JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M210486200 on February 28, 2003

J. Biol. Chem., Vol. 278, Issue 19, 17263-17268, May 9, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/19/17263    most recent
M210486200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moore, M. L.
Right arrow Articles by McMillin, J. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moore, M. L.
Right arrow Articles by McMillin, J. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Upstream Stimulatory Factor Represses the Induction of Carnitine Palmitoyltransferase-Ibeta Expression by PGC-1*

Meredith L. Moore, Edwards A. ParkDagger , and Jeanie B. McMillin§

From the Department of Pathology and Laboratory Medicine, The University of Texas Medical School at Houston, UT-Houston Health Science Center and the Graduate School of Biomedical Sciences, The Texas Medical Center, Houston, Texas 77030 and the Dagger  Department of Pharmacology, The University of Tennessee, Memphis, Tennessee 38163

Received for publication, October 13, 2002, and in revised form, February 20, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Transcriptional regulation of carnitine palmitoyltransferase-1beta (CPT-1beta ) is coordinated with contractile gene expression through cardiac-enriched transcription factors, GATA4 and SRF. Metabolic modulation of CPT-1beta promoter activity has been described with the stimulation of gene expression by oleate that is mediated through the peroxisome proliferator-activated receptor (PPAR) pathway. The coactivator, peroxisomal proliferator-activated receptor gamma  coactivator (PGC-1), enhances gene expression through interactions with nuclear hormone receptors and the myocyte enhancer factor 2 (MEF2) family. PGC-1 and MEF2A synergistically activate CPT-1beta promoter activity. This stimulation is enhanced by mutation of the E-box sequences that flank the MEF2A binding site. These elements bind the upstream stimulatory factors (USF1 and USF2), which activate transcription in CV-1 fibroblasts. However, overexpression of the USF proteins in myocytes depresses CPT-1beta activity and significantly reduces MEF2A and PGC-1 synergy. Co-immunoprecipitation studies demonstrate that PGC-1 and USF2 proteins can physically interact. Our studies demonstrate that PGC-1 stimulates CPT-1beta gene expression through MEF2A. USF proteins have a novel role in repressing the expression of the CPT-1beta gene and modulating the induction by the coactivator, PGC-1.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Carnitine palmitoyltransferase-1 (CPT-1)1 is located on the outer mitochondrial membrane and functions in the transport of fatty acids into the matrix for beta -oxidation. The beta  isoform (CPT-1beta ) is primarily expressed in skeletal and cardiac muscle and white adipose tissue (1). The alpha  isoform of CPT-1 (CPT-1alpha ) predominates in the remaining tissues and exhibits different kinetics from the muscle isoform. Early evidence suggests that CPT-1beta is transcriptionally up-regulated in response to electrical stimulation and consequent hypertrophic growth (2). The cardiac-enriched factors GATA4 and serum response factor (SRF) are synergistic activators of CPT-1beta expression (3). Because metabolic substrate preference shifts with hypertrophy and failure, recent studies have focused on the identification of transcription factors capable of transmitting nutritional as well as pathological messages into changes in gene transcription.

Fatty-acid induction of gene expression through peroxisome proliferator activator receptor-alpha (PPARalpha ) binding to the muscle-specific form of CPT-1beta has been extensively studied (4, 5). However, the rat CPT-1beta gene is only modestly induced by physiological levels of fatty acids (6), and CPT-1beta message is increased 2-fold in rodent models of fasting and diabetes where circulating fatty acids are elevated (7). The PPARalpha -mediated regulation of several genes is enhanced by the PPARgamma coactivator-1 (PGC-1). PGC-1 is highly expressed in metabolically active tissues including brown fat, skeletal muscle, and heart (8). PGC-1 has been implicated in mitochondrial biogenesis in the heart and increased mitochondrial respiration in brown fat (8). PGC-1 is a coactivator for many factors in the nuclear hormone receptor family including PPARalpha , the glucocorticoid receptor, the thyroid hormone receptor, and several orphan receptors (9-12). These combinatorial interactions upregulate the expression of fatty acid oxidation, oxidative phosphorylation, and tricarboxylic acid cycle enzymes as well as uncoupling proteins in response to cold, fasting, or exercise (8). PGC-1 also physically interacts with myocyte enhancer factor 2C (MEF2C) to upregulate GLUT4 expression and glucose uptake in L6 cells that were overexpressing PGC-1 (13). Associations with negative binding partners have been proposed but no specific proteins have yet been identified (14).

Upstream stimulatory factor (USF) is a member of the basic helix-loop-helix leucine zipper family and preferentially binds to the E-box consensus CANNTG with CG as interior nucleotides (15). In the heart, USF proteins regulate the expression of energy transfer and contractile-responsive sarcomeric genes (16). We have shown that USF heterodimers bind to two E-box sites within the CPT-1beta promoter. However, the regulatory significance of USF in the context of this gene is unknown (3). Although USF is expressed ubiquitously, the relative amount of USF proteins varies with tissue type (17). Alterations in USF protein stoichiometry may be involved in regulating different sets of genes. While a high degree of amino acid conservation characterizes their dimerization and DNA binding sequences, their extreme divergence in N-terminal amino acid sequences could direct selective contacts for a variety of transcription factors (17).

Here, we have examined the regulation of the CPT-1beta gene by PGC-1 and USF proteins. We found that PGC-1 stimulates CPT-1beta expression through interactions with MEF2A. Furthermore, the induction by PGC-1 and MEF2A is inhibited by USF. We demonstrate that PCG-1 and USF proteins can physically interact. Our results demonstrate that PCG-1 is a powerful stimulator of a key regulatory protein in long chain fatty acid oxidation in the heart and suggest a novel role for USF in modulating PGC-1 action on the CPT-1beta gene.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmids and Luciferase Constructs-- The p-391/+80 rat CPT-1beta luciferase construct has been described (McMillin et al., Ref. 18). Generation of site mutations within the -391/+80 fragment was performed with the QuickChange Mutagenesis kit (Stratagene, La Jolla, CA) as reported (3). All promoter constructs and their correct insertions were confirmed by DNA sequencing.

Cell Culture and Transfections-- Isolation of neonatal rat cardiac myocytes was performed as previously described (19). Cells were plated in 6-well plates (Primeria, Fisher, Pittsburgh, PA) at a cell density of 6 × 105 cells/well. Dulbecco's Modified Eagle's Medium was supplemented with 1% penicillin/streptomycin (Invitrogen) and 10% calf serum (Hyclone Laboratories, Inc., Logan, UT). Cultures were maintained at 37 °C in an atmosphere of 95% air and 5% CO2 for 36 h before transfection. CV-1 fibroblast cells (ATCC no. CCL-70) were trypsinized 24 h before transfection and plated to 85% confluence. Both cell types were transfected with LipofectAMINE PLUS Reagent (Invitrogen) in serum-free medium for 3 h. The medium was then replaced with serum-containing culture medium for an additional 48 h. Transfections included 1.0 µg of wild-type or mutated CPT-1beta -391/+80 firefly luciferase reporter gene construct and 0.25 µg of pRL CMV-Renilla luciferase construct to control for transfection efficiency. Co-transfections included various combinations of the following CMV-driven expression vectors: USF1, USF2, USF2Delta B or USF2Delta N (from Dr. M. Sawadogo), and pSV-PGC-1 (from Dr. B. Spiegelman). Total DNA concentrations were kept constant with the corresponding empty vectors. Final protein concentrations were determined with the BCA protein assay reagent kit (Pierce, Rockford, IL), and luciferase activities were measured with the Promega Dual Luciferase kit (Madison, WI). Promoter activity is expressed as Renilla-corrected firefly luciferase/total protein.

Electrophoretic Mobility Shift Assays-- Nuclear extracts from primary rat neonatal myocytes were prepared as described (20). Double-stranded DNA probes that contained sequences from the rat CPT-1beta promoter were synthesized by Operon Technologies, Inc. (Alameda, CA) as follows: Ebox-315 ctagcaggctacacagctgactcctggg (underlined sequences from Ebox-315 were mutated to TagcCT); Ebox-252 ctagcaccatgctcacgtgagaccctcg (underlined sequences from Ebox-252 were mutated to cGcgCA). EMSA reaction mixtures included 2-5 µg of nuclear extract, 25 mM Hepes, 100 mM KCl, 0.1% Nonidet P40 (v/v), 1 mM dithiothreitol, 5% glycerol, and 50 ng of polydeoxyinosine:deoxycytosine (poly(dIdC)) as a nonspecific competitor in a 20-µl reaction volume. After a 10-min room temperature incubation, 0.3 ng of radiolabeled probe was added, and the reaction was allowed to incubate for an additional 20 min. Antibody (SantaCruz Biotechnology, Santa Cruz, CA) or 25-100-fold molar excess of cold probe was added during the first incubation when included. Protein-DNA complexes were separated on a 4% non-denaturing polyacrylamide gel at room temperature.

Western Blotting-- Transfected myocytes or CV-1 cells were harvested in 200 µl of sample buffer (1.5% SDS, 60 mM Tris-HCl, 11% glycerol in phosphate-buffered saline), sonicated, and boiled. 10 µg of protein were separated on a 10% polyacrylamide ready gel (Bio-Rad Laboratories, Hercules, CA) and transferred to polyvinylidene difluoride membrane (PerkinElmer Life Science Products, Boston, MA). Immunoblots were performed with a USF2 polyclonal primary antibody (Santa Cruz Biotechnology) diluted 1:3000 or a PGC-1 antibody (Calbiochem, San Diego, CA) diluted 1:1000. Reactive proteins were detected with the appropriate secondary antibody and chemi-luminescence reagents (PerkinElmer Life Science Products).

Immunoprecipitation-- Rat neonatal myocytes were cultured in 10-cm plates, washed with 1× phosphate-buffered saline, and harvested in 0.75 ml of modified RIPA buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.5% deoxycholate, 1 mM phenylmethylsulfonyl fluoride, 1 mM Na3VO4, and protease inhibitors) for 10 min at -80°. Cell lysates were cleared with centrifugation, and the supernatant was precleared with protein A beads for 2 h. 500 µl of precleared extract was incubated with 2 µl of appropriate antibody for 6 h. Protein A beads were added for an additional overnight incubation under identical conditions. Beads were washed in modified RIPA buffer, diluted in Lammeli buffer, boiled for 5 min, and analyzed by Western blot as described above. Where indicated, cell extracts were replaced with 10 µg of purified GST fusion proteins and 15 µl of in vitro transcription translation (TNT) product programmed per manufacturer's instructions (Promega, Madison WI), and diluted in 500 µl of modified RIPA buffer.

GST Pull-down Assays-- GST and GST-PGC-1alpha fusion proteins were prepared as described previously (21). [35S]methionine-labeled USF-1 and USF-2 were expressed using a linked transcription/translation kit (PROTEINscript II from Ambion) (22). GST-PGC-1alpha proteins bound to Sepharose-4B were incubated with 35S-labeled proteins in 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, and a protease inhibitor mixture (Sigma). The Sepharose-4B-bound GST proteins were washed four times with the buffer used for binding. Bound proteins were eluted in Laemmli buffer and resolved by SDS-PAGE. The 35S-labeled proteins were visualized by storage phosphor autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our first experiments examined the relative affinity of nuclear protein binding to the E-boxes in the CPT-1 promoter. We have previously shown that USF1 and 2 bind to the E-box sequences from the CPT-1beta promoter as heterodimers (3). The consensus E-box element -252 robustly binds USF proteins (Fig. 1, lane 2). The E-box element -315 requires additional nuclear extract from cardiac myocytes to produce a similar band (Fig. 1, compare lane 2, 2-µl nuclear extract versus lane 8, 5-µl nuclear extract). To examine further the relative binding strengths of the two E-box regions, increasing concentrations of the unlabeled alternate DNA sequence were added to the gel shift binding reaction. Residual USF binding persists on element -252 even in the presence of 100-fold molar excess of the unlabeled -315 sequence (Fig. 1, lanes 3-5). However, a 25-fold excess of -252 competitor is sufficient to compete all protein binding to the E-box -315 (Fig. 1, lanes 9-11). Consistent with its consensus sequence, E-box -252 is the stronger USF binding site. However, E-box-315 also binds USF with lower affinity.


View larger version (76K):
[in this window]
[in a new window]
 
Fig. 1.   USF1 and USF2 proteins preferentially bind to E-box element -252. USF binding to CPT-1 promoter sequences was characterized by gel mobility shift assay. Oligomers for the two E-box elements were 32P-end-labeled and incubated with nuclear extract (2 µl for E-Box-252; 5 µl for E-Box-315) from rat neonatal cardiac myocytes as described (see "Experimental Procedures"). Unlabeled double-stranded oligomers were used as competitors and were added in excess of the labeled probe as is indicated above each lane. The unlabeled mutant oligomer contains a mutation in the USF site and was added in up to 100-fold excess.

To define a regulatory role for USF proteins with the CPT-1beta gene, both USF1 and USF2 were transfected into CV-1 fibroblasts with the CPT-1beta luciferase reporter construct. A model of binding sites in the CPT-1beta promoter is shown in Fig. 2, top panel. Expression of the CPT-1beta promoter increased 15.8 ± 1.5-fold by USF overexpression (Fig. 2). Co-transfection of a vector with the N-terminal activation domain of USF2 deleted (Fig. 2, USFDelta N) significantly reduced USF1/USF2 up-regulation of the CPT-1beta construct. Removal of the DNA binding/dimerization domain of USF2 (Fig. 2, USFDelta B) diminished promoter activation by 6.5 ± 0.9-fold (p < 0.0001). A weaker functional inhibition by USFDelta N compared with USFDelta B may be, in part, due to reduced expression of the former construct in CV-1 cells (Fig. 2, inset). Therefore, USF proteins can activate CPT-1beta in CV-1 fibroblasts and requires intact protein structure to regulate gene expression.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Domain deletions within the USF2 protein abrogate function in CV-1 cells. Top, diagram of the CPT-1beta promoter is shown and the key regulatory elements identified. Early passage CV-1 fibroblasts were co-transfected with 1 µg each -391/+80 wild-type reporter, USF1, USF2, USF2Delta N, or USF2Delta B as indicated. Cells were harvested, and luciferase activity measured and normalized as described. Bars represent the mean ± S.E. for triplicate measurements from three independent experiments. Inset, 10 µg of protein from CV-1 cells transfected with USF2, USF2Delta N, or USF2Delta B was separated on 10% ready gels and analyzed by Western blot with specific USF2 antibodies. *, p < 0.0005; §, p < 10-6.

Since cell-type dependent functions have been reported for USF1 and USF2 (23, 24), we wished to determine whether similar effects of USF-1 on CPT-1beta would be observed in cardiac myocytes. We transfected out CPT-1beta -luciferase into cardiac myocytes with the USF expression vectors. In cardiac myocytes, mutation of E-box -315 increases promoter activity 2.2 ± 0.2-fold (p < 0.01), suggesting that USF proteins function to suppress CPT-1beta gene expression in this cell type. Consistent with this idea, overexpression of USF1 and USF2 in cardiac myocytes reduces CPT-1beta luciferase expression to less than 40% of basal activity (Fig. 3). Substitution of a DNA binding-deficient mutant USF2 for the wild-type factor does not affect USF2-mediated suppression. However, truncation of the N-terminal domain returns luciferase values to baseline, suggesting that the suppressor activity of USF2 may be localized in this region (Fig. 3). The finding of opposite effects of USF overexpression in CV-1 fibroblasts versus cardiac myocytes suggests that USF-mediated repression of CPT-1beta reporter gene expression requires USF interactions with myocyte-enriched factors.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.   Overexpression of USF proteins inhibits activity of the CPT-1beta promoter construct. Myocytes were co-transfected as described with 1 µg of -391/+80 reporter gene construct. Combinations of 1.0 µg of USF1 and either 1.0 µg of USF2 (wild-type) or USF2Delta B or USF2Delta N (1 µg each) were overexpressed, as indicated below the x axis. Total DNA concentrations were kept constant with the empty vector pSG5. Cells were harvested after 48 h in serum containing Dulbecco's modified Eagle's medium. Luciferase was measured and corrected for Renilla expression and protein content. Bars represent mean ± S.E. for triplicate measurements from three separate passages. *, p < 10-5.

PPARalpha and RXRalpha can bind to the fatty acid response element (FARE) (also called PPRE) of CPT-1beta , and these nuclear receptors can interact with PGC-1 (25, 26). In CPT-1beta , the PPRE is flanked by the two E-box motifs, and this region also contains the myocyte-specific (MEF2) site that binds MEF2A and MEF2C (3). To identify potential cell-specific interactions, we first investigated the effects of USF on the PGC-1 regulation of the CPT-1beta promoter in neonatal cardiac myocytes. Transfection of PGC-1-stimulated reporter activity in cardiac myocytes in a dose-dependent manner (Fig. 4A). Overexpression of USF proteins in the myocyte culture completely blunted the PGC-1 induction of CPT-1beta and returned expression to basal levels (Fig. 4B). To determine the interactions by which USF interferes with PGC-1 function in cardiac myocytes, we investigated this regulatory motif for myocyte-specific proteins, e.g. MEF-2, that are known to recruit the latter cofactor (13).


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4.   USF expression blunts PGC-1 up-regulation of the CPT-1beta promoter construct. A, myocytes were co-transfected as described with 1 µg of -391/+80 reporter gene construct and increasing concentrations of PGC-1 expression vector, as indicated. B, myocytes were co-transfected with 1 µg of the -391/+80 CPT-1beta construct and 0.5 µg each of USF1, USF2, and PGC-1 as indicated. Total DNA concentrations were kept constant with the appropriate empty vector. Cells were harvested after 48 h in serum containing Dulbecco's modified Eagle's medium. Luciferase was measured and corrected for Renilla expression and protein content. Bars represent mean ± S.E. for triplicate measurements from 3 separate passages. *, p < 0.0001compared to PGC-1 alone.

Endogenous levels of muscle-specific transcription factors often interfere with transfection studies in myocytes or are already expressed at saturating concentrations. Therefore, to determine the magnitude of MEF2A and PGC-1 regulation of CPT-1beta , these expression vectors were co-transfected into a cardiac-null fibroblast cell line, CV-1. Here, MEF2A synergistically and significantly co-activates PGC-1 induction of CPT-1beta reporter gene expression by greater than 40-fold (Fig. 5). Because USF prevented PGC-1 activation of CPT-1beta luciferase expression in cardiac myocytes (Fig. 4), we asked whether the bHLH factor could also interfere with PGC-1/MEF2A synergy. Addition of USF1 and 2 expression vectors abolished synergy and decreased PGC-1/MEF2A activation by greater than 60% (Fig. 5). Substitution of either serum response factor (SRF), or the cardiac-enriched factor, Nkx2.5, for USF does not affect PGC-1/MEF2A synergy (Table I). To determine if USF proteins might be interfering with the ability of MEF2A to stimulate CPT-1beta , we cotransfected CPT-1beta -Luc with expression vectors for USF proteins and MEF2A. USF1/2 alone stimulated -391/+80 CPT-1beta -Luc 4.3 ± 0.6-fold, while MEF2A stimulated 1.7 ± 0.15-fold. When both USF and MEF2A were transfected, the CPT-1beta -Luc vector was stimulated 6.1 ± 0.65-fold. These data indicate that USF represses CPT-1beta promoter activity by blocking synergistic interactions between PGC-1 and the muscle-specific transcription factor, MEF2A.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5.   PGC-1 and MEF2A synergistic activation of CPT-1beta is sensitive to USF1/2 overexpression. Subconfluent CV-1 cells were transfected as described with 1 µg of reporter, 0.5 µg PGC-1, 0.5 µg MEF2A, and 0.25 µg each USF1 and USF2, as indicated. Total DNA concentrations were kept constant at 2.5 µg with the appropriate empty vector. Cells were maintained in serum-containing media for 48 h, harvested, and assayed as described. Bars represent triplicate measurements from three independent experiments presented as mean ± S.E. The significance of comparisons indicated as an asterisk (p < 10-6) compared with PGC-1 alone, and § (p < 10-6) compared with PGC-1 plus MEF2A.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Inhibition of PGC-1/MEF2A synergy is specific for USF
CV-1 fibroblasts were co-transfected with 1.0 µg of luciferase reporter, 0.5 µg of PGC-1, 0.5 of µg MEF2A and either 0.1 µg of SRF, 0.5 µg of Nkx2.5, or 0.25 µg each USF1 and USF2. USF inhibition studies were also performed on the double E-box mutant promoter (DEM). Data are expressed as percent reduction in the magnitude of synergistic activation compared to empty vector controls.

To confirm that E-box-binding proteins could alter PGC-1/MEF2A interactions, reporter constructs with mutations in either or both E-box elements were transfected with the synergistic combination into CV-1 cells. Individual E-box mutations in either E-box -315 or E-box -252 increased synergy to 69 ± 4- and 82 ± 7-fold, respectively (versus 43 ± 3-fold for wild type, Fig. 6). The double E-box mutant showed an even greater response to PGC-1/MEF2A, i.e. 117 ± 8-fold induction (Fig. 6). PGC-1/MEF2A synergistic activation of the double E-box mutant construct remained sensitive to USF overexpression (Table I), suggesting that direct DNA binding was not essential for USF modulation of PGC-1/MEF2A interactions. Therefore, based on these data, USF appears to function by regulating MEF2 recruitment of cofactors like PGC-1.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   PGC-1/MEF2A synergy is enhanced by E-box sequence mutation. Early passage CV-1 cells were transfected with the synergistic combination 0.5 µg of PGC-1 and 0.5 µg of MEF2A with 1.0 µg of either wild-type or E-box mutant reporter construct as indicated (DEM, double E-box mutant). Cells were harvested after 48 h in serum containing Dulbecco's modified Eagle's medium, and luciferase was measured and corrected for both Renilla expression and protein content. Bars represent mean ± S.E. for at least three experiments performed in triplicate, and p values are compared with synergy on the wild-type promoter.

Our next experiments were performed to determine if USF proteins could interact with PGC-1. Co-immunoprecipitation experiments with anti-USF2 IP of neonatal rat cardiac myocyte extract revealed PGC-1 interactions following immunoblots with anti-PGC-1 antibodies (Fig. 7A, IP). Anti-USF2 IP of neonatal rat cardiac myocyte extract revealed PGC-1 interactions following immunoblot with anti-PGC-1 antibodies (Fig. 7A, IB). PGC-1 protein was also detected in control anti-MEF2 immunoprecipitates but not anti-actin precipitates (data not shown). To confirm USF2/PGC-1 interaction, anti-GST immunoprecipitation with PGC-1-GST fusion protein and USF2 TNT products also revealed the presence of USF2 protein (Fig. 7A). IP reactions with unprogrammed TNT products did not pull-down USF2 protein (data not shown). We also conducted GST-PGC-1 pull-down experiments using bacterially expressed GST-PGC-1 and [35S]methionine-labeled USF-1 or USF-2. As is shown in Fig. 7B, the full-length PGC-1 or PGC-1 vectors containing either amino acids 1-400 or 1-170 were able to pull-down USF-1 and USF-2. GST alone did not interact with either isoform of USF. These data indicate that USF proteins can interact with peptides within the first 170 amino acids of PGC-1.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 7.   PGC-1 and USF2 physically interact. A, co-immunoprecipitation (IP) with MEF2 and USF antibodies was performed with protein extracts from cultured, neonatal rat cardiac myocyte as described under "Experimental Procedures." Antibodies used for Western immunoblot analysis (IB) are listed on the left hand side of the gel. In the GST lane, PGC-1 fused to GST was incubated with GST antibodies and USF2 TNT reaction products. Proteins bound to Sepharose beads were released by boiling and analyzed by Western blot. Input lane contained 5-10% of the total protein used for the immunoprecipitation. Nonspecific bands detected by the PGC-1 antibody in the input lane were removed during the washing steps and are not present in the final IP lanes. B, GST-PGC-1 was prepared as described under "Experimental Procedures." [35S]USF-1 or [35S]USF-2 were incubated with GST-PGC proteins of varying lengths in in vitro pull-downs. The proteins were subjected to electrophoresis in SDS-acrylamide gels and visualized by autoradiography.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Fatty acid oxidation accounts for the majority of energy utilization in the normal, beating heart and fatty acid is the dominant fuel used by the diabetic heart. Since CPT-1beta regulates fatty acid entry into beta -oxidation, this enzyme has a prominent role in modulating changes in fuel selection. Long term adaptive responses extend beyond localized adjustments in enzyme activity from changes in the malonyl-CoA pool. Metabolic up-regulation of CPT-1beta gene expression by fatty acids occurs through the ligand-dependent activation of PPARalpha binding to a PPRE motif in the promoter region of human (5) and rat CPT-1beta (6). The stimulation of genes encoding proteins involved in cardiac fatty acid transport and metabolism by long chain fatty acids is well documented (5, 27). Consistent with these observations, the rat CPT-1beta promoter is only moderately increased in neonatal cardiac myocytes exposed to physiological concentrations of oleate (6). Cotransfection of PPARalpha and PGC-1 into NIH3T3 cells stimulated luciferase genes driven by the promoters of the human CPT-1beta or mouse MCAD genes (10). Here we show that CPT-1beta gene expression is activated in cardiac myocytes in a concentration-dependent manner by overexpression of PGC-1.

Our data indicate that PGC-1 will induce CPT-1beta through interactions with MEF2C. Since the MEF2A and PPARalpha binding sites are adjacent in the rat CPT-1beta promoter, we believe that both factors will recruit PCG-1 to the CPT-1beta promoter and induce high expression of CPT-1beta in the heart. In fact, PPARalpha and MEF2C interact with different regions of PGC-1 allowing for the possibility that PGC-1 could physically interact with both proteins simultaneously. MEF2C interacts with amino acids in the 400-570 region of PGC-1 (8), while PPARalpha interacts with the LXXLL peptide motif at amino acids 142-146 of PGC-1 (10). The MEF2C and PPARalpha binding sites in the CPT-1beta promoter are flanked by E-boxes that bind USF proteins. Our results indicate that the USF proteins can disrupt the synergistic stimulation between MEF2C and PGC-1. The ability of USF to interfere with the transcriptional cooperation of PGC-1 and MEF2C may stem from the specific architecture of the CPT-1beta promoter. Further studies are needed to determine if the inhibition of PGC-1 transactivation by USF proteins is a general phenomenon or is mediated in a gene-specific and tissue-specific manner.

The up-regulation of metabolic genes critical to mitochondrial energy production in the heart is controlled by factors binding to conserved regulatory motifs found in heart and striated muscle, including the GATA and MEF2 elements and the CArG and E-boxes. These motifs, present in the alpha  myosin heavy chain gene (28), troponin I (29), alpha  actin (30), muscle creatine kinase (31), and the Na+-Ca2+ exchanger (32), are also conserved in the muscle-specific mitochondrial isoforms of cytochrome oxidase (33), mitochondrial creatine kinase (34), and CPT-1beta (18). These genomic sequences have been proposed to be necessary in specifying expression of genes involved in high energy phosphate production and energy channeling to the unique oxidative requirements of cardiac muscle (34).

In contrast to the normal working heart, carbohydrate utilization increases at the expense of lipids during cardiac hypertrophy. Hypertrophied hearts exhibit reduced levels of PPARalpha expression with a down-regulation of fatty acid oxidation genes (35). Therefore, maladaptive reliance on glycolytic pathways in heart failure and concomitant down-regulation of CPT-1beta suggest that glucose-responsive transcription factors may play a role in appositional changes in fatty acid and glucose metabolism genes.

USF binding to E-box sites in cardiac-specific promoters has been proposed to be a component of protein complexes that coordinately control the expression of myosin light-chain 2 and alpha  myosin heavy chain genes (36, 37). The role of internal and flanking E-box nucleotide sequences in the context of the cardiac TnI gene demonstrates that the specific nucleotide composition is important to the regulation of bHLH-mediated gene expression (29). Likewise, the majority of genes in which the promoter contains USF-binding E-boxes are not regulated by glucose (38). Thus, the context of the E-box and the protein composition of the USF-binding complex are important in eliciting a transcriptional response. USF is ubiquitously expressed (17), so tissue-specific factors should play an important role in determining the ultimate regulatory consequences of USF activity. We have demonstrated that the action of USF on CPT-1beta reporter gene expression is dependent on cell-specific protein interactions, where USF up-regulates CPT-1beta in fibroblasts and down-regulates CPT-1beta in cardiac myocytes. PGC-1-mediated activation of CPT-1beta is abolished by USF in cardiac myocytes as well as in fibroblasts when the cardiac context for the MEF2 element adjacent to E-252 on the CPT-1 gene is invoked by overexpression of the cardiac-specific factor, MEF2A.

PGC-1 is most widely recognized for its role in co-activating nuclear hormone receptors so that the downstream targets, while varied, are genes involved in thermogenesis, energy production, and mitochondrial biogenesis (8, 25, 39, 40). The inducible nature of PGC-1 expression provides the cell with a mechanism for stimulation of metabolism in response to stress (40). PGC-1-mediated up-regulation of GLUT4 responds to an increased need for metabolic substrate to prevent self-catabolism (13). This proposition could also be extended to include a possible role for the up-regulation of fatty acid import (27).

USF binding to E-boxes is required for transcriptional activation of a variety of cardiac genes including contractile proteins as well as for the activity of the alpha  B-crystallin enhancer (41). Alteration in MAPK/ERK signaling pathways is a molecular mechanism by which factor phosphorylation, e.g. PPARalpha (35), may coordinate and modulate these various signaling pathways during hypertrophic growth. Phosphorylation of p38 enhances PGC-1 co-activation of PPARalpha (42, 43) and promotes transduction of cytokine signals to PGC-1 regulated genes (44). During contractile stimulation, USF1 is phosphorylated resulting in enhanced DNA binding and increased alpha  myosin heavy chain promoter activity (45). Application of a phosphorylation-dependent regulatory scheme to PGC-1/USF interactions would identify another transcription factor interaction responsible for cross-talk among cardiac gene families. MAPK activity releases PGC-1 from the inhibitory association of a PGC-1/repressor complex associated with the L2/L3 region of PGC-1 (14) and promotes co-activation of PGC-1-dependent promoters. If PGC-1/USF association is regulated in a similar manner, this phosphorylation-dependent mechanism could potentially integrate PGC-1 stimulated fatty acid metabolism with increased contractile gene expression. Alternatively, the MEF2 binding site flanked by E-box elements within the promoters of contractile genes (46-48) could also recruit modulatory USF proteins.

In summary, the current data suggests that PGC-1 will promote high levels of CPT-1beta gene expression in the heart through interactions with PPARalpha and MEF2C. USF proteins can modulate the inductive effects of MEF2C and PGC-1. USF2 and PGC-1 physically interact, defining a new mechanism for the upstream stimulatory factors in the coordination of fatty acid oxidation genes. The potential exists for phosphorylation control to integrate stress kinase signaling with gene expression through these transcription factor interactions. Given the altered substrate preference and increased p38 activity in pathologic hypertrophy, this regulatory mechanism may play a significant role in the pleitrophic genetic response to disease.

    ACKNOWLEDGEMENTS

We thank Chad Jones for assistance with the cardiac myocyte preparations and Dr. S. Song for the GST pull-down assays. We also thank Dr. Michelle Sawadogo for USF expression vectors and Dr. Bruce Spiegelman for the PGC-1 expression vector.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant RO1 HL38863, the Juvenile Diabetes Research Foundation (JDRF), and the American Heart Association (AHA).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Dept. of Pathology and Laboratory Medicine, The University of Texas Medical School at Houston, 6431 Fannin, Houston, TX 77030. Tel.: 713-500-5335; Fax: 703-500-0730; E-mail: Jeanie.B.McMillin@uth.tmc.edu.

Published, JBC Papers in Press, February 28, 2003, DOI 10.1074/jbc.M210486200

    ABBREVIATIONS

The abbreviations used are: CPT-1, carnitine palmitoyltransferase-1; SRF, serum response factor; PPAR, peroxisome proliferator activator receptor; PGC-1, PPARgamma coactivator-1; MEF2, myocyte enhancer factor 2; USF, upstream stimulatory factor; L-PK, liver-type pyruvate kinase; MAPK, mitogen-activated protein kinase; TNT, transcription/translation; GST, glutathione S-transferase; RIPA, radioimmune precipitation assay buffer; CMV, cytomegalovirus; ERK, extracellular-regulated kinase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. McGarry, J. D., and Brown, N. F. (1997) Eur. J. Biochem. 244, 1-14[Medline] [Order article via Infotrieve]
2. Xia, Y., Buja, L. M., and McMillin, J. B. (1996) J. Biol. Chem. 271, 12082-12087[Abstract/Free Full Text]
3. Moore, M. L., Wang, G.-L., Belaguli, N. S., Schwartz, R. J., and McMillin, J. B. (2001) J. Biol. Chem. 276, 1026-1033[Abstract/Free Full Text]
4. Mascaro, C., Acosta, E., Ortiz, J. A., Marrero, P. F., Hegardt, F. G., and Haro, D. (1998) J. Biol. Chem. 273, 8560-8563[Abstract/Free Full Text]
5. Brandt, J. M., Djouadi, F., and Kelly, D. P. (1998) J. Biol. Chem. 273, 23786-23792[Abstract/Free Full Text]
6. Wang, G. L., Moore, M. L., and McMillin, J. B. (2002) Biochem. J. 362, 609-618[CrossRef][Medline] [Order article via Infotrieve]
7. Cook, G. A., Edwards, T. L., Jansen, M. S., Bahouth, S. W., Wilcox, H. G., and Park, E. A. (2001) J. Mol. Cell Cardiol. 33, 317-329[CrossRef][Medline] [Order article via Infotrieve]
8. Knutti, D., and Kralli, A. (2001) Trends Endocrinol. Metab. 12, 360-365[CrossRef][Medline] [Order article via Infotrieve]
9. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 92, 829-839[CrossRef][Medline] [Order article via Infotrieve]
10. Vega, R. B., Huss, J. M., and Kelly, D. P. (2000) Mol. Cell. Biol. 20, 1868-1876[Abstract/Free Full Text]
11. Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., Newgard, C. B., and Spiegelman, B. M. (2001) Nature 413, 131-138[CrossRef][Medline] [Order article via Infotrieve]
12. Wu, Y., Delerive, P., Chin, W. W., and Burris, T. P. (2002) J. Biol. Chem. 277, 8898-8905[Abstract/Free Full Text]
13. Michael, L. F., Wu, Z., Cheatham, R. B., Puigserver, P., Adelmant, G., Lehman, J. J., Kelly, D. P., and Spiegelman, B. M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3820-3825[Abstract/Free Full Text]
14. Knutti, D., Kressler, D., and Kralli, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9713-9718[Abstract/Free Full Text]
15. Sawadogo, M., and Roeder, R. G. (1985) Cell 43, 165-175[CrossRef][Medline] [Order article via Infotrieve]
16. Qin, W., Khuchua, Z., Klein, S. C., and Strauss, A. W. (1997) J. Biol. Chem. 272, 25210-25216[Abstract/Free Full Text]
17. Sirito, M., Lin, Q., Maity, T., and Sawadogo, M. (1994) Nucleic Acids Res. 22, 427-433[Abstract/Free Full Text]
18. Wang, D., Harrison, W., Buja, L. M., Elder, F. F. B., and McMillin, J. B. (1998) Genomics 48, 314-323[CrossRef][Medline] [Order article via Infotrieve]
19. McMillin, J. B., Hudson, E. K., and Buja, L. M. (1993) Methods Toxicol. 2, 301-309
20. Muller, M. M., Schreiber, E., Schaffner, W., and Matthias, P. (1989) Nucleic Acids Res. 17, 6420[Free Full Text]
21. Tcherepanova, I., Puigserver, P., Norris, J. D., Spiegelman, B. M., and McDonnell, D. P. (2000) J. Biol. Chem. 275, 16302-16308[Abstract/Free Full Text]
22. Luo, X., and Sawadogo, M. (1996) Mol. Cell. Biol. 16, 1367-1375[Abstract]
23. Han, S. Y., Kim, J. C., Suh, J. M., and Chung, I. K. (2001) FEBS Lett. 505, 57-62[CrossRef][Medline] [Order article via Infotrieve]
24. Qyang, Y., Luo, X., Lu, T., Ismail, P. M., Krylov, D., Vinson, C., and Sawadogo, M. (1999) Mol. Cell. Biol. 19, 1508-1517[Abstract/Free Full Text]
25. Lehman, J. J., Barger, P. M., Kovacs, A., Saffitz, J. E., Medeiros, D. M., and Kelly, D. P. (2000) J. Clin. Invest. 106, 847-856[Medline] [Order article via Infotrieve]
26. Lehman, J. J., and Kelly, D. P. (2002) Clin. Exp. Pharmacol. Physiol. 29, 339-345[CrossRef][Medline] [Order article via Infotrieve]
27. van der Lee, K. A., Vork, M. M., De Vries, J. E., Willemsen, P. H., Glatz, J. F., Reneman, R. S., Van der Vusse, G. J., and Van Bilsen, M. (2000) J. Lipid Res. 41, 41-47[Abstract/Free Full Text]
28. Molkentin, J. D., Jobe, S. M., and Markham, B. E. (1996) J. Mol. Cell Cardiol. 28, 1211-1225[CrossRef][Medline] [Order article via Infotrieve]
29. Yutzey, K. E., and Konieczny, S. F. (1992) Nucleic Acids Res. 20, 5105-5113[Abstract/Free Full Text]
30. Moss, J. B., McQuinn, T. C., and Schwartz, R. J. (1994) J. Biol. Chem. 269, 12731-12740[Abstract/Free Full Text]
31. Shield, M. A., Haugen, H. S., Clegg, C. H., and Hauschka, S. D. (1996) Mol. Cell. Biol. 16, 5058-5068[Abstract]
32. Nicholas, S. B., and Philipson, K. D. (1999) Am. J. Physiol. 277, H324-330
33. Lenka, N., Vijayasarathy, C., Mullick, J., and Avadhani, N. G. (1998) Prog. Nucleic Acids Res. Mol. Biol. 61, 309-344[Medline] [Order article via Infotrieve]
34. Qin, W., Khuchua, Z., Boero, J., Payne, R. M., and Strauss, A. W. (1999) Histochem. J. 31, 357-365[CrossRef][Medline] [Order article via Infotrieve]
35. Barger, P. M., Brandt, J. M., Leone, T. C., Weinheimer, C. J., and Kelly, D. P. (2000) J. Clin. Invest. 105, 1723-1730[Medline] [Order article via Infotrieve]
36. Navankasattusas, S., Sawadogo, M., van Bilsen, M., Dang, C. V., and Chien, K. R. (1994) Mol. Cell. Biol. 14, 7331-7339[Abstract/Free Full Text]
37. Ojamaa, K., Samarel, A. M., and Klein, I. (1995) J. Biol. Chem. 270, 31276-31281[Abstract/Free Full Text]
38. Vaulont, S., Vasseur-Cognet, M., and Khan, A. (2000) J. Biol. Chem. 275, 31555-31558[Free Full Text]
39. Wu, P., Inskeep, K., Bowker-Kinley, M. M., Popov, K. M., and Harris, R. A. (1999) Diabetes 48, 1593-1599[Abstract]
40. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C., and Spiegelman, B. M. (1999) Cell 98, 115-124[CrossRef][Medline] [Order article via Infotrieve]
41. Gopal-Srivastava, R., Haynes, J. I., 2nd, and Piatigorsky, J. (1995) Mol. Cell. Biol. 15, 7081-7090[Abstract]
42. Oberkofler, H., Esterbauer, H., Linnemayr, V., Strosberg, A. D., Krempler, F., and Patsch, W. (2002) J. Biol. Chem. 277, 16750-16757[Abstract/Free Full Text]
43. Barger, P. M., Browning, A. C., Garner, A. N., and Kelly, D. P. (2001) J. Biol. Chem. 276, 44495-44501[Abstract/Free Full Text]
44. Puigserver, P., Rhee, J., Lin, J., Wu, Z., Yoon, J. C., Zhang, C. Y., Krauss, S., Mootha, V. K., Lowell, B. B., and Spiegelman, B. M. (2001) Mol. Cell 8, 971-982[CrossRef][Medline] [Order article via Infotrieve]
45. Xiao, Q., Kenessey, A., and Ojamaa, K. (2002) Am. J. Physiol. Heart Circ. Physiol. 283, H213-219[Abstract/Free Full Text]
46. Cheng, G., Hagen, T. P., Dawson, M. L., Barnes, K. V., and Menick, D. R. (1999) J. Biol. Chem. 274, 12819-12826[Abstract/Free Full Text]
47. Christensen, T. H., and Kedes, L. (1999) Gene Expr. 8, 247-261[Medline] [Order article via Infotrieve]
48. Mably, J. D., and Liew, C. C. (1996) Circ. Res. 79, 4-13[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
H. Wang, T. H. Peiris, A. Mowery, J. Le Lay, Y. Gao, and L. E. Greenbaum
CCAAT/Enhancer Binding Protein-{beta} Is a Transcriptional Regulator of Peroxisome-Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Regenerating Liver
Mol. Endocrinol., July 1, 2008; 22(7): 1596 - 1605.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Handschin and B. M. Spiegelman
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 Coactivators, Energy Homeostasis, and Metabolism
Endocr. Rev., December 1, 2006; 27(7): 728 - 735.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev, April 1, 2006; 86(2): 465 - 514.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Phan, T. L. Rasmussen, O. Nakagawa, J. McAnally, P. D. Gottlieb, P. W. Tucker, J. A. Richardson, R. Bassel-Duby, and E. N. Olson
BOP, a regulator of right ventricular heart development, is a direct transcriptional target of MEF2C in the developing heart
Development, June 1, 2005; 132(11): 2669 - 2678.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Okada, E. Matsuura, Z. Tozuka, R. Nagai, A. Watanabe, K. Matsumoto, K. Yasui, R. W. Jackman, T. Nakano, and T. Doi
Upstream stimulatory factors stimulate transcription through E-box motifs in the PF4 gene in megakaryocytes
Blood, October 1, 2004; 104(7): 2027 - 2034.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Baldan, J. Relat, P. F. Marrero, and D. Haro
Functional interaction between peroxisome proliferator-activated receptors-{alpha} and Mef-2C on human carnitine palmitoyltransferase 1{beta} (CPT1{beta}) gene activation
Nucleic Acids Res., September 8, 2004; 32(16): 4742 - 4749.
[Abstract] [Full Text] [PDF]