JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M212224200 on February 21, 2003

J. Biol. Chem., Vol. 278, Issue 19, 17164-17169, May 9, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/17164    most recent
M212224200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lange, T.
Right arrow Articles by Neufeld, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lange, T.
Right arrow Articles by Neufeld, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

VEGF162, A New Heparin-binding Vascular Endothelial Growth Factor Splice Form That Is Expressed in Transformed Human Cells*

Tali LangeDagger , Noga Guttmann-RavivDagger , Limor Baruch§, Marcelle Machluf§, and Gera NeufeldDagger

From the Dagger  Department of Cell Biology and Anatomy, The Bruce Rappaport Faculty of Medicine, Technion, Israel Institute of Technology, P. O. Box 9697, 1 Efron Street, Haifa 31096, Israel and § Faculty of Biotechnology and Food Engineering, Technion-Institute of Technology, Haifa 32000, Israel

Received for publication, December 2, 2002, and in revised form, February 3, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The splice forms of vascular endothelial growth factor (VEGF) differ in biological properties such as the receptor types that they recognize and their interaction with heparan sulfate proteoglycans. We have identified a new VEGF mRNA splice form encoding a VEGF species containing 162 amino acids (VEGF162) in human A431 ovarian carcinoma cells. This novel mRNA contains the peptides encoded by exons 1-5, 6A, 6B, and 8 of the VEGF gene. Recombinant VEGF162 is biologically active. It induces proliferation of endothelial cells in vitro and angiogenesis in vivo as determined by the alginate bead assay. VEGF162 binds less efficiently than VEGF145 but more efficiently than VEGF165 to a natural basement membrane produced by corneal endothelial cells. VEGF138, an artificial VEGF form that contains exon 6B but lacks exons 6A and 7, did not bind to this basement membrane at all, indicating that exon 6B probably interferes with the interaction of exon 6A with heparin and heparan sulfate proteoglycans.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The various forms of vascular endothelial growth factor (VEGF)1 are generated by alternative splicing from a single gene (1-4). The domains encoded by exons 1-5 of the VEGF gene contain information required for the recognition of the tyrosine kinase VEGF receptors 1 (flt-1) and 2 (KDR/flk-1) (5) and are present in all the VEGF splice forms. Most VEGF splice forms are distinguished by the presence or absence of the peptides encoded by exons 6 and 7 of the VEGF gene that code for two independent heparin-binding domains. VEGF121 lacks both exons and does not bind to heparin. VEGF165 contains the exon 7-encoded peptide, VEGF145 contains the peptide encoded by exon 6A, and VEGF189 contains both exon 6A and exon 7 (3, 6-8). VEGF206 has a structure similar to that of VEGF189, except that it contains both exons 6A and 6B of the VEGF gene. However, the contribution of exon 6B to the biological properties of VEGF206 has not been studied. The amino acids encoded by exon 8 are present in most of the VEGF splice forms. However, it was recently found that in the novel VEGF form VEGF165b, the 6 amino acids encoded by exon 8 are replaced by 6 amino acids derived from a putative ninth exon to yield a VEGF form that probably inhibits angiogenesis (9). In another recently described VEGF splice form, exon 8 is completely truncated to generate a 148-amino acid form (10). In addition, it was recently found that VEGF forms possessing an extended N termini of unknown function also exist (11).

Most VEGF isoforms induce proliferation of vascular endothelial cells, induce angiogenesis, and cause permeabilization of blood vessels (8). Recently, certain differences between some common VEGF splice forms have been reported. The neuropilin-1 and neuropilin-2 receptors function as receptors for axon guidance factors belonging to the semaphorin family (12, 13). It was found that both neuropilins also function as VEGF receptors that differentiate between various forms of VEGF (14, 15). Thus, VEGF121 cannot bind to either of the neuropilins, whereas VEGF165 binds efficiently to both receptors, and VEGF145 binds well to neuropilin-2 but not to neuropilin-1 (16). Such differences are also reflected in the functional properties of the VEGF splice forms. It was found that mice expressing only VEGF121 do not develop properly (17, 18) because the heparan sulfate-binding VEGF forms are required for correct branching of blood vessels during development (19). Likewise, mice expressing only VEGF189 display impaired arterial development (17), suggesting that each VEGF form possesses specific characteristics and that the various VEGF forms complement each other to achieve a balanced angiogenic response.

Exon 6B was first identified in VEGF206 (Fig. 1C), but the effect of exon 6B on the biological properties of VEGF206 had not been studied because VEGF206, like VEGF189, is not secreted into the medium of cells that produce these VEGF forms and is thus difficult to isolate and characterize. We report here the identification of a new exon 6B-containing form of VEGF expressed by A431 ovarian carcinoma cells. This VEGF form is 162 amino acids long (VEGF162). In this work, we have characterized the properties of VEGF162 and compared them with those of the closely related VEGF145 and those of VEGF138, an artificial exon 6B-containing VEGF form.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Human recombinant VEGF165 was purified from Sf-9 insect cells as described previously (20). The pDCHIP11 plasmid (containing the DHFR minigene) was kindly provided by Dr. Lawrence Chasin (Columbia University, New York, NY) (21). Rabbit polyclonal antibody directed against VEGF was produced in our laboratory as described previously (20). Monoclonal anti-VEGF antibodies (V4758), peroxidase-conjugated anti-rabbit IgG antibodies, and alkaline phosphatase-conjugated anti-rabbit IgG antibodies were purchased from Sigma. The EZ-ECL kit was from Biological Industries Inc. (Beth Haemek, Israel). Heparin-Sepharose was purchased from Pharmacia Corporation. Tissue culture plasticware was from Corning. Tissue culture media were obtained from Invitrogen. Other tissue culture reagents were from Biological Industries Inc.

Detection of VEGF162 mRNA in Cells-- Total mRNA was prepared from A431 human ovarian carcinoma cells. Complementary DNA was synthesized from 5 µg of total RNA using Moloney murine leukemia virus reverse transcriptase (Promega). A specific oligonucleotide derived from the 3'-untranslated region of VEGF mRNA (nucleotides 908-931, GGGTGTGTCTACAGGAATCCCAG) was used as a primer. The reaction was carried out for 1 h at 37 °C and for 30 min at 42 °C, and the enzyme was then inactivated by a 10-min incubation at 90 °C. PCR amplification was carried out in the presence of 5 units of Extaq Taq polymerase (Takara), 1 mM of each deoxynucleotide triphosphate, and 20 pmol of each primer. The oligonucleotides used as primers for the PCR reaction were CGGGATCCGAAACCATGAACTTTCTGC, corresponding to the first 9 N-terminal amino acids of the VEGF coding region, and CTTCCGGGCTCGGTGATTTAGCAG, corresponding to a sequence from the 3'-untranslated region of human VEGF (nucleotides 867-891). Each of the 30 amplification cycles consisted of a 40-s incubation at 94 °C, a 1.5-min incubation at 63 °C, and a 1.5-min incubation at 72 °C.

The PCR products were precipitated, and an additional stage of nested PCR was performed, using internal primers specific for VEGF162: CGAATTCTGCCTTGCTGCTCTACCTCCACCAT, corresponding to amino acids 17-25 of the VEGF coding region, and GCTTGTCACATTGGGGGCCA, corresponding to amino acids 184-190 of VEGF162, located at the junction between exons 6B and 8 of the VEGF gene. The same amplification protocol was used for this step. However, the annealing temperature was raised to 68 °C to exclude nonspecific products as much as possible.

Construction of VEGF138- and VEGF162-encoding Expression Vectors and Production of Recombinant VEGF162-- The VEGF162 cDNA was subcloned into the EcoRI site of the PECE expression vector (22). The PECE/VEGF162 vector was transfected into DG44 Chinese hamster ovary cells (CHO DHFR- cells) (23), along with the pDCHIP11 plasmid, which contains the DHFR minigene (21). Cells were selected using minimum Eagle's medium alpha  lacking nucleosides. Increasing concentrations of methotrexate were used to amplify the VEGF162 cDNA to enhance VEGF162 production. The maximal concentration of methotrexate used was 100 nM. The concentrations of VEGF162 in the conditioned medium of VEGF162-producing cells were assessed using anti-VEGF antibodies.

To partially purify the VEGF162 protein, serum-free conditioned medium was applied to a heparin-Sepharose column. The column was pre-equilibrated with wash buffer (10 mM Tris, pH 7.5, 150 mM NaCl). The conditioned medium was loaded on this column. The column was then washed extensively with wash buffer and then washed with wash buffer containing 250 mM NaCl. Elution was performed with the same buffer containing 800 mM NaCl. This procedure was almost identical to the procedure used for the purification of VEGF145 (4).

To obtain a cDNA encoding VEGF138, we amplified the VEGF145 cDNA by PCR using the 3' primer 5'-CGGGATCCTCACCGCCTCGGCTTGTCACATTGGGGGCCAGGGAGGCTCCAGGGCATTAGACAGCAGCGGGCACCAACGTACTTTTCTTGTCTTGCTCT-3' containing the entire exon 8 sequence fused to exon 6B and the last 17 bp of exon 5. The 5' primer was 5'-CGGGATCCGAAACCATGAACTTTCTGC-3' derived from the 5' end of the VEGF cDNA. The annealing temperature was 55 °C. The PCR product was subcloned into the PECE expression vector (22) and expressed in DHFR- CHO cells as described for VEGF162.

Purification of VEGF138 from serum-free medium of the VEGF138-expressing cells was achieved by chromatography on a phenyl-Sepharose column followed by ion exchange chromatography as described for VEGF121 (24).

The protein concentrations in various VEGFs were determined using the BioRad protein assay according to the instructions of the vendor. The VEGF content was also assessed semiquantitatively by comparing VEGF concentrations in samples containing equal amounts of protein using Western blot analysis as described previously (20).

Cell Proliferation Assays-- Human umbilical vein-derived endothelial cells were prepared from umbilical veins as described previously (25) and cultured in M199 medium supplemented with 20% fetal calf serum, vitamins, 2 mM glutamine, and antibiotics. Basic fibroblast growth factor was added to the culture every other day. For the proliferation assay, cells were plated in 24-well dishes at 20,000 cells/well. After attachment, the medium was replaced by the same medium containing 1% fetal calf serum, and various concentrations of VEGF were added. The cells received a second dose of VEGF 48 h after the beginning of the experiment, and 48 h later, the cells were trypsinized and counted in a Coulter counter.

Binding of VEGF to Extracellular Matrix-coated Dishes-- Tissue culture dishes coated with extracellular matrix secreted by bovine corneal endothelial cells were prepared as described previously (26, 27) or were kindly donated by Dr. Israel Vlodavsky (Technion, Israel). Binding experiments were performed at room temperature. The extracellular matrix-coated wells were washed five times with rinse buffer (10 mM Tris-HCl, pH 7.2, 150 mM NaCl, 0.1% Tween 20). Nonspecific sites were blocked with binding buffer (20 mM K2HPO4, 10 mM KH2PO4, 1 mM EDTA, 0.8% NaCl, 1 mg/ml bovine serum albumin, pH 7.2) for 1 h. The binding buffer was aspirated, and dishes were incubated in a final volume of 0.1 ml of binding buffer for 2 h with various amounts of VEGF forms. The dishes were then washed five times with rinse buffer. Bound VEGF was detected using an anti-VEGF monoclonal antibody that was bound to the dishes in binding buffer for 2 h. This antibody recognizes all the VEGF splice forms equally well in Western blot analysis (data not shown). Dishes were again washed five times with rinse buffer. Bound antibody was detected using anti-mouse alkaline phosphatase-conjugated antibody as described previously (4).

Alginate Bead Angiogenesis Assay-- CHO-VEGF162 and CHO-pDCHIP11 cells were encapsulated within microspheres composed of Ca2+-alginate and a polyelectrolyte poly-L-(lysine) (4, 28). Briefly, cells were resuspended in sodium alginate in saline (1.2% (w/v); Pronova Ultra Pure MVG) to a final ratio of 1.5 × 106 cells/ml alginate. The suspension was sprayed through a 22-gauge needle located inside an air jet-head droplet-forming apparatus into a solution of HEPES-buffered calcium chloride (13 mM HEPES, 1.5% (w/v) CaCl2, pH 7.4; Sigma), where the droplets gelled for 20 min. The alginate microspheres were coated with 0.1% (w/v) poly-L-(lysine) (Mr 27,000; Sigma) in saline for 12 min with gentle agitation. Capsules were washed three times in HEPES and then suspended in culture media. Clusters of alginate beads were injected subcutaneously into nude mice. The clusters of beads were removed after 6 days and examined using a dissecting microscope.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Human A431 Squamous Carcinoma-derived Cells Express VEGF162 mRNA-- The presence of the peptide encoded by exon 6B in VEGF206 (2) (Fig. 1C) indicates that this peptide may be present in additional forms of VEGF. We have used a primer derived from the 3'-untranslated region of the VEGF mRNA (nucleotides 827-850) to generate first-strand cDNA species from total RNA prepared from several human tumor-derived cell lines. We subsequently used a 3' primer corresponding to a hypothetical junction between exon 6B and exon 8 in conjunction with a 5' primer corresponding to the beginning of the VEGF mRNA to amplify the cDNA in order to detect exon 6B-containing VEGF splice forms differing from VEGF206. Using these primers, we have found that A431 squamous carcinoma cells contain a VEGF mRNA of a size corresponding to a VEGF mRNA species that contains exons 1-5, 6A, 6B, and 8 (Fig. 1A, lane 1). No amplified cDNA could be detected in an identical control experiment in which the reverse transcriptase enzyme was omitted (Fig. 1A, lane 2). The structure of this new VEGF cDNA was verified by sequencing, and it did indeed correspond to the expected sequence of a VEGF splice form encoding a 162-amino acid-long form of VEGF (VEGF162) (Fig. 1C).


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1.   A, expression of VEGF162 mRNA in A431 cells. RNA from A431 cells was reverse-transcribed using a primer derived from the 3'-untranslated region of the VEGF mRNA as described. The cDNA was then amplified using a 3' primer corresponding to the 3' end of exon 6B fused to exon 8 and a 5' primer derived from the 5' end of the VEGF coding sequence as described. Lane 1, amplification of A431-derived RNA; lane 2, control without reverse transcriptase; lane 3, PCR using as substrate plasmid containing the VEGF138 cDNA; lane 4, PCR using as substrate plasmid containing the VEGF162 cDNA. The experiment was repeated three times with similar results. B, VEGF cDNAs encoding VEGF forms lacking a junction between exons 6B and 8 are not amplified by the primers used to detect the VEGF162 cDNA. PCR was performed using the same conditions described for the experiment shown in A. Plasmids containing cDNAs encoding known forms of VEGF were used as templates. Lane 1, VEGF121; lane 2, VEGF138; lane 3, VEGF145; lane 4, VEGF162; lane 5, VEGF165; lane 6, VEGF189; lane 7, VEGF162; lane 8, VEGF206. C, the VEGF splice forms. The various VEGF splice forms that contain the peptide encoded by exon 8 are shown. Exons are not drawn to scale. VEGF138 is an artificial construct.

Because the 3' primer used corresponded to a hypothetical exon 6B/exon 8 junction, it could perhaps have hybridized via the exon 6B matching portion of the primer to an exon 6B-containing cDNA such as that encoding VEGF206 during the PCR amplification stage. Such amplification would generate the VEGF162 cDNA, even though VEGF162 mRNA was not present. This possibility is somewhat unlikely because the annealing temperature we used was 68 °C, making annealing between VEGF206 and the 10 exon 6B-derived bases of the primer difficult. Nevertheless, to exclude this possibility, we tried to find out whether the primer pair we used to amplify the VEGF162 cDNA is able to amplify cDNAs encoding VEGF splice forms other than VEGF162. The pair of primers successfully amplified cDNAs encoding VEGF138 (an artificial cDNA containing exons 1-5, 6B, and 8; Fig. 1C; Fig. 1B, lane 2) and VEGF162 (Fig. 1B, lane 4). However, we have not been able to amplify any other VEGF cDNA including the cDNA encoding VEGF206 (Fig. 1B, lane 8) with this pair of primers under the conditions that we used to amplify the VEGF162 cDNA derived from the A431 cells. This experiment therefore indicates that the VEGF162 cDNA was indeed generated from a natural mRNA species encoding VEGF162.

Recombinant VEGF162 Induces Proliferation of Endothelial Cells in Vitro-- To study the biological properties of VEGF162 and to compare them with those of other VEGF splice forms, we produced recombinant VEGF162. The VEGF162 cDNA was subcloned into the PECE expression vector (22) and co-transfected into CHO DHFR- cells (23). Clones expressing relatively large amounts of VEGF162 were initially isolated using a selective medium lacking nucleosides, and the integrated VEGF162 cDNA was further amplified using methotrexate (23). Conditioned medium from such cells, but not conditioned medium from empty vector-transfected cells, contained immunoreactive VEGF162 (Fig. 2A). The VEGF162 was partially purified using a heparin-Sepharose affinity column. It was eluted from the column with 0.8 M NaCl and used for additional experiments. At this stage, it was about 80% pure (Fig. 2B, lane 3). VEGF162 migrated as two bands in reduced SDS-PAGE gels, as do all the other VEGF forms (see, for example, VEGF165, Fig. 2B, lane 1) (4, 29). The upper band probably contains glycosylated VEGF162, as is the case with VEGF165 (29). VEGF162 was biologically active and induced proliferation of human umbilical vein-derived endothelial cells with an ED50 of about 10 ng/ml (Fig. 3). This value is somewhat lower than the ED50 of VEGF145 (30 ng/ml) (4), indicating that these two VEGF forms, which differ only by the presence of exon 6B in VEGF162, have similar biological potencies (4).


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2.   A, expression of recombinant VEGF162. CHO cells transfected with expression vector containing the VEGF162 cDNA (lane 2) or CHO cells transfected with empty vector (lane 1) were grown to confluence. The medium was changed to serum-free medium and collected 48 h later. Aliquots of 30 µl were separated on a 14% SDS-PAGE gel and blotted onto nitrocellulose. VEGF was detected using polyclonal antibodies directed against VEGF as described previously (4, 20). B, purification of VEGF162. Recombinant VEGF165 (0.5 µg) purified from baculovirus (20) (lane 1) or VEGF162 purified by heparin-Sepharose affinity chromatography from 20 ml of conditioned medium of VEGF162-expressing CHO cells (lane 3) was chromatographed on a 14% SDS-PAGE gel. The gel was silver-stained and photographed. Size markers are shown in lane 2. Arrows indicate the position of the VEGF162 bands.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   VEGF162 induces proliferation of human umbilical vein-derived endothelial cells. Human umbilical vein-derived endothelial cells were seeded (20,000 cells/well) and stimulated with increasing concentrations of VEGF162 added every other day as described. After 4 days, the cells were counted in a Coulter counter. The activity is shown in comparison with the activity of a saturating concentration of VEGF165 (5 ng/ml) done in the same experiment.

Exon 6B Inhibits the Binding of VEGF162 to Extracellular Matrix as Compared with VEGF145-- Although VEGF165 and VEGF145 display an almost identical affinity toward heparin, VEGF165 binds less efficiently than VEGF145 to a native basement membrane produced by corneal endothelial cells (Fig. 4B) (4). The presence of exon 6B is the only difference that distinguishes VEGF162 from VEGF145. To find out whether exon 6B influences the ability to bind to this basement membrane, we incubated basement membrane-coated 24-well dishes with increasing concentrations of VEGF145 or VEGF162 as described previously using antibodies directed against VEGF to detect bound VEGF (4). VEGF145 bound to the basement membrane more efficiently at low concentrations, and at the maximal concentration tested (1 µg/ml), the amount of VEGF145 that bound to the basement membrane was 2-2.5-fold higher than the amount of bound VEGF162 (Fig. 4, A and B). In contrast, at this concentration, VEGF138 did not bind at all to the basement membrane despite the presence of exon 6B in this artificial VEGF form, indicating that exon 6B does not interact with extracellular matrices on its own. In that respect, VEGF138 behaved like VEGF121 (4). VEGF165 was able to bind to the basement membrane as reported previously (4), although it did so less efficiently than either VEGF145 or VEGF162 (Fig. 4B) (4). This result indicates that the peptide encoded by exon 6B may modulate exon 6A-mediated binding to basement membranes.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4.   A, VEGF145 binds more efficiently than VEGF162 to a basement membrane produced by corneal endothelial cells. Increasing concentrations of VEGF145 (open circle ) or VEGF162 (black-square) were bound to 24-well dishes coated with a basement membrane produced by corneal endothelial cells as described under "Experimental Procedures." The wells were then washed extensively, and bound VEGF was determined using antibodies directed against VEGF as described. Each point represents the average of three different measurements, and the error bars represent the S.D. B, comparison of the binding of various VEGF forms to basement membrane. One hundred ng of each VEGF form (1 µg/ml) were bound to 24-well dishes coated with a basement membrane produced by bovine corneal endothelial cells. The wells were then washed, and bound VEGF was determined as described in A. The experiment shown is a representative experiment that was repeated three times with similar results.

VEGF162 Induces Angiogenesis in Vivo-- To find out whether VEGF162 induces angiogenesis, we used the alginate bead assay (4), with modifications (28). Cells were cultured in alginate beads for 1 week to remove impurities from the alginate and to verify growth factor production and release. VEGF162 secretion into the medium was verified by Western blot analysis (data not shown). Clusters of alginate beads were injected subcutaneously into the flanks of nude mice. After 6 days, the animals were sacrificed. The clusters of alginate beads were removed and photographed. It can be seen that blood vessels have penetrated the clusters of beads containing VEGF162-producing cells (Fig. 5C) but not clusters of beads containing equal concentrations of empty vector-transfected cells (Fig. 5A). The inner surface of the skin adjacent to the clusters of beads containing VEGF162-expressing cells contained a higher density of blood vessels. At places in which new blood vessels that grew into the cluster of alginate beads were ripped, bloody leaks can be seen (Fig. 5D). The skin covering the clusters of control beads contained a lower density of blood vessels. Furthermore, the vessels were intact, and no ripped blood vessels were observed in any of the control animals (Fig. 5B). These results indicate that VEGF162 is able to induce angiogenesis in vivo.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 5.   VEGF162 induces angiogenesis in vivo. CHO cells expressing recombinant VEGF162 (C and D) or CHO cells transfected with empty expression vector (A and B) were embedded in alginate beads and implanted under the skin of nude mice as described. After a week, the beads were removed. The clusters of the beads (A and C) as well as the inner surface of the skin that was in contact with the beads (B and D) were photographed immediately.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

VEGF206 was identified as a nonsecreted VEGF form in which alternative splicing in the region of exon 6 of the VEGF mRNA resulted in a 41-amino acid insertion relative to the more widely distributed VEGF165. The insertion included the 24 amino acids found in VEGF189 (2) and 17 additional amino acids. These two different portions of exon 6 have become known as exons 6A and 6B. VEGF206 is a relatively rare form of VEGF that is not released into the conditioned medium of producing cells and is therefore difficult to study. The presence of exon 6B in VEGF206 indicated that exon 6B may be present in additional forms and that the properties of such forms may perhaps be studied more readily. We therefore set out to look for such forms.

We have found that A431 squamous carcinoma cells contain mRNA encoding an additional exon 6B-containing VEGF form. This form is identical to VEGF145 (4), except for the added amino acids encoded by exon 6B that lead to the production of a 162-amino acid-long VEGF form. This form may have been wrongly identified as VEGF165 because the mass of VEGF162 and the size of the mRNA encoding VEGF162 closely resemble VEGF165. Recombinant VEGF162 was secreted from CHO DHFR- cells and was biologically active as determined by endothelial cell proliferation assays and by its ability to induce angiogenesis in vivo. In these properties, it does not appear to be significantly different from VEGF145. VEGF162 bound to a native basement membrane produced by corneal endothelial cells. It bound to the basement membrane less efficiently than VEGF145 but better than VEGF165, which binds to such matrices relatively inefficiently, despite the substantial affinity that it displays toward heparin (4, 7). The synthetic VEGF form VEGF138, which contains exon 6B but lacks exon 6A, was not able to bind to this basement membrane, behaving very similarly in this respect to VEGF121 (4). It can therefore be concluded that exon 6B does not contribute to VEGF binding to the extracellular matrix. Rather, exon 6B seems to interfere with the interaction of exon 6A with basement membrane components, leading to a decreased extracellular matrix binding ability as compared with VEGF145. However, the interaction of VEGF162 with the basement membrane is still somewhat stronger than that of VEGF165.

The evidence gathered in the past decade indicates that apparently insignificant differences in the properties of the VEGF splice forms have turned out to be biologically meaningful. Mice expressing only VEGF120 or VEGF188 develop abnormally, even if these VEGF forms are expressed at levels comparable with the expression levels of all VEGF forms put together (17-19, 30). These changes are the result of differential affinities to heparan sulfate proteoglycans and extracellular matrix components, differential recognition of VEGF receptors, and differential susceptibility to reactive oxygen species (8, 14-16, 31). These differences imply that certain forms of VEGF may act more efficiently than other forms in specific microenvironments and suggest that the differential splicing of VEGF may be more tightly regulated than is currently appreciated. Some evidence supporting such tight regulation is already available. For example, it was found that progesterone selectively up-regulates the expression of VEGF189 in decidual cells (32).

To conclude, we have characterized a new, secreted, biologically active VEGF splice form. Whether this VEGF splice form has a biological role distinct from that of other VEGF forms is unclear at the moment, and it is not known whether there exist specific mechanisms that regulate the synthesis of the VEGF162 mRNA. Tools that allow easy discrimination between the expression patterns of VEGF162 and the other splice forms will have to be developed to study the in vivo expression patterns of VEGF162. The elucidation of these questions, as well as the design of experiments aimed at the identification of the specific biological roles of VEGF162, will most likely be the focus for the continuation of the research in the near future.

    ACKNOWLEDGEMENTS

We thank Dr. Ofra Kessler for critical comments and excellent technical tips. We thank Dr. Israel Vlodavsky for invaluable help with basement membrane binding experiments.

    FOOTNOTES

* This research was supported by grants from Collateral Therapeutics Inc. and the Israel Science Foundation (to G. N.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 972-8523672; Fax: 972-8523947; E-mail: gera@tx.technion.ac.il.

Published, JBC Papers in Press, February 21, 2003, DOI 10.1074/jbc.M212224200

    ABBREVIATIONS

The abbreviations used are: VEGF, vascular endothelial growth factor; CHO, Chinese hamster ovary; DHFR, dihydrofolate reductase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Tischer, E., Mitchell, R., Hartman, T., Silva, M., Gospodarowicz, D., Fiddes, J. C., and Abraham, J. A. (1991) J. Biol. Chem. 266, 11947-11954[Abstract/Free Full Text]
2. Houck, K. A., Ferrara, N., Winer, J., Cachianes, G., Li, B., and Leung, D. W. (1991) Mol. Endocrinol. 5, 1806-1814[Abstract]
3. Neufeld, G., Cohen, T., Gitay-Goren, H., Poltorak, Z., Tessler, S., Gengrinovitch, S., and Levi, B.-Z. (1996) Cancer Metastasis Rev. 15, 153-158[CrossRef][Medline] [Order article via Infotrieve]
4. Poltorak, Z., Cohen, T., Sivan, R., Kandelis, Y., Spira, G., Vlodavsky, I., Keshet, E., and Neufeld, G. (1997) J. Biol. Chem. 272, 7151-7158[Abstract/Free Full Text]
5. Keyt, B. A., Nguyen, H. V., Berleau, L. T., Duarte, C. M., Park, J., Chen, H., and Ferrara, N. (1996) J. Biol. Chem. 271, 5638-5646[Abstract/Free Full Text]
6. Houck, K. A., Leung, D. W., Rowland, A. M., Winer, J., and Ferrara, N. (1992) J. Biol. Chem. 267, 26031-26037[Abstract/Free Full Text]
7. Park, J. E., Keller, G. A., and Ferrara, N. (1993) Mol. Biol. Cell 4, 1317-1326[Abstract]
8. Neufeld, G., Cohen, T., Gengrinovitch, S., and Poltorak, Z. (1999) FASEB J. 13, 9-22[Abstract/Free Full Text]
9. Bates, D. O., Cui, T. G., Doughty, J. M., Winkler, M., Sugiono, M., Shields, J. D., Peat, D., Gillatt, D., and Harper, S. J. (2002) Cancer Res. 62, 4123-4131[Abstract/Free Full Text]
10. Whittle, C., Gillespie, K., Harrison, R., Mathieson, P. W., and Harper, S. J. (1999) Clin. Sci. (Lond.) 97, 303-312[Medline] [Order article via Infotrieve]
11. Meiron, M., Anunu, R., Scheinman, E. J., Hashmueli, S., and Levi, B. Z. (2001) Biochem. Biophys. Res. Commun. 282, 1053-1060[CrossRef][Medline] [Order article via Infotrieve]
12. Neufeld, G., Cohen, T., Shraga, N., Lange, T., Kessler, O., and Herzog, Y. (2002) Trends Cardiovasc. Med. 12, 13-19[CrossRef][Medline] [Order article via Infotrieve]
13. Liu, B. P., and Strittmatter, S. M. (2001) Curr. Opin. Cell Biol. 13, 619-626[CrossRef][Medline] [Order article via Infotrieve]
14. Gitay-Goren, H., Cohen, T., Tessler, S., Soker, S., Gengrinovitch, S., Rockwell, P., Klagsbrun, M., Levi, B.-Z., and Neufeld, G. (1996) J. Biol. Chem. 271, 5519-5523[Abstract/Free Full Text]
15. Soker, S., Takashima, S., Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998) Cell 92, 735-745[CrossRef][Medline] [Order article via Infotrieve]
16. Gluzman-Poltorak, Z., Cohen, T., Herzog, Y., and Neufeld, G. (2000) J. Biol. Chem. 275, 18040-18045[Abstract/Free Full Text]
17. Stalmans, I., Ng, Y. S., Rohan, R., Fruttiger, M., Bouche, A., Yuce, A., Fujisawa, H., Hermans, B., Shani, M., Jansen, S., Hicklin, D., Anderson, D. J., Gardiner, T., Hammes, H. P., Moons, L., Dewerchin, M., Collen, D., Carmeliet, P., and D'Amore, P. A. (2002) J. Clin. Invest. 109, 327-336[CrossRef][Medline] [Order article via Infotrieve]
18. Carmeliet, P., Ng, Y. S., Nuyens, D., Theilmeier, G., Brusselmans, K., Cornelissen, I., Ehler, E., Kakkar, V. V., Stalmans, I., Mattot, V., Perriard, J. C., Dewerchin, M., Flameng, W., Nagy, A., Lupu, F., Moons, L., Collen, D., D'Amore, P. A., and Shima, D. T. (1999) Nat. Med. 5, 495-502[CrossRef][Medline] [Order article via Infotrieve]
19. Ruhrberg, C., Gerhardt, H., Golding, M., Watson, R., Ioannidou, S., Fujisawa, H., Betsholtz, C., and Shima, D. T. (2002) Genes Dev. 16, 2684-2698[Abstract/Free Full Text]
20. Cohen, T., Gitay-Goren, H., Neufeld, G., and Levi, B.-Z. (1992) Growth Factors 7, 131-138[Medline] [Order article via Infotrieve]
21. Ciudad, C. J., Urlaub, G., and Chasin, L. A. (1988) J. Biol. Chem. 263, 16274-16282[Abstract/Free Full Text]
22. Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A., and Rutter, W. J. (1986) Cell 45, 721-732[CrossRef][Medline] [Order article via Infotrieve]
23. Urlaub, G., and Chasin, L. A. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 4216-4220[Abstract/Free Full Text]
24. Cohen, T., Gitay-Goren, H., Sharon, R., Shibuya, M., Halaban, R., Levi, B.-Z., and Neufeld, G. (1995) J. Biol. Chem. 270, 11322-11326[Abstract/Free Full Text]
25. Neufeld, G., and Gospodarowicz, D. (1988) J. Cell. Physiol. 136, 537-542[CrossRef][Medline] [Order article via Infotrieve]
26. Neufeld, G., and Gospodarowicz, D. (1987) J. Cell. Physiol. 132, 287-294[CrossRef][Medline] [Order article via Infotrieve]
27. Vlodavsky, I., Lui, G. M., and Gospodarowicz, D. (1980) Cell 19, 607-616[CrossRef][Medline] [Order article via Infotrieve]
28. Joki, T., Machluf, M., Atala, A., Zhu, J., Seyfried, N. T., Dunn, I. F., Abe, T., Carroll, R. S., and Black, P. M. (2001) Nat. Biotechnol. 19, 35-39[CrossRef][Medline] [Order article via Infotrieve]
29. Peretz, D., Gitay-Goren, H., Safran, M., Kimmel, N., Gospodarowicz, D., and Neufeld, G. (1992) Biochem. Biophys. Res. Commun. 182, 1340-1347[CrossRef][Medline] [Order article via Infotrieve]
30. Mattot, V., Moons, L., Lupu, F., Chernavvsky, D., Gomez, R. A., Collen, D., and Carmeliet, P. (2002) J. Am. Soc. Nephrol. 13, 1548-1560[Abstract/Free Full Text]
31. Gengrinovitch, S., Berman, B., David, G., Witte, L., Neufeld, G., and Ron, D. (1999) J. Biol. Chem. 274, 10816-10822[Abstract/Free Full Text]
32. Ancelin, M., Buteau-Lozano, H., Meduri, G., Osborne-Pellegrin, M., Sordello, S., Plouet, J., and Perrot-Applanat, M. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 6023-6028[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Bastide, Z. Karaa, S. Bornes, C. Hieblot, E. Lacazette, H. Prats, and C. Touriol
An upstream open reading frame within an IRES controls expression of a specific VEGF-A isoform
Nucleic Acids Res., April 1, 2008; 36(7): 2434 - 2445.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
N. Shraga-Heled, O. Kessler, C. Prahst, J. Kroll, H. Augustin, and G. Neufeld
Neuropilin-1 and neuropilin-2 enhance VEGF121 stimulated signal transduction by the VEGFR-2 receptor
FASEB J, March 1, 2007; 21(3): 915 - 926.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. Segev, N. Nili, and B. H Strauss
The role of perlecan in arterial injury and angiogenesis
Cardiovasc Res, September 1, 2004; 63(4): 603 - 610.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
N. Ferrara
Vascular Endothelial Growth Factor: Basic Science and Clinical Progress
Endocr. Rev., August 1, 2004; 25(4): 581 - 611.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. Kessler, N. Shraga-Heled, T. Lange, N. Gutmann-Raviv, E. Sabo, L. Baruch, M. Machluf, and G. Neufeld
Semaphorin-3F Is an Inhibitor of Tumor Angiogenesis
Cancer Res., February 1, 2004; 64(3): 1008 - 1015.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/17164    most recent
M212224200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lange, T.
Right arrow Articles by Neufeld, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lange, T.
Right arrow Articles by Neufeld, G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.