Originally published In Press as doi:10.1074/jbc.M300788200 on March 5, 2003
J. Biol. Chem., Vol. 278, Issue 19, 17299-17306, May 9, 2003
HSF-1 Interacts with Ral-binding Protein 1 in a
Stress-responsive, Multiprotein Complex with HSP90 in
Vivo*
Yanzhong
Hu and
Nahid F.
Mivechi
From the Institute of Molecular Medicine and Genetics and
Department of Radiology, Medical College of Georgia,
Augusta, Georgia 30912
Received for publication, January 23, 2003, and in revised form, March 4, 2003
 |
ABSTRACT |
Heat shock factor 1 (HSF1) regulates the rapid
and transient expression of heat shock genes in response to stress. The
transcriptional activity of HSF1 is tightly controlled, and
under physiological growth conditions, the HSF1 monomer is in a
heterocomplex with the molecular chaperone HSP90. Through unknown
mechanisms, transcriptionally repressed HSF1·HSP90
heterocomplexes dissociate following stress, which triggers HSF1
activation and heat shock gene transcription. Using a yeast two-hybrid
screening system, we have identified Ral-binding protein 1 (RalBP1) as
an additional HSF1-interacting protein. We show that RalBP1 and HSF1
interact in vivo, and transient cotransfection of HSF1
and RalBP1 into hsf1
/
mouse embryo
fibroblasts represses HSP70 expression. Furthermore, transient
cotransfection of HSF1 and the constitutively active form of RalA
(RalA23V), an upstream activator of the RalBP1 signaling pathway,
increases the heat-inducible expression of HSP70, whereas the
dominant negative form (RalA28N) suppresses HSP70 expression. We
further find that
-tubulin and HSP90 are also present in the RalBP1·HSF1 heterocomplexes in unstressed cells. Upon heat shock, the
Ral signaling pathway is activated, and the resulting RalGTP binds
RalBP1. Concurrently, HSF1 is activated, leaves the
RalBP1·HSF1·HSP90·
-tubulin heterocomplexes, and translocates
into the nucleus, where it then activates transcription. In conclusion,
these observations reveal that the RalGTP signal transduction pathway
is critical for activation of the stress-responsive HSF1 and perhaps
HSP90 molecular chaperone system.
 |
INTRODUCTION |
Mammalian heat shock factor 1 (HSF1),1 a phosphorylated
protein, regulates the stress inducibility of heat shock genes.
Phosphorylation of HSF1 is indicative of its complex mode of regulation
by various signaling pathways. Studies using phosphopeptide analysis of
HSF1 protein as well as studies analyzing the transactivation
properties of HSF1 using chimeric constructs containing GAL4-HSF1 or
LexA-HSF1 have suggested that phosphorylation of serine residues
Ser303, Ser307, and Ser363 is
likely to be involved in repression of HSF1 transcriptional activity
(1-7). Mitogen-activated protein kinases and glycogen synthase kinase
3 are candidates for phosphorylating these residues. HSF1 could
potentially be phosphorylated during its activation process as well,
perhaps at Ser230 by calcium calmodulin protein kinase II
(8). HSF1 is also found in multichaperone complexes under physiological
conditions and during its repression (9-11). Specifically, HSP90 has
been co-immunoprecipitated with the monomeric form of HSF1, suggesting that an HSP90·HSF1 heterocomplex may keep HSF1 in a repressed state.
Disruption of this heterocomplex by stress would allow HSF1 to form
trimers and acquire DNA binding capability. One likely outcome of the
disruption of HSF1·HSP90 heterocomplexes during stress is the
accumulation of denatured polypeptides and the ability of HSP90 to bind
such denatured polypeptides (9-11). During recovery from stress, HSF1
trimers have been found in separate complexes with HSP70 and in
HSP90-immunophilin (FKBP52)-p23 chaperone complexes (10). Heat shock
factor-binding protein 1, which interacts with HSF1 trimers
together with HSP70, has also been isolated (12), and this interaction
appears to also be a negative regulator of HSF1 transcriptional activity.
Ral proteins are GTPases present in the plasma membrane and cytoplasmic
vesicles and become biologically active through exchange of GDP for GTP
(13-17). Epidermal growth factor, other receptor tyrosine kinases, and
G protein-coupled receptor-induced Ral activation is dependent on Ras
activation, suggesting that Ral guanine nucleotide exchange factors can
also function as Ras effector molecules (17-22). Ras-dependent activation of Ral functions in parallel to
the Ras-Raf-Mek-extracellular signal-regulated kinase pathway in a
number of cell types (15, 17, 18, 20). In addition, Ral can be
activated by a Ras-independent pathway that involves a phospholipase
C-mediated increase in intracellular Ca2+ (19, 20, 23).
Ras-independent activation of Ral signaling via stimulation of
formyl-Met-Leu-Phe receptor and dissociation of Ral-GDS from
-arrestin has been shown to cause cytoskeletal rearrangement (24).
The physiological consequence of RalGTP signaling is unknown. However,
control of transcription could be one end point of the RalGTP signaling
(22, 25-32). Ral activation in response to insulin induces
phosphorylation of c-Jun transcription factor through activation of Jun
N-terminal kinase and cellular Src (28). Similarly, activated
Ral-GTPase leads to phosphorylation of Stat3 (22). Other reports
suggest that expression of constitutive active Ral leads to activation
of NF-
B and its downstream gene cyclin D1 (31).
Ras-dependent Ral signaling pathway leads to phosphorylation of Forkhead transcription factor on threonine residues
447 and 451, leading to its activation. The protein kinase involved in
such phosphorylation is unknown (25). Ras-dependent activation of RalGTP signaling has been implicated in cellular transformation; in addition, cells expressing constitutively active RalGTP show an enhanced growth rate and can form colonies in soft agar
(15, 18, 33, 34). RalGTP has been shown to bind mammalian Sec 5, a
subunit of the exocyst complex. Inhibition of RalA binding to Sec 5 prevents filopod production by tumor necrosis factor
and
interleukin-1 (35, 36). Several Ral targets that provide clues in Ral
guanine nucleotide exchange factor-induced signaling pathways have been
identified. Ral has been shown to interact with phospholipase D and
Arf, which suggests a role for Ral in phospholipase D-mediated vesicle
transport and membrane trafficking (37, 38). Ral could also function in
regulating the cytoskeleton through interaction with Ral-binding
protein 1 (RalBP1) (22-24, 27, 39, 40). RalBP1 (also known as RLIP76
or RIP1) is a Ral effector molecule and associates in epidermal growth
factor receptor complexes with the tyrosine-phosphorylated proteins
POB1 and Reps1 (41-43). Reps1 can also bind to the adaptor proteins Crk and Grb2 (43). The significance of or the signaling pathway leading
from the RalGTP-RalBP1 interaction is not known, but RalBP1 contains a
weak GTPase (GAP) activity for Cdc42 and Rac GTPases in
vitro (39, 44). Ral has therefore been shown to affect cellular
proliferation, receptor-mediated endocytosis, Src kinase activation,
and phospholipase D activation (15, 17, 37-39, 45, 46).
In these studies, we show that one pathway leading to HSF1 activation
is mediated through the activation of the RalGTP signal transduction
pathway. HSF1 interacts with a Ral effector molecule, RalBP1, both
in vivo and in vitro. The HSF1·RalBP1 complex
dissociates upon Ral activation by heat shock, since RalGTP has a high
affinity for the Ral binding domain of RalBP1, thus leading to HSF1
activation. We also show that the HSF1·RalBP1 heterocomplexes contain
HSP90 and
-tubulin.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Treatment Conditions--
H1299 is a human lung
carcinoma cell line that is maintained in Dulbecco's modified Eagle's
medium supplemented with 10% fetal calf serum. Generation of
hsf1-deficient mouse embryo fibroblasts (MEFs) has been
reported elsewhere.2 These
cells were transformed with SV40 DNA and maintained in Dulbecco's
modified Eagle's medium plus 10% heat-inactivated fetal calf serum.
Cultured tissue culture cells were heated at 80% confluence in a
circulating water bath. To reach equivalent cellular cytotoxicity to
heat shock between cells derived from human or mouse, H1299 cells were
heated at 43 °C, and MEFs were heated at 42 °C.
Yeast Two-hybrid Screening--
For yeast two-hybrid screening,
we used a CytoTrap two-hybrid system (Stratagene, La Jolla, CA) (48).
In this system, protein-protein interactions in the cytoplasm are
detected through the recruitment of human Sos to the membrane of cells,
resulting in the activation of the Ras pathway. The CytoTrap System
uses the cdc25H yeast strain and a temperature-sensitive yeast
homologue of human Sos. There are two plasmids, one encoding Sos, which
can be fused to a bait, and one containing Myr, which can be fused to
the cDNA library. In the pMyr plasmids, the genes are fused with
the Src myristoylation signal, which targets and anchors the
proteins in the plasma membrane. The cDNA library and the bait are
cotransfected into yeast cdc25H. The only cells that can grow on the
galactose plate at 37 °C (which induces the expression of the
cDNA library) are cells that harbor protein-protein interactions.
A fragment of human HSF1 (amino acid residues 2-380) was subcloned
into the pSos vector and was used as a bait. A human heart tissue
cDNA library that had been subcloned into the pMyr vector was used
to find interacting proteins with HSF1. 10 µg of the bait construct
and 10 µg of the cDNA library were cotransfected into the
competent yeast cdc25H strain. The transformed yeast were plated in
SD
(uracil/leucine-deficient) glucose plates and allowed
to grow at 25 °C for 48-72 h. The yeast colonies that appeared on
the plates were replica-plated on the SD
(uracil/leucine-deficient)-galactose plate and SD
(uracil/leucine-deficient) glucose plate, respectively, and incubated at 37 °C for 6 days. The positive colonies were grown in 5 ml of
SD
glucose broth at 25 °C. Plasmid DNA was extracted
and used to transform Escherichia coli DH5
and then
selected on chloramphenicol-containing agar plates. Plasmid DNA was
isolated and sequenced. The plasmids pMyr and pSos encoding MafB
transcription factor were supplied by the manufacturer and used as a
positive control.
Plasmid Constructs--
The human full-length RalBP1 cDNA
was a gift of Dr. R. Cool (Max Plank-Institut, Durtmund,
Germany) (49). A FLAG-tagged RalBP1 was generated using PCR
amplification and subcloned into pcDNA3 at the KpnI and
XhoI sites. The plasmid pcDNA3-HSF1 was constructed as
described previously (1). The pGEX-HSF1 constructs, containing amino
acid residue 2-81 or amino acid residue 2-270 fragments, were
amplified using the following primers. For pGEX-HSF1 2-81, forward and
reverse primers were 5'-GGGGATCCGATCTGATCTGCCCGTGGGC and
5'-GGGGGAATTCGACCACTTTCCGGAAGC, respectively. For pGEX-HSF1 2-270,
forward primer was as above, and the reverse primer was 5'-GGGGGAATTCGCCACTGTCGTTCAGC. The fragments were then subcloned into
plasmids pGEX-2T at BamHI and EcoRI sites. The
generation of pcDNA3-FLAG-RalA was as follows. The RalA cDNA
was amplified from the human RalA EST clones (Incite Genomics, St.
Louis, MO) using forward primer
(5'-GGGGTACCGCCACCATGGATTACAAGGATGACGACGATAAGGCTGCAAATAAGCCCAAGGGTC) and reverse primer (5'-GGGCTCGAGTTATAAAATGCAGCATCTTTC). The PCR product
was digested with restriction enzymes KpnI and
XhoI and subcloned into plasmid pcDNA3. This generated
pcDNA3-FLAG-RalA with the FLAG tag fused in-frame to the 5'
terminus. The construct pcDNA3-RalA28N was generated using a
site-directed mutagenesis kit (Stratagene) with the following primers:
forward primer, 5'-GGCGTGGGCAAGAATGCTCTGACTCTAC; reverse primer,
5'-GTAGAGTCAGAGCATTCTTGCCCACGCC. The construct pcDNA3-Ral23V was
similarly constructed using forward primer
(5'-GTCATCATGGTGGGCAGTGTGGGCGTGGGCAAGTCAGC) and reverse primer
(5'-GCTGACTTGCCCACGCCCACACTGCCCACCATGATGAC). The sequences of the
final constructs were confirmed by sequencing.
Transient Transfection Assays--
Transient transfections were
performed using LipofectAMINE 2000 (Amersham Biosciences). Transfected
DNA mixes included 2 µg of expression plasmid DNA and, when required,
carrier DNA added to a total of 4 µg. The DNA mix was added to
1-3 × 105 cells. The transfection frequency varied
between 70 and 80% in all experiments as determined by
immunofluorescence analysis.
In Vitro Transcription/Translation and RalBP1-HSF1
Interaction in Vitro--
TNT rabbit reticulocyte cell lysate was used
to transcribe and translate the FLAG-tagged RalBP1 according to the
manufacturer's instructions (Promega Corp., Madison, WI). Briefly, 1 µg of pcDNA3- FLAG-RalBP1 was used as a template. The reaction was
carried out at 30 °C, and the product was radiolabeled using
[35S]methionine. 2 µl of labeled RalBP1 was incubated
with 20 ng of purified full-length HSF1 in radioimmune precipitation
buffer for 1 h at 4 °C. Antibody to human HSF1 was then added
to the reaction, and the mixture was incubated at 4 °C for 1 h.
30 µl of 50% solution of protein A solution was then added, and the mixture was centrifuged. The protein A-protein complexes were fractionated on SDS-PAGE, and the gel was exposed to x-ray film (1).
Immunoprecipitation and Immunoblotting--
Cells (3 × 105) were cotransfected with 1 µg of each plasmid using
LipofectAMINE 2000. Cells were allowed to recover for 48 h, rinsed
with PBS, and appropriately treated and harvested. Cells were lysed
with radioimmune precipitation buffer (150 mM NaCl, 1%
Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris, pH
7.5, containing 1× mixture of protease inhibitors (Sigma). 1 mg of cell lysate was precleared by incubating 30 µg of protein A-agarose beads at 4 °C; 10 µg of mouse anti-FLAG monoclonal antibody (or other antibodies as indicated in the figure legends) was added to the
precleared cell lysate and was incubated for an additional 2 h at
4 °C. 30 µl of the protein A-agarose beads was added to the
mixture and incubated for an additional 2 h. Protein A beads were
then pelleted by spinning at 1000 × g for 1 min at
4 °C and washed three times with radioimmune precipitation buffer
(1). Protein A-antibody-protein complexes were suspended in SDS sample buffer (2% SDS, 10% glycerol, 1 mM EDTA, 100 mM dithiothreitol, 60 mM Tris, pH 6.8, 0.001%
bromphenol blue) and boiled for 10 min. The proteins were separated on
a 12% SDS-PAGE gel and transferred to a nitrocellulose membrane. The
membrane was immunoblotted using one of the following primary
antibodies: rabbit polyclonal antibody to HSF1 (1:1000) or HSP90
(1:5000) (StressGen; Victoria, Canada); mouse monoclonal antibody to
HSP70 (1:5000) (StressGen), FLAG, and
-tubulin (Sigma); or
polyclonal antibody to RalBP1 (Santa Cruz Biotechnology). The
corresponding horseradish peroxidase-conjugated secondary antibodies
were used, and signals were developed using the enhanced
chemiluminescence (ECL) method (ECL kit; Amersham Biosciences) (1).
For immunoprecipitation of HSP90 heterocomplexes, H1299 cells were
transiently transfected with plasmids containing pcDNA3- RalBP1.
After 24 h, groups of cells were incubated with 2 mM
dithiobis(succinimidyl propionate) protein cross-linker for 10 min
(10). One group of cells was treated at 43 °C for 30 min and then
rinsed twice with 43 °C-prewarmed PBS buffer, and twice with PBS at
25 °C. Other groups of cells were incubated at 37 °C and
similarly rinsed with PBS. Cells were then lysed in buffer containing
50 mM Tris-Cl pH 7.4, 150 mM NaCl, 1% Triton
X-100, 1× mixture of protease inhibitors (Sigma) for 30 min. Cell
lysates were centrifuged at 10,000 × g for 10 min. The
protein concentration of the supernatant was estimated using a BCA
protein assay kit (Pierce). 1 mg of each of the cell lysates was mixed
with 40 µl of 50% solution of protein A-agarose and incubated at
4 °C for 1 h. The protein A-agarose was then centrifuged, and
the precleared supernatant was incubated with 10 µg of rabbit
polyclonal anti-HSP90
and incubated at 4 °C for 2 h. 40 µl
of 50% solution of protein A-agarose was then added at 4 °C for an
additional 2 h. The protein A complexes were centrifuged at
10,000 × g for 1 min. The pellet was washed with lysis
buffer three times. 100 µl of 2× SDS sample buffer was added, and
samples were heated at 100 °C for 5 min. 35 µl of the samples were
fractionated on SDS-PAGE and analyzed by immunoblotting using appropriate antibodies.
Pull-down Assay--
Cell lysates were prepared in buffer
containing 10% glycerol, 2% Nonidet P-40, 50 mM Tris-HCl
(pH 7.4), 200 mM NaCl, 10 mM MgCl2,
1 mM dithiothreitol, 20 mM NaF, 1 mM sodium vanadate plus mixtures of protease inhibitors
(Sigma), and 700 µg of protein from each sample was incubated with 20 µg of glutathione S-transferase (GST)-Ral binding domain
(RalBD) purified according to the manufacturer's instructions
(Amersham Biosciences) for 1 h at 4 °C. The beads were washed
three times with 25 mM Tris-HCl (pH 7.5), 40 mM
NaCl, 1% Nonidet P-40, 30 mM MgCl2, 1 mM dithiothreitol (50). Samples were boiled in SDS-PAGE
sample buffer and analyzed.
Immunofluorescent Analysis--
105 cells were
cultured on chamber slides for 24 h and were transiently
transfected with 1 µg of pcDNA3-FLAG-RalBP1 and allowed to grow
for an additional 24 h. Cells were then rinsed with PBS and fixed
in 4% paraformaldehyde for 30 min at 25 °C. Cells were then
permeabilized with 0.1% of Triton X-100, 0.1 mM sodium
citrate for 2 min and then incubated with appropriate primary antibody and Texas Red- or fluorescein isothiocyanate-conjugated secondary antibodies as indicated in the figure legends. Nuclei were stained with
4',6-diamidino-2-phenylindole, and images were analyzed using fluorescent microscopy (5). Immunolocalization of HSF1 has been
described previously (5).
 |
RESULTS |
HSF1 Interacts with RalBP1--
To understand the regulatory
pathways involved in HSF1 activity, we used a yeast two-hybrid
screening system to identify proteins that interact with HSF1. A
portion of the HSF1 protein encoding the DNA binding, trimerization,
and regulatory domains (amino acid residues 2-380) (Fig.
1a) and a human heart cDNA
library were used. Several proteins were identified and sequenced. One of these showed 100% sequence homology to RalBP1 (or RLIP76). The
fragment of RalBP1 that interacted with HSF1 contained amino acid
residues 440-655 (Fig. 1, b and c).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 1.
HSF1 interacts with RalBP1 in a yeast-two
hybrid system. a, schematic representation of
full-length HSF1 cDNA and the pSos-HSF1 bait plasmid containing the
truncated HSF1 cDNA. See details of the yeast-two hybrid system
under "Experimental Procedures." b, yeast two-hybrid
screen (using the CytoTrap system) showing HSF1 interaction with
RalBP1. First row, plasmids containing pSos-HSF1
and RalBP1 clone that was isolated from cDNA library containing
pMyr-RalBP1. Second row, plasmids containing
pSos-MafB and pMyr-MafB (positive controls). Third
row, plasmids containing pSos and pMyr-MafB (negative
controls). Fourth row, plasmids containing pSos
alone cotransfected with pMyr-RalBp1. c, schematic
representation of pMyr-RalBP1 isolated by yeast two-hybrid screening
(amino acids 440-655) and the full-length RalBP1, showing the location
of the Rho GAP homology domain, Ral-binding region, POB1 binding
region, and HSF1 binding region.
|
|
RalBP1 is a RalGTP-binding protein (44). Full-length RalBP1 encodes a
RhoGAP homology domain between amino acid residues 210 and 353 and a
Ral binding domain between amino acid residues 403 and 499 (Fig.
1c). The fragment of RalBP1 that was isolated interacting
with HSF1 encoded amino acid residues 440-655, encompassing a portion
of the Ral binding and the entire POB1 binding region (41).
HSF1 Interacts with RalBP1 in Vitro and in Vivo--
To confirm
that HSF1 interacts with RalBP1 in vitro and in mammalian
cells in vivo, we performed immunoprecipitation experiments. Full-length RalBP1 was transcribed and translated in vitro
using [35S]methionine. The product was mixed with
full-length human HSF1 and was immunoprecipitated with antibody to
HSF1. Lane 1 in Fig. 2a shows that HSF1 interacts
with RalBP1 in vitro.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2.
HSF1 interacts with RalBP1 in
vitro and in vivo. a, HSF1
interacts with RalBP1 in vitro. 5 µl of in
vitro translated lysate were used for pull-down experiments
(lanes 1-3), and lane 4 represents 5 µl of lysate. Co-immunoprecipitation of in
vitro transcribed and translated
[35S]methionine-labeled RalBP1 mixed together with
purified HSF1 in a pull-down experiment using antibody to HSF1.
Lane 1, reaction contained HSF1 protein, antibody
to HSF1, protein A, and [35S]methionine-labeled RalBP1.
Lane 2, reaction as in lane
1 without the addition of antibody to HSF1. Lane
3, reaction as in lane 1 but using
preimmune serum. Lane 4, original in
vitro translated lysate of [35S]methionine-labeled
RalBP1. b, HSF1 interacts with RalBP1 in vivo.
H1299 cells were transiently transfected with expression vector
containing FLAG-RalBP1. After 48 h, FLAG-RalBP1 was
immunoprecipitated from control (37 °C) or heated (43 °C, 1 h) cell lysates using antibody to FLAG. The complex was fractionated on
SDS-PAGE and immunoblotted using antibody to HSF1. Lane
1, cells were incubated at 43 °C for 1 h.
Lane 2, cells were incubated at 37 °C.
Lane 3, cells were incubated at 37 °C, and
cell lysate was immunoprecipitated using nonimmune serum (negative
control). The bottom panel shows the immunoblot
of endogenous HSF1 in the heated (lane 1) and
control (lane 2) samples that were used to
co-immunoprecipitate RalBP1. Note that HSF1 band is retarded in
SDS-PAGE due to hyperphosphorylation in heated cells when compared with
unheated control cells. c, RalBP1 interacts with HSF1
in vivo. H1299 cells were transiently transfected with
expression vector containing FLAG-RalBP1. After 48 h, HSF1 was
immunoprecipitated (IP) from control (37 °C) or heated
(43 °C, 1 h) cell lysates using antibody to HSF1. The complex
was fractionated on SDS-PAGE and immunoblotted using antibody to FLAG.
Lane 1, cells were incubated at 43 °C for
1 h; lane 2, cells were incubated at
37 °C. Lane 3, cells were incubated at
37 °C, and cell lysate was immunoprecipitated using nonimmune serum
(negative control). The bottom panel shows the
amount of FLAG-RalBP1 expressed in the heated (lane
1) or control (lane 2) cells used for
immunoprecipitation. Note that HSF1 mobility is retarded in SDS-PAGE
due to hyperphosphorylation in heated cells when compared with unheated
control cells. d and e, GST-HSF1 fusion
constructs. d, schematic representation of full-length HSF1
cDNA and GST-HSF1 deletion constructs. e, Coomassie Blue
staining of SDS-PAGE containing purified GST-HSF1 proteins of mutant
constructs as indicated. MW, molecular weight. f,
DNA binding domain of HSF1 interacts with RalBP1. GST pull-down
experiments using H1299 cell lysates transiently transfected with
expression plasmids containing FLAG-RalBP1 and the purified GST-HSF1
mutant constructs shown in d or GST beads alone. The
pull-down products were analyzed by SDS-PAGE and immunoblotted using
antibody to FLAG-RalBP1.
|
|
HSF1 is monomeric and repressed at 37 °C and is mainly located in
the cytoplasm. HSF1 is hyperphosphorylated and translocated into the
nucleus once cells are exposed to a brief period of heat treatment (5,
51, 52). To examine whether HSF1 interacts with RalBP1 when cells are
cultured at 37 °C or after cells are exposed to heat stress, H1299
cells were transiently transfected with FLAG-tagged, full-length
RalBP1, and immunoprecipitation experiments were performed using
antibody to FLAG (Fig. 2b) or antibody to HSF1 (Fig.
2c). The immunoblotting was performed using antibody to HSF1
(Fig. 2b) or antibody to RalBP1 (Fig. 2c). The results indicate that RalBP1 interacts with HSF1 in vivo,
when cells are cultured at 37 °C, and that this interaction is
greatly reduced when cells are exposed to 43 °C (Fig. 2,
b and c, lanes 1 and
2). To ensure that the level of transiently transfected RalBP1 or the endogenous HSF1 were similar in control or heated samples, immunoblotting of cell lysates from control and heated cells
were performed using antibody to HSF1 (Fig. 2b) or antibody to FLAG to detect RalBP1 (Fig. 2c).
Since a large fragment of HSF1 was used in the yeast two-hybrid
screening, we determined the region of HSF1 that interacts with RalBP1
using HSF1 deletion mutants. Pull-down experiments were performed using
two GST fusion constructs of HSF1, one containing amino acid residues
2-81 (fragment encoding the DNA binding domain), and the other
containing amino acid residues 2-270 (fragment encoding the DNA
binding and trimerization domains) (Fig. 2, d and
e). The lysates of the H1299 cells that were transiently
transfected with full-length FLAG-RalBP1 were incubated with the
purified GST-HSF1 mutant proteins. Proteins that were pulled down were fractionated on SDS-PAGE, and immunoblotting was performed using antibody to FLAG. The results show that the minimal domain of HSF1 that
is required for binding to RalBP1 is its DNA binding domain (Fig.
2f). Since the GST-HSF1 2-270 appears to pull down more
RalBP1, some amino acid residues beyond the DNA binding domain of HSF1
could be required for a more stable interaction between HSF1 and
RalBP1.
The results shown in Fig. 1 indicated that the C-terminal portion of
RalBP1 (amino acid residues 440-655) interacts with HSF1. Since the
Ral binding domain (amino acid residues 403-499) that is capable of
binding to RalGTP is located within this region on RalBP1, experiments
were performed to determine whether HSF1 and RalGTP have common binding
sites on RalBP1. Pull-down experiments were performed using purified
GST-RalBD (amino acid residues 403-499) and H1299 cell lysates
containing endogenous HSF1. Immunoblots failed to detect HSF1,
suggesting that the sequences encoded by the Ral binding domain alone
were not sufficient to allow binding to HSF1 (data not shown).
These results suggest that RalBP1 interacts with amino acid residues
encoding the DNA binding domain of HSF1 in vitro and that
this interaction occurs at 37 °C, but not when cells are exposed to
heat stress in vivo.
RalBP1 Is a Cytoplasmic Protein and, Together with
-Tubulin,
Accumulates around the Nucleus after Heat Shock--
A Ral-binding
protein known as cytocentrin, which has high levels of sequence
homology to RalBP1, has been shown to be associated with the formation
of mitotic spindles. Mitotic spindles contain microtubules and are
composed of
-,
-, and
-tubulins (53). To determine the
intracellular location of RalBP1 and whether it is associated with
microtubules, H1299 cells were transiently transfected with
FLAG-RalBP1. After a 48-h incubation at 37 °C, cytoplasmic and
nuclear fractions were isolated, and immunoblotting experiments were
performed using antibody to RalBP1 and
-tubulin. In a similar
fractionation experiment, we also used immunoblotting to detect HSF1.
The results indicate that elevated levels of RalBP1 were found within
the nuclear fraction after cells were exposed to heat shock, whereas an
abundant amount of
-tubulin was found in both fractions (Fig.
3a). As predicted, HSF1 was
translocated into the nuclear fraction as cells were heated at
39-43 °C. The translocation of HSF1 from cytoplasm into the nucleus
coincides with its hyperphosphorylation and increase in its apparent
molecular size (Fig. 3a) (5, 52).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 3.
RalBP1 is a cytoplasmic protein and, together
with -tubulin, associates with the nuclear
fraction after heat shock. a, H1299 cells were
transiently transfected with plasmids containing FLAG-RalBP1. After a
48-h incubation at 37 °C, cells were left untreated (37 °C) or
were heated at 39, 41, or 43 °C for 1 h. Nuclear and
cytoplasmic fractions were isolated, and equal amounts of each fraction
were analyzed by immunoblotting using antibody to FLAG, -tubulin, or
HSF1. Note the increase in RalBP1 associated with nuclear fractions at
elevated temperatures. Also note that the HSF1 band is retarded in
SDS-PAGE due to hyperphosphorylation in heated cells when compared with
unheated control cells. b, RalBP1 interacts with -tubulin
under control or heat shock conditions. H1299 cells were transiently
transfected with plasmids containing FLAG-RalBP1. After a 48-h
incubation at 37 °C, cells were left untreated (37 °C) or were
heated at 43 °C for 1 h. RalBP1 was immunoprecipitated from
equal amounts of cell lysates from control (37 °C) or heated
(43 °C) sample using antibody to -tubulin. The immunoprecipitated
materials were analyzed by immunoblotting using antibody to FLAG
(upper panel). The middle
panel shows an equal amount of -tubulin in the cell
lysates used for immunoprecipitation as detected by immunoblotting
using antibody to -tubulin. The first lane in
the upper two panels shows cell lysate
from control (37 °C) cells that was immunoprecipitated using
nonimmune serum (negative control). The lower
panel (same cell lysate as in Fig. 2c) shows that
an equal amount of FLAG-RalBP1 was expressed in control (37 °C) or
heated (43 °C) samples as detected by immunoblotting using antibody
to FLAG. c, immunofluorescent analysis of FLAG-RalBP1 and
-tubulin. H1299 cells were transiently transfected with
FLAG-RalBP1. After a 48-h incubation at 37 °C, cells were left
untreated (37 °C) or heated (43 °C for 1 h) and were then
fixed and stained with antibody to FLAG or -tubulin. The images were
analyzed by fluorescence microscopy (original magnification, ×450).
The arrows show a cell expressing FLAG-RalBP1 and the same
cell stained with -tubulin. The third column
shows when the two images were overlapped. d,
immunofluorescent analysis of HSF1. H1299 cells were left untreated
(37 °C) or heated (43 °C for 1 h) and were then fixed and
stained with antibody to HSF1. The images were analyzed by fluorescence
microscopy (original magnification, ×450). The arrows show
HSF1 in control or heated cells.
|
|
To determine whether RalBP1 associates with
-tubulin,
co-immunoprecipitation experiments were performed with H1299 cells transiently transfected with FLAG-RalBP1 using antibody to
-tubulin. Immunoprecipitated materials were analyzed by immunoblotting using antibody to FLAG-RalBP1 or to
-tubulin. The results indicate that
-tubulin associates with RalBP1 at 37 °C and when cells were
treated at 43 °C (Fig. 3b). There was some increase in
association of
-tubulin with RalBP1 when cells were heated. To
ensure that the level of transiently transfected RalBP1 was similar in
control or heated samples, immunoblotting of cell lysates was performed using antibody to FLAG to detect RalBP1 (Fig. 3b).
We also performed immunofluorescence studies to visualize the location
of RalBP1 and
-tubulin. Thus, H1299 cells were transiently transfected with FLAG-RalBP1, and control or heated cells were fixed
and stained with antibody to FLAG-RalBP1 or to
-tubulin. The results
indicated that RalBP1 does not enter the nucleus after heat shock but
accumulates around the nucleus together with
-tubulin (Fig.
3c). Similar analyses indicated that endogenous HSF1 is located in the both cytoplasm and nucleus under control conditions and
that HSF1 is translocated into the nucleus and forms characteristic nuclear granules after heat shock (Fig. 3d) (5, 52).
The Ral Signaling Pathway Is Activated by Heat Shock, Leading to an
Increase in RalGTP Binding to RalBP1--
The Ral binding domain of
RalBP1 associates with Ral in a GTP-dependent manner (39).
To determine whether the Ral signaling pathway is activated by heat
shock, leading to an increase in Ral-GTP as measured by an increase in
Ral-GTP binding to the Ral binding domain of RalBP1, we performed the
following experiments. H1299 cells were transiently transfected with
expression constructs containing FLAG-RalA or the dominant negative
form (FLAG-RalA28N). Cells were left untreated or were heated at
43 °C. Cell lysates were incubated with the purified GST-RalBD.
Samples were then analyzed by immunoblotting using antibody to FLAG
(Fig. 4). The results indicate that cells
transfected with FLAG-RalA show no binding to GST-RalBD at 37 °C,
indicating that the Ral signaling pathway is repressed under
physiological conditions (Fig. 4). However, there is an increase in
binding of FLAG-RalA to GST-RalBD within 10 min of exposure of cells to
43 °C. In contrast, cells expressing FLAG-RalA28N do not show any
binding to RalBD at 37 °C or after cells were exposed to heat shock.
To ensure that the levels of expression of transiently transfected
FLAG-RalA and FLAG-RalA28N were similar in H1299 cells expressing these
constructs, immunoblot experiments were performed with cell lysates
from transiently transfected cells using antibody to FLAG (Fig. 4,
lower panel).

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 4.
Increase in RalGTP binding to the Ral binding
domain of RalBP1 protein after heat shock. H1299 cells were
transiently transfected with plasmids containing FLAG-tagged wild-type
RalA or the dominant negative allele form of RalA (RalA28N). After a
48-h incubation at 37 °C, cells were left untreated or were heated
for 5, 10, or 30 min at 43 °C. Equal amounts of cell lysate were
incubated with the purified GST-Ral binding domain of RalBP1
(GST-RalBD) and analyzed by SDS-PAGE, followed by immunoblotting using
antibody to FLAG (upper panel). The
lower panel shows the immunoblot analysis of cell
lysates containing transfected FLAG-tagged wild-type RalA or RalA28N
using antibody to FLAG to show that the levels of expression of the
transfected constructs were approximately equal in all samples.
|
|
These results indicate that treatment of cells with heat shock leads to
activation of the Ral signal transduction pathway and conversion of
RalGDP to RalGTP, which then binds to the Ral binding domain of
RalBP1.
Activation of the Ral Signaling Pathway Coincides with Increases in
HSP70 Expression--
Our findings suggest that RalBP1 binds to HSF1
at 37 °C. However, after exposure of the cells to heat shock, RalBP1
dissociates from HSF1 and binds to activated Ral. This allows HSF1 to
then translocate into the nucleus and activate transcription. To test whether the activation of the Ral signaling pathway that leads to the
RalGTP-RalBP1 interaction leads to altered HSP70 gene expression, H1299
cells or hsf1
/
MEFs were transiently
transfected with expression constructs containing constitutively active
Ral23V or the dominant negative RalA28N. Therefore,
hsf1
/
MEFs were co-transfected with HSF1
expression vector. The hsf1
/
MEFs lack the
ability to express any inducible heat shock proteins (HSPs) including
HSP70 after heat shock. Reintroduction of HSF1 in
hsf1
/
MEFs results in the induction of
inducible HSPs in those cells that transiently express HSF1.
Accumulation of HSP70 was examined after heat shock using
immunoblotting. The results (Fig. 5,
a and b) indicate that HSP70 expression is
increased after heat shock when cells were transfected with
constitutively active RalA23V and is decreased when cells were
transfected with dominant negative RalA28N. These results confirm the
above observation that the activation of the Ral signaling pathway by
heat shock that is associated with an increase in RalGTP-RalBP1 binding
leads to an increase in HSP70 expression. Furthermore, this effect is
mainly due to HSF1, since cotransfection of dominant negative allele Ral28N together with HSF1 can completely abolish HSP70 induction in
hsf1
/
MEFs (Fig. 5b).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
Activation of the Ral signaling pathway leads
to activation of HSF1 and an increase in inducible HSP70 after heat
shock. a and b, H1299 or
hsf1 / MEFs were transiently transfected with
plasmids containing pcDNA3 (in the case of H1299) or
pcDNA3-HSF1 (in the case of hsf1 / MEFs)
and cotransfected with plasmids containing RalA23V or RalA28N. After a
48-h incubation at 37 °C, cells were left untreated or were heated
as indicated. Following 0-6 h of recovery time at 37 °C, cell
lysates were prepared and analyzed by immunoblotting using antibody to
inducible HSP70 or to FLAG as indicated. Antibody to FLAG shows levels
of expression of transfected plasmid constructs.
|
|
To find out whether the expression of RalBP1 lowers the ability of HSF1
to induce HSP70, again we took advantage of
hsf1
/
MEF. Thus,
hsf1
/
MEFs were transfected with expression
vectors containing HSF1 or HSF1 plus RalBP1. We then measured the
ability of cells to induce HSP70 after heat shock. The results show
that in cells expressing HSF1 and RalBP1, the level of HSP70 expression
after heat shock was reduced compared with cells expressing only HSF1 (Fig. 6). Note that in some experiments,
cells transiently transfected with HSF1 show basal levels of
transcriptional activity even at 37 °C (Fig. 6, upper
panel). This is perhaps due to the absence of sufficient
negative regulators to repress HSF1 transcriptional activity under
control conditions once HSF1 is overexpressed (52). Interestingly,
RalBP1 cotransfected with HSF1 reduces this residual constitutive
active HSF1 as well as the levels of the heat-inducible HSP70 (Fig.
6).

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 6.
HSP70 expression is reduced in
hsf1 /
MEFs expressing RalBP1. hsf1 / MEFs were
cotransfected with expression plasmids containing pcDNA3-HSF1 alone
(upper panel) or pcDNA3-HSF1 and
pcDNA3-RalBP1 (lower panel). After 48 h,
cells were left untreated (C) or were heated at 42 °C for
30 min followed by recovery at 37 °C for 0 or 2 h. Equal
amounts of cell lysates were analyzed by SDS-PAGE using antibody to the
inducible HSP70 or RalBP1 or actin as indicated.
|
|
Together with the data shown in Fig. 2, b and c,
our results demonstrate that RalBP1 binds the repressed form of HSF1 at
37 °C. After heat shock, HSF1 is released from RalBP1 and is
translocated into the nucleus, driving transcription of HSP70. The
dissociation of HSF1 from RalBP1 could be due to the high affinity of
RalGTP for RalBP1, which has been previously demonstrated (39), and we
show here that it is also enhanced after exposure of cells to heat shock.
HSF1 and RalBP1 Are in Heterocomplexes with HSP90 and
-Tubulin
in Vivo--
HSF1 interacts with HSP90 in the cytoplasm, and this
interaction keeps HSF1 in a repressed state (11). To investigate
whether HSF1·RalBP1 heterocomplexes also contain HSP90 and perhaps
-tubulin, we performed co-immunoprecipitation experiments. H1299
cells were transiently cotransfected with FLAG-RalBP1 and HSF1. HSP90
was then immunoprecipitated using anti-HSP90 antibody, and the
immunoprecipitated materials were analyzed by immunoblotting using
antibody to detect RalBP1, HSF1,
-tubulin, or HSP90. The results
indicate that HSF1, RalBP1, and
-tubulin can be coimmunoprecipitated
with HSP90 at 37 °C (Fig. 7). After
heat shock, HSF1 dissociates from RalBP1,
-tubulin, and HSP90.
Interestingly, some fraction of RalBP1 remains bound to HSP90 after
heat shock in some experiments, suggesting slower release kinetics for
HSP90 than for HSF1 from this complex. However, RalBP1 levels returned
to that observed at 37 °C after the heated cells were allowed to
recover for 4 h at 37 °C. At this recovery time, HSF1 had not
yet appeared in the RalBP1·HSP90·
-tubulin heterocomplex (data
not shown). We did not find HSP70/HSC70 in the same complex with
RalBP1·HSF1·HSP90 (data not shown).

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 7.
HSF-1 interacts with RalBP1, HSP90, and
-tubulin. H1299 cells were transiently
transfected with plasmids containing pcDNA3-RalBP1 and
pcDNA3-HSF1. 48 h after transfection, cells were left
untreated (lane 1) or were heated at 43 °C for
1 h (lane 2). Cell lysates were prepared,
and HSP90 was immunoprecipitated using antibody to HSP90
(lanes 1 and 2) or no antibody
(lane 3). The samples were immunoblotted using
antibody to FLAG to detect RalBP1 or hemagglutinin to detect HSF1,
anti-HSP90, or anti- -tubulin.
|
|
 |
DISCUSSION |
In this study, we show evidence that the Ral-binding protein
RalBP1 interacts with HSF1 in vivo. The RalPB1-HSF1
interaction occurs at 37 °C, and RalBP1·HSF1 heterocomplexes
dissociate after heat shock. We also find significantly high levels of
HSP90 and
-tubulin in the RalBP1·HSF1 heterocomplexes. This
extends the previous observations indicating that the monomeric,
repressed form of HSF1 is in heterocomplexes with HSP90 (11) and
extends a previous observation that HSF1·HSP90 heterocomplexes are
located on
-tubulin that is a component of the cytoskeleton. Under
stress conditions, HSP90·HSF1 heterocomplexes dissociate, perhaps
because of the affinity of HSP90 for denatured polypeptides (9, 11). These results indicate that RalBP1·HSF1·HSP90·
-tubulin
heterocomplexes receive signals from stresses that activate the Ral
signaling pathway, which also leads to HSF1 activation. HSF1·HSP90
heterocomplexes are reported to be dynamic, and immunodepletion of
HSP90 leads to activation of HSF1 (11). We have not detected
HSP70/HSC70 proteins in RalBP1· HSF1·HSP90·
-tubulin
complexes, a result that is also consistent with previous studies
indicating that the repressed form of HSF1 interacts only with HSP90
and not with HSP70 (11). However, HSP70 interacts with the trimeric
form of HSF1 together with HSP90 and multiple other co-chaperones
during the HSF1 inactivation process; this interaction occurs in the
nucleus (9, 10, 12).
We also show that the Ral signal transduction pathway is highly
activated by heat shock. Activation of the Ral signaling pathway is
associated with conversion of RalGDP to RalGTP and, because of the high
affinity of RalGTP for RalBP1, the RalBP1·HSF1·HSP90·
-tubulin heterocomplexes can potentially dissociate, leading to release of HSF1
and allowing it to translocate into the nucleus. It is conceivable that RalBP1·HSF1·HSP90·
-tubulin heterocomplexes
also contain protein kinases, and such a kinase could be activated upon
activation of the Ral signaling pathway. This protein kinase could then
phosphorylate and activate HSF1. Similarly to the
Ras-Raf-Mek-extracellular signal-regulating kinase signaling pathway,
activation of the Ral signaling pathway could also lead to activation
of an as yet unknown protein kinase cascade. Since Ral is found not
only in the plasma membrane but also in membrane vesicles, and
Ras-independent activation of Ral is calcium-dependent
(13-17, 23), we hypothesize that activation of
calcium-dependent protein kinases such as, for example,
protein kinase C, protein kinase G, or
calcium/calmodulin-dependent protein kinase, could
phosphorylate and activate HSF1.
Calcium/calmodulin-dependent protein kinase has been
implicated in phosphorylation of HSF1 on serine 230, leading to its
activation (8); however, more evidence is required to implicate this or
any other enzyme in the pathway.
Similar to the other small GTP binding proteins Ras and Rac, no protein
kinase has been discovered to be downstream of the Ral signal
transduction pathway. Ral, through its interacting partners, has been
implicated in multiple cellular processes such as endocytosis,
actin/cytoskeletal organization, and vesicle function (17, 41, 43, 53).
The significance of the RalBP1 binding to the active form of RalGTP is
not understood. RalBP1 contains a weak GTPase activity toward Cdc42 and
Rac, which influences the actin cytoskeleton and can modulate the Jun
N-terminal kinase signaling pathway (33, 39, 40, 44, 54). The
RalGTP-RalBP1 interaction represses the activity of Rac. Since Jun
N-terminal kinase has been shown to be activated by heat shock (1) and it has been suggested that it also phosphorylates HSF1 and represses its transcriptional activity during its inactivation cycle (1), slowing
down Rac activation and similarly slowing down activation of Jun
N-terminal kinase after heat shock could perhaps provide a sufficient
amount of time for a rapid activation of HSF1 and transcription of
downstream genes followed by its subsequent inactivation by
phosphorylation by Jun N-terminal kinase and perhaps other protein
kinases. RalBP1 has also been shown to interact with the µ2 subunit of AP2, which is involved in endocytosis (49,
55). Therefore, active RalGTP has been suggested to stabilize
association of µ2-RalBP1 with the membrane, leading to
inhibition of clathrin-dependent endocytosis of certain
receptors such as epidermal growth factor (49).
Interestingly, RalBP1 has a Ral binding region, and this region of
RalBP1 partially overlaps with the region that binds HSF1. This
suggests that Ral and HSF1 could compete for a binding site on RalBP1.
However, the HSF1 binding region in RalBP1 requires a number of amino
acids that extend to the POB1 binding region. The exact boundaries of
the Ral binding region and POB1 binding region in RalBP1, however, has
not been fully defined. POB1 (partner of
RalBP1) is a protein with unknown function. It contains an Eps15 homology domain, and proteins with such domains appear to be
involved in clathrin-dependent endocytosis (56). RalBP1 and POB1 may link the tyrosine kinase and Src homology 3-containing proteins to Ral. We also have further found that RalBP1 colocalizes and
is in the same complex with
-tubulin. Furthermore, HSF1 and HSP90 also colocalize to this same complex. This is significant, since these results locate the repressed HSF1 on the cytoskeletal proteins that have been shown to undergo major morphological changes upon heat stress (47). We further show that the Ral signaling pathway
is activated by heat shock, and transient transfection of the
constitutively active form of Ral (RalA23V) increases HSP70 expression
in both H1299 cells, which contain endogenous HSF1, and
hsf1
/
MEF cells in which HSF1 was
transiently expressed. These results strongly suggest that activation
of the Ral signaling pathway increases RalGTP binding to RalBP1, and
therefore, there is less RalBP1 that is present in cells to bind and
repress HSF1. Similarly, transient transfection of RalBP1 in
hsf1
/
MEF reduced HSF1-mediated HSP70 expression.
In conclusion, we show that HSF1 interacts with RalBP1 in
vivo at 37 °C. HSF1·RalBP1 heterocomplexes also contain HSP90
and
-tubulin. Upon heat shock, HSF1 dissociates from RalBP1 and
translocates into the nucleus. This coincides with the activation of
the Ral-GTP signaling pathway as shown by an increase in Ral-GTP
binding to the Ral binding domain of RalBP1. Expression of constitutive
active RalGTP leads to an increase in HSP70 expression and, expression of the dominant negative allele of Ral leads to a decrease in HSP70
expression. Activation of RalGTP signaling pathway by heat shock could
lead to activation of downstream protein kinases and phosphorylation of
HSF1, leading to its nuclear translocation and activation.
 |
ACKNOWLEDGEMENTS |
We thank the following investigators for
providing valuable materials or assistance: Dr. R. Cool for providing
full-length human RalBP1 cDNA, Dr. S. Korsmeyer for plasmids
encoding SV40 large T antigen, and Dr. Y. Zhang for help and materials.
 |
FOOTNOTES |
*
This work was supported by NCI, National Institutes of
Health, Grants CA62130 and CA85947 (to N. F. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Medical College of
Georgia, Institute of Molecular Medicine and Genetics, 1120 15th St.
CB2803, Augusta, Georgia 30912. Tel.: 706-721-8759; Fax: 706-721-8752;
E-mail: mivechi@immag.mcg.edu.
Published, JBC Papers in Press, March 5, 2003, DOI 10.1074/jbc.M300788200
2
Zhang, Y., Huang, L., Zhang, J., Moskophidis,
D., and Mivechi, N. F. (2002) J. Cell. Biochem. 86, 376-393.
 |
ABBREVIATIONS |
The abbreviations used are:
HSF1, heat shock
factor 1;
RalBP1, Ral-binding protein 1;
RalBD, Ral binding domain;
MEF, mouse embryo fibroblast;
PBS, phosphate-buffered saline;
HSP, heat
shock protein.
 |
REFERENCES |
| 1.
|
Dai, R.,
He, B.,
Freitag, W.,
Zhang, Y.,
and Mivechi, N. F.
(2000)
J. Biol. Chem.
275,
18210-18218[Abstract/Free Full Text]
|
| 2.
|
Knauf, U.,
Newton, E. M.,
Kyriakins, J.,
and Kingston, R. E.
(1996)
Genes Dev.
10,
2782-2793[Abstract/Free Full Text]
|
| 3.
|
Soncin, F.,
Asea, A.,
Zhang, X.,
Stevenson, M. A.,
and Calderwood, S. K.
(2000)
Int. J. Mol. Med.
6,
705-710[Medline]
[Order article via Infotrieve]
|
| 4.
|
Kline, M. P.,
and Morimoto, R. I.
(1997)
Mol. Cell. Biol.
17,
2107-2115[Abstract]
|
| 5.
|
He, B.,
Meng, Y.-H.,
and Mivechi, N. F.
(1998)
Mol. Cell. Biol.
18,
6624-6633[Abstract/Free Full Text]
|
| 6.
|
Chu, B.,
Soncin, F.,
Price, B. D.,
Stevenson, M. A.,
and Calderwood, S. K.
(1996)
J. Biol. Chem.
271,
30847-30857[Abstract/Free Full Text]
|
| 7.
|
Xia, W.,
and Voellmy, R.
(1997)
J. Biol. Chem.
272,
4094-4102[Abstract/Free Full Text]
|
| 8.
|
Holmberg, C. I.,
Hietakangas, V.,
Mikhailov, A.,
Rantanen, J. O.,
Kallio, M.,
Meinander, A.,
Hellman, J.,
Morrice, N.,
Mackintosh, C.,
Morimoto, R. I.,
Eriksson, J. E.,
and Sistonen, L.
(2001)
EMBO J.
20,
3800-3810[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Bharadwaj, S.,
Ali, A.,
and Ovsenek, N.
(1999)
Mol. Cell. Biol.
19,
8033-8041[Abstract/Free Full Text]
|
| 10.
|
Zou, J.,
Guo, Y.,
Guettouche, T.,
Smith, D. F.,
and Voellmy, R.
(1998)
Cell
94,
471-480[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Guo, Y.,
Guettouche, T.,
Fenna, M.,
Boellmann, F.,
Pratt, W. B.,
Toft, D. O.,
Smith, D. F.,
and Voellmy, R.
(2001)
J. Biol. Chem.
276,
45791-45799[Abstract/Free Full Text]
|
| 12.
|
Satyal, S. H.,
Chen, D.,
Fox, S. G.,
Kramer, J. M.,
and Morimoto, R. I.
(1998)
Genes Dev.
12,
1962-1974[Abstract/Free Full Text]
|
| 13.
|
Bielinske, D. F.,
Pyun, N. Y.,
Linko-Stentz, K.,
Macara, I.,
and Fine, R. E.
(1993)
Biochim. Biophys. Acta
1151,
246-256[Medline]
[Order article via Infotrieve]
|
| 14.
|
Volknandt, W.,
Pevsner, J.,
Elferink, L. A.,
and Scheller, R. H.
(1993)
FEBS Lett.
317,
53-56[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Urano, T.,
Emkey, R.,
and Feig, L. A.
(1996)
EMBO J.
16,
810-816
|
| 16.
|
Reuther, G. W.,
and Der, C. J.
(2000)
Curr. Opin. Cell Biol.
12,
157-165[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Feig, L. A.,
Urano, T.,
and Cantor, S.
(1996)
Trends Biochem. Sci.
21,
438-441[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
White, M. A.,
Vale, T.,
Camonis, J. H.,
Schaefer, E.,
and Wigler, M. H.
(1996)
J. Biol. Chem.
271,
16439-16442[Abstract/Free Full Text]
|
| 19.
|
Wolthuis, R. M.,
Franke, B.,
van Triest, M.,
Bauer, B.,
Cool, R. H.,
and Camonis, J. H.
(1998)
Mol. Cell. Biol.
18,
2486-2491[Abstract/Free Full Text]
|
| 20.
|
Wolthuis, R. M.,
Zwartkruis, F.,
Moen, T. C.,
and Bos, J. L.
(1998)
Curr. Biol.
8,
471-474[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Wolthuis, R. M.,
and Bos, J. L.
(1999)
Curr. Opin. Genet. Dev.
9,
112-117[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Goi, T.,
Shipitsin, M.,
Lu, Z.,
Foster, D. A.,
Klinz, S. G.,
and Feig, L. A.
(2000)
EMBO J.
19,
623-630[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Hofer, F.,
Berdeaux, R.,
and Martin, G. S.
(1998)
Curr. Biol.
8,
839-842[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Bhattacharya, M.,
Anborgh, P. H.,
Babwah, A. V.,
Dale, L. B.,
Bobransky, T.,
Benovic, J. L.,
Feldman, R. D.,
Verdi, J. M.,
Rylett, R. J.,
and Ferguson, S. S.
(2002)
Nat. Cell Biol.
8,
547-555
|
| 25.
|
de Ruiter, N. D.,
Burgering, B. M.,
and Bos, J. L.
(2001)
Mol. Cell. Biol.
21,
8225-8235[Abstract/Free Full Text]
|
| 26.
|
McCormick, F.
(1995)
Mol. Reprod. Dev.
42,
500-506[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Franke, B.,
Akkerman, J. W.,
and Bos, J. L.
(1997)
EMBO J.
16,
252-259[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
de Ruiter, N. D.,
Wolthuis, R. M.,
van Dam, H.,
Burgering, B. M.,
and Bos, J. L.
(2000)
Mol. Cell. Biol.
20,
8480-8488[Abstract/Free Full Text]
|
| 29.
|
Wolthuis, R. M.,
de Ruiter, N. D.,
Cool, R. H.,
and Bos, J. L.
(1997)
EMBO J.
16,
6748-6761[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Ouwens, D. M.,
de Ruiter, N. D.,
van der Zon, G. C.,
Carter, A. P.,
Schouten, J.,
van der Burgt, C.,
Kooistra, K.,
Bos, J. L.,
Maassen, J. A.,
and van Dam, H.
(2002)
EMBO J.
21,
3782-3793[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Henry, D. O.,
Moskalenko, S. A.,
Kaur, K. J.,
Fu, M.,
Pestell, R. G.,
Camonis, J. H.,
and White, M. A.
(2000)
Mol. Cell. Biol.
20,
8084-8092[Abstract/Free Full Text]
|
| 32.
|
Kops, G. J.,
de Ruiter, N. D.,
DeVeries-Smits, A. M.,
Powell, D. R.,
Bos, J. L.,
and Burgering, B. M.
(1999)
Nature
398,
630-634[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Ward, Y.,
Wang, W.,
Woodhouse, E.,
Linnoila, I.,
Liotta, L.,
and Kelly, K.
(2001)
Mol. Cell. Biol.
21,
5958-5969[Abstract/Free Full Text]
|
| 34.
|
Rodriguez-Viciana, P.,
Warne, P.,
Khwaja, A.,
Marte, B.,
Pappin, D.,
Ridley, A.,
and Downward, J.
(1997)
Cell
89,
457-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Sugihara, K.,
Asano, S.,
Tanaka, K.,
Iwamatsu, A.,
Okawa, K.,
and Ohta, Y.
(2002)
Nat. Cell Biol.
4,
73-78[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Moskalenko, S.,
Henry, D. O.,
Rosse, C.,
Mirey, G.,
Camonis, J. H.,
and White, M. A.
(2001)
Nat. Cell Biol.
4,
66-72
|
| 37.
|
Luo, J. Q.,
Liu, X.,
Frankel, P.,
Rotunda, T.,
Ramos, M.,
Flom, J.,
Jiang, L. A.,
Feig, L. A.,
Morris, A. J.,
Kahn, R. A.,
and Foster, D. A.
(1998)
Proc. Natl. Acad. Sci.
95,
3632-3637[Abstract/Free Full Text]
|
| 38.
|
Jiang, H.,
Luo, J. Q.,
Urano, T.,
Frankel, P.,
Lu, Z.,
Foster, D. A.,
and Fieg, L. A.
(1995)
Nature
378,
409-412[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Cantor, S. B.,
Urano, T.,
and Feig, L. A.
(1995)
Mol. Cell. Biol.
15,
4578-4584[Abstract]
|
| 40.
|
Park, S. H.,
and Weinberg, R. A.
(1995)
Oncogene
11,
2349-2355[Medline]
[Order article via Infotrieve]
|
| 41.
|
Ikeda, M.,
Ishida, O.,
Hinoi, T.,
Kishida, S.,
and Kikuchi, A.
(1998)
J. Biol. Chem.
273,
814-821[Abstract/Free Full Text]
|
| 42.
|
Nakashima, S.,
Morinaka, K.,
Koyama, S.,
Ikeda, M.,
Kishida, M.,
Okawa, K.,
Iwamatsu, A.,
Kishida, S.,
and Kikuchi, A.
(1999)
EMBO J.
18,
3629-3642[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Yamaguchi, A.,
Urano, T.,
Goi, T.,
and Feig, L. A.
(1997)
J. Biol. Chem.
272,
31230-31234[Abstract/Free Full Text]
|
| 44.
|
Jullien-Flores, V.,
Dorseuil, O.,
Romero, F.,
Letourneur, F.,
Saragosti, S.,
Berger, R.,
Tavitian, A.,
Gacon, G.,
and Camonis, J. H.
(1995)
J. Biol. Chem.
270,
22473-22477[Abstract/Free Full Text]
|
| 45.
|
Miller, M. J.,
Prigent, S.,
Kupperman, E.,
Rioux, L.,
Park, S. H.,
Framisco, J. R.,
White, M. A.,
Rutkowski, J. L.,
and Meinkoth, J. L.
(1997)
J. Biol. Chem.
272,
5600-5605[Abstract/Free Full Text]
|
| 46.
|
Ohta, Y.,
Suzuki, N.,
Nakamura, S.,
Hartwig, J. H.,
and Stossel, T. P.
(1999)
Proc. Natl. Acad. Sci.
96,
2122-2128[Abstract/Free Full Text]
|
| 47.
|
Liang, P.,
and MacRae, T. H.
(1997)
J. Cell Sci.
110,
1431-1440[Abstract]
|
| 48.
|
Aronheim, A.,
Zandi, E.,
Hennenmann, H.,
Elledge, S. J.,
and Karin, M.
(1997)
Mol. Cell. Biol.
17,
3094-3102[Abstract]
|
| 49.
|
Jullien-Flores, V.,
Mahe, Y.,
Mirey, G.,
Leprince, C.,
Meunier-Bisceuil, B.,
Sorkin, A.,
and Camonis, J. H.
(2000)
J. Cell Sci.
113,
2837-2844[Abstract]
|
| 50.
| |