|
Originally published In Press as doi:10.1074/jbc.M301028200 on March 3, 2003
J. Biol. Chem., Vol. 278, Issue 19, 16857-16862, May 9, 2003
37-kDa Laminin Receptor Precursor Modulates Cytotoxic Necrotizing
Factor 1-mediated RhoA Activation and Bacterial Uptake*
Jin Woong
Chung ,
Suk Jin
Hong§,
Kee Jun
Kim ,
Daniel
Goti ,
Monique F.
Stins ,
Sooan
Shin ,
Valina L.
Dawson§¶ **,
Ted M.
Dawson§¶**, and
Kwang Sik
Kim 
From the Departments of Pediatrics,
§ Neurology, ¶ Neuroscience, Physiology, and
** Institute for Cell Engineering, Johns Hopkins University,
School of Medicine, Baltimore, Maryland 21287
Received for publication, January 30, 2003
 |
ABSTRACT |
Cytotoxic necrotizing factor 1 (CNF1) is a
bacterial toxin known to activate Rho GTPases and induce host cell
cytoskeleton rearrangements. The constitutive activation of Rho GTPases
by CNF1 is shown to enhance bacterial uptake in epithelial cells and
human brain microvascular endothelial cells. However, it is unknown how exogenous CNF1 exhibits such phenotypes in eukaryotic cells. Here, we identified 37-kDa laminin receptor precursor (LRP) as
the receptor for CNF1 from screening the cDNA library of human brain microvascular endothelial cells by the yeast two-hybrid system
using the N-terminal domain of CNF1 as bait. CNF1-mediated RhoA
activation and bacterial uptake were inhibited by exogenous LRP or LRP
antisense oligodeoxynucleotides, whereas they were increased in
LRP-overexpressing cells. These findings indicate that the CNF1
interaction with LRP is the initial step required for CNF1-mediated
RhoA activation and bacterial uptake in eukaryotic cells.
 |
INTRODUCTION |
Escherichia coli K1 is a major cause of neonatal
Gram-negative bacillary meningitis. Despite advances in antimicrobial
chemotherapy and supportive care, the mortality and morbidity
associated with E. coli meningitis remain significant
because of incomplete understanding of the pathogenesis of this
disease. We have previously shown that E. coli invasion of
human brain microvascular endothelial cells
(HBMEC)1 is a prerequisite
for penetration into the central nervous system in vivo, and
identified several E. coli determinants contributing to
invasion of HBMEC, including Ibe proteins, AslA, TraJ, and CNF1 (1-6).
We have also demonstrated that E. coli invasion of HBMEC
requires host cell actin cytoskeleton rearrangements and activations of
RhoA (7, 8). CNF1, a bacterial toxin known to induce host cell
cytoskeleton rearrangements, activates Rho GTPases such as RhoA, Cdc42,
and Rac1 (9, 10), which regulate various cellular processes involving
actin filaments. The constitutive activation of Rho GTPases by CNF1 has
been shown to induce stress fiber formation, membrane ruffling, and
phagocytosis in epithelial cells (11-13). We have shown that CNF1
contributes to E. coli invasion into HBMEC, in part through
activation of RhoA (8).
CNF1 is a 113-kDa single chain toxin molecule that consists of a
N-terminal cell surface receptor binding domain, a C-terminal catalytic
domain, and a transmembrane domain in the middle (14). After
translocation into the cytosol, the enzymatic domain of CNF1 activates
Rho GTPases by deamidation of glutamine 63 of RhoA (9, 10), or
glutamine 61 in Rac1 and Cdc42 into glutamic acid (11). The glutamine
residue is essential for GTP hydrolysis, and its modification results
in constitutively activated Rho GTPases by arresting the Rho GTPases
cycle between the GDP-bound inactive and GTP-bound active forms (14).
However, it is unclear how CNF1 enters the eukaryotic cells and
activates Rho GTPases. CNF1 has been suggested to be internalized via
receptor-mediated endocytosis upon binding to a cell surface receptor
(15, 16), but the identity and characteristics of the CNF1 receptor are
not known.
In this study, for the purpose of identifying CNF1 receptor, the
cDNA library of HBMEC was constructed and screened by the yeast
two-hybrid system using the N terminus of CNF1 (nCNF1) as bait. We
identified for the first time that 37-kDa laminin receptor precursor
(LRP) functions as the receptor for CNF1. Exogenous LRP or LRP
antisense oligodeoxynucleotides (ODN) inhibited CNF1-mediated RhoA
activation and bacterial uptake, whereas overexpression of LRP
increased binding and effects of CNF1.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Plasmids, and Antibodies--
E.
coli K1 strain E44 is a spontaneous rifampin-resistant mutant
derived from the cerebrospinal fluid isolate of a neonate with
meningitis, strain RS218 (serotype O18:K1:H7). The isogenic cnf1 deletion mutant of strain E44 was previously reported
(8). E. coli BL21 (Invitrogen, Carlsbad, CA) or XL1-Blue
(Stratagene, Ceda Creek, TX) was used for expression of the recombinant
proteins. E. coli DH10B (Invitrogen) was used for the
construction of the cDNA library. Plasmids pGBKT7 and pGADT7 were
purchased from Clontech (Palo Alto, CA), and used
for construction of the bait CNF1 and prey cDNA libraries,
respectively. Anti-LRP polyclonal antibody was purchased from Abcam
(Cambridgeshire, UK). Anti-CNF1 monoclonal antibody NG8 (17) was a
generous gift from Dr. Allison O'Brien (Uniformed Services
University of the Health Sciences, Bethesda, MD). Plasmid pGEX-2T
(Amersham Biosciences) was used for construction of GST fusion proteins.
cDNA Construction and Yeast Two-hybrid Screen--
For bait
construction, the N-terminal segment of cnf1 (nCNF1) was
amplified by PCR from E44 chromosomal DNA using primers, 5'-aagaattcatgggtaaccatggc-3' and
5'-acggatccattgctaagtgtcttattgg-3'. The amplified fragments
(amino acids 1-299) were cloned into pGBKT7 vector via
EcoRI and BamHI sites (underlined) to create the
bait plasmid pGBKT7:nCNF1. Full-length CNF1 (fCNF1, amino acids
1-1007) and the C-terminal fragment of CNF1 (cCNF1, amino acids
720-1007) were amplified using forward primers
5'-aagaattcatgggtaaccatggc-3' (fCNF1) and
5'-aagaattcagtatcgaaagcacc-3' (cCNF1) and reverse primer
5'-acggatcccaataccgatatttcgg-3' and cloned into pGBKT7 vector to construct pGBKT7:fCNF1 and pGBKT7:cCNF1, respectively, following the same strategies as described above. The cDNA library from mRNA of HBMEC was constructed with the
SuperScriptTM Choice system (Invitrogen) following the
manufacturer's protocol, and ligated into prey vector, pGADT7
(Clontech). pGBKT7 contains the DNA binding domain
and c-myc epitope, and pGADT7 contains the activation domain and
hemagglutinin epitope at the N terminus of the multicloning sites. The
whole screening procedure was performed according to the MATCHMAKER
protocol from Clontech using yeast strain AH109 as host.
In Vitro Translation of Recombinant Proteins and Ligand Overlay
Assay--
The N-terminal domain of CNF1 (nCNF1), C-terminal domain of
CNF1 (cCNF1), and full-length CNF1 (fCNF1) were in vitro
translated from pGBKT7:nCNF1, pGBKT7:cCNF1, and pGBKT7:fCNF1,
respectively, using TNT quick coupled
transcription/translation systems (Promega, Madison, WI) according to
the manufacturer's protocol. pGADT7:LRP-(89-295) was used for
in vitro translation of LRP-(89-295) following the same
protocol. For ligand overlay assay, HBMEC membrane proteins or the
bacterial lysates from E. coli BL21 containing
pGADT7:LRP-(89-295) were separated in a SDS-PAGE gel and transferred
to a PVDF membrane. After washing, the membrane was blocked overnight
with 5% skim milk in phosphate-buffered saline at 4 °C, and
incubated with in vitro translated [35S]CNF1
for 1 h at room temperature. After extensive washing, radiolabeled CNF1 was detected with a Cyclone PhosphorImager (Packard, Boston, MA).
Co-immunoprecipitation and Western Blot--
30 µg of total
protein of bacterial lysates from E. coli K1 strain E44 or
its isogenic cnf1 deletion mutant (E44 CNF1) was combined
with 10 µl of in vitro translated
[35S]LRP-(89-295), and the mixture was incubated at
37 °C for 1 h. After incubation, the mixture was precipitated
with anti-CNF1 monoclonal antibody NG8 in the presence of protein
A-Sepharose (Roche Diagnostics, Indianapolis, IN) in 0.5 ml of
co-immunoprecipitation buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM dithiothreitol, 5 µg/ml
aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 0.1% Tween 20 (v/v), and 1% Nonidet P-40) at 4 °C for overnight. After washing, immunoprecipitates were separated by SDS-PAGE in duplicate. One set was dried and subjected to scan by PhosphorImager and the other
was transferred to PVDF membrane, blocked, and incubated with anti-CNF1
monoclonal antibody NG8. The membrane was washed and incubated with
horseradish peroxidase-conjugated secondary antibody. Protein detection
was performed with the enhanced chemiluminescence (ECL) system
(Amersham Biosciences).
Construction and Purification of Recombinant LRP--
For
construction of GST-LRP, full-length LRP was amplified from the HBMEC
cDNA library by PCR using primers,
5'-acggatccatgtccggagcccttgat-3' and
5'-aagaattcttaagaccagtcagtggtt-3'. For GST-CNF1,
full-length CNF1 was PCR-amplified from E44 genomic DNA using primers
5'-acggatccatgggtaaccatggc-3' and
5'-aagaattccaataccgatatttcgg-3'. Amplified fragments were cloned into pGEX-2T (Amersham biosciences) via BamHI and
EcoRI sites, and introduced into E. coli
XL1-Blue. Expression and purification of the recombinant proteins were
performed with a GST purification kit (Clontech)
according to the manufacturer's protocol.
Cell Cultures--
HBMECs were isolated and cultured as
described previously (18). Briefly, HBMECs were grown in RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 10% Nu-Serum, 2 mM glutamine, 1 mM pyruvate, penicillin (100 units/ml), streptomycin (100 µg/ml), essential amino acids, and
vitamins. HEp-2 cells were purchased from ATCC (ATCC CCL 23),
maintained and cultured according to the provider's protocol.
RhoA-GTP Assay--
To examine the effects of LRP in
CNF1-mediated RhoA activation, RhoA-GTP assays were performed as
described previously (8) with the following modifications. Briefly,
HBMEC or HEp-2 cells were lysed in lysis buffer (50 mM
Tris-HCl, pH 7.4, 0.1% SDS, 0.5% sodium deoxycholate, 10 mM sodium pyrophosphate, 25 mM
-glycerophosphate, 150 mM NaCl, 2 mM EDTA, 2 mM EGTA, 1% Triton X-100, 1 mM
Na3VO4, 50 mM NaF, 1 mM
phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, 1 µg/ml
leupeptin, and 1 µg/ml pepstatin). Glutathione
S-transferase-rhotekin beads (Upstate Biotechnologies, Inc.,
Lake Placid, NY) were incubated with cytosolic fractions of the cells
for 1 h at 4 °C by head over head rotation to collect active
forms of RhoA, i.e. RhoA-GTP. After washing three times with
lysis buffer, the protein complex was resolved by 12% SDS-PAGE and
transferred to PVDF membrane. The blots were blocked with 25 mM Tris (pH 7.4), 150 mM NaCl, and 0.1% Tween
20 containing 4% skim milk for 30 min at room temperature. After
blocking, the membranes were incubated overnight at 4 °C with mouse
monoclonal antibody against RhoA (Santa Cruz Biotechnology, Santa Cruz,
CA) and subsequently incubated for 60 min at room temperature with
horseradish peroxidase-linked secondary antibody against mouse.
Antibody-bound RhoA was visualized using an ECL system (Amersham
Biosciences). A single band of RhoA in the 21-kDa range was detected.
The density of RhoA-GTP bands were quantitated using an imaging densitometer.
In Vitro HBMEC Invasion Assay--
Invasion assays were
performed as described previously (8) with the following modifications.
Briefly, confluent HBMEC in 24-well plates were incubated with
107 E. coli (multiplicity of infection of 100)
in experimental medium (M199-Ham's F-12 (1:1) containing 5%
heat-inactivated fetal bovine serum, 2 mM glutamine, and 1 mM pyruvate). Plates were incubated at 37 °C in 5%
CO2 incubator for 90 min. Monolayers were washed with RPMI
1640 and extracellular bacteria were killed by 1 h incubation in
experimental media containing gentamicin (100 µg/ml). The monolayers were washed again and lysed in 0.5% Triton X-100. The released intracellular bacteria were enumerated by plating on sheep blood agar
plates. To determine the role of LRP on CNF1-induced E. coli K1 invasion, monolayers were incubated with a mixture of 3 µg/ml CNF1
and 30 µg/ml GST-LRP or GST in experimental medium for 2 h
before addition of bacteria and HBMEC invasion assays were carried out
as described above.
Enzyme-linked Immunosorbent Assay--
Full-length LRP was
amplified from the HBMEC cDNA library by PCR using primers,
5'-acggatccatgtccggagcccttgat-3' and
5'-aagaattcttaagaccagtcagtggtt-3', and cloned into the
vector pcDNA3.1/His A (Invitrogen) via BamHI and
EcoRI sites (underlined) to create pcDNA3.1:LRP. HBMEC
stably transfected with pcDNA3.1 or pcDNA3.1:LRP was seeded in
96-well plates. Upon confluence, the cells were washed with
phosphate-buffered saline containing 0.05% Tween 20 and different
concentrations of GST-CNF1 or no ligand in binding buffer
(phosphate-buffered saline containing 0.05% Tween 20 and 2% bovine
serum albumin) were added to each well. After 1 h incubation at
room temperature, the ligand was aspirated and the cells were washed
five times with binding buffer. After washing, anti-GST polyclonal
antibody (Amersham Biosciences) was added, and the cells were further
incubated for 1 h at room temperature. After washing, the cells
were incubated for 1 h at room temperature with anti-goat IgG
conjugated with alkaline phosphatase. To detect binding of GST-CNF1,
p-nitrophenyl phosphate was added to each well and the color
change was quantitated at 405 nm on a microplate spectrophotometer.
Antisense ODN Treatment--
Based on the human LAMR1 cDNA
sequences, antisense and sense phosphorothiate oligodeoxynucleotides,
respectively, were designed against nucleotides 1-20. They were
antisense, ACATCAAGGGCTCCGGACAT, and sense, ATGTCCGGAGCCCTTGATGT. HBMEC
were transfected with antisense and sense phosphorothiate ODNs with
OligofectAMINE (Invitrogen) followed by manufacturer's protocol and
48 h was allowed for HBMEC cells to uptake the ODNs.
 |
RESULTS |
Identification of LRP as a CNF1 Receptor by the Yeast Two-hybrid
System and Coimmunoprecipitation--
In an attempt to identify the
CNF1 receptor, we screened a cDNA library of HBMEC by the yeast
two-hybrid system using the N terminus of CNF1 (nCNF1) as bait. We
screened more than 2 × 106 individual clones from a
HBMEC cDNA library and identified nine positive clones at the
highest stringency selection conditions (Trp-, Leu-, His-, Ade-).
Sequence analysis revealed that one of the nine colonies contained a
putative transmembrane domain, which showed a 100% match to the
partial sequence (amino acids 89-295) of LAMR1 encoding laminin
receptor precursor (LRP). LRP is comprised of a cytoplasmic N-terminal
domain (amino acids 1-85), and an extracellular C-terminal domain
(amino acids 102-295) that are separated by a transmembrane domain
(amino acids 86-101) (19). This clone was further characterized for
its interaction with CNF1 by retransformation. A yeast colony
co-transformed with pGADT7:LRP-(89-295) and pGBKT7:nCNF1 was positive
in both growth on the selection medium (Leu-, Trp-, His-, Ade-) and
5-bromo-4-chloro-3-indolyl- -D-galactopyranoside (X-gal)
assays (Fig. 1a). Similarly,
interaction between fCNF1 and LRP-(89-295) in yeast was observed (Fig.
1a). In contrast, co-transformation with
pGADT7:LRP-(89-295) and pGBKT7:cCNF1 or pGBKT7 vector alone did not
restore growth ability or enzyme activity (Fig. 1a),
suggesting that the LRP-(89-295) binds to full-length CNF1 and nCNF1,
but not to cCNF1 in vivo.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1.
Interaction of CNF1 and LRP.
a, yeast two-hybrid system. Yeast cells were cotransformed
with the prey plasmid pGADT7:LRP-(89-295) and the bait plasmids
pGBKT7, pGBKT7:cCNF1, pGBKT7:nCNF1, and pGBKT7:fCNF1. Strains were
grown on selective media, diluted to A600 of
0.5, and 10-fold serial dilutions were spotted onto plates (Leu-, Trp-)
either with or without histidine (His) and adenine (Ade), which were
incubated for 4 days at 30 °C. b, co-immunoprecipitation.
The 35S-labeled extracellular domain of LRP
([35S]LRP-(89-295)) produced by the in vitro
translation system was incubated with bacterial lysates with or without
CNF1 in the presence of monoclonal anti-CNF antibody (NG8) and
precipitated with protein A-Sepharose. The immunoprecipitates were
eluted using an SDS sample buffer and subjected to SDS-PAGE. Bound
[35S]LRP-(89-295) was detected by PhosphorImager
(upper panel). Presence or absence of CNF1 in
immunoprecipitates was verified by Western blotting with monoclonal
anti-CNF1 antibody, NG8 (bottom panel).
|
|
To validate the results obtained with the yeast two-hybrid system
in vitro, coimmunoprecipitation was performed as described under "Experimental Procedures." When the bacterial lysates
containing CNF1 were mixed with in vitro translated
radiolabeled LRP-(89-295) ([35S]LRP-(89-295)),
LRP-(89-295) was detected in immunoprecipitates with anti-CNF1
monoclonal antibody whereas no LRP-(89-295) was detected in the
absence of CNF1 (Fig. 1b).
Identification of LRP by Ligand Overlay Assays--
In parallel
with the yeast two-hybrid screening, a [35S]CNF1 ligand
overlay assay was performed to identify and confirm the cell surface
receptor for CNF1. Membrane proteins of HBMEC were subjected to
SDS-PAGE, and the overlay assay was performed. In this experiment, a
protein of 37 kDa was identified as an interacting protein with either
[35S]nCNF1 or [35S]fCNF1, but no membrane
protein was detected with [35S]cCNF1 (Fig.
2a). To verify the specific
interactions between CNF1 and the putative receptor, we performed the
overlay assay after preincubation of the membrane with non-radiolabeled
nCNF1, which totally blocked binding of radiolabeled nCNF1 to the
membrane (Fig. 2a). Because LRP was identified as a CNF1
receptor with yeast two-hybrid screening, we speculated that this
37-kDa protein might be LRP. We next recovered the prey vector
containing tagged hemagglutinin (pGADT7:LRP-(89-295)) from the yeast
and introduced it into E. coli. Bacterial lysates containing
HA-tagged LRP-(89-295) were subjected to [35S]nCNF1
ligand overlay assay to verify that CNF1 indeed binds to LRP-(89-295)
in vitro. [35S]nCNF1 bound LRP-(89-295) when
the protein was expressed (Fig. 2b, left panel,
lane 2), whereas bound [35S]nCNF1 was not
detected in the absence of LRP-(89-295) (Fig. 2b,
left panel, lane 1). Western blot using
anti-hemagglutinin monoclonal antibody indicates that the protein
detected with the [35S]CNF1 overlay assay migrates at the
same molecular weight as HA-tagged LRP-(89-295) (Fig. 2b,
right panel). These results taken together indicate that the
extracellular domain of LRP binds to CNF1 and thus is likely to be the
receptor that mediates the CNF1 biologic activity, such as RhoA
activation and enhancement of bacterial uptake.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
In vitro binding assay.
a, in vitro ligand overlay assay with HBMEC
membrane proteins using radiolabeled N-terminal CNF1
([35S]nCNF1, lane 1), full-length CNF1
([35S]fCNF1, lane 2), or C-terminal CNF1
([35S]cCNF1, lane 3). HBMEC membrane proteins
were separated in SDS-PAGE gel and transferred to PVDF membrane. The
membrane was blocked with 5% skim milk and incubated with
[35S]nCNF1, [35S]cCNF1, or
[35S]fCNF1 overnight. In lane 4, the membrane
was preincubated with nonradiolabeled nCNF1 for 1 h before
addition of [35S]nCNF1. After washing, the image was
scanned using PhosphorImager. b, E. coli
(pGADT7:LRP-(89-295)) lysates (lane 1, without induction;
lane 2, with 2 mM
isopropyl-1-thio- -D-galactopyranoside
(IPTG) induction) were separated in SDS-PAGE gel and
subjected to overlay assay as described above using
[35S]nCNF1 as a ligand. Western blot (WB) was
performed with the same lysates, and LRP-(89-295) was detected by
anti-hemagglutinin (HA) monoclonal antibody.
|
|
LRP Inhibits CNF1-induced RhoA Activation--
We and others have
previously shown that CNF1 activates RhoA in HBMEC and other eukaryotic
cells such as HEp-2 cells (8-10). To determine the effect of LRP on
CNF1-induced RhoA activation, HBMEC or HEp-2 cells were treated with
CNF1 with or without GST-LRP, and total lysates were compared for the
activated GTP-bound form of RhoA as described previously (8). The
amount of RhoA-GTP was quantitated from the blot using an imaging
densitometer, and normalized to the values of controls where the cells
were treated with only GST. CNF1, as expected, increased RhoA
activation in HBMEC and HEp-2 cells by 60 and 91%, respectively (Fig.
3). However, when CNF1 was added in the
presence of GST-LRP, the levels of RhoA activation decreased by 44 and
50%, respectively, in HBMEC and HEp-2 cells when compared with
CNF1-treated HBMEC or HEp-2 cells in the presence of GST. GST alone did
not have any inhibitory effect on CNF1-induced RhoA activation (Fig.
3). These results suggest that exogenous LRP competes with endogenous
LRP for CNF1 binding, and acts as an inhibitor of RhoA activation by
CNF1 in both HBMEC and HEp-2 cells.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibitory effects of exogenous LRP on
CNF1-mediated RhoA activation. HBMEC or HEp-2 cells were incubated
with the proteins (lane 1, GST, lane 2, GST LRP;
lane 3, CNF1; lane 4, CNF1 mixed with GST LRP;
lane 5, CNF1 mixed with GST) for 30 min at 37 °C. Cells
were lysed with lysis buffer as described under "Experimental
Procedures," and the cytosolic fractions were collected after
centrifugation at 4 °C for 5 min. The cytosol fractions containing
equal amounts of total proteins were incubated with GST-rhotekin beads
for 60 min at 4 °C. After washing, the GTP-bound form of RhoA was
separated by SDS-PAGE and detected by Western blotting with a RhoA
specific antibody. Before performing rhotekin incubation, an aliquot of
each sample was analyzed by Western blotting using anti-RhoA monoclonal
antibody, showing equal amounts of proteins in all samples (total
RhoA). The blots shown are representative of three independent
experiments. The densities of RhoA-GTP bands were quantitated using an
imaging densitometer, and the levels of RhoA activation were calculated
by comparing the densities of RhoA-GTP bands with those of total RhoA
in each lane. The values were then normalized to those of control,
where only GST was treated to the cells, and expressed as -fold
increases.
|
|
LRP Decreases CNF1-enhanced Bacterial Invasion--
We have
previously shown that CNF1 increases E. coli K1 invasion of
HBMEC (8). We next examined whether exogenous LRP inhibited CNF1-induced enhancement of bacterial uptake. CNF1-treated cells showed
an approximately 400% increase in E. coli E44 invasion compared with non-treated cells (Fig. 4).
Consistent with the results obtained from RhoA-GTP assays where GST-LRP
decreased CNF1-mediated RhoA activation in response to CNF1, the
enhancement of E. coli uptake into HBMEC was significantly
(p < 0.05) decreased when CNF1 was co-incubated with
GST-LRP compared with CNF1 alone or with GST incubation (Fig. 4). These
results suggest that GST-LRP effectively inhibits E. coli
invasion by sequestering CNF1.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibitory effects of exogenous LRP in
E. coli invasion into HBMEC. HBMEC monolayers
were incubated with a mixture of 3 µg/ml CNF1 and 30 µg/ml GST-LRP
or GST in experimental medium for 2 h before addition of bacteria
and invasion assays were carried out as described under "Experimental
Procedures" (*, p < 0.05 compared with CNF1 or CNF1 + GST, calculated using two-tail paired t test). Experiments
were performed in triplicate. Error bars represent standard
deviation.
|
|
Binding and Effects of CNF1 in LRP-overexpressing HBMEC--
To
confirm the binding of CNF1 to LRP in HBMEC, HBMECs were stably
transfected with pcDNA3.1:LRP and the binding of GST-CNF1 to HBMEC
was analyzed by enzyme-linked immunosorbent assay. The binding of CNF1
to HBMEC was dose-dependent, but was markedly greater when
LRP was overexpressed, compared with control vector-transfected cells
(Fig. 5a). These results
suggest a specific interaction between CNF1 and HBMEC via LRP, thus
supporting the concept that LRP is the receptor for CNF1. In addition,
CNF1-mediated bacterial uptake was significantly (p < 0.05) greater in LRP overexpressing cells (Fig. 5b). Also,
CNF1-mediated RhoA activation was markedly greater in
LRP-overexpressing HBMEC (Fig. 5c). Quantification of the
RhoA-GTP amount with densitometry showed 42% higher activation of RhoA
by CNF1 in LRP overexpressing cells than in the control cells (Fig.
5c). These results support our finding that LRP acts as the
CNF1 receptor, thus mediating CNF1-mediated bacterial uptake and RhoA
activation in HBMEC.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of CNF1 on bacterial uptake and RhoA
activation in LRP-overexpressing HBMEC. a, binding of
GST-CNF1 to pcDNA3.1:LRP-transfected HBMEC. HBMEC stably transfected with
pcDNA3.1:LRP ( ) or empty plasmid pcDNA3.1 ( ) were
incubated with different concentrations of GST-CNF1. Absorbance was
normalized by subtracting the background value where no CNF1 was added.
b, invasion assays with E. coli K1 strain E44 in
pcDNA3.1:LRP- transfected HBMEC ( ). As control,
invasion assays in pcDNA3.1- transfected cells ( ) were
included (*, p < 0.05, calculated using two-tail
paired t test). c, CNF1-induced RhoA activation
in pcDNA3.1:LRP- transfected HBMEC. pcDNA3.1 or
pcDNA3.1:LRP-transfected HBMECs were treated with 3 µg/ml
GST-CNF1 for 30 min and RhoA assays were performed as described above.
For control, an equivalent level of GST alone was added to transfected
HBMEC. The densities of RhoA-GTP bands were quantitated using an
imaging densitometer, and normalized to the values of controls, where
only GST was treated to the cells, to calculate -fold increases.
|
|
LRP-Antisense ODN Treatment Decreased CNF1 Effects on RhoA
Activation and Bacterial Uptake--
To confirm correlation between
CNF1 effects and level of LRP expression, HBMEC were treated with LRP
antisense ODNs before RhoA-GTP or invasion assays. Treatment of HBMEC
with LRP antisense ODNs decreased LRP expression by 62% compared with
the sense ODN-treated HBMEC (Fig.
6a). CNF1 effects on RhoA
activation were decreased when the expression of LRP was reduced by
antisense ODN treatment, whereas sense ODN treatment did not show
noticeable changes in CNF1 effects, when compared with wild type HBMEC
(Fig. 6b). For example, RhoA activation by CNF1 in HBMEC was
74% decreased with LRP antisense ODNs compared with non-treated cells,
whereas the effect of LRP sense ODNs was negligible (Fig.
6b). CNF1-mediated bacterial uptake was also significantly
(p < 0.01) decreased in LRP antisense ODN-treated
HBMEC compared with sense ODN-treated HBMEC (Fig. 6b). These
results taken together indicate that LRP acts as the CNF1 receptor,
thus mediating CNF1-mediated bacterial uptake and RhoA activation.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of CNF1 on bacterial uptake and RhoA
activation in LRP antisense ODN-treated HBMEC. a,
Western blot analysis shows decreased expression of LRP by antisense
ODN. HBMECs were treated with antisense (AS) and sense
(S) ODNs. After 48 h, whole lysates were separated by
SDS-PAGE and transferred to PVDF membrane, and LRP was detected by
polyclonal anti-LRP antibody. The membrane was stripped and reprobed
with monoclonal anti-tubulin antibody for loading control. 48 h
after treatment of HBMEC with ODNs, RhoA assays (b) and
invasion assays (c) were performed as described under
"Experimental Procedures" (*, p < 0.01, calculated
using two-tail paired t test) ( , sense; , antisense
ODN). Quantification of RhoA activation was performed as described
above with densitometry. WT, wild type.
|
|
 |
DISCUSSION |
We have previously shown that CNF1 contributes to E. coli K1 invasion of HBMEC in vitro and traversal of the
blood-brain barrier in the experimental hematogenous meningitis animal
model (8). CNF1 is a protein belonging to the group of dermonecrotizing
toxins, produced by pathogenic E. coli (20, 21). It is
described as AB toxins, such as diphtheria, cholera, and tetanus
toxins, which are comprised of catalytic domain, cell binding domain,
and membrane translocation domain (22). Entry of CNF1 into eukaryotic
cells includes binding to a host receptor and internalization via an endocytic mechanism (16). Endocytosed CNF1 is routed to the degradative
pathway, i.e. fusion with the late endosome compartment and,
its catalytic activity is translocated into the cytosol in an
acid-dependent manner (16). Previous competition
experiments suggested the presence of the receptor for CNF1 and the
specific interaction between CNF1 and the cellular receptor. For
example, the activity of CNF1 was inhibited when the full-length CNF1
was co-incubated with the N-terminal domain of CNF1 while coincubation with the C-terminal domain of CNF1 had no effect on the CNF1 activity (14). However, the identity and characteristics of the receptor have
not been determined. In the present study, we identified 37-kDa LRP as
the CNF1 receptor by the yeast two-hybrid system, co-immunoprecipitation, ligand overlay, and correlating the activity of
CNF1 with the expression levels of LRP.
LRP has been known to be cell surface non-integrin laminin-binding
protein receptors in several cell types, and involved in a variety of
cellular mechanisms such as cell migration, adhesion, angiogenesis, and
metastasis (23-25). According to the previous study, the N-terminal
domain of LRP (amino acids 1-85) is a cytoplasmic domain, and the
C-terminal domain of LRP (amino acids 102-295) is an extracellular
domain, which are separated by a transmembrane domain (amino acids
86-101) (19). Because the cDNA clone identified in this study
matches the extracellular domain of LRP containing the transmembrane
domain (amino acids 89-295), it is likely that LRP is a receptor for
CNF1. In vivo interaction between the N-terminal binding
domain of CNF1 and extracellular domain of LRP was verified by
cotransformation experiments where yeasts expressing LRP-(89-295) could grow on selection medium only when they are co-expressing fCNF1
or nCNF1, but not cCNF1. This finding is consistent with the previous
demonstration that the receptor binding domain is located at the N
terminus of CNF1 (14). Co-immunoprecipitation experiments showed
specific interaction between LRP-(89-295) and CNF1 in
vitro, and the ligand overlay assay indicated that the CNF1
binding to LRP (or host cell) is mediated by direct interaction between CNF1 containing N-terminal domain and the
extracellular domain of LRP. For example, LRP-(89-295) bound to fCNF1
and nCNF1, but not to cCNF1. The interaction between LRP-(89-295) and
[35S]nCNF1 was abolished by preincubation with
non-labeled nCNF1, proving the specific interaction between nCNF1 and
LRP-(89-295). Indeed, exogenous recombinant LRP could inhibit CNF1
activities such as RhoA activation and enhancement of bacterial uptake
in HBMEC, by competing with cellular LRP in binding to CNF1. The inhibitory effect of LRP on CNF1 activation of RhoA also occurs in
HEp-2 cells, where CNF1 has been shown to induce cytoskeletal rearrangements and bacterial uptake (12, 13), suggesting that LRP is a
receptor for CNF1 in a variety of eukaryotic cells. Enzyme-linked immunosorbent assay experiments showed higher binding of CNF1 to HBMEC
transfected with pcDNA3.1:LRP than control vector-transfected HBMEC, illustrating the specific interaction between CNF1 and HBMEC via
LRP. The effects of CNF1 on bacterial uptake and RhoA activation were,
as expected, much higher in LRP-overexpressing HBMEC, possibly because
of higher binding of CNF1 to LRP. In contrast, the CNF1 effects were
inhibited when the expression of LRP was decreased by antisense ODNs,
showing correlation between effects of CNF1 and levels of LRP
expression in host cells.
LRP has also been identified as the receptor for the cellular prion
protein (26-28) and certain alphaviruses including Sindbis and
Venezuelan equine encephalitis virus (29, 30). However, this is the
first demonstration that LRP acts as a cellular receptor for bacterial
toxin in activation of RhoA and enhancement of bacterial uptake.
Identification of receptors for bacterial toxins has been a challenge,
and only a limited number of these receptors have been identified to
date (31, 32). The identification of a toxin receptor is essential for
elucidating structure-functional analysis of a toxin as well as
understanding the pathogenesis of toxin-induced diseases. In addition,
LRP has been shown to be associated with the progression of a wide
variety of carcinomas. For example, the interactions between tumor
cells and LRP have been shown to play an important role in tumor
invasion and metastasis (33-36). p53 has been reported to
down-regulate LRP expression levels by repressing an AP-2
cis-acting element localized in the first intron of the LRP
gene in ovarian carcinoma cells (37). Our demonstration of LRP as the
receptor for CNF1 suggests that CNF1 protein or CNF1-expressing
bacteria may interact with mammalian cells exhibiting higher expression
of LRP, and contribute to their transformation to cancer cells.
In summary, LRP was identified as the specific receptor for CNF1 by the
yeast two-hybrid system and in vitro ligand binding assays.
Exogenous LRP competes with endogenous LRP in binding with CNF1, thus
decreasing effects of CNF1, such as RhoA activation and bacterial
uptake. CNF1-mediated RhoA activation and bacterial uptake were
markedly increased when LRP is overexpressed and the effects of CNF1
were decreased when the expression of LRP is reduced by antisense ODN,
indicating that LRP functions as the receptor for CNF1. The
demonstration that the excess amount of recombinant LRP or LRP
antisense ODN could not totally inhibit the effects of CNF1 on RhoA
activation or bacterial uptake, however, suggests that there may be an
alternative pathway for CNF1 entry into eukaryotic cells, and this
issue is currently being investigated in our laboratory.
 |
ACKNOWLEDGEMENTS |
We thank Bethany Toliver and Donna Pearce for
technical support. We thank Dr. Allison O'Brien for supplying
anti-CNF1 monoclonal antibodies.
 |
FOOTNOTES |
*
This work was supported by grants from the National
Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.

To whom correspondence should be addressed: Division of
Pediatric Infectious Diseases, Johns Hopkins University School of Medicine, 600 N. Wolfe St., Park 256, Baltimore, MD 21287. Tel.: 410-614-3917; Fax: 410-614-1491; E-mail: kwangkim@jhmi.edu.
Published, JBC Papers in Press, March 3, 2003, DOI 10.1074/jbc.M301028200
 |
ABBREVIATIONS |
The abbreviations used are:
HBMEC, human
brain microvascular endothelial cells;
LRP, laminin receptor precursor;
ODN, oligonucleotides;
GST, glutathione S-transferase;
PVDF, polyvinylidene difluoride;
fCNF1, full-length CNF1;
cCNF1, C-terminal
fragment CFN1;
nCNF1, N-terminal fragment CNF1.
 |
REFERENCES |
| 1.
|
Huang, S. H.,
Wan, Z. S.,
Chen, Y. H.,
Jong, A. Y.,
and Kim, K. S.
(2001)
J. Infect. Dis.
183,
1071-1078[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Hoffman, J. A.,
Badger, J. L.,
Zhang, Y.,
Huang, S. H.,
and Kim, K. S.
(2000)
Infect. Immun.
68,
5062-5067[Abstract/Free Full Text]
|
| 3.
|
Badger, J. L.,
Wass, C. A.,
and Kim, K. S.
(2000)
Mol. Microbiol.
36,
174-182[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Wang, Y.,
Huang, S. H.,
Wass, C. A.,
Stins, M. F.,
and Kim, K. S.
(1999)
Infect. Immun.
67,
4751-4756[Abstract/Free Full Text]
|
| 5.
|
Huang, S. H.,
Chen, Y. H.,
Fu, Q.,
Stins, M.,
Wang, Y.,
Wass, C.,
and Kim, K. S.
(1999)
Infect. Immun.
67,
2103-2109[Abstract/Free Full Text]
|
| 6.
|
Prasadarao, N. V.,
Wass, C. A.,
Huang, S. H.,
and Kim, K. S.
(1999)
Infect. Immun.
67,
1131-1138[Abstract/Free Full Text]
|
| 7.
|
Prasadarao, N. V.,
Wass, C. A.,
Stins, M. F.,
Shimada, H.,
and Kim, K. S.
(1999)
Infect. Immun.
67,
5775-5783[Abstract/Free Full Text]
|
| 8.
|
Khan, N. A.,
Wang, Y.,
Kim, K. J.,
Chung, J. W.,
Wass, C. A.,
and Kim, K. S.
(2002)
J. Biol. Chem.
277,
15607-15612[Abstract/Free Full Text]
|
| 9.
|
Flatau, G.,
Lemichez, E.,
Gauthier, M.,
Chardin, P.,
Paris, S.,
Fiorentini, C.,
and Boquet, P.
(1997)
Nature
387,
729-733[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Schmidt, G.,
Sehr, P.,
Wilm, M.,
Selzer, J.,
Mann, M.,
and Aktories, K.
(1997)
Nature
387,
725-729[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Lerm, M.,
Selzer, J.,
Hoffmeyer, A.,
Rapp, U. R.,
Aktories, K.,
and Schmidt, G.
(1999)
Infect. Immun.
67,
496-503[Abstract/Free Full Text]
|
| 12.
|
Fiorentini, C.,
Arancia, G.,
Caprioli, A.,
Falbo, V.,
Ruggeri, F. M.,
and Donelli, G.
(1988)
Toxicon
26,
1047-1056[Medline]
[Order article via Infotrieve]
|
| 13.
|
Falzano, L.,
Fiorentini, C.,
Donelli, G.,
Michel, E.,
Kocks, C.,
Cossart, P.,
Cabanie, L.,
Oswald, E.,
and Boquet, P.
(1993)
Mol. Microbiol.
9,
1247-1254[Medline]
[Order article via Infotrieve]
|
| 14.
|
Rittinger, K.,
Walker, P. A.,
Eccleston, J. F.,
Smerdon, S. J.,
and Gamblin, S. J.
(1997)
Nature
389,
758-762[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Lemichez, E.,
Flatau, G.,
Bruzzone, M.,
Boquet, P.,
and Gauthier, M.
(1997)
Mol. Microbiol.
24,
1061-1070[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Contamin, S.,
Galmiche, A.,
Doye, A.,
Flatau, G.,
Benmerah, A.,
and Boquet, P.
(2000)
Mol. Biol. Cell
11,
1775-1787[Abstract/Free Full Text]
|
| 17.
|
Meysick, K. C.,
Mills, M.,
and O'Brien, A. D.
(2001)
Infect. Immun.
69,
2066-2074[Abstract/Free Full Text]
|
| 18.
|
Stins, M. F.,
Gilles, F.,
and Kim, K. S.
(1997)
J. Neuroimmunol.
76,
81-90[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Sorokin, A. V.,
Mikhailov, A. M.,
Kachko, A. V.,
Protopopova, E. V.,
Konovalova, S. N.,
Andrianova, M. E.,
Netesov, S. V.,
Kornev, A. N.,
and Loktev, V. B.
(2000)
Biochemistry (Mosc.)
65,
546-553[Medline]
[Order article via Infotrieve]
|
| 20.
|
Caprioli, A.,
Falbo, V.,
Roda, L. G.,
Ruggeri, F. M.,
and Zona, C.
(1983)
Infect. Immun.
39,
1300-1306[Abstract/Free Full Text]
|
| 21.
|
Blanco, J.,
Blanco, M.,
Alonso, M. P.,
Blanco, J. E.,
Garabal, J. I.,
and Gonzalez, E. A.
(1992)
FEMS Microbiol. Lett.
75,
155-159[Medline]
[Order article via Infotrieve]
|
| 22.
|
Falnes, P. O.,
and Sandvig, K.
(2000)
Curr. Opin. Cell Biol.
12,
407-413[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
McKenna, D. J.,
Simpson, D. A.,
Feeney, S.,
Gardiner, T. A.,
Boyle, C.,
Nelson, J.,
and Stitt, A. W.
(2001)
Exp. Eye Res.
73,
81-92[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Vande Broek, I.,
Vanderkerken, K.,
De Greef, C.,
Asosingh, K.,
Straetmans, N.,
Van Camp, B.,
and Van Riet, I.
(2001)
Br. J. Cancer
85,
1387-1395[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Donaldson, E. A.,
McKenna, D. J.,
McMullen, C. B.,
Scott, W. N.,
Stitt, A. W.,
and Nelson, J.
(2000)
Mol. Cell. Biol. Res. Commun.
3,
53-59[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Hundt, C.,
Peyrin, J. M.,
Haik, S.,
Gauczynski, S.,
Leucht, C.,
Rieger, R.,
Riley, M. L.,
Deslys, J. P.,
Dormont, D.,
Lasmezas, C. I.,
and Weiss, S.
(2001)
EMBO J.
20,
5876-5886[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Gauczynski, S.,
Peyrin, J. M.,
Haik, S.,
Leucht, C.,
Hundt, C.,
Rieger, R.,
Krasemann, S.,
Deslys, J. P.,
Dormont, D.,
Lasmezas, C. I.,
and Weiss, S.
(2001)
EMBO J.
20,
5863-5875[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Rieger, R.,
Edenhofer, F.,
Lasmezas, C. I.,
and Weiss, S.
(1997)
Nat. Med.
3,
1383-1388[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Wang, K. S.,
Kuhn, R. J.,
Strauss, E. G.,
Ou, S.,
and Strauss, J. H.
(1992)
J. Virol.
66,
4992-5001[Abstract/Free Full Text]
|
| 30.
|
Ludwig, G. V.,
Kondig, J. P.,
and Smith, J. F.
(1996)
J. Virol.
70,
5592-5599[Abstract/Free Full Text]
|
| 31.
|
Backstrom, M.,
Shahabi, V.,
Johansson, S.,
Teneberg, S.,
Kjellberg, A.,
Miller-Podraza, H.,
Holmgren, J.,
and Lebens, M.
(1997)
Mol. Microbiol.
24,
489-497[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Naglich, J. G.,
Metherall, J. E.,
Russell, D. W.,
and Eidels, L.
(1992)
Cell
69,
1051-1061[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Pellegrini, R.,
Martignone, S.,
Menard, S.,
and Colnaghi, M. I.
(1994)
Int. J. Cancer Suppl.
8,
116-120[Medline]
[Order article via Infotrieve]
|
| 34.
|
Narumi, K.,
Inoue, A.,
Tanaka, M.,
Isemura, M.,
Shimo-Oka, T.,
Abe, T.,
Nukiwa, T.,
and Satoh, K.
(1999)
Jpn. J. Cancer Res.
90,
425-431[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Menard, S.,
Tagliabue, E.,
and Colnaghi, M. I.
(1998)
Breast Cancer Res. Treat.
52,
137-145[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Clausse, N.,
Jackers, P.,
Jares, P.,
Joris, B.,
Sobel, M. E.,
and Castronovo, V.
(1996)
DNA Cell Biol.
15,
1009-1023[Medline]
[Order article via Infotrieve]
|
| 37.
|
Modugno, M.,
Tagliabue, E.,
Ardini, E.,
Berno, V.,
Galmozzi, E.,
De Bortoli, M.,
Castronovo, V.,
and Menard, S.
(2002)
Oncogene
21,
7478-7487[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. K. Grande, K. C. Meysick, S. B. Rasmussen, and A. D. O'Brien
Cytotoxic Necrotizing Factor Type 1-Neutralizing Monoclonal Antibody NG8 Recognizes Three Amino Acids in a C-Terminal Region of the Toxin and Reduces Toxin Binding to HEp-2 Cells
Infect. Immun.,
January 1, 2009;
77(1):
170 - 179.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Jacobsen, D. J. Stickler, H. L. T. Mobley, and M. E. Shirtliff
Complicated Catheter-Associated Urinary Tract Infections Due to Escherichia coli and Proteus mirabilis
Clin. Microbiol. Rev.,
January 1, 2008;
21(1):
26 - 59.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. McNichol, S. B. Rasmussen, H. M. Carvalho, K. C. Meysick, and A. D. O'Brien
Two Domains of Cytotoxic Necrotizing Factor Type 1 Bind the Cellular Receptor, Laminin Receptor Precursor Protein
Infect. Immun.,
November 1, 2007;
75(11):
5095 - 5104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Blumenthal, C. Hoffmann, K. Aktories, S. Backert, and G. Schmidt
The Cytotoxic Necrotizing Factors from Yersinia pseudotuberculosis and from Escherichia coli Bind to Different Cellular Receptors but Take the Same Route to the Cytosol
Infect. Immun.,
July 1, 2007;
75(7):
3344 - 3353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Davis, H. M. Carvalho, S. B. Rasmussen, and A. D. O'Brien
Cytotoxic Necrotizing Factor Type 1 Delivered by Outer Membrane Vesicles of Uropathogenic Escherichia coli Attenuates Polymorphonuclear Leukocyte Antimicrobial Activity and Chemotaxis.
Infect. Immun.,
August 1, 2006;
74(8):
4401 - 4408.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qiao, F. Huang, R. P. Naikawadi, K. S. Kim, T. Said, and H. Lum
Lysophosphatidylcholine impairs endothelial barrier function through the G protein-coupled receptor GPR4
Am J Physiol Lung Cell Mol Physiol,
July 1, 2006;
291(1):
L91 - L101.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Kim, J. W. Chung, and K. S. Kim
67-kDa Laminin Receptor Promotes Internalization of Cytotoxic Necrotizing Factor 1-expressing Escherichia coli K1 into Human Brain Microvascular Endothelial Cells
J. Biol. Chem.,
January 14, 2005;
280(2):
1360 - 1368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Zeng, D. Wang, Z. Yang, Z. Wang, L. D. Asico, C. S. Wilcox, G. M. Eisner, W. J. Welch, R. A. Felder, and P. A. Jose
Dopamine D1 Receptor Augmentation of D3 Receptor Action in Rat Aortic or Mesenteric Vascular Smooth Muscles
Hypertension,
March 1, 2004;
43(3):
673 - 679.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. E. Cochran, C. A. Evans, D. Blinco, J. Burthem, F. K. Stevenson, S. J. Gaskell, and A. D. Whetton
Proteomic Analysis of Chronic Lymphocytic Leukemia Subtypes with Mutated or Unmutated Ig VH Genes
Mol. Cell. Proteomics,
December 1, 2003;
2(12):
1331 - 1341.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|