JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M212590200 on February 25, 2003

J. Biol. Chem., Vol. 278, Issue 19, 17121-17129, May 9, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/17121    most recent
M212590200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, Z. L.
Right arrow Articles by Rosenberg, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, Z. L.
Right arrow Articles by Rosenberg, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Involvement of Heparan Sulfate (HS) in FGF1/HS/FGFR1 Signaling Complex*

Zhengliang L. WuDagger , Lijuan ZhangDagger §, Tomio Yabe||**, B. KuberanDagger , David L. BeelerDagger , Andre LoveDagger §, and Robert D. RosenbergDagger §DaggerDagger

From the Departments of Dagger  Biology and || Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 and the § Department of Medicine, Harvard Medical School, Boston, Massachusetts 02215

Received for publication, December 10, 2002, and in revised form, February 25, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Fibroblast growth factor (FGF) signaling begins with the formation of a ternary complex of FGF, FGF receptor (FGFR), and heparan sulfate (HS). Multiple models have been proposed for the ternary complex. However, major discrepancies exist among those models, and none of these models have evaluated the functional importance of the interacting regions on the HS chains. To resolve the discrepancies, we measured the size and molar ratio of HS in the complex and showed that both FGF1 and FGFR1 simultaneously interact with HS; therefore, a model of 2:2:2 FGF1·HS·FGFR1 was shown to fit the data. Using genetic and biochemical methods, we generated HSs that were defective in FGF1 and/or FGFR1 binding but could form the signaling ternary complex. Both genetically and chemically modified HSs were subsequently assessed in a BaF3 cell mitogenic activity assay. The ability of HS to support the ternary complex formation was found to be required for FGF1-stimulated cell proliferation. Our data also proved that specific critical groups and sites on HS support complex formation. Furthermore, the molar ratio of HS, FGF1, and FGFR1 in the ternary complex was found to be independent of the size of HS, which indicates that the selected model can take place on the cell surface proteoglycans. Finally, a mechanism for the FGF·FGFR signaling complex formation on cell membrane was proposed, where FGF and FGFR have their own binding sites on HS and a distinct ternary complex formation site is directly responsible for mitogenic activity.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Heparan sulfate (HS)1 is a linear and highly sulfated polysaccharide, consisting of 50-150 basic disaccharide repeats of uronic acid and D-glucosamine units (1). Sulfation can occur at 2-O of the uronic acid and 3-O, 6-O, and N of the D-glucosamine and is catalyzed by a variety of sulfotransferases. Each modification is incomplete, which leads to sequence variation on HS, and it is very likely that critical sulfate groups determine the specificity of HS-protein interactions (2). Along the HS chain, the majority of sulfated residues are clustered in short functional domains separated by relatively less sulfated oligosaccharide sequences (3). Heparin resembles these functional domains and is widely used for the functional study of HS. One major function of HS is to interact with fibroblast growth factors (FGFs) and their receptors (FGFRs) and form FGF·HS·FGFR signaling complexes (4-7). Defects in HS can cause complete losses of FGF, Hedgehog, and Wingless signaling pathways and lead to severe abnormality in embryonic development (8, 9). The involvement of HS in the FGF molecular signaling complex suggests that FGF activity and specificity may be modulated by HS and in turn by enzymes that synthesize and degrade HS.

FGFs and FGFRs play critical roles in the control of many fundamental cellular processes, such as cell proliferation, differentiation, and migration (10-13). There are 23 known FGFs and five types of FGFRs in humans (14). FGF1 and FGF2 were the first to be isolated and were called acidic and basic FGF, respectively. Studies performed primarily on FGF2 have identified a stretch of basic residues in the polypeptide chain as participating in the heparin-binding site (15). FGFRs belong to a group of receptor tyrosine kinases and are activated through FGFs and HS induced dimerization (10). The unspliced form of FGFR contains an intracellular tyrosine kinase domain, a trans-membrane region, an extracellular region containing three Ig domains, a string of acidic residues between the first and second Ig domains (16), and an HS binding site in the second Ig domain (17). The Ig domain I has been shown to be dispensable, and receptor variants containing only the Ig domain II and III (beta  form) have been found to exhibit an equivalent degree of binding to FGFs as the variants containing all three domains (alpha  form). Ig domain III can undergo differential splicing and thereby exhibits IIIb and IIIc forms (16). All receptors show redundant specificity for ligand binding (i.e. one receptor may bind to several FGFs, and one FGF may bind to more than one receptor) (12). FGF1 interacts with almost all FGFRs, and FGFR1 is a common receptor for many ligands; thus, we have chosen FGF1 and FGFR1 to carry out our studies.

Although the importance of HS in FGF signaling is well documented, the exact roles of HS in the signaling complex are less well characterized. One key issue concerns the minimum size of HS in the signaling complex. This size of HS reflects the spatial arrangement of FGF and FGFR in the complex; thus, this parameter is critical for modeling the FGFR signaling complex. Basically, there are three modes of interaction between multiple proteins and a single chain of HS (Fig. 1), designated as the cis, trans, and mix mode. Mix mode contains both cis and trans modes. Different modes of interaction require HS with different lengths to participate. So far, various models with different modes of HS-protein interactions and thus different HS length requirements have been proposed. For example, hexasaccharide (dp6) was found to be able to link two FGF1 in a trans mode (18) (Fig. 1B, IV); dodecasaccharide (dp12) was thought to be the minimum length for linking one FGF2 and one FGFR1 in a cis mode (19) (Fig. 1A, I); and hexadecasaccharide (dp16) was proposed to be able to fully span a heparin binding site created by a 2:2 FGF1·FGFR2 complex in a mix mode (Fig. 1C, VI) (20). On the other hand, the shortest biologically active heparin oligosaccharide has been reported to be an octasaccharide (dp8) (21), hexasaccharide (dp6) (22, 23), trisaccharide, or even disaccharide (dp2) (24, 25). These contradictory findings prompted us to design a more accurate method to determine the size of HS in FGFR signaling complex.

A second key issue that remains controversial concerns the stoichiometry of HS in the FGF·FGFR signaling complex. Intracellular signaling is believed to be initiated from receptor dimerization and trans-phosphorylation (10, 26), but models with different stoichiometry for HS and FGF have been proposed (Fig. 1). For example, a single HS chain binds one FGF and two FGFRs (27) (Fig. 1A, III); a single HS chain binds two FGFs, which in turn bind two FGFRs (18) (Fig. 1B, IV); and one each of FGF, HS, and FGFR first form an FGF·HS·FGFR half-complex, two of which then dimerize (28) (Fig. 1C, VII). Because the size of HS can be up to 150 disaccharide repeats, and only shorter oligosaccharides no more than 7 disaccharide repeats (dp14) were used for modeling study in most cases, one unresolved question is whether the models established with shorter oligosaccharides can be extended to the cell surface HS proteoglycans.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1.   Various models of FGFR signaling complexes with three modes of protein/HS interaction. A, three models with cis mode of interaction. Yellow balls, FGFs; blue bars, FGFRs; red rods, HS. B, two models with the trans mode of interaction. C, three models with the mix mode of interaction. In model VII, two chains of HS are incorporated.

HSs from different tissues or developmental stages have different fine structures (29, 30) and can activate or inhibit FGF signaling pathways (31-33). It is believed that this phenomenon is caused by replacing of critical functional groups during the synthesis of the HSs (2, 32, 34). The critical functional groups on HS interacting with FGFs (19, 23, 35) or FGFRs (24, 36, 37) have been investigated previously. For example, 2-O sulfation at an iduronic acid was found critical for FGF2 binding (38), and 6-O-sulfation was found to be important for FGFR1 binding (37, 39). However, less information about the relationship between critical groups on HS mediating FGF·HS·FGFR ternary complex formation to the groups required for FGF or FGFR binding has been available.

With in vitro modification of HS and a gel mobility shift assay (40), we have measured the minimum HS size and the molar ratio among FGF1, HS, and FGFR1 as a function of HS size and showed that both FGF1 and FGFR1 interact with HS in the complex. Based upon these results, we suggest that a 2:2:2 FGF1·HS·FGFR1 model best fits the data. In addition, utilizing a cell genetic study, we have found that there are different critical groups at different sites on HS involved in the ternary complex formation and FGF and FGFR binding interactions. We also find that the ability of HS to form a ternary complex with FGF1 and FGFR1 is a prerequisite for FGF1-stimulated mitogenic activity. Based on these data, we propose a mechanism showing how the FGF1·FGFR1 signaling complex is formed on HS cell surface proteoglycan.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents-- Heparin oligosaccharides (dp4 to dp24) were purchased from Iduron (Manchester, UK). Completely desulfated and N-sulfated heparin sulfate (DSNS) and completely desulfated and N-acetylated heparin (DSNAc) were from Seikagaku America (Falmouth, MA). FGF1 and FGFR1b (IIIc)/Fc were from R&D Systems (Minneapolis, MN). 3'-Phosphoadenosine 5'-phosphosulfate was from Calbiochem. 3-O-sulfotransferase (3-OST-1) and 6-OST-1 were prepared as previously described (40). The CHOpgsA-745 cell line and 6-O-desulfated heparin (6ODS) were kind gifts from Dr. Jeffrey D. Esko (University of California, San Diego). Preparation of 35S-labeled 3'-phosphoadenosine 5'-phosphosulfate, radiolabeling of HS, autoradiograph, and gel analysis were the same as previously described (40). Anti-FGF1 antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, California). The CHO-K1 cell line was from ATCC (Manassas, VA). 2-OST-deficient cell CHOpgsF-17 was prepared as described (41). Fetal bovine serum was from Invitrogen. Protein A, Alexa Fluor® 647 conjugate was from Molecular Probes, Inc. (Eugene, OR).

Heparin Digestion and Disaccharide Analysis-- The heparin sample (20 mg) was digested with a mixture of heparinase and heparantinase I and II (Seikagaku Corp., Tokyo, Japan) at 37 °C for 2 h in 50 ml of buffer of 2 mM Ca(Ac)2, 20 mM sodium acetate, pH 7.0. The digestion products were separated with a C18-reversed phase column (IPRP-HPLC) (Vydac, Lake Forest, CA). The sample was eluted with 2.5, 6, 10.5, 18, and 50% acetonitrile in 40 mM NH4H2PO4 and 1 mM tetrabutylammonium dihydrophosphate (Sigma) for 15, 15, 45, 25, and 20 min, respectively, and was monitored with light absorbance at 232 nm (41).

Expression of FGFR1-- The extracellular domain of FGFR1, including Ig domain II and IIIc (from residue 142 to 365) (42, 43) was PCR-cloned from a Human Placenta Quik-clone TM cDNA library (Clontech, Palo Alto, California). The PCR forward primer was GATAACACCAAACCAAACCG, and the backward primer was CCTCTCTTCCAGGGCTTCCA. The PCR product was expressed in a pBAD/TOPO ThioFusion TM Expression System (Invitrogen). The expressed protein was a fusion protein with thioredoxin at the C-terminal and was refolded in 150 mM NaCl, 10 mM Tris, pH 8.0, 10% glycerol, 1 mM L-cysteine.

Binding Reaction and Gel Mobility Shift Assay-- For a typical 20-µl binding reaction, 1 µl of FGF1, 1 µl of FGFR1, and 0.1 µl of HS or heparin were added into an appropriate volume of binding buffer. The concentrations of FGF1, FGFR1, and HS were adjusted as needed before the reaction. The reaction was incubated at 23 °C for 20 min. The binding buffer contained 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 10 mM of MgCl2, and 1.4 mM KH2PO4 and 12% glycerol. Half of the reaction was loaded onto a native 4.5% polyacrylamide gel. The gel was run at 6 V/cm for 70 min. After the run, the gel was dried under vacuum and exposed to a phosphor imager plate.

Cell Culture and Mitogenic Assays-- Suspension cultures of FGFR1a (IIIc)-expressing BaF3 cells (a generous gift from professor D. M. Ornitz) were maintained in AIM V medium (Invitrogen), supplemented with 5 nM recombinant mouse interleukin-3 (R&D Systems). For mitogenic assays, 50 µl of AIM V medium (serum-free) containing HSs and FGF-1 at final concentrations of 1 µg/ml and 5 nM, respectively, were plated into a 96-well assay plate. Cells were washed and resuspended in AIM V medium (serum-free), and 2,500 cells were added to each well for a total volume of 100 µl. The cells were then incubated at 37 °C with 5% CO2 for 24 h; afterward, 100 µl of Syto-11 dye (Molecular Probes), which was prepared in 10 mM Tris, 1 mM EDTA, 50 mM NaCl, pH 8.0, was added to each well and incubated for 30 min at 37 °C. The sample was excited at 508 nm, and the fluorescence emission at 527 nm was then measured using the SpectraMax Gemini XS (Molecular Devices, Inc., Sunnyvale, CA). The data were analyzed with Softmax software, and each data point presented was the average of a triplicate determination.

Flow Cytometry Analysis-- Nearly confluent monolayers of cells in a T-75 flask were detached by adding 10 ml of phosphate-buffered saline containing 10% fetal bovine serum and 2 mM EDTA and centrifuged. The cell pellets were placed on ice. About 1 × 106 cells were first mixed with 20 µl of phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 10 mM MgCl2, and 1.4 mM KH2PO4) and 1 µg of FGFR1beta (IIIc)/Fc, and then 4 µg of protein A-Alexa Fluor® 647 conjugate was added. Protein A binds to the Fc region of FGFR1beta (IIIc)/Fc. In a separate experiment, 0.5 µg of FGF1 was also added at this point. After 15 min of incubation, the cells were washed once with 10 ml of phosphate-buffered saline and resuspended in 300 ml of phosphate-buffered saline containing 10% fetal bovine serum. Flow cytometry was performed with FACScan and FACStar instruments (Becton Dickinson).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Observation of the Ternary Complex of FGF1, HS, and FGFR1-- Previously, we applied gel mobility shift assay to study antithrombin III/HS interaction (40). The same method was applied to study FGF/HS/FGFR interactions. A ladder of defined lengths of oligosaccharides from dp2 to dp24 was first radiolabeled with 6-OST-1 sulfotransferases (40) and examined on a 15% PAGE gel (Fig. 2A). The labeled ladder was then applied to gel mobility shift assays with FGF1 or FGFR1 (Fig. 2B). FGF1 could bind to tetrasaccharide (dp4) and longer chains, whereas FGFR1 only showed significant binding to octasaccharide (dp8) and longer chains. The mobility of the binary complex FGF1·HS was greater than that of FGFR1·HS. When equivalents of FGF1 and FGFR1 were mixed with excess dp18 and applied to the assay, a distinct band, with mobility greater than FGFR1·HS but less than FGF1·HS, was observed (Fig. 3A), suggesting the formation of a ternary complex among FGF1, FGFR1, and HS. This ternary complex could be observed when the concentrations of FGF1 and FGFR1 were as low as 128 nM, although either no or less binary complexes of HS·FGFR1 and FGF1·HS could be observed at this concentration, suggesting the cooperative binding among HS, FGF, and FGFR. Cooperative binding is a characteristic of FGF·HS·FGFR ternary complex formation (44, 45).


View larger version (110K):
[in this window]
[in a new window]
 
Fig. 2.   Oligosaccharide labeling and binding assay with FGF1 and FGFR1. A, an oligosaccharide ladder from dp2 to dp24 was radiolabeled with 6-OST-1 and separated with a 15% PAGE gel. The dp2 was prepared from digestion of a 6-OST-1-labeled heparin. The size of each oligosaccharide is indicated. B, measuring the minimum FGF1 and FGFR1 binding HS. The oligosaccharide ladder was used to do the binding assay with FGF1 or FGFR1. Each lane contained roughly 25 ng of oligosaccharide and 31 pmol (50 ng) of FGF1 or 24 pmol (100 ng) of FGFR1. F1, FGF1; R1, FGFR1.


View larger version (65K):
[in this window]
[in a new window]
 
Fig. 3.   Observation of FGF1·HS·FGFR1 ternary complex. A, complex formation and its concentration dependence. Excess dp18 was used for the reactions, and the concentrations of FGF1 and FGFR1 in the binding reactions are indicated. F1:HS, binary complex of FGF1 and HS; HS:R1, binary complex of HS and FGFR1; F1:HS:R1, ternary complex of FGF1, HS, and FGFR1. B, thermal stability of the binary and ternary complexes. Around 0.8 mM each of FGF1, FGFR1, and dp18 were used in all of the binding reactions. The heating temperature and the duration (min) for each reaction are indicated. C, ternary complex formation on CHO cells assayed with flow cytometry. The cells were sequentially sorted without any protein, with FGFR1beta (IIIc)/Fc, and with both FGF1 and FGFR1beta (IIIc)/Fc. Left panel, HS-deficient CHOpgsA-745 cell. Middle panel, HS-expressing CHO-K1 cell. Right panel, a CHO cell expressing 2-O-sulfation negative HS. The fluorescence-tagged FGFR1beta (IIIc)/Fc was monitored. F1, FGF1; R1/Fc, FGFR1b (IIIc)/Fc.

To further confirm that the above ternary complex did form at the native state of the proteins, binding samples were heated before loading onto a gel (Fig. 3B). After the sample was heated at 47 °C, the binary complex of HS·FGFR1 significantly decreased, whereas the binary complex of FGF1·HS was stable. Heating at 60 °C caused the disappearance of both of the binary complexes but not the ternary complex. Heating at 100 °C caused the disappearance of all of the complexes. This experiment suggests that the native state of the proteins is required for the ternary complex formation, and the order of the thermal stability of the complexes is FGF1·HS·FGFR1 > FGF1·HS > HS·FGFR1.

To determine whether the observed ternary complex can form on cells with membrane HS proteoglycan under similar binding conditions, we carried out flow cytometry assays with CHO cells and FGFR1beta (IIIc)/Fc in the presence or absence of FGF1. FGFR1beta (IIIc)/Fc contained the same functional domains as the FGFR1 used in the gel shift assays, except for the inclusion of an Fc region of IgG. The binding of FGFR1beta (IIIc)/Fc to CHO cells was monitored (Fig. 3C). The HS-deficient CHOpgsA-745 cell showed no binding, even in the presence of FGF1. On the other hand, HS-expressing wild type CHO-K1 cells had weak binding, but this binding was greatly enhanced when FGF1 was added. These experiments suggest that FGFR1beta (IIIc)/Fc can bind to the HS proteoglycan on the cell membrane and form a much tighter ternary complex together with FGF1. Interestingly, a 2-OST-deficient cell CHOpgsF-17 did not bind to FGFR1beta (IIIc)/Fc alone but also showed a much stronger binding in the presence of FGF1, suggesting the formation of the ternary complex in the absence of 2-O-sulfation (Fig. 3C).

The Minimum Oligosaccharide Supporting the Ternary Complex Formation-- To determine the minimum oligosaccharide that can initiate the ternary complex with FGF1 and FGFR1, the labeled ladder (Fig. 2A) was applied to a gel shift assay with both FGF1 and FGFR1 (Fig. 4A). The ternary complex could be observed with tetrasaccharide and larger oligosaccharides but not with disaccharide.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4.   Minimal HS in the ternary complex of FGF1·HS·FGFR1. A, binding assay with the oligosaccharide ladder in the presence of FGF1 and/or FGFR1. Each lane contained 100 ng of oligosaccharide and 16 pmol each of FGF1 and/or FGFR1. FGF1·HS·FGFR1 is visible from dp4 to dp16. B, Western blot of another gel with anti-FGF1. To see FGF1·HS, limited FGFR1 was applied to each binding reaction. Lanes 1 and 2 contained no HS.

To confirm the above observation, another gel was visualized with anti-FGF1 antibody (Fig. 4B). FGF1 had a low mobility in a native gel electrophoresis. The binding of HS to FGF1 added negative charges to FGF1, and the resulting FGF1·HS complex moved faster than the free FGF. The further addition of FGFR1 slowed FGF1·HS complex because of the formation of the ternary complex. The ternary complexes were observed with tetrasaccharide and longer oligosaccharides but not with disaccharide. This experiment confirmed that tetrasaccharide was the minimum HS required for the formation of a ternary complex of FGF1, HS, and FGFR1.

The Molar Ratio of HS in the Ternary Complex-- First, we determined the ratio of FGF1 and FGFR1 in the ternary complex. In this experiment, a fixed amount of FGF1 but increasing amounts of FGFR1 were added to a series of binding reactions (Fig. 5A). The bands of the ternary complexes were subjected to densitometry analysis (Fig. 5B), and the band density was plotted against the molar equivalents of FGFR1 to FGF1 (Fig. 5C). The slope of the curve declined sharply when FGFR1 was equivalent to FGF1, suggesting that FGF1 and FGFR1 have a 1:1 ratio in the ternary complex. The continuing increase in band intensity above equivalence might be caused by a shift of equilibrium, since excess FGFR1 (the reactant) generated more product (the ternary complex) formation and caused the disappearance of the FGF1·HS. At the level of 4 eq of FGFR1, there was almost no FGF1·HS observed.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5.   Molar ratio between FGF1 and FGFR1 in the ternary complex. A, gel shift assay with excess HS (dp12). Lanes 2-9, constant concentrations of FGF1 (0.8 mM) but increasing concentrations of FGFR1 were applied. The molar concentration ratios (R1/F1) are indicated at the top. No protein was in lane 1, and only FGFR1 (3.2 mM) was added in lane 10. B, densitometry analysis of A. C, the band intensity of the ternary complex was plotted against the molar equivalents of FGFR1 to FGF1.

We further measured the molar ratio of HS in the ternary complex. In a series of binding reactions with the oligosaccharide ladder (Fig. 1A), each reaction contained 250 ng of oligosaccharide (from dp4 to dp24), 16 pmol of FGF1, and 64 pmol of FGFR1. The 4:1 molar concentration ratio of FGFR1 to FGF1 overwhelmingly favored the formation of FGF1·HS·FGFR1, so that almost all the FGF1 was incorporated into the ternary complex (Fig. 5A). After electrophoresis, the amount of the oligosaccharide present in the ternary complex in each reaction was calculated by densitometry analysis, and the molar ratio between the oligosaccharide and FGF1 in the ternary complexes was then determined (see Table II). It was surprising to find that, independent of the size of HS, the ratio was consistently near 1:1. Considering the 1:1 ratio between FGF1 and FGFR1, this result suggests that the ternary complex has a molar ratio of 1:1:1 among FGF1, HS, and FGFR1.

Critical Sulfate Groups on HS for the Ternary Complex Formation-- We used DSNAc, DSNS, and 6ODS heparin as starting materials to investigate the role of critical groups (Fig. 6A). When DSNAc was modified with 6-OST-1 or with 6-OST-1 plus 3-OST-1, it could not bind to either FGF1 or FGFR1 and failed to form the ternary complex with FGF1 and FGFR1. When DSNS was modified with 6-OST-1 or 3-OST-1, it still could not bind to either FGF1 or FGFR1 individually but could initiate the ternary complex formation. When 6ODS was modified with 3-OST-1, it could not bind to FGFR1 but could bind to FGF1 and initiate the ternary complex formation. These experiments suggest that N-sulfation and perhaps, to a lesser extent, O-sulfation are critical for the ternary complex formation. On the contrary, 6-O-sulfation, which is critical for FGFR1 binding, is not critical for the ternary complex formation.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of critical sulfate groups on the formation of the ternary complex. A, 3-OST-1- and/or 6-OST-1-modified heparin oligosaccharides and chemically modified heparin were shifted with FGF1 and/or FGFR1. /31, modified with 3-OST-1; /61, modified with 6-OST-1; /31,61, modified with 3-OST-1 and 6-OST-1; F1, FGF1; R1, FGFR1. B, disaccharide analysis of the heparin and chemically modified heparins. a, heparin; b, DSNAc; c, DSNS; d, 6ODS.

The chemical compositions of these modified heparins were further validated through disaccharide analysis (Fig. 6B). The major disaccharides found in DSNAc and DSNS were Delta UA-(1-4)GlcNAc and Delta UA-(1-4)GlcNS, respectively. Only very small amounts of Delta UA2S-(1-4)GlcNS and Delta UA-(1-4)GlcNS6S were observed in DSNS, which might arise from nonspecific sulfation during the chemical N-sulfation step. The major disaccharide found in 6ODS was Delta UA2S-(1-4)GlcNS, as a result of the 6-O desulfation of the trisulfated disaccharide, Delta UA2S-(1-4)GlcNS6S. Because of the presence of a small amount of Delta UA2S-(1-4)GlcNS in DSNS and Delta UA-(1-4)GlcNS6S in 6ODS, it is hard to reach a definitive conclusion about the importance of 2-O- and 6-O-sulfation in the ternary complex formation; nevertheless, since 2-O- and 6-O-sulfation in DSNS and 6ODS, respectively, was significantly lower than that in the wild type heparin, 2-O- and 6-O-sulfation may not be as important in the ternary complex formation as in the binary complex formation. Interestingly, because the trisulfated disaccharide, Delta UA2S-(1-4)GlcNS6S, was not found in DSNS and 6ODS, yet DSNS/31 and 6ODS/31 could support the ternary complex formation, it is concluded that the trisulfated disaccharide is not required for the ternary complex formation.

The Ability of HS to Form a Ternary Complex with FGF1 and FGFR1 but Not Binary Complexes Is Associated with Cell Mitogenic Activity-- Ternary complex formation was observed with various modified heparins and heparin oligosaccharides, but it is more important to know whether the formed ternary complexes are responsible for mitogenic activity. The oligosaccharides and modified heparins were further tested for their mitogenic activities in an FGFR1alpha (IIIc)-expressing BaF3 cell system (21) stimulated with FGF1 (see Table III). FGFR1alpha (IIIc) contains all three Ig-like extracellular domains, and it showed the same binding characteristics with FGFR1beta (IIIc) (16). In the assay, disaccharide had background mitogenic activity; tetramer, hexamer, and octamer oligosaccharides had medium mitogenic activities; and decasaccharide and larger oligosaccharides had mitogenic activities comparable with that of heparin. Except for disaccharide, all other oligosaccharides showed the ability to support the ternary complex formation (Fig. 4). The 6-O- and 3-O-sulfated DSNAc, which did not support the ternary complex formation (Fig. 6A), had almost no activity. On the other hand, 6-O- or 3-O-sulfated DSNS and 3-O-sulfated 6ODS, which did not support the binary complex with either FGF1 or FGFR1 but supported ternary complex formation (Fig. 6A), showed significant activities. These data suggest that the abilities of these oligosaccharides and modified heparins to initiate FGF1·HS·FGFR1 ternary complex but not FGF1·HS and FGFR1·HS complexes correlate with mitogenic activities.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Since Yayon et al. (4) first demonstrated the importance of heparan sulfate proteoglycan for high affinity FGF2·FGFR1 binding, a large amount of data has been produced, indicating that HS is essential for FGF signaling (3, 5, 46). Later, HS was proved to be an essential component of the FGF·FGFR signaling complex (3, 10, 42), but the roles that HS plays in the signaling complex formation are still obscure. We have provided a novel strategy to study the physical parameters of HS as well as the signaling complex as a whole. This new strategy enabled us to measure the size, molar ratio, and molecular interactions of HS in the ternary complex. It allowed us to study critical groups on HS involved in the ternary complex formation and FGFR activation. It also allowed us to correlate the ability of HS to initiate a ternary complex and the mitogenic activity.

Requirements on Ternary Complex Formation Select a 2:2:2 Model-- Based on our data, we have identified three molecular parameters for choosing models of the FGF1·FGFR1 signaling complex. First, the minimum HS in the ternary complex is a tetrasaccharide. Second, the molar ratio among HS, FGF1, and FGFR1 in the ternary complex is 1:1:1. Third, HS interacts with both FGF1 and FGFR1 in the ternary complex. These requirements along with the requirement of receptor dimerization (10, 26) are used to evaluate the potential models in Fig. 1 (Table I).


                              
View this table:
[in this window]
[in a new window]
 
Table I
Selecting FGFR1 molecular signaling models with HS size and stoichiometry

Whereas the requirements on the size and ratio of HS in the complex are obvious, the requirement that HS interacts with both FGF1 and FGFR1 may not be so obvious. Because both FGF1 and FGFR1 can bind to HS independently (Fig. 2B), with similar affinity (47, 48), it is likely that both of them bind to HS in the ternary complex. If HS interacts only with FGF1 in the ternary complex, the dissociation of FGF1 from the polysaccharide will release HS from the ternary complex; thus, HS should be liberated from FGF1·HS and FGF1·HS·FGFR1 at the same temperature, but experiments showed that HS could only be liberated from the ternary complex at higher temperature (Fig. 3B). Again, if HS interacts only with FGF1 in the ternary complex, an HS with no affinity for FGF1 will not be able to form a ternary complex with FGF1 and FGFR1, but experiments showed the opposite (Fig. 6A). One might argue that FGF1 may experience a major conformational change upon the association with FGFR1 and thus have greater affinity toward HS, but this has not been seen in crystallographic studies (15, 18, 20, 42, 49).

From the binding assay, we found the minimum HS for FGF1 and FGFR1 binding were tetrasaccharide and octasaccharide, respectively (Fig. 2B), and the minimum HS required for ternary complex formation was only a tetrasaccharide (Fig. 4). Based upon these findings, the length of two contiguous FGF1 binding sites on HS will span at least eight sugar residues, and the length needed for one FGF1 site and one FGFR1 site will cover at least 12 sugar residues (Fig. 1A, Table I). Obviously, the cis mode cannot explain the findings from the present and past studies (24, 25, 50) that shorter oligosaccharides could initiate the ternary complex formation and activate FGF receptors.

Compared with the cis mode, the trans mode would better explain the requirement of HS size. In a typical model of the trans mode, two FGFs bind to an oligosaccharide from the opposite sides; therefore, a tetrasaccharide will be of sufficient size (Fig. 1B, IV). However, this model does not contain FGFR1/HS interaction, and the molar ratio of HS to FGF1 and FGFR1 is 1:2:2. Model V (Fig. 1B) is excluded, because the minimum HS in this model is an octasaccharide.

Recently, models with the mix mode of interaction have been proposed based on crystallographic studies (20, 28, 42, 43). In Schlessinger's "two-end" model, two antiparallel oligosaccharides are incorporated, and the oligosaccharide can be as short as hexasaccharide (Fig. 1C, VII). The complex is a dimer consisting of two 1:1:1 FGF2·HS·FGFR1 half-complexes and is stabilized via both FGFR1·FGFR1 and HS·FGFR1 contacts. Within each 1:1:1 FGF2·HS·FGFR1 complex, the hexasaccharide not only makes numerous contacts with both FGF2 and FGFR1, thereby augmenting FGF2/FGFR1 binding, but also makes contacts with FGFR1 in the neighboring half-complex, thus playing a dual role in the ternary complex formation. Except for the difference in the minimum size on HS (Table I), this "two-end" model fits the data described previously.

Although hexasaccharide was the smallest oligosaccharide shown to be effective in the "two-end" model (28), we believe that a tetrasaccharide still can make effective contacts with FGF2 and FGFR1 in the ternary complex. According to Schlessinger's crystal structure (28), the first six sugar residues at the nonreducing end of a decasaccharide make 30 hydrogen bonds, including nine with FGFR1, 16 with FGF2 in the same half-complex, and five with FGFR1 in the adjoining half-complex. Among these, all of the contacts to the FGFR1, and 8 of the 16 contacts to the FGF2 are due to the first four sugar residues. On the other hand, the first two sugar residues make 12 contacts, with only one to FGF2, whereas the next two sugar residues make 10 contacts, with none to the FGFR1 in the same half-complex. This suggests that a tetrasaccharide, but not a disaccharide, may still fulfill the dual role played by a hexasaccharide in the ternary complex formation and thus explains why a tetrasaccharide was the minimum oligosaccharide capable of initiating the ternary complex formation and possessing biological activity. Recently, tetrasaccharide has also been reported to bind FGF2 and promote cell growth (23, 24, 50).

The fact that a tetrasaccharide cannot make full contacts with FGF2 and FGFR1 may explain why it is not as active as a hexasaccharide (see Table III), but it still remains unclear why shorter oligosaccharides like dp6 and dp8 showed lower mitogenic activity than longer oligosaccharides (see Table III). It is possible that additional HS length helps the recruitment of FGF1 or FGFR1 to form the ternary complex. The opportunity for each of FGF1, HS, and FGFR1 to encounter each other simultaneously on a cell surface is probably low. It is more likely that HS, by its abundance, first associates with one of the proteins (47) (e.g. FGFR1); then the unoccupied region of HS functions as a recruiter, where FGF1 can bind and join the complex by proximity. The analysis of the binding mechanism and study of critical functional groups on HS further supports this hypothesis (Fig. 7).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 7.   A proposed mechanism for the formation of the FGF1·FGFR1 signaling complex. In the inactive state, FGF1 and FGFR1 bind to their primary binding sites on the HS chain. The binding sites can be contiguous in the same sulfated domain or separated in different sulfated domains, depending on the size of the sulfated domains. During the activation, one FGF1 binds to one FGFR1 on the same chain of HS and form a half-complex at the nonreducing ends. Two of these half-complexes then associate to an active molecular signaling complex.

Novel Binding Mechanism for HS in the Ternary Complex Involves Different Critical Functional Groups and a Different Binding Site-- Plotnikov and Schlessinger's (28, 43) crystal structures show that a new binding grove for HS forms among two FGFs and two FGFRs. Since the binding environment of HS in the ternary complex is very different from that on individual FGF or FGFR, it is likely that the contacts could be made through a different set of functional groups on HS, which is suggested in our experiments. It was previously shown that 2-O-sulfation is critical for FGF1 binding (19, 51), and both 2- and 6-O-sulfation is critical for FGFR1 binding (Figs. 3C and 6A) (52), but N-sulfation is critical for the ternary complex formation (Fig. 6). Besides, the N-, 2-O-, and 6-O-trisulfated disaccharide is not found to be important for the ternary complex formation (Fig. 6). Consistently, among the first four sugar residues of the octasaccharide in Schlessinger's crystal structure, the N-sulfation and the backbone structure make 16 of 22 hydrogen bonds to all of the necessary protein components (28). The observation of different critical groups in ternary complex formation suggests that by changing critical groups, HS can determine the nature of FGF1·HS·FGFR1 complex formation.

A different set of critical groups suggests that the site where ternary complex forms on HS can be different from the site where FGF1 or FGFR1 binds. The fact that enzyme-modified 6ODS and HS on CHOpgsF-17 cells could not bind to FGFR1 but still formed a ternary complex with FGF1 and FGFR1 (Figs. 3C and 6A) suggests that the ternary complex formation site is different from the site where FGFR1 binds (Fig. 7). This is also consistent with and explains the previous report that 6-O-desulfated heparin showed mitogenic activity (53). On the other hand, cells that were 2-OST-deficient were able to form a ternary complex with FGF1 and FGFR1 (Fig. 3C) and mount an apparently normal signaling response to FGF1 (see Table III) and FGF2 (54), although 2-O-sulfation is critical for FGF1 and FGF2 binding (19, 35, 51). It is also reported that the HS from the culture medium of the mammary fibroblasts and the myoepithelial-like cells possessed high affinity to FGF2 but lacked mitogenic activity (55). This evidence suggests that the ternary complex formation site can be different from the site where FGF1 or FGF2 binds (Fig. 7). The fact that the modified DSNS without the ability to bind either FGF1 or FGFR1 (Fig. 6A) could initiate a ternary complex and possess mitogenic activity (see Table III) further supports the idea.

A Proposed Mechanism for the Formation of FGF1·FGFR1 Signaling Complex on Cell Membrane-- For all tested oligosaccharides, the 1:1:1 ratio among FGF1, HS, and FGFR1 (Table II) implies that there is only one site where the ternary complex can form on each HS. According to Schlessinger's model (28), this site would be at the nonreducing end of HS. On the other hand, there could be internal binding sites for FGF1 (48) and FGFR1 inside the sulfated domains (3). Given that the size of the sulfated domains on heparan sulfate usually covers 12-20 sugar residues (1), these sites could be located on different sulfated domains or located contiguously in the same sulfated domain. Due to the overwhelming abundance of HS, FGF1 and FGFR1 may first bind to HS individually (47). Because FGF1 and FGFR1 bind to HS with relative low affinities (44, 45) and the resulting FGF1·HS and FGFR1·HS binary complexes are less stable (Fig. 3B), FGF1 and FGFR1 can undergo binding-releasing cycles rapidly and therefore translocate along the HS chains. Once an FGF1 and an FGFR1 interact with each other on the HS chain, they will probably form a half-complex at the nonreducing end of the HS. Alternatively, the FGF1 and FGFR1 can associate with each other in the surrounding solution, and the FGF1·FGFR1 complex can then bind to its binding site at the nonreducing end of the HS. Two half-complexes then may associate with each other and form a much more stable ternary complex (Fig. 3B), which allows the receptor trans-phosphorylation (Fig. 7). On the other hand, the binding of FGF1 and FGFR1 to HS can be considered as a recruiting mechanism to increase the effective concentration and facilitate the association of FGF1 and FGFR1 at the nonreducing ends for the formation of the ternary complex (Fig. 7). In this sense, HS serves as both a "catalyst of molecular encounter" (47) and a structure component. Shorter oligosaccharides lacking these FGF1 and FGFR1 binding sites would have less chance to form a ternary complex and thus explain why they showed less biological activities (Table III).


                              
View this table:
[in this window]
[in a new window]
 
Table II
The molar ratio of oligosaccharide to FGF1 in the ternary complex
Each binding reaction contained 16 pmol of FGF1, 64 pmol of FGFR1, and 250 ng of oligosaccharide. The molecular weight of oligosaccharides was calculated based on the molecular weight of the fully sulfated disaccharide, which is 577.


                              
View this table:
[in this window]
[in a new window]
 
Table III
Sulfation versus complex formation and mitogenic activity

Perspective-- Overall, we observed a direct link among critical groups on HS, FGF1·FGFR1 signaling complex formation, and cell growth. The regulatory role of HS in organ development and cell proliferation has been observed before (8, 9, 29, 30, 56), but the mechanism of this regulation was obscure. It is possible that a cell could regulate its own activity, through altering the critical groups on HS, thus affecting the formation of specific FGFR signaling complexes. The placement of critical groups on HS must result from the operation of a set of tightly regulated modification enzymes. Recently, the gene structures for almost all of these enzymes have been elucidated, and it has been shown that N-, 3-O-, and 6-O-sulfotransferases exhibit genetic polymorphism and encode distinct isoforms (2, 7). These isoforms differ in substrate specificity and expression pattern, both spatially and temporally (7), which may cause the specific modification on HS. Further study of these enzymes is crucial to our understanding of specific modifications on HS and the regulatory role of HS.

Using chemically and enzymatically modified heparin sulfates and a gel mobility shift assay, we were able to monitor the formation of the FGF1·FGFR1 signaling complex and study the physical parameters of HS in the complex. The results concerning the size, molar ratio, and molecular interactions of HS in the complex and the concept of receptor dimerization (10, 26) allowed us to select a 2:2:2 FGF1·HS·FGFR1 signaling model. We demonstrated that FGF1, FGFR1, and the FGF1·FGFR1 complex can bind to different sites on HS, and only the ternary complex formation site possesses mitogenic activity. We also demonstrated that different critical groups are present in these different HS sites. Finally, the molar ratio of HS, FGF1, and FGFR1 in the ternary complex was found to be independent of the size of HS, which provides strong evidence that the formation of the proposed signaling complex can occur on cell surface HS proteoglycans. This study demonstrates the structural as well as regulatory roles of HS in the FGF1·HS·FGFR1 complex and can serve as a model for studying other HS molecular interactions.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address: Dept. of Immunology and Pathology, Washington University School of Medicine, St. Louis, MO 63110.

** Present address: Dept. of Molecular Developmental Biology, Tokyo Metropolitan Institute for Neuroscience, Tokyo 183-8526, Japan.

Dagger Dagger To whom correspondence should be addressed: Dept. of Biology, Massachusetts Institute of Technology, 31 Ames St., MIT Bldg. 68-488. Tel.: 617-253-8803; Fax: 617-258-6553; E-mail: rdrrosen@mit.edu.

Published, JBC Papers in Press, February 25, 2003, DOI 10.1074/jbc.M212590200

    ABBREVIATIONS

The abbreviations used are: HS, heparan sulfate; FGF, fibroblast growth factor; FGFR, FGF receptor; DSNS, completely desulfated and N-sulfated heparin sulfate; DSNAc, completely desulfated and N-acetylated heparin; 6ODS, 6-O-desulfated heparin; OST, O-sulfotransferase; CHO, Chinese hamster ovary; Delta UA, unsaturated uronic acid; GlcNS, N-sulfated GlcN; Delta UA2S, 2-O-sulfated Delta UA; GlcNS6S, N- and 6-O-sulfated GlcN.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Bernfield, M., Gotte, M., Park, P. W., Reizes, O., Fitzgerald, M. L., Lincecum, J., and Zako, M. (1999) Annu. Rev. Biochem. 68, 729-777[CrossRef][Medline] [Order article via Infotrieve]
2. Rosenberg, R. D., Shworak, N. W., Liu, J., Schwartz, J. J., and Zhang, L. (1997) J. Clin. Invest. 99, 2062-2070[Medline] [Order article via Infotrieve]
3. Gallagher, J. T. (2001) J. Clin. Invest. 108, 357-361[CrossRef][Medline] [Order article via Infotrieve]
4. Yayon, A., Klagsbrun, M., Esko, J. D., Leder, P., and Ornitz, D. M. (1991) Cell 64, 841-848[CrossRef][Medline] [Order article via Infotrieve]
5. Rapraeger, A. C., Krufka, A., and Olwin, B. B. (1991) Science 252, 1705-1708[Abstract/Free Full Text]
6. Spivak-Kroizman, T., Lemmon, M. A., Dikic, I., Ladbury, J. E., Pinchasi, D., Huang, J., Jaye, M., Crumley, G., Schlessinger, J., and Lax, I. (1994) Cell 79, 1015-1024[CrossRef][Medline] [Order article via Infotrieve]
7. Esko, J. D., and Selleck, S. B. (2002) Annu. Rev. Biochem. 71, 435-471[CrossRef][Medline] [Order article via Infotrieve]
8. Perrimon, N., and Bernfield, M. (2000) Nature 404, 725-728[CrossRef][Medline] [Order article via Infotrieve]
9. Lander, A. D., and Selleck, S. B. (2000) J. Cell Biol. 148, 227-232[Abstract/Free Full Text]
10. Schlessinger, J. (2000) Cell 103, 211-225[CrossRef][Medline] [Order article via Infotrieve]
11. Lemmon, M. A., and Schlessinger, J. (1994) Trends Biochem. Sci. 19, 459-463[CrossRef][Medline] [Order article via Infotrieve]
12. Galzie, Z., Kinsella, A. R., and Smith, J. A. (1997) Biochem. Cell Biol. 75, 669-685[CrossRef][Medline] [Order article via Infotrieve]
13. Naski, M. C., and Ornitz, D. M. (1998) Front. Biosci. 3, D781-94
14. Sleeman, M., Fraser, J., McDonald, M., Yuan, S., White, D., Grandison, P., Kumble, K., Watson, J. D., and Murison, J. G. (2001) Gene (Amst.) 271, 171-182[CrossRef][Medline] [Order article via Infotrieve]
15. Faham, S., Hileman, R. E., Fromm, J. R., Linhardt, R. J., and Rees, D. C. (1996) Science 271, 1116-1120[Abstract]
16. Givol, D., and Yayon, A. (1992) FASEB J. 6, 3362-3369[Abstract]
17. Kan, M., Wang, F., Xu, J., Crabb, J. W., Hou, J., and McKeehan, W. L. (1993) Science 259, 1918-1921[Abstract/Free Full Text]
18. DiGabriele, A. D., Lax, I., Chen, D. I., Svahn, C. M., Jaye, M., Schlessinger, J., and Hendrickson, W. A. (1998) Nature 393, 812-817[CrossRef][Medline] [Order article via Infotrieve]
19. Guimond, S., Maccarana, M., Olwin, B. B., Lindahl, U., and Rapraeger, A. C. (1993) J. Biol. Chem. 268, 23906-23914[Abstract/Free Full Text]
20. Stauber, D. J., DiGabriele, A. D., and Hendrickson, W. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 49-54[Abstract/Free Full Text]
21. Ornitz, D. M., Yayon, A., Flanagan, J. G., Svahn, C. M., Levi, E., and Leder, P. (1992) Mol. Cell. Biol. 12, 240-247[Abstract/Free Full Text]
22. Gambarini, A. G., Miyamoto, C. A., Lima, G. A., Nader, H. B., and Dietrich, C. P. (1993) Mol. Cell Biochem. 124, 121-129[CrossRef][Medline] [Order article via Infotrieve]
23. Zhou, F. Y., Kan, M., Owens, R. T., McKeehan, W. L., Thompson, J. A., Linhardt, R. J., and Hook, M. (1997) Eur. J. Cell Biol. 73, 71-80[Medline] [Order article via Infotrieve]
24. Ostrovsky, O., Berman, B., Gallagher, J., Mulloy, B., Fernig, D. G., Delehedde, M., and Ron, D. (2002) J. Biol. Chem. 277, 2444-2453[Abstract/Free Full Text]
25. Ornitz, D. M., Herr, A. B., Nilsson, M., Westman, J., Svahn, C. M., and Waksman, G. (1995) Science 268, 432-436[Abstract/Free Full Text]
26. Heldin, C. H. (1995) Cell 80, 213-223[CrossRef][Medline] [Order article via Infotrieve]
27. Springer, B. A., Pantoliano, M. W., Barbera, F. A., Gunyuzlu, P. L., Thompson, L. D., Herblin, W. F., Rosenfeld, S. A., and Book, G. W. (1994) J. Biol. Chem. 269, 26879-26884[Abstract/Free Full Text]
28. Schlessinger, J., Plotnikov, A. N., Ibrahimi, O. A., Eliseenkova, A. V., Yeh, B. K., Yayon, A., Linhardt, R. J., and Mohammadi, M. (2000) Mol. Cell 6, 743-750[CrossRef][Medline] [Order article via Infotrieve]
29. Allen, B. L., Filla, M. S., and Rapraeger, A. C. (2001) J. Cell Biol. 155, 845-858[Abstract/Free Full Text]
30. Lindahl, U., Kusche-Gullberg, M., and Kjellen, L. (1998) J. Biol. Chem. 273, 24979-24982[Free Full Text]
31. Zhang, Z., Coomans, C., and David, G. (2001) J. Biol. Chem. 276, 41921-41929[Abstract/Free Full Text]
32. Pye, D. A., Vives, R. R., Hyde, P., and Gallagher, J. T. (2000) Glycobiology 10, 1183-1192[Abstract/Free Full Text]
33. Guimond, S. E., and Turnbull, J. E. (1999) Curr. Biol. 9, 1343-1346[CrossRef][Medline] [Order article via Infotrieve]
34. Berry, D., Kwan, C. P., Shriver, Z., Venkataraman, G., and Sasisekharan, R. (2001) FASEB J. 15, 1422-1424[Free Full Text]
35. Turnbull, J. E., Fernig, D. G., Ke, Y., Wilkinson, M. C., and Gallagher, J. T. (1992) J. Biol. Chem. 267, 10337-10341[Abstract/Free Full Text]
36. Loo, B. M., Kreuger, J., Jalkanen, M., Lindahl, U., and Salmivirta, M. (2001) J. Biol. Chem. 276, 16868-16876[Abstract/Free Full Text]
37. McKeehan, W. L., Wu, X., and Kan, M. (1999) J. Biol. Chem. 274, 21511-21514[Abstract/Free Full Text]
38. Maccarana, M., Casu, B., and Lindahl, U. (1993) J. Biol. Chem. 268, 23898-23905[Abstract/Free Full Text]
39. Pye, D. A., Vives, R. R., Turnbull, J. E., Hyde, P., and Gallagher, J. T. (1998) J. Biol. Chem. 273, 22936-22942[Abstract/Free Full Text]
40. Wu, Z. L., Zhang, L., Beeler, D. L., Kuberan, B., and Rosenberg, R. D. (2002) FASEB J. 16, 539-545[Abstract/Free Full Text]
41. Zhang, L., Lawrence, R., Schwartz, J. J., Bai, X., Wei, G., Esko, J. D., and Rosenberg, R. D. (2001) J. Biol. Chem. 276, 28806-28813[Abstract/Free Full Text]
42. Pellegrini, L., Burke, D. F., von Delft, F., Mulloy, B., and Blundell, T. L. (2000) Nature 407, 1029-1034[CrossRef][Medline] [Order article via Infotrieve]
43. Plotnikov, A. N., Schlessinger, J., Hubbard, S. R., and Mohammadi, M. (1999) Cell 98, 641-650[CrossRef][Medline] [Order article via Infotrieve]
44. Nugent, M. A., and Edelman, E. R. (1992) Biochemistry 31, 8876-8883[CrossRef][Medline] [Order article via Infotrieve]
45. Pantoliano, M. W., Horlick, R. A., Springer, B. A., Van Dyk, D. E., Tobery, T., Wetmore, D. R., Lear, J. D., Nahapetian, A. T., Bradley, J. D., and Sisk, W. P. (1994) Biochemistry 33, 10229-10248[CrossRef][Medline] [Order article via Infotrieve]
46. Lin, X., Buff, E. M., Perrimon, N., and Michelson, A. M. (1999) Development 126, 3715-3723[Abstract]
47. Powell, A. K., Fernig, D. G., and Turnbull, J. E. (2002) J. Biol. Chem. 277, 28554-28563[Abstract/Free Full Text]
48. Mach, H., Volkin, D. B., Burke, C. J., Middaugh, C. R., Linhardt, R. J., Fromm, J. R., Loganathan, D., and Mattsson, L. (1993) Biochemistry 32, 5480-5489[CrossRef][Medline] [Order article via Infotrieve]
49. Plotnikov, A. N., Hubbard, S. R., Schlessinger, J., and Mohammadi, M. (2000) Cell 101, 413-424[CrossRef][Medline] [Order article via Infotrieve]
50. Delehedde, M., Lyon, M., Gallagher, J. T., Rudland, P. S., and Fernig, D. G. (2002) Biochem. J. 9, 235-244
51. Ishihara, M., Kariya, Y., Kikuchi, H., Minamisawa, T., and Yoshida, K. (1997) J. Biochem. (Tokyo) 121, 345-349[Abstract/Free Full Text]
52. Lundin, L., Larsson, H., Kreuger, J., Kanda, S., Lindahl, U., Salmivirta, M., and Claesson-Welsh, L. (2000) J. Biol. Chem. 275, 24653-24660[Abstract/Free Full Text]
53. Kariya, Y., Kyogashima, M., Suzuki, K., Isomura, T., Sakamoto, T., Horie, K., Ishihara, M., Takano, R., Kamei, K., and Hara, S. (2000) J. Biol. Chem. 275, 25949-25958[Abstract/Free Full Text]
54. Merry, C. L., Bullock, S. L., Swan, D. C., Backen, A. C., Lyon, M., Beddington, R. S., Wilson, V. A., and Gallagher, J. T. (2001) J. Biol. Chem. 276, 35429-35434[Abstract/Free Full Text]
55. Rahmoune, H., Chen, H. L., Gallagher, J. T., Rudland, P. S., and Fernig, D. G. (1998) J. Biol. Chem. 273, 7303-7310[Abstract/Free Full Text]
56. Brickman, Y. G., Ford, M. D., Gallagher, J. T., Nurcombe, V., Bartlett, P. F., and Turnbull, J. E. (1998) J. Biol. Chem. 273, 4350-4359[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea