![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 19, 17164-17169, May 9, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, December 2, 2002, and in revised form, February 3, 2003
The splice forms of vascular endothelial
growth factor (VEGF) differ in biological properties such as the
receptor types that they recognize and their interaction with heparan
sulfate proteoglycans. We have identified a new VEGF mRNA splice
form encoding a VEGF species containing 162 amino acids
(VEGF162) in human A431 ovarian carcinoma cells. This
novel mRNA contains the peptides encoded by exons 1-5, 6A, 6B, and
8 of the VEGF gene. Recombinant VEGF162 is biologically active. It induces proliferation of endothelial cells
in vitro and angiogenesis in vivo as determined
by the alginate bead assay. VEGF162 binds less efficiently
than VEGF145 but more efficiently than VEGF165
to a natural basement membrane produced by corneal endothelial cells.
VEGF138, an artificial VEGF form that contains exon
6B but lacks exons 6A and 7, did not bind to this basement membrane at
all, indicating that exon 6B probably interferes with the interaction
of exon 6A with heparin and heparan sulfate proteoglycans.
The various forms of vascular endothelial growth factor
(VEGF)1 are generated by
alternative splicing from a single gene (1-4). The domains encoded by
exons 1-5 of the VEGF gene contain information required for
the recognition of the tyrosine kinase VEGF receptors 1 (flt-1) and 2 (KDR/flk-1) (5) and are present in all the VEGF splice
forms. Most VEGF splice forms are distinguished by the presence or
absence of the peptides encoded by exons 6 and 7 of the VEGF
gene that code for two independent heparin-binding domains.
VEGF121 lacks both exons and does not bind to heparin. VEGF165 contains the exon 7-encoded peptide,
VEGF145 contains the peptide encoded by exon 6A, and
VEGF189 contains both exon 6A and exon 7 (3, 6-8).
VEGF206 has a structure similar to that of
VEGF189, except that it contains both exons 6A and 6B of
the VEGF gene. However, the contribution of exon 6B to the biological properties of VEGF206 has not been studied. The
amino acids encoded by exon 8 are present in most of the VEGF splice forms. However, it was recently found that in the novel VEGF form VEGF165b, the 6 amino acids encoded by exon 8 are replaced
by 6 amino acids derived from a putative ninth exon to yield a VEGF form that probably inhibits angiogenesis (9). In another recently described VEGF splice form, exon 8 is completely truncated to generate
a 148-amino acid form (10). In addition, it was recently found that
VEGF forms possessing an extended N termini of unknown function also
exist (11).
Most VEGF isoforms induce proliferation of vascular endothelial cells,
induce angiogenesis, and cause permeabilization of blood vessels (8).
Recently, certain differences between some common VEGF splice forms
have been reported. The neuropilin-1 and neuropilin-2 receptors
function as receptors for axon guidance factors belonging to the
semaphorin family (12, 13). It was found that both neuropilins also
function as VEGF receptors that differentiate between various forms of
VEGF (14, 15). Thus, VEGF121 cannot bind to either of the
neuropilins, whereas VEGF165 binds efficiently to both
receptors, and VEGF145 binds well to neuropilin-2 but not
to neuropilin-1 (16). Such differences are also reflected in the
functional properties of the VEGF splice forms. It was found that mice
expressing only VEGF121 do not develop properly (17, 18)
because the heparan sulfate-binding VEGF forms are required for correct
branching of blood vessels during development (19). Likewise, mice
expressing only VEGF189 display impaired arterial
development (17), suggesting that each VEGF form possesses specific
characteristics and that the various VEGF forms complement each other
to achieve a balanced angiogenic response.
Exon 6B was first identified in VEGF206 (Fig.
1C), but the effect of exon 6B on the biological properties
of VEGF206 had not been studied because
VEGF206, like VEGF189, is not secreted into the
medium of cells that produce these VEGF forms and is thus difficult to isolate and characterize. We report here the
identification of a new exon 6B-containing form of VEGF expressed by
A431 ovarian carcinoma cells. This VEGF form is 162 amino acids long
(VEGF162). In this work, we have characterized the
properties of VEGF162 and compared them with those of the
closely related VEGF145 and those of VEGF138,
an artificial exon 6B-containing VEGF form.
Materials--
Human recombinant VEGF165 was
purified from Sf-9 insect cells as described previously (20). The
pDCHIP11 plasmid (containing the DHFR minigene) was kindly
provided by Dr. Lawrence Chasin (Columbia University, New York, NY)
(21). Rabbit polyclonal antibody directed against VEGF was produced in
our laboratory as described previously (20). Monoclonal anti-VEGF
antibodies (V4758), peroxidase-conjugated anti-rabbit IgG antibodies,
and alkaline phosphatase-conjugated anti-rabbit IgG antibodies were purchased from Sigma. The EZ-ECL kit was from Biological Industries Inc. (Beth Haemek, Israel). Heparin-Sepharose was purchased from Pharmacia Corporation. Tissue culture plasticware was from
Corning. Tissue culture media were obtained from Invitrogen. Other
tissue culture reagents were from Biological Industries Inc.
Detection of VEGF162 mRNA in Cells--
Total
mRNA was prepared from A431 human ovarian carcinoma cells.
Complementary DNA was synthesized from 5 µg of total RNA using
Moloney murine leukemia virus reverse transcriptase (Promega). A
specific oligonucleotide derived from the 3'-untranslated region of VEGF mRNA (nucleotides 908-931, GGGTGTGTCTACAGGAATCCCAG) was used
as a primer. The reaction was carried out for 1 h at 37 °C and
for 30 min at 42 °C, and the enzyme was then inactivated by a 10-min
incubation at 90 °C. PCR amplification was carried out in the
presence of 5 units of Extaq Taq polymerase (Takara), 1 mM of each deoxynucleotide triphosphate, and 20 pmol of
each primer. The oligonucleotides used as primers for the PCR reaction
were CGGGATCCGAAACCATGAACTTTCTGC, corresponding to the first 9 N-terminal amino acids of the VEGF coding region, and
CTTCCGGGCTCGGTGATTTAGCAG, corresponding to a sequence from the
3'-untranslated region of human VEGF (nucleotides 867-891). Each of
the 30 amplification cycles consisted of a 40-s incubation at 94 °C,
a 1.5-min incubation at 63 °C, and a 1.5-min incubation at
72 °C.
The PCR products were precipitated, and an additional stage of nested
PCR was performed, using internal primers specific for VEGF162: CGAATTCTGCCTTGCTGCTCTACCTCCACCAT,
corresponding to amino acids 17-25 of the VEGF coding region, and
GCTTGTCACATTGGGGGCCA, corresponding to amino acids 184-190 of
VEGF162, located at the junction between exons 6B and 8 of
the VEGF gene. The same amplification protocol was used for this step.
However, the annealing temperature was raised to 68 °C to exclude
nonspecific products as much as possible.
Construction of VEGF138- and
VEGF162-encoding Expression Vectors and Production of
Recombinant VEGF162--
The VEGF162 cDNA
was subcloned into the EcoRI site of the PECE
expression vector (22). The PECE/VEGF162 vector was
transfected into DG44 Chinese hamster ovary cells (CHO DHFR
To partially purify the VEGF162 protein, serum-free
conditioned medium was applied to a heparin-Sepharose column. The
column was pre-equilibrated with wash buffer (10 mM Tris,
pH 7.5, 150 mM NaCl). The conditioned medium was loaded on
this column. The column was then washed extensively with wash buffer
and then washed with wash buffer containing 250 mM NaCl.
Elution was performed with the same buffer containing 800 mM NaCl. This procedure was almost identical to the
procedure used for the purification of VEGF145 (4).
To obtain a cDNA encoding VEGF138, we amplified
the VEGF145 cDNA by PCR using the 3' primer
5'-CGGGATCCTCACCGCCTCGGCTTGTCACATTGGGGGCCAGGGAGGCTCCAGGGCATTAGACAGCAGCGGGCACCAACGTACTTTTCTTGTCTTGCTCT-3' containing the entire exon 8 sequence fused to exon 6B and the last 17 bp of exon 5. The 5' primer was 5'-CGGGATCCGAAACCATGAACTTTCTGC-3' derived from the 5' end of the VEGF cDNA. The annealing
temperature was 55 °C. The PCR product was subcloned into the PECE
expression vector (22) and expressed in DHFR
Purification of VEGF138 from serum-free medium of the
VEGF138-expressing cells was achieved by chromatography on
a phenyl-Sepharose column followed by ion exchange chromatography as
described for VEGF121 (24).
The protein concentrations in various VEGFs were determined using the
BioRad protein assay according to the instructions of the vendor. The
VEGF content was also assessed semiquantitatively by comparing VEGF
concentrations in samples containing equal amounts of protein using
Western blot analysis as described previously (20).
Cell Proliferation Assays--
Human umbilical vein-derived
endothelial cells were prepared from umbilical veins as described
previously (25) and cultured in M199 medium supplemented with 20%
fetal calf serum, vitamins, 2 mM glutamine, and
antibiotics. Basic fibroblast growth factor was added to the culture
every other day. For the proliferation assay, cells were plated in
24-well dishes at 20,000 cells/well. After attachment, the medium was
replaced by the same medium containing 1% fetal calf serum, and
various concentrations of VEGF were added. The cells received a second
dose of VEGF 48 h after the beginning of the experiment, and
48 h later, the cells were trypsinized and counted in a Coulter counter.
Binding of VEGF to Extracellular Matrix-coated
Dishes--
Tissue culture dishes coated with extracellular matrix
secreted by bovine corneal endothelial cells were prepared as described previously (26, 27) or were kindly donated by Dr. Israel Vlodavsky (Technion, Israel). Binding experiments were performed at room temperature. The extracellular matrix-coated wells were washed five
times with rinse buffer (10 mM Tris-HCl, pH 7.2, 150 mM NaCl, 0.1% Tween 20). Nonspecific sites were blocked
with binding buffer (20 mM K2HPO4,
10 mM KH2PO4, 1 mM
EDTA, 0.8% NaCl, 1 mg/ml bovine serum albumin, pH 7.2) for 1 h.
The binding buffer was aspirated, and dishes were incubated in a final
volume of 0.1 ml of binding buffer for 2 h with various amounts of
VEGF forms. The dishes were then washed five times with rinse buffer.
Bound VEGF was detected using an anti-VEGF monoclonal antibody that was
bound to the dishes in binding buffer for 2 h. This antibody
recognizes all the VEGF splice forms equally well in Western blot
analysis (data not shown). Dishes were again washed five times with
rinse buffer. Bound antibody was detected using anti-mouse alkaline phosphatase-conjugated antibody as described previously (4).
Alginate Bead Angiogenesis Assay--
CHO-VEGF162
and CHO-pDCHIP11 cells were encapsulated within microspheres composed
of Ca2+-alginate and a polyelectrolyte
poly-L-(lysine) (4, 28). Briefly, cells were resuspended in
sodium alginate in saline (1.2% (w/v); Pronova Ultra Pure MVG) to a
final ratio of 1.5 × 106 cells/ml alginate.
The suspension was sprayed through a 22-gauge needle located inside an
air jet-head droplet-forming apparatus into a solution of
HEPES-buffered calcium chloride (13 mM HEPES, 1.5% (w/v)
CaCl2, pH 7.4; Sigma), where the droplets gelled for 20 min. The alginate microspheres were coated with 0.1% (w/v) poly-L-(lysine) (Mr 27,000;
Sigma) in saline for 12 min with gentle agitation. Capsules were washed
three times in HEPES and then suspended in culture media. Clusters of
alginate beads were injected subcutaneously into nude mice. The
clusters of beads were removed after 6 days and examined using a
dissecting microscope.
Human A431 Squamous Carcinoma-derived Cells Express
VEGF162 mRNA--
The presence of the peptide encoded
by exon 6B in VEGF206 (2) (Fig.
1C) indicates that this
peptide may be present in additional forms of VEGF. We have used a
primer derived from the 3'-untranslated region of the VEGF mRNA
(nucleotides 827-850) to generate first-strand cDNA species from
total RNA prepared from several human tumor-derived cell lines. We
subsequently used a 3' primer corresponding to a hypothetical junction
between exon 6B and exon 8 in conjunction with a 5' primer
corresponding to the beginning of the VEGF mRNA to amplify the
cDNA in order to detect exon 6B-containing VEGF splice forms
differing from VEGF206. Using these primers, we have found
that A431 squamous carcinoma cells contain a VEGF mRNA of a size
corresponding to a VEGF mRNA species that contains exons 1-5, 6A,
6B, and 8 (Fig. 1A, lane 1). No amplified
cDNA could be detected in an identical control experiment in which
the reverse transcriptase enzyme was omitted (Fig. 1A,
lane 2). The structure of this new VEGF cDNA was
verified by sequencing, and it did indeed correspond to the expected
sequence of a VEGF splice form encoding a 162-amino acid-long
form of VEGF (VEGF162) (Fig. 1C).
Because the 3' primer used corresponded to a hypothetical exon 6B/exon
8 junction, it could perhaps have hybridized via the exon 6B matching
portion of the primer to an exon 6B-containing cDNA such as that
encoding VEGF206 during the PCR amplification stage. Such
amplification would generate the VEGF162 cDNA, even though VEGF162 mRNA was not present. This possibility
is somewhat unlikely because the annealing temperature we used was
68 °C, making annealing between VEGF206 and the 10 exon
6B-derived bases of the primer difficult. Nevertheless, to exclude this
possibility, we tried to find out whether the primer pair we used to
amplify the VEGF162 cDNA is able to amplify cDNAs
encoding VEGF splice forms other than VEGF162. The pair of
primers successfully amplified cDNAs encoding VEGF138
(an artificial cDNA containing exons 1-5, 6B, and 8; Fig.
1C; Fig. 1B, lane 2) and
VEGF162 (Fig. 1B, lane 4). However,
we have not been able to amplify any other VEGF cDNA including the
cDNA encoding VEGF206 (Fig. 1B, lane
8) with this pair of primers under the conditions that we used to
amplify the VEGF162 cDNA derived from the A431 cells.
This experiment therefore indicates that the VEGF162
cDNA was indeed generated from a natural mRNA species
encoding VEGF162.
Recombinant VEGF162 Induces Proliferation of
Endothelial Cells in Vitro--
To study the biological properties of
VEGF162 and to compare them with those of other VEGF splice
forms, we produced recombinant VEGF162. The
VEGF162 cDNA was subcloned into the PECE expression vector (22) and co-transfected into CHO DHFR Exon 6B Inhibits the Binding of VEGF162 to
Extracellular Matrix as Compared with
VEGF145--
Although VEGF165 and
VEGF145 display an almost identical affinity toward
heparin, VEGF165 binds less efficiently than
VEGF145 to a native basement membrane produced by corneal
endothelial cells (Fig. 4B)
(4). The presence of exon 6B is the only difference that distinguishes
VEGF162 from VEGF145. To find out whether exon 6B influences the ability to bind to this basement membrane, we incubated basement membrane-coated 24-well dishes with increasing concentrations of VEGF145 or VEGF162 as
described previously using antibodies directed against VEGF to detect
bound VEGF (4). VEGF145 bound to the basement membrane more
efficiently at low concentrations, and at the maximal concentration
tested (1 µg/ml), the amount of VEGF145 that bound to the
basement membrane was 2-2.5-fold higher than the amount of bound
VEGF162 (Fig. 4, A and B). In
contrast, at this concentration, VEGF138 did not bind at
all to the basement membrane despite the presence of exon 6B in this
artificial VEGF form, indicating that exon 6B does not interact with
extracellular matrices on its own. In that respect, VEGF138
behaved like VEGF121 (4). VEGF165 was able to
bind to the basement membrane as reported previously (4), although it
did so less efficiently than either VEGF145 or
VEGF162 (Fig. 4B) (4). This result indicates
that the peptide encoded by exon 6B may modulate exon 6A-mediated
binding to basement membranes.
VEGF162 Induces Angiogenesis in Vivo--
To find out
whether VEGF162 induces angiogenesis, we used the alginate
bead assay (4), with modifications (28). Cells were cultured in
alginate beads for 1 week to remove impurities from the alginate
and to verify growth factor production
and release. VEGF162 secretion into the medium was verified
by Western blot analysis (data not shown). Clusters of alginate beads
were injected subcutaneously into the flanks of nude mice. After 6 days, the animals were sacrificed. The clusters of alginate beads were
removed and photographed. It can be seen that blood vessels have
penetrated the clusters of beads containing
VEGF162-producing cells (Fig. 5C) but not
clusters of beads containing equal concentrations of empty
vector-transfected cells (Fig. 5A). The inner surface of the
skin adjacent to the clusters of beads containing
VEGF162-expressing cells contained a higher density of
blood vessels. At places in which new blood vessels that grew into the
cluster of alginate beads were ripped, bloody leaks can be seen (Fig.
5D). The skin covering the clusters of control beads
contained a lower density of blood vessels. Furthermore, the vessels
were intact, and no ripped blood vessels were observed in any of the
control animals (Fig. 5B). These results indicate that
VEGF162 is able to induce angiogenesis in
vivo.
VEGF206 was identified as a nonsecreted VEGF form in
which alternative splicing in the region of exon 6 of the VEGF mRNA
resulted in a 41-amino acid insertion relative to the more widely
distributed VEGF165. The insertion included the 24 amino
acids found in VEGF189 (2) and 17 additional amino acids.
These two different portions of exon 6 have become known as exons 6A
and 6B. VEGF206 is a relatively rare form of VEGF that is
not released into the conditioned medium of producing cells and is
therefore difficult to study. The presence of exon 6B in
VEGF206 indicated that exon 6B may be present in additional
forms and that the properties of such forms may perhaps be studied more
readily. We therefore set out to look for such forms.
We have found that A431 squamous carcinoma cells contain mRNA
encoding an additional exon 6B-containing VEGF form. This form is
identical to VEGF145 (4), except for the added amino acids encoded by exon 6B that lead to the production of a 162-amino acid-long
VEGF form. This form may have been wrongly identified as
VEGF165 because the mass of VEGF162 and the
size of the mRNA encoding VEGF162 closely resemble
VEGF165. Recombinant VEGF162 was secreted from
CHO DHFR The evidence gathered in the past decade indicates that apparently
insignificant differences in the properties of the VEGF splice forms
have turned out to be biologically meaningful. Mice expressing only
VEGF120 or VEGF188 develop abnormally, even if these VEGF forms are expressed at levels comparable with the expression levels of all VEGF forms put together (17-19, 30). These changes are
the result of differential affinities to heparan sulfate proteoglycans and extracellular matrix components, differential recognition of VEGF
receptors, and differential susceptibility to reactive oxygen species
(8, 14-16, 31). These differences imply that certain forms of VEGF may
act more efficiently than other forms in specific microenvironments and
suggest that the differential splicing of VEGF may be more tightly
regulated than is currently appreciated. Some evidence supporting such
tight regulation is already available. For example, it was found that
progesterone selectively up-regulates the expression of
VEGF189 in decidual cells (32).
To conclude, we have characterized a new, secreted, biologically active
VEGF splice form. Whether this VEGF splice form has a biological role
distinct from that of other VEGF forms is unclear at the moment, and it
is not known whether there exist specific mechanisms that regulate the
synthesis of the VEGF162 mRNA. Tools that allow easy
discrimination between the expression patterns of VEGF162
and the other splice forms will have to be developed to study the
in vivo expression patterns of VEGF162. The
elucidation of these questions, as well as the design of experiments
aimed at the identification of the specific biological roles of
VEGF162, will most likely be the focus for the continuation
of the research in the near future.
We thank Dr. Ofra Kessler for critical
comments and excellent technical tips. We thank Dr. Israel Vlodavsky
for invaluable help with basement membrane binding experiments.
*
This research was supported by grants from Collateral
Therapeutics Inc. and the Israel Science Foundation (to G. N.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. Tel.: 972-8523672;
Fax: 972-8523947; E-mail: gera@tx.technion.ac.il.
Published, JBC Papers in Press, February 21, 2003, DOI 10.1074/jbc.M212224200
The abbreviations used are:
VEGF, vascular
endothelial growth factor;
CHO, Chinese hamster ovary;
DHFR, dihydrofolate reductase.
VEGF162, A New Heparin-binding Vascular Endothelial
Growth Factor Splice Form That Is Expressed in Transformed Human
Cells*
,
,
¶
Department of Cell Biology and Anatomy, The
Bruce Rappaport Faculty of Medicine, Technion, Israel Institute of
Technology, P. O. Box 9697, 1 Efron Street, Haifa 31096, Israel and
§ Faculty of Biotechnology and Food Engineering,
Technion-Institute of Technology, Haifa 32000, Israel
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
cells)
(23), along with the pDCHIP11 plasmid, which contains the
DHFR minigene (21). Cells were selected using minimum
Eagle's medium
lacking nucleosides. Increasing concentrations of
methotrexate were used to amplify the VEGF162 cDNA to
enhance VEGF162 production. The maximal concentration of
methotrexate used was 100 nM. The concentrations of
VEGF162 in the conditioned medium of
VEGF162-producing cells were assessed using
anti-VEGF antibodies.
CHO cells as described
for VEGF162.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (43K):
[in a new window]
Fig. 1.
A, expression of
VEGF162 mRNA in A431 cells. RNA from A431 cells
was reverse-transcribed using a primer derived from the 3'-untranslated
region of the VEGF mRNA as described. The cDNA was then
amplified using a 3' primer corresponding to the 3' end of exon 6B
fused to exon 8 and a 5' primer derived from the 5' end of the VEGF
coding sequence as described. Lane 1, amplification of
A431-derived RNA; lane 2, control without reverse
transcriptase; lane 3, PCR using as substrate plasmid
containing the VEGF138 cDNA; lane 4, PCR
using as substrate plasmid containing the VEGF162
cDNA. The experiment was repeated three times with similar results.
B, VEGF cDNAs encoding VEGF forms lacking a junction
between exons 6B and 8 are not amplified by the primers used to detect
the VEGF162 cDNA. PCR was performed using the same
conditions described for the experiment shown in A. Plasmids
containing cDNAs encoding known forms of VEGF were used as
templates. Lane 1, VEGF121; lane 2,
VEGF138; lane 3, VEGF145; lane
4, VEGF162; lane 5, VEGF165;
lane 6, VEGF189; lane 7,
VEGF162; lane 8, VEGF206.
C, the VEGF splice forms. The various VEGF splice forms that
contain the peptide encoded by exon 8 are shown. Exons are not drawn to
scale. VEGF138 is an artificial construct.
cells (23). Clones
expressing relatively large amounts of VEGF162 were
initially isolated using a selective medium lacking nucleosides, and
the integrated VEGF162 cDNA was further amplified using
methotrexate (23). Conditioned medium from such cells, but not
conditioned medium from empty vector-transfected cells, contained
immunoreactive VEGF162 (Fig.
2A). The VEGF162
was partially purified using a heparin-Sepharose affinity column. It
was eluted from the column with 0.8 M NaCl and used for
additional experiments. At this stage, it was about 80% pure (Fig.
2B, lane 3). VEGF162 migrated as two bands in reduced SDS-PAGE gels, as do all the other VEGF forms (see,
for example, VEGF165, Fig. 2B, lane
1) (4, 29). The upper band probably contains glycosylated
VEGF162, as is the case with VEGF165 (29).
VEGF162 was biologically active and induced proliferation
of human umbilical vein-derived endothelial cells with an
ED50 of about 10 ng/ml (Fig.
3). This value is somewhat lower than the
ED50 of VEGF145 (30 ng/ml) (4), indicating that these two VEGF forms, which differ only by the presence of exon 6B in
VEGF162, have similar biological potencies (4).

View larger version (38K):
[in a new window]
Fig. 2.
A, expression of recombinant
VEGF162. CHO cells transfected with expression vector
containing the VEGF162 cDNA (lane 2) or CHO
cells transfected with empty vector (lane 1) were grown to
confluence. The medium was changed to serum-free medium and collected
48 h later. Aliquots of 30 µl were separated on a 14% SDS-PAGE
gel and blotted onto nitrocellulose. VEGF was detected using polyclonal
antibodies directed against VEGF as described previously (4, 20).
B, purification of VEGF162. Recombinant
VEGF165 (0.5 µg) purified from baculovirus (20)
(lane 1) or VEGF162 purified by
heparin-Sepharose affinity chromatography from 20 ml of conditioned
medium of VEGF162-expressing CHO cells (lane 3)
was chromatographed on a 14% SDS-PAGE gel. The gel was silver-stained
and photographed. Size markers are shown in lane 2. Arrows indicate the position of the VEGF162
bands.

View larger version (14K):
[in a new window]
Fig. 3.
VEGF162 induces proliferation of
human umbilical vein-derived endothelial cells. Human umbilical
vein-derived endothelial cells were seeded (20,000 cells/well) and
stimulated with increasing concentrations of VEGF162 added
every other day as described. After 4 days, the cells were counted in a
Coulter counter. The activity is shown in comparison with the activity
of a saturating concentration of VEGF165 (5 ng/ml) done in
the same experiment.

View larger version (18K):
[in a new window]
Fig. 4.
A, VEGF145 binds more
efficiently than VEGF162 to a basement membrane produced by
corneal endothelial cells. Increasing concentrations of
VEGF145 (
) or VEGF162 (
) were bound to
24-well dishes coated with a basement membrane produced by corneal
endothelial cells as described under "Experimental Procedures." The
wells were then washed extensively, and bound VEGF was determined using
antibodies directed against VEGF as described. Each point
represents the average of three different measurements, and the
error bars represent the S.D. B, comparison of
the binding of various VEGF forms to basement membrane. One hundred ng
of each VEGF form (1 µg/ml) were bound to 24-well dishes coated with
a basement membrane produced by bovine corneal endothelial cells. The
wells were then washed, and bound VEGF was determined as described in
A. The experiment shown is a representative experiment that
was repeated three times with similar results.

View larger version (57K):
[in a new window]
Fig. 5.
VEGF162 induces angiogenesis
in vivo. CHO cells expressing recombinant
VEGF162 (C and D) or CHO cells
transfected with empty expression vector (A and
B) were embedded in alginate beads and implanted under the
skin of nude mice as described. After a week, the beads were removed.
The clusters of the beads (A and C) as well as
the inner surface of the skin that was in contact with the beads
(B and D) were photographed immediately.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
cells and was biologically active as determined by
endothelial cell proliferation assays and by its ability to induce
angiogenesis in vivo. In these properties, it does not
appear to be significantly different from VEGF145. VEGF162 bound to a native basement membrane produced by
corneal endothelial cells. It bound to the basement membrane less
efficiently than VEGF145 but better than
VEGF165, which binds to such matrices relatively
inefficiently, despite the substantial affinity that it displays toward
heparin (4, 7). The synthetic VEGF form VEGF138, which
contains exon 6B but lacks exon 6A, was not able to bind to this
basement membrane, behaving very similarly in this respect to
VEGF121 (4). It can therefore be concluded that exon 6B
does not contribute to VEGF binding to the extracellular matrix.
Rather, exon 6B seems to interfere with the interaction of exon 6A with
basement membrane components, leading to a decreased extracellular
matrix binding ability as compared with VEGF145. However,
the interaction of VEGF162 with the basement membrane is
still somewhat stronger than that of VEGF165.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Tischer, E.,
Mitchell, R.,
Hartman, T.,
Silva, M.,
Gospodarowicz, D.,
Fiddes, J. C.,
and Abraham, J. A.
(1991)
J. Biol. Chem.
266,
11947-11954 2.
Houck, K. A.,
Ferrara, N.,
Winer, J.,
Cachianes, G.,
Li, B.,
and Leung, D. W.
(1991)
Mol. Endocrinol.
5,
1806-1814[Abstract]
3.
Neufeld, G.,
Cohen, T.,
Gitay-Goren, H.,
Poltorak, Z.,
Tessler, S.,
Gengrinovitch, S.,
and Levi, B.-Z.
(1996)
Cancer Metastasis Rev.
15,
153-158[CrossRef][Medline]
[Order article via Infotrieve]
4.
Poltorak, Z.,
Cohen, T.,
Sivan, R.,
Kandelis, Y.,
Spira, G.,
Vlodavsky, I.,
Keshet, E.,
and Neufeld, G.
(1997)
J. Biol. Chem.
272,
7151-7158 5.
Keyt, B. A.,
Nguyen, H. V.,
Berleau, L. T.,
Duarte, C. M.,
Park, J.,
Chen, H.,
and Ferrara, N.
(1996)
J. Biol. Chem.
271,
5638-5646 6.
Houck, K. A.,
Leung, D. W.,
Rowland, A. M.,
Winer, J.,
and Ferrara, N.
(1992)
J. Biol. Chem.
267,
26031-26037 7.
Park, J. E.,
Keller, G. A.,
and Ferrara, N.
(1993)
Mol. Biol. Cell
4,
1317-1326[Abstract]
8.
Neufeld, G.,
Cohen, T.,
Gengrinovitch, S.,
and Poltorak, Z.
(1999)
FASEB J.
13,
9-22 9.
Bates, D. O.,
Cui, T. G.,
Doughty, J. M.,
Winkler, M.,
Sugiono, M.,
Shields, J. D.,
Peat, D.,
Gillatt, D.,
and Harper, S. J.
(2002)
Cancer Res.
62,
4123-4131 10.
Whittle, C.,
Gillespie, K.,
Harrison, R.,
Mathieson, P. W.,
and Harper, S. J.
(1999)
Clin. Sci. (Lond.)
97,
303-312[Medline]
[Order article via Infotrieve]
11.
Meiron, M.,
Anunu, R.,
Scheinman, E. J.,
Hashmueli, S.,
and Levi, B. Z.
(2001)
Biochem. Biophys. Res. Commun.
282,
1053-1060[CrossRef][Medline]
[Order article via Infotrieve]
12.
Neufeld, G.,
Cohen, T.,
Shraga, N.,
Lange, T.,
Kessler, O.,
and Herzog, Y.
(2002)
Trends Cardiovasc. Med.
12,
13-19[CrossRef][Medline]
[Order article via Infotrieve]
13.
Liu, B. P.,
and Strittmatter, S. M.
(2001)
Curr. Opin. Cell Biol.
13,
619-626[CrossRef][Medline]
[Order article via Infotrieve]
14.
Gitay-Goren, H.,
Cohen, T.,
Tessler, S.,
Soker, S.,
Gengrinovitch, S.,
Rockwell, P.,
Klagsbrun, M.,
Levi, B.-Z.,
and Neufeld, G.
(1996)
J. Biol. Chem.
271,
5519-5523 15.
Soker, S.,
Takashima, S.,
Miao, H. Q.,
Neufeld, G.,
and Klagsbrun, M.
(1998)
Cell
92,
735-745[CrossRef][Medline]
[Order article via Infotrieve]
16.
Gluzman-Poltorak, Z.,
Cohen, T.,
Herzog, Y.,
and Neufeld, G.
(2000)
J. Biol. Chem.
275,
18040-18045 17.
Stalmans, I.,
Ng, Y. S.,
Rohan, R.,
Fruttiger, M.,
Bouche, A.,
Yuce, A.,
Fujisawa, H.,
Hermans, B.,
Shani, M.,
Jansen, S.,
Hicklin, D.,
Anderson, D. J.,
Gardiner, T.,
Hammes, H. P.,
Moons, L.,
Dewerchin, M.,
Collen, D.,
Carmeliet, P.,
and D'Amore, P. A.
(2002)
J. Clin. Invest.
109,
327-336[CrossRef][Medline]
[Order article via Infotrieve]
18.
Carmeliet, P.,
Ng, Y. S.,
Nuyens, D.,
Theilmeier, G.,
Brusselmans, K.,
Cornelissen, I.,
Ehler, E.,
Kakkar, V. V.,
Stalmans, I.,
Mattot, V.,
Perriard, J. C.,
Dewerchin, M.,
Flameng, W.,
Nagy, A.,
Lupu, F.,
Moons, L.,
Collen, D.,
D'Amore, P. A.,
and Shima, D. T.
(1999)
Nat. Med.
5,
495-502[CrossRef][Medline]
[Order article via Infotrieve]
19.
Ruhrberg, C.,
Gerhardt, H.,
Golding, M.,
Watson, R.,
Ioannidou, S.,
Fujisawa, H.,
Betsholtz, C.,
and Shima, D. T.
(2002)
Genes Dev.
16,
2684-2698 20.
Cohen, T.,
Gitay-Goren, H.,
Neufeld, G.,
and Levi, B.-Z.
(1992)
Growth Factors
7,
131-138[Medline]
[Order article via Infotrieve]
21.
Ciudad, C. J.,
Urlaub, G.,
and Chasin, L. A.
(1988)
J. Biol. Chem.
263,
16274-16282 22.
Ellis, L.,
Clauser, E.,
Morgan, D. O.,
Edery, M.,
Roth, R. A.,
and Rutter, W. J.
(1986)
Cell
45,
721-732[CrossRef][Medline]
[Order article via Infotrieve]
23.
Urlaub, G.,
and Chasin, L. A.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
4216-4220 24.
Cohen, T.,
Gitay-Goren, H.,
Sharon, R.,
Shibuya, M.,
Halaban, R.,
Levi, B.-Z.,
and Neufeld, G.
(1995)
J. Biol. Chem.
270,
11322-11326 25.
Neufeld, G.,
and Gospodarowicz, D.
(1988)
J. Cell. Physiol.
136,
537-542[CrossRef][Medline]
[Order article via Infotrieve]
26.
Neufeld, G.,
and Gospodarowicz, D.
(1987)
J. Cell. Physiol.
132,
287-294[CrossRef][Medline]
[Order article via Infotrieve]
27.
Vlodavsky, I.,
Lui, G. M.,
and Gospodarowicz, D.
(1980)
Cell
19,
607-616[CrossRef][Medline]
[Order article via Infotrieve]
28.
Joki, T.,
Machluf, M.,
Atala, A.,
Zhu, J.,
Seyfried, N. T.,
Dunn, I. F.,
Abe, T.,
Carroll, R. S.,
and Black, P. M.
(2001)
Nat. Biotechnol.
19,
35-39[CrossRef][Medline]
[Order article via Infotrieve]
29.
Peretz, D.,
Gitay-Goren, H.,
Safran, M.,
Kimmel, N.,
Gospodarowicz, D.,
and Neufeld, G.
(1992)
Biochem. Biophys. Res. Commun.
182,
1340-1347[CrossRef][Medline]
[Order article via Infotrieve]
30.
Mattot, V.,
Moons, L.,
Lupu, F.,
Chernavvsky, D.,
Gomez, R. A.,
Collen, D.,
and Carmeliet, P.
(2002)
J. Am. Soc. Nephrol.
13,
1548-1560 31.
Gengrinovitch, S.,
Berman, B.,
David, G.,
Witte, L.,
Neufeld, G.,
and Ron, D.
(1999)
J. Biol. Chem.
274,
10816-10822 32.
Ancelin, M.,
Buteau-Lozano, H.,
Meduri, G.,
Osborne-Pellegrin, M.,
Sordello, S.,
Plouet, J.,
and Perrot-Applanat, M.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
6023-6028
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
A. Bastide, Z. Karaa, S. Bornes, C. Hieblot, E. Lacazette, H. Prats, and C. Touriol An upstream open reading frame within an IRES controls expression of a specific VEGF-A isoform Nucleic Acids Res., April 1, 2008; 36(7): 2434 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shraga-Heled, O. Kessler, C. Prahst, J. Kroll, H. Augustin, and G. Neufeld Neuropilin-1 and neuropilin-2 enhance VEGF121 stimulated signal transduction by the VEGFR-2 receptor FASEB J, March 1, 2007; 21(3): 915 - 926. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Segev, N. Nili, and B. H Strauss The role of perlecan in arterial injury and angiogenesis Cardiovasc Res, September 1, 2004; 63(4): 603 - 610. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ferrara Vascular Endothelial Growth Factor: Basic Science and Clinical Progress Endocr. Rev., August 1, 2004; 25(4): 581 - 611. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Kessler, N. Shraga-Heled, T. Lange, N. Gutmann-Raviv, E. Sabo, L. Baruch, M. Machluf, and G. Neufeld Semaphorin-3F Is an Inhibitor of Tumor Angiogenesis Cancer Res., February 1, 2004; 64(3): 1008 - 1015. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |