrial encephalomyopathic diseases: mitochondrial myopathy,
encephalopathy, lactic acidosis, and stroke-like episodes (5) (MELAS),
and myoclonus epilepsy associated with ragged-red fibers (MERRF) (6).
The MERRF mt tRNALys lacking the wobble modification was
found to be incapable of translating cognate codons because of a
complete loss of codon-anticodon pairing on the ribosome (7), strongly
implicating deficient decoding arising from the modification defect
as one of the main causes of the mitochondrial dysfunction, and
representing the first known case of a human disease apparently
resulting from the loss of a post-transcriptional modification.
CCA-addition at the 3' terminus of tRNA is one of the essential steps
for tRNA maturation in mitochondria. In human mitochondrial DNA, the
CCA sequence of tRNAs is not encoded in the tRNA genes but is
post-transcriptionally synthesized by ATP (CTP):tRNA
nucleotidyltransferase (CCA-adding enzyme). We recently cloned and
characterized the human mt CCA-adding enzyme, and we showed that it
efficiently recognizes mt tRNAs with unusual structures (8). Bacterial and yeast CCA-adding enzymes have been shown to recognize the elbow
region of tRNA formed by D- and T-loop interaction (9-11). In
contrast, human mt tRNAs have no consensus sequence in either the D- or
T-loop. Although the tRNA recognition mechanism of the human mt
CCA-adding enzyme is now under investigation, the T-arm has been found
to be important for efficient CCA-addition (8).
We report here in vitro evidence that two pathogenic
mitochondrial point mutations significantly inhibit CCA-addition to the corresponding tRNAs. The first mutation, A4317G in the mt
tRNAIle gene, was described to be associated with severe
cardiomyopathy in a 1-year-old infant who died from cardiac failure
(12). The other, A10044G in the mt tRNAGly gene, was
reported in several siblings of one family and appeared to be
associated with sudden unexpected death (13). Although little is known
of the molecular pathogenesis of these two point mutations, because
they occur at similar positions in the respective T-loops of mt
tRNAIle and tRNAGly, we speculated that they
could modulate CCA-adding activity during the tRNA maturation. A
kinetic analysis of CCA-addition and a structural investigation of the
mutant tRNAs indicated the involvement of these pathogenic point
mutations in the molecular pathogenesis of mitochondrial diseases.
 |
EXPERIMENTAL PROCEDURES |
Materials--
[ -32P]ATP (110 TBq/mmol) was
obtained from Amersham Biosciences and [5'-32P]pCp
(111 TBq/mmol) from PerkinElmer Life Sciences. Nuclease S1 and T4 RNA
ligase were purchased from Takara Bio Inc., RNase V1 was from Ambion
Inc., and RNase U2 was from Sigma.
In Vitro Transcription of Human mt tRNAs--
Template plasmids
for in vitro transcription of human mt tRNAs for Ile and Gly
were constructed with synthetic DNAs. DNA fragments containing the
class III promoter of T7 RNA polymerase directly connected upstream of
human mt tRNAIle or mt tRNAGly gene were
synthesized by Klenow enzyme using two overlapping primers. The A1-U72
base pair of both tRNAs was replaced with G1-C72 to promote the
efficiency of transcription by T7 RNA polymerase. The following DNA
primers were used: mtIle1,
AAAAGGGGGAATTCTAATACGACTCACTATAGGAAATATGTCTGATAAAAGAGTTACTTTGATAGA; mtIle2,
AAAAGGGGAAGCTTTGGAAATAAGGGGGTTTAAGCTCCTATATTTACTCTATCAAAGTAACTCTTT; mtGly1,
AAAAGGGGGAATTCTAATACGACTCACTATAGCTCTTTTAGTATAAATAGTACGTTAACTTCCAA; mtGly2, AAAAGGGGAAGCTTTGCTCTTTTTTGAATGTTGTCAAAACTAGTTAATTGGAAGTTAACGGTACTA.
The synthetic DNA fragments were cloned into the
EcoRI/HindIII sites of pUC18 and sequenced. The
DNA fragments were amplified from the cloned plasmid to be used as
templates for T7 transcription by PCR with the following primer sets:
GGGAATTCTAATACGACTCACATAGGAAAT (T7-Ile) and TGGAAATAAGGGGGTTTAAGC for
the wild type tRNAIle-D; T7-Ile and GTGGAAATAAGGGGGTTTAAGC
for the wild type tRNAIle-DC; T7-Ile and
GGTGGAAATAAGGGGGTTTAAGC for the wild type tRNAIle-DCC;
T7-Ile and TGGAAATAAGGGGGCTTAAGC for the A4317G tRNAIle-D;
T7-Ile and GTGGAAATAAGGGGGCTTAAGC for the A4317G
tRNAIle-DC; T7-Ile and GGTGGAAATAAGGGGGCTTAAGC for
the A4317G tRNAIle-DCC; GAATTCTAATACGACTCACTATAGC (T7-Gly)
and TGCTCTTTTTTGAATGTTGTCAAAA for the wild type tRNAGly-D;
T7-Gly and GTGCTCTTTTTTGAATGTTGTCAAAA for the wild type
tRNAGly-DC; T7-Gly and GGTGCTCTTTTTTGAATGTTGTCAAAA for the
wild type tRNAGly-DCC; T7-Gly and
TGCTCTTTTTTGAACGTTGTCAAAAACTAGT for the A10044G tRNAGly-D;
T7-Gly and GTGCTCTTTTTTGAACGTTGTCAAAAACTAGT for the A10044G tRNAGly-DC; T7-Gly and GGTGCTCTTTTTTGAACGTTGTCAAAAACTAGT
for the A10044G tRNAGly-DCC. In vitro
run-off transcription was performed according to the literature (14).
All transcripts obtained were purified by denaturing 12%
polyacrylamide gels containing 7 M urea.
Preparation of Human mt CCA-adding Enzyme--
Human mt
CCA-adding enzyme was expressed in Escherichia coli and
purified as described previously (8).
Assays of CCA-adding Enzyme--
Assays were carried out as
described previously (8). The 10-µl reaction mixtures contained 50 mM Tris-HCl (pH 8.5), 10 mM MgCl2,
100 mM KCl, 0.1 mM CTP, and/or ATP, 0.033 µM [ -32P]CTP or
[ -32P]ATP, 1 µM substrate tRNA, and 10 ng of purified recombinant CCA-adding enzyme. Reaction products were
resolved by denaturing 10% PAGE, and the radioactivity of the labeled
bands was measured using an image analyzer (BAS-5000; Fuji Photo Film).
Determination of Kinetic Parameters for C-addition or
A-addition--
The 10-µl reaction mixtures for C-addition or
A-addition contained 50 mM Tris-HCl (pH 8.5), 10 mM MgCl2, 100 mM KCl, 10 ng of
CCA-adding enzyme, 0.5 mM CTP or ATP, 0.033 µM [ -32P]CTP or
[ -32P]ATP, and 1-12 µM tRNA-DC or
tRNA-DCC. After incubation for 5 min while the nucleotide incorporation
rate was constant, reactions were stopped by adding 8 M
urea. Mixtures were loaded onto denaturing 10% PAGE, and the gel was
exposed to an imaging plate along with the standard dilution series of
[ -32P]CTP or [ -32P]ATP
electrophoresed on another gel. The amount of nucleotide incorporated
was calculated by comparing the radioactivities of labeled tRNA with
those of nucleotide standards. The initial velocities of nucleotide
incorporation were then utilized in Lineweaver-Burk plots to determine
the kinetic parameters.
Nuclease Probing--
The tRNAs were labeled at the 3' terminus
with [5'-32P]pCp by T4 RNA ligase and then purified by
denaturing PAGE. Limited digestion under denaturing condition by
alkaline, RNase T1, and RNase U2 was performed according to the method
of Donis-Keller (15) to verify the sequence of tRNAs. Limited digestion
under non-denaturing condition by nucleases S1, V1, and U2 was carried
out at 25 °C for 5 min in 50 mM NaOAc (pH 5.0), 20 mM MgCl2, 300 mM NaCl, and 100 A260 units/ml of a yeast tRNA mixture. For the
digestion with nuclease S1, 1 mM ZnSO4 was
added. The enzyme concentrations were 0.04, 0.2, and 0.4 units/µl
nuclease S1; 4 × 10 3, 8 × 10 3,
and 1.6 × 10 2 units/µl RNase V1; and 8 × 10 4, 4 × 10 3, and 8 × 10 3 units/µl RNase U2. Reactions were stopped by adding
8 M urea and quenching in liquid nitrogen. Mixtures were
then loaded onto 50-cm-long denaturing 15% polyacrylamide gel
containing 7 M urea and 10% glycerol. The gels were
exposed to an imaging plate and analyzed with a bioimaging analyzer
(FLA3000; Fuji Photo Film).
Conformational Analysis of Small RNA Fragments--
Short RNA
fragments containing the T-arm region of the wild type and A4317G
tRNAIle were transcribed in vitro (14) using the
following DNA fragments as templates, and were purified with
super-denaturing PAGE (15% polyacrylamide, 7 M urea, 30%
formamide, 1× TBE). The fragments used are as follows: wild type,
TAGAAATAAGGGGGTTTAAGCTCCTATAGTGAGTCGTATTAGAATAATACGACTCACTATAGG; A4317G,
TAGAAATAAGGGGGCTTAAGCTCCTATAGTGAGTCGTATTAGAATAATACGACTCACTATAGG. The RNA fragments were then electrophoresed under a
super-denaturing condition (15% polyacrylamide, 7 M urea,
30% formamide, 1× TBE) after denaturation in a super-denaturing
buffer (50% formamide, 1× TBE) at 65 °C for 15 min, the regular
denaturing condition (15% polyacrylamide, 7 M urea, 1×
TBE) after being mixed with a denaturing buffer (7 M urea,
1× TBE), and a non-denaturing condition (15% polyacrylamide, 1× TBE)
without denaturation.
Measurement of RNA Melting Profiles--
Melting profiles were
measured by a Gilford Response II spectrophotometer using 0.1 or 0.2 A260 units of RNA samples in 400 µl of a
buffer consisting of 50 mM sodium cacodylate (pH 7.0), 10 mM MgCl2, and 200 mM NaCl as
described previously (16).
 |
RESULTS |
Effects of Pathogenic A4317G and A10044G Mutations in mt tRNAs on
CCA-addition--
We found previously (8) that the human mt CCA-adding
enzyme requires the T-arm region of mt tRNAs for efficient
CCA-addition, prompting us to hypothesize that some mitochondrial
diseases associated with pathogenic point mutations in tRNA genes may
result from an absence or an inefficiency of CCA-addition to mt tRNA
during maturation. Because two pathogenic point mutations, A4317G and A10044G, were found at similar positions in the respective T-loop of mt
tRNAIle and mt tRNAGly, we focused our
attention on evaluating these mutations (Fig. 1).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
Pathogenic mutations in human mt tRNAs.
The mutation positions are indicated as outlined letters.
The base alterations to promote the efficiency of transcription are
shown in boxes. Bases are numbered according to the
numbering rule proposed by Sprinzl et al. (26).
|
|
To examine the effects of the mutations, we prepared wild type and
mutant tRNAs without the 3'-terminal CCA sequence (tRNA-D) by in
vitro transcription, and we evaluated their capability of incorporating CCA catalyzed by the recombinant human mt CCA-adding enzyme (8). As shown in Fig.
2a, in
vitro-transcribed wild type mt tRNAs for Ile and Gly were repaired
by the human mt CCA-adding enzyme as efficiently as canonical yeast
tRNAPhe. In contrast, both mutants exhibited significantly
lower levels of CCA incorporation, with remarkable reduction in the
case of the A4317G mt tRNAIle mutation (Fig.
2a).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 2.
Effects of pathogenic point mutations on
CCA-addition. a, effects on CCA-addition by human mt
CCA-adding enzyme were compared using yeast tRNAPhe-D, wild
type (WT), and A4317G mutant of mt tRNAIle-D,
and WT and A10044G mutant of mt tRNAGly-D, in the presence
of CTP and [ -32P]ATP. b, effects on
C-addition and A-addition. The C-adding efficiency to WT and mutant of
tRNA-DC (left) and A-adding efficiency to WT and mutant of
tRNA-DCC (right) were compared. Above,
tRNAIle; below, tRNAGly.
|
|
Because the CCA-adding reaction consists of C-addition and A-addition,
we prepared wild type and mutant tRNAs without the 3'-terminal CA
sequence (tRNA-DC) and 3'-terminal A (tRNA-DCC), and we investigated
the efficiency of C-addition to tRNA-DC and A-addition to tRNA-DCC.
Both C- and A-addition to mutant tRNAs were reduced (Fig.
2b), not as remarkably as the entire CCA-addition (Fig.
2a), suggesting that the reduced reaction at each step of C-
and A-addition results accumulatively in significant decrease of whole
CCA-addition (Fig. 2a).
The kinetic parameters of C-addition to tRNAs-DC and A-addition to
tRNAs-DCC for wild type and mutant tRNAs were determined as shown in
Table I. The kcat
values for both mutant tRNAs were severely reduced, whereas
Km values were slightly affected in either C- or
A-adding step. This observation suggests that these two mutations
inhibit both C- and A-adding steps by mainly hindering the catalytic
process without affecting the substrate recognition.
Structural Rearrangement of T-arm in mt tRNAIle with
the A4317G Mutation--
Suspecting that the reduction in the
kcat value might arise from structural
alterations caused by the pathogenic point mutation, we carried out
nuclease probing by using double-stranded specific RNase V1 and
single-stranded specific cleavages by nuclease S1 and RNase U2, and we
compared the cleavage profiles with those of the wild type. The
nuclease cleavage pattern in Fig.
3a indicates that although the
A4317G mutant appears to retain the global secondary structure of the
wild type mt tRNAIle, some significant differences are
evident in the T-arm region. C54 and C62 of the A4317G mutant became
sensitive to double-stranded specific RNase V1 on the 5' side, whereas
the 5' side of A49 exhibited high resistibility to this nuclease (Fig.
3b). This finding suggests structural rearrangement of the
T-arm region caused by the A4317G mutation, as was predicted by Tanaka
et al. (12) when they first reported the mutation. They
proposed the T-stem "slippage" model as shown in the
inset of Fig. 3b, in which the T-arm has a stem of 6 bp with two A-C mismatches and a 4-base loop. The RNase V1 cleavages at C54 and C62 in mutant tRNA are likely to result from two
Watson-Crick base pairs, G53-C60 and C54-G59. An absence of cleavage at
A49 can be explained by the A49-C64 mismatch. In addition, the 5' side
of U56 of the mutant was less sensitive to RNase V1 cleavage than that
of the wild type. Because the base pairs between T-loop and D-loop are
known to accommodate cleavage sites for RNase V1 (17), tertiary
interaction between the T- and D-loops involving U56 is assumed to be
impaired by the structural rearrangement.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 3.
Structural rearrangement of T-arm in A4317G
mutant tRNAIle. a, nuclease cleavage patterns of
wild-type and mutant tRNAIle. , Al,
T1, and U2 indicate no treatment and treatment by
alkaline digestion, RNase T1 (specific for G), or RNase U2 (for A > G), respectively. The structure lanes contained tRNA partially digested
by nuclease S1, V1, or U2 under the non-denaturing condition.
b, structure of wild-type and mutant tRNAIle.
Secondary structure models of the wild-type and mutant
tRNAIle and a summary of the nuclease probing results are
depicted. Black arrows indicate positions where the mutant
is more sensitive to the nuclease than the wild type; gray
arrows show where it is less sensitive. Outlined
letters indicate the mutation points. Inset, T-stem
"slippage" model proposed by Tanaka et al. (12).
|
|
Aberrantly Stable Secondary Structure of T-arm in mt
tRNAIle Induced by the A4317G Mutation--
The
structural rearrangement by the A4317G mutation is supported by the
abnormal migration of RNA fragments containing the T-arm region on the
alkaline ladder (Fig. 3a). The 3' part of the RNA fragment
cleaved at the 3' side of A49 of the mutant tRNA migrates faster than
the corresponding fragment of the wild type, whereas normal migration
of a one-nucleotide-short RNA fragment (cleaved at the 3' side of G50)
is observed. This extraordinary mobility of the RNA fragment of the
mutant tRNA, despite the electrophoresis of the denaturing gel at
55 °C, suggests the formation of aberrantly stable secondary
structure in the T-arm region caused by the A4317G mutation. Similar
faster migration is observed in the cases of RNA fragments
corresponding to positions 45-48, indicating that the stable secondary
structure of the T-arm region is retained in the whole tRNA molecule
with the A4317G mutation.
To characterize the structural rearrangement resulting from the A4317G
mutation, the 3' parts of RNA fragments from G50 to A73 with or without
the mutation were synthesized by T7 RNA polymerase (Fig.
4a). Fig. 4b shows
that the RNA fragment with the A4317G mutation migrated faster than the
wild type in gels under the non-denaturing or regular denaturing
condition (as in Fig. 3a), whereas no discernible difference
in the mobility was observed in the super-denaturing gel (see
"Materials and Methods" for details of each condition). Faster
migration in the gel is indicative of a stable, compact structure of
the RNA fragment with the A4317G mutation.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 4.
Aberrantly stable structure of T-arm
in A4317G mutant tRNAIle. a, the sequence of
short RNA fragments containing the T-arm region of the wild-type and
A4317G tRNAIle. Outlined letters indicate
mutation points. b, migration of wild-type and A4317G RNA
fragments in super-denaturing, regular denaturing, and non-denaturing
gels.
|
|
The melting profiles of the wild type and mutant fragments are plotted
in Fig. 5a. Only the mutant
fragment exhibits an evident melting curve with higher
Tm values, verifying its stable secondary structure.
This also explains the fact that the Tm value of mt
tRNAIle with the A4317G mutation (59 °C) was higher than
that of the wild type mt tRNAIle (57.5 °C) (Fig.
5b).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
The A4317G mutation stabilizes the tRNA by
forming an aberrantly stable structure in the T-arm region.
a, melting curves of short RNA fragments containing the
T-arm region of the wild-type and A4317G tRNAIle.
Unfilled circles indicate the wild type and filled
circles the A4317G mutant. b, melting curves of
wild-type and A4317G tRNAIle. Unfilled squares
indicate the wild type and filled squares the A4317G
mutant.
|
|
Taken together, these results demonstrate that the strong inhibition of
CCA-addition to the mt tRNAIle A4317G mutant is caused by
the structural rearrangement of the T-arm region induced by the mutation.
Structural Change in mt tRNAGly with the A10044G
Mutation--
Considering that position 10044 in the secondary
structure of mt tRNAGly is identical to that of 4317 in mt
tRNAIle (Fig. 1b), the tertiary structure
of the mt tRNAGly A10044G mutant was also evaluated by
nuclease probing (Fig. 6a). As
shown in Fig. 6b, strong cleavages were observed at both the 5' and 3' sides of A55/A56 in the T-loop of the mutant tRNA by nuclease
S1 and RNase U2, respectively. In addition, residues in the D-loop show
slightly higher sensitivity to nuclease S1, with decreased
accessibility at the 5' side of U20/A21 by RNase V1. These results
suggest that tertiary interaction between the T- and D-loops is
weakened by the A10044G mutation, whereas the global secondary
structure is conserved.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 6.
Structural change in A10044G mutant
tRNAGly. a, nuclease cleavage pattern of
wild-type and mutant tRNAGly. , Al,
T1, and U2 indicate no treatment and treatment by
alkaline digestion, RNase T1 (specific for G), or RNase U2 (for A > G), respectively. The structure lanes contained tRNA partially digested
by nuclease S1, V1, or U2 under the non-denaturing condition.
b, structure of wild-type and mutant tRNAGly.
Secondary structure models of the wild-type and mutant
RNAGly and a summary of the nuclease probing results are
depicted. Black arrows indicate positions where the mutant
is more sensitive to the nuclease than the wild type; gray
arrows show where it is less sensitive. Outlined
letters indicate the mutation points.
|
|
 |
DISCUSSION |
In the initial step of mammalian mitochondrial tRNA maturation
process, the 5' end leader and 3' end trailer are removed by RNase P
and 3'-tRNase, respectively, followed by the addition of 3' CCA
terminus by the CCA-adding enzyme (18, 19). It is possible to consider
that some pathogenic mutations may have deleterious effect on the tRNA
maturation step. Here we have shown that both the A4317G and A10044G
mutations in mt tRNAs significantly inhibit the CCA-addition by the
human mt CCA-adding enzyme. Both C- and A-addition were inhibited by
these mutations, not as remarkably as the entire CCA-addition,
suggesting that the reduced reaction at two C-adding steps and one
A-adding step results accumulatively in significant decrease of whole
CCA-addition. The CCA sequence of mt tRNAs is not encoded in the tRNA
genes but is post-transcriptionally synthesized by mt CCA-adding
enzyme. Immature tRNAs without complete CCA sequence cannot be
aminoacylated nor protected by elongation factors, resulting in their
instability in mitochondria. Thus, the significant decrease of entire
CCA-addition by A4317G and A10044G mutations (Fig. 2a) might
be a direct cause for mitochondrial dysfunction.
The A4317G mutation in mt tRNAIle induced a structural
rearrangement of the T-arm region, whereas the A10044G mutation in mt tRNAGly weakened the T-loop/D-loop interaction. It has been
considered that the CCA-adding enzyme recognizes the elbow region of
tRNA formed by the D- and T-loops (9, 10, 20, 21), and we showed
previously (8) that the mt CCA-adding enzyme has a lower substrate
specificity than the E. coli enzyme, presumably to enable it
to recognize mt tRNAs with unusual structures. Our finding that both
the A4317G and A10044G mutations in human mt tRNAs had a small effect
on the Km values for C- and A-addition indicates
that these mutations do not inhibit recognition of the tRNA elbow
region by the mt CCA-adding enzyme. Thus, the decreases observed in the
kcat values might result from an inappropriate positioning of the tRNA substrate in the enzyme during the catalytic process.
The sequences of the T- and D-loops are highly conserved in cytoplasmic
tRNAs, but mammalian mt tRNAs have unusual structures without consensus
sequences in either of the loops (22). Hence, it is difficult to
predict the conformational influence of a single mutation in mt tRNAs
because of their abnormality. When Tanaka et al. (12) first
reported the A4317G mutation in mt tRNAIle, they deduced
that it would cause structural rearrangement of the T-arm
region (Fig. 3b). Our findings based on nuclease probing and
RNA fragment analysis have clearly demonstrated their proposed structural rearrangement. We previously analyzed another pathogenic point mutation (A4269G in mt tRNAIle associated with fatal
cardiomyopathy) and found that this mutation destabilizes the whole
tRNA structure with a lower Tm, which explains the
rapid decay of the A4269G mutant tRNA observed in cybrid cells (16). In
contrast, the A4317G mutation stabilizes tRNA by forming an aberrantly
stable secondary structure in the T-arm region, thereby increasing its
Tm value. It is plausible that this structural
rearrangement affects various steps in the tRNA maturation process,
including CCA-addition. In the case of the A10044G mutation in mt
tRNAGly, such structural rearrangement was not observed,
but instead a weakened interaction between the T- and D-loops was
suggested. In mitochondria, high sensitivity to nucleases in either the
T- or D-loop can lead to instability of the tRNA.
The A4317G mutation was reported to decrease significantly
isoleucylation (23, 24). Thus, it can be assumed that the pathogenic A4317G mutation at least causes defects in both CCA-addition and the
following aminoacylation. In addition, because certain
mutations in the T-loop were demonstrated to decrease the tRNA
processing activity of Drosophila RNase P and 3'-tRNase
(25), it can be speculated that both the A4317G and A10044G mutations
also affect the 5'- and 3'-processing of tRNA. We cannot define
which step in tRNA maturation process is the most damaged in
vivo, because neither of the cell lines carrying these mutations
is available at the present
time.2 Even if the 5'- and
3'-processing proceeds inefficiently by these mutations, the following
CCA-addition and aminoacylation are still considered to be crucial
steps for tRNA function.
Our findings presented here indicate the probability that the
CCA-addition disorder of the pathogenic A4317G and A10044G mutants is
involved in mitochondrial dysfunction. Furthermore, they suggest an
approach to understanding the mechanism of tRNA recognition by the mt
CCA-adding enzyme, which is currently under investigation.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Kimitsuna Watanabe
(University of Tokyo) for the use of the laboratory facilities and for
continuous encouragement during this project. We also thank Drs. Kozo
Tomita and Nono Takeuchi (University of Tokyo) for technical advice and helpful discussions.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this work.
§
To whom correspondence should be addressed: Dept. of Integrated
Biosciences, Graduate School of Frontier Sciences, University of Tokyo,
Bldg. FSB-301, 5-1-5 Kashiwanoha, Kashiwa, Chiba Prefecture, 277-8562, Japan. Tel.: 81-4-7136-5401; Fax: 81-4-7136-3602; E-mail: t-suzuki@k.u-tokyo.ac.jp.
Published, JBC Papers in Press, March 5, 2003, DOI 10.1074/jbc.M213216200
2
M. Tanaka, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
mt, mitochondrial;
WT, wild type;
pCp, cytidine 3',5'-bisphosphate.
 |
REFERENCES |
| 1.
|
Schon, E. A.,
Bonilla, E.,
and DiMauro, S.
(1997)
J. Bioenerg. Biomembr.
29,
131-149[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Kogelnik, A. M.,
Lott, M. T.,
Brown, M. D.,
Navathe, S. B.,
and Wallace, D. C.
(1998)
Nucleic Acids Res.
26,
112-115[Abstract/Free Full Text]
|
| 3.
|
Florentz, C.,
and Sissler, M.
(2001)
EMBO Rep.
2,
481-486[Medline]
[Order article via Infotrieve]
|
| 4.
|
Suzuki, T.,
Suzuki, T.,
Wada, T.,
Saigo, K.,
and Watanabe, K.
(2002)
EMBO J.
21,
6581-6589[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Yasukawa, T.,
Suzuki, T.,
Ueda, T.,
Ohta, S.,
and Watanabe, K.
(2000)
J. Biol. Chem.
275,
4251-4257[Abstract/Free Full Text]
|
| 6.
|
Yasukawa, T.,
Suzuki, T.,
Ishii, N.,
Ueda, T.,
Ohta, S.,
and Watanabe, K.
(2000)
FEBS Lett.
467,
175-178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Yasukawa, T.,
Suzuki, T.,
Ishii, N.,
Ohta, S.,
and Watanabe, K.
(2001)
EMBO J.
20,
4794-4802[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Nagaike, T.,
Suzuki, T.,
Tomari, Y.,
Takemoto-Hori, C.,
Negayama, F.,
Watanabe, K.,
and Ueda, T.
(2001)
J. Biol. Chem.
276,
40041-40049[Abstract/Free Full Text]
|
| 9.
|
Spacciapoli, P.,
Doviken, L.,
Mulero, J. J.,
and Thurlow, D. L.
(1989)
J. Biol. Chem.
264,
3799-3805[Abstract/Free Full Text]
|
| 10.
|
Spacciapoli, P.,
and Thurlow, D. L.
(1990)
J. Mol. Recognit.
3,
149-155[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Li, Z.,
Gillis, K. A.,
Hegg, L. A.,
Zhang, J.,
and Thurlow, D. L.
(1996)
Biochem. J.
314,
49-53[Medline]
[Order article via Infotrieve]
|
| 12.
|
Tanaka, M.,
Ino, H.,
Ohno, K.,
Hattori, K.,
Sato, W.,
Ozawa, T.,
Tanaka, T.,
and Itoyama, S.
(1990)
Lancet
336,
1452[Medline]
[Order article via Infotrieve]
|
| 13.
|
Santorelli, F. M.,
Schlessel, J. S.,
Slonim, A. E.,
and DiMauro, S.
(1996)
Pediatr. Neurol.
15,
145-149[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Milligan, J. F.,
and Uhlenbeck, O. C.
(1989)
Methods Enzymol.
180,
51-62[Medline]
[Order article via Infotrieve]
|
| 15.
|
Donis-Keller, H.
(1980)
Nucleic Acids Res.
8,
3133-3142[Abstract/Free Full Text]
|
| 16.
|
Yasukawa, T.,
Hino, N.,
Suzuki, T.,
Watanabe, K.,
Ueda, T.,
and Ohta, S.
(2000)
Nucleic Acids Res.
28,
3779-3784[Abstract/Free Full Text]
|
| 17.
|
Lockard, R. E.,
and Kumar, A.
(1981)
Nucleic Acids Res.
9,
5125-5140[Abstract/Free Full Text]
|
| 18.
|
Rossmanith, W.,
Tullo, A.,
Potuschak, T.,
Karwan, R.,
and Sbisa, E.
(1995)
J. Biol. Chem.
270,
12885-12891[Abstract/Free Full Text]
|
| 19.
|
Reichert, A. S.,
and Morl, M.
(2000)
Nucleic Acids Res.
28,
2043-2048[Abstract/Free Full Text]
|
| 20.
|
Hegg, L. A.,
and Thurlow, D. L.
(1990)
Nucleic Acids Res.
18,
5975-5979[Abstract/Free Full Text]
|
| 21.
|
Shi, P. Y.,
Maizels, N.,
and Weiner, A. M.
(1998)
EMBO J.
17,
3197-3206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Helm, M.,
Brule, H.,
Friede, D.,
Giege, R.,
Putz, D.,
and Florentz, C.
(2000)
RNA (New York)
6,
1356-1379
|
| 23.
|
Kelley, S. O.,
Steinberg, S. V.,
and Schimmel, P.
(2001)
J. Biol. Chem.
276,
10607-10611[Abstract/Free Full Text]
|
| 24.
|
Degoul, F.,
Brule, H.,
Cepanec, C.,
Helm, M.,
Marsac, C.,
Leroux, J.,
Giege, R.,
and Florentz, C.
(1998)
Hum. Mol. Genet.
7,
347-354[Abstract/Free Full Text]
|
| 25.
|
Levinger, L.,
Bourne, R.,
Kolla, S.,
Cylin, E.,
Russell, K.,
Wang, X.,
and Mohan, A.
(1998)
J. Biol. Chem.
273,
1015-1025[Abstract/Free Full Text]
|
| 26.
|
Sprinzl, M.,
Horn, C.,
Brown, M.,
Ioudovitch, A.,
and Steinberg, S.
(1998)
Nucleic Acids Res.
26,
148-153[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Bonnefond, C. Florentz, R. Giege, and J. Rudinger-Thirion
Decreased aminoacylation in pathology-related mutants of mitochondrial tRNATyr is associated with structural perturbations in tRNA architecture
RNA,
April 1, 2008;
14(4):
641 - 648.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ling, H. Roy, D. Qin, M. A. T. Rubio, J. D. Alfonzo, K. Fredrick, and M. Ibba
Pathogenic mechanism of a human mitochondrial tRNAPhe mutation associated with myoclonic epilepsy with ragged red fibers syndrome
PNAS,
September 25, 2007;
104(39):
15299 - 15304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Levinger, M. Morl, and C. Florentz
Mitochondrial tRNA 3' end metabolism and human disease
Nucleic Acids Res.,
October 11, 2004;
32(18):
5430 - 5441.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Hino, T. Suzuki, T. Yasukawa, K. Seio, K. Watanabe, and T. Ueda
The pathogenic A4269G mutation in human mitochondrial tRNAIle alters the T-stem structure and decreases the binding affinity for elongation factor Tu
Genes Cells,
March 1, 2004;
9(3):
243 - 252.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Temperley, S. H. Seneca, K. Tonska, E. Bartnik, L. A. Bindoff, R. N. Lightowlers, and Z. M.A. Chrzanowska-Lightowlers
Investigation of a pathogenic mtDNA microdeletion reveals a translation-dependent deadenylation decay pathway in human mitochondria
Hum. Mol. Genet.,
September 15, 2003;
12(18):
2341 - 2348.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|