|
Originally published In Press as doi:10.1074/jbc.M212766200 on March 1, 2003
J. Biol. Chem., Vol. 278, Issue 19, 17509-17514, May 9, 2003
Phosphorylation-dependent Regulation of Kv2.1 Channel
Activity at Tyrosine 124 by Src and by Protein-tyrosine Phosphatase
*
Zohar
Tiran ,
Asher
Peretz§,
Bernard
Attali§¶, and
Ari
Elson
From the Department of Molecular Genetics, The
Weizmann Institute of Science, Rehovot 76100, Israel and the
§ Department of Physiology, Sackler Medical School, Tel Aviv
University, Tel Aviv 69978, Israel
Received for publication, December 16, 2002, and in revised form, February 24, 2003
 |
ABSTRACT |
Voltage-gated potassium (Kv) channels are a
complex and heterogeneous family of proteins that play major roles in
brain and cardiac excitability. Although Kv channels are activated by
changes in cell membrane potential, tyrosine phosphorylation of channel subunits can modulate the extent of channel activation by
depolarization. We have previously shown that dephosphorylation of
Kv2.1 by the nonreceptor-type tyrosine phosphatase PTP
(cyt-PTP ) down-regulates channel activity and counters its
phosphorylation and up-regulation by Src or Fyn. In the present study,
we identify tyrosine 124 within the T1 cytosolic domain of Kv2.1 as a
target site for the activities of Src and cyt-PTP .
Tyr124 is phosphorylated by Src in vitro;
in whole cells, Y124F Kv2.1 is significantly less phosphorylated by Src
and loses most of its ability to bind the D245A substrate-trapping
mutant of cyt-PTP . Phosphorylation of Tyr124 is critical
for Src-mediated up-regulation of Kv2.1 channel activity, since Y124F
Kv2.1-mediated K+ currents are only marginally up-regulated
by Src, in contrast with a 3-fold up-regulation of wild-type Kv2.1
channels by the kinase. Other properties of Kv2.1, such as expression
levels, subcellular localization, and voltage dependence of channel
activation, are unchanged in Y124F Kv2.1, indicating that the effects
of the Y124F mutation are specific. Together, these results indicate that Tyr124 is a significant site at which the mutually
antagonistic activities of Src and cyt-PTP affect Kv2.1
phosphorylation and activity.
 |
INTRODUCTION |
Voltage-dependent K+
(Kv)1 channels are key
regulators of cellular functions and affect parameters such as action
potential wave forms, neuronal firing patterns, synaptic integration,
neurotransmitter release, volume regulation, and cell proliferation
(1). Proper function of Kv channels is vital to health and well being,
as demonstrated by identification of mutations in genes that encode Kv
channel subunits as causing cardiac and neurological disorders in
humans (2-4).
Kv channels are composed of four -subunits that span the cell
membrane and that can be found in some cases in association with
regulatory cytosolic -subunits (1, 5, 6). All Kv channel
-subunits share a common core structure of six transmembrane segments (S1-S6) and a P-loop forming the pore region of the channel (7). -Subunits contain several major structural domains. Among these
is a voltage-sensing domain, composed of segments S1-S4 that folds in
-helical structure and surrounds the pore. This domain is
responsible for energy transduction and for controlling gating
behavior. A second major domain of -subunits is the pore domain
(segments S5-P-S6), whose structure is likely to be similar to the
crystal structure of the bacterial KcsA K+ channel, with
the inner helix S6 lining much of the pore (7). Another major domain of
-subunits is the T1 region, which is part of the cytosolic
N-terminal domain. In Shaker-related Kv channels, this
domain comprises ~120 amino acids and is located between the
N-terminal inactivation ball and S1 (8). The T1 domain is responsible
for molecular segregation of Kv channels, in which tetramerization of
-subunits belonging to the same subfamily is preferred (8). In
addition, this domain associates with the auxiliary -subunits of
Shaker-related Kv channels and is the site for regulation of
channel activity by various cytosolic factors (8-11).
Significant evidence has shown that Kv channels are substrates of
protein kinase activities and that phosphorylation can affect channel
characteristics (12-15). Several studies have established a prominent
role for Src family protein-tyrosine kinases (PTKs) in regulation of Kv
channels. Among these, Src family kinases have been shown to
phosphorylate Kv1.3 and to down-regulate its activity in heterologous
expression systems as well as in Jurkat T cells and in rat olfactory
bulb neurons (16-21). Similar effects were noted with Kv1.5 in
transfected HEK 293 cells (22). Src- and Fyn-mediated phosphorylation
of Kv1.5 and of Kv2.1 enhanced K+ channel activity in mouse
Schwann cells and in rat cortical astrocytes (23-25). Interestingly,
in rat retinal pigment epithelial cells, Src family tyrosine kinases
can activate or inhibit Kv1.3 channel activity in a manner dependent on
protein kinase C activity (26). Last, an indirect role for the Kv1.5
-subunits in phosphorylation of other subunits was recently shown.
The Src homology 3 domains of Src family kinases can bind Kv1.5,
thereby granting these PTKs access to Kv channel -subunits that
associate with Kv1.5 but that have no Src homology 3 binding sites of
their own (27).
Protein-tyrosine phosphatases (PTPs) are generic antagonists of PTKs
and play crucial roles in regulating physiological processes by
affecting protein phosphorylation (28-30). However, in contrast with
the wealth of information concerning the effects of PTKs on Kv
channels, very little is known about how PTPs participate in these
processes. The receptor-type PTP (31, 32) physically associates with
Kv1.2 and up-regulates channel activity following its inhibition by the
G protein-coupled M1 muscarinic acetylcholine receptor in
Xenopus oocytes and mammalian cells (33). The same PTP was
later shown also to counter serotonergic inhibition of Kv1.1 and Kv1.2
in a similar experimental system (34). We have demonstrated that the
nonreceptor form of PTP epsilon (cyt-PTP ) (35) dephosphorylates and
down-regulates Kv1.5 and Kv2.1 following their phosphorylation by Src
or by Fyn in transfected cells and in Xenopus oocytes (36).
In agreement with these results, both Kv1.5 and Kv2.1 were
hyperphosphorylated in primary Schwann cells and in sciatic nerve
tissue from mice genetically lacking PTP . These effects were
correlated with increased Kv channel currents in PTP -deficient
Schwann cells, as well as with transient but severe hypomyelination of
sciatic nerve axons in young PTP -deficient mice (36). Strong support
for Kv2.1 being a substrate of cyt-PTP was obtained in experiments,
which established that a substrate-trapping mutant of cyt-PTP bound
and co-precipitated with Kv2.1 (36, 37). Interactions between this
mutant and Kv2.1 were severely reduced by sodium pervanadate,
indicating that they were mediated by the catalytic site of cyt-PTP
binding to at least one phosphotyrosine residue in Kv2.1. The identity
of that residue, however, remained unknown.
In the present study, we identify Tyr124, a tyrosine
residue located in the T1 cytosolic domain of Kv2.1, as an important
site for phosphorylation by Src. We also identify the same residue as a
docking site for the substrate-trapping mutant of cyt-PTP , implying
that it is dephosphorylated by this phosphatase. Phosphorylation of
Tyr124 has significant effects on Src-mediated regulation
of Kv2.1 channel activity, since mutating this residue to a
nonphosphorylatable phenylalanine abolishes most of the ability of Src
to up-regulate channel activity without affecting other properties of
the channel. These results establish Tyr124 as an important
site for mutually antagonistic regulation of Kv2.1 by Src and by
cyt-PTP and highlight the role of post-translational modifications
in the T1 domain in affecting Kv2.1 activity.
 |
EXPERIMENTAL PROCEDURES |
Reagents--
The following cDNAs were used in this study,
all cloned in the eukaryotic expression vector pcDNA3 (Invitrogen):
mouse cyt-PTP (35), D245A cyt-PTP (36), rat Kv2.1 (gift of Drs.
J. Barhanin and M. Lazdunski), and chicken wild-type and Y527F Src
(gift of Dr. S. Courtneidge). Both PTP cDNAs contained a
FLAG tag at their C terminus. The Y124F mutation was introduced into
the rat Kv2.1 cDNA by site-directed mutagenesis; the presence of
the desired mutation and absence of other mutations were verified by
DNA sequencing. Antibodies used in this study included polyclonal
anti-PTP (38), polyclonal anti-Kv2.1 (Alomone Laboratories,
Jerusalem), monoclonal anti-v-Src (Calbiochem), anti-FLAG M2 affinity
beads (Sigma), and anti-phosphotyrosine (clone PY20; Transduction Laboratories).
Cell Culture and Immunofluorescence--
HEK 293 cells were
grown in Dulbecco's modified Eagle's medium (Invitrogen),
supplemented with 10% (v/v) fetal calf serum (Invitrogen), 2 mM glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin. Cells were transfected using the calcium-phosphate method
(39). For immunofluorescence, 293 cells were plated on glass cover
slips previously coated with polylysine (Sigma), transfected with the
relevant expression vectors, and stained with antibodies as described
previously (40). Primary antibodies used were monoclonal anti-FLAG M2
and/or polyclonal anti-Kv2.1, each diluted 1:250; secondary antibodies
included CY3- or fluorescein-conjugated anti-mouse or anti-rabbit IgG
(1:300 dilution; Jackson Immunoresearch Laboratories). Stained cells
were examined with the aid of a Bio-Rad model MRC 1024 confocal system
and an argon/krypton mixed gas laser, mounted on a Zeiss Axiovert microscope.
Protein Blotting and Substrate Trapping--
Cells were lysed in
Buffer A (50 mM Tris-Cl, pH 7.5, 150 mM NaCl,
1% Nonidet P-40), supplemented with 0.5 mM sodium
pervanadate and protease inhibitors (1 mM
4-(2-aminoethyl)-benzenesulfonyl fluoride, 40 µM
bestatin, 15 µM E-64, 20 µM leupeptin, 15 µM pepstatin; Sigma). SDS gel electrophoresis, blotting,
and antibody hybridization were as described (40). Complete protein
transfer following blotting was verified routinely by noting transfer
of prestained molecular size marker proteins of the proper size range;
the absence of lane-to-lane variations in blotting was verified by
staining the blotted membranes with Ponceau S (Sigma). In control
experiments, where known, graded amounts of protein were subject to
SDS-PAGE and blotting, the intensities of signals obtained were
proportional in a linear fashion to the amounts of antigen loaded on
the gel. For substrate-trapping immunoprecipitation experiments, cells were lysed in Buffer A supplemented with 5 mM iodoacetic
acid and protease inhibitors. One mg of cellular proteins was reacted with anti-FLAG M2 beads for 6-8 h, followed by two washes with buffer
A and one wash with radioimmune precipitation buffer.
GST Fusion Protein Phosphorylation by Src--
GST-Y124 was
prepared by annealing the two complementary oligomers, Y124
sense (GATCCGGCATCGATGAGATCTACCTGGAGTCCTGCG) and Y124 antisense
(AATTCGCAGGACTCCAGGTAGATCTCATCGATGCCG). The resulting double-stranded
DNA fragment, which encoded a decapeptide centered around
Tyr124 of Kv2.1 (119GIDEIYLESC; accession
number X16476) and which contained BamHI and
EcoRI overhangs, was cloned into the BamHI and
EcoRI sites of pGEX2TK (Amersham Biosciences). The mutated
GST-Y124F construct, in which Tyr124 was replaced by an
unphosphorylatable phenylalanine, was prepared in a similar manner
using oligonucleotides Y124F sense
(GATCCGGCATCGATGAGATCTTCCTGGAGTCCTGCG) and Y124F antisense
(AATTCGCAGGACTCCAGGAAGATCTCATCGATGCCG). The structure of the
constructs was verified by DNA sequencing. GST fusion proteins were
grown in Escherichia coli DH5 bacteria, and purified by
binding to glutathione-agarose beads (Sigma) and subsequent elution
with 20 mM glutathione, 50 mM Tris-Cl, pH 8.0. Wild-type chicken Src was expressed in 293 cells and was
immunoprecipitated using anti-v-Src antibodies (Calbiochem). GST fusion
phosphorylation reactions were conducted in 25 µl of kinase buffer
(20 mM MOPS, pH 7.0, 5 mM MgCl2),
to which equal amounts of precipitated Src, 1 µl (equal to 5 µCi)
of [ -32P]ATP (3000 Ci/mmol, 10 mCi/ml; Amersham
Biosciences), and equal amounts (~2 µg/5 µl) of eluted GST fusion
proteins were added. Tubes were incubated at 30 °C for 30 min;
samples were then separated on 12% SDS-PAGE gels and blotted onto
membranes. Radioactivity present in GST fusion proteins was quantified
with a phosphor imager (BAS 2500; Fuji, Japan). Verification of the
amounts of GST fusion proteins present in the reactions was performed
by Ponceau S staining of membranes and by probing membranes with anti-GST antibodies. For verification of amounts of Src present, blots
were probed with anti-Src antibodies.
Electrophysiology in Xenopus Oocytes--
Xenopus
laevis frogs were purchased from Xenopus 1 (Dexter, MI). The procedures followed for surgery and maintenance of
frogs were approved by the Animal Research Ethics Committee of Tel Aviv University. Frogs were anesthetized with 0.2% tricaine (Sigma). Pieces
of the ovary were surgically removed and digested with 1 mg/ml
collagenase (type IA; Sigma) in Ca2+-free ND96 (96 mM NaCl, 2 mM KCl, 1 mM
MgCl2, and 5 mM HEPES titrated to pH 7.5 with
NaOH) for 1 h to remove follicular cells. Stage V and VI oocytes
were used for DNA nuclear injection and were maintained at 18 °C in
ND96 (containing 1.8 mM CaCl2), supplemented with 1 mM pyruvate and 50 µg/ml gentamycin. Nuclear
injections utilized 0.5 ng/10 nl plasmid DNA encoding WT Kv2.1 or Y124F
Kv2.1 per oocyte; when indicated, similar amounts of DNA for
constitutively active Y527F Src were also injected.
Standard two-electrode voltage clamp measurements were performed as
previously described (41) 2-4 days following nuclear DNA
microinjection. Oocytes were bathed in a modified ND96 solution (containing 96 mM NaCl, 2 mM KCl, 1 mM MgCl2, 0.1 mM CaCl2,
and 5 mM HEPES, titrated to pH 7.4 with NaOH) under
constant perfusion using a peristaltic pump (Gilson) at a flow rate of
0.4 ml/min. CaCl2 was reduced to 0.1 mM to
virtually eliminate the contribution of endogenous
Ca2+-activated Cl currents. Whole cell
currents were recorded at room temperature (20-22 °C) using a
GeneClamp 500 amplifier (Axon Instruments). Glass microelectrodes (A-M
Systems, Inc.) were filled with 3 M KCl and had tip
resistances of 0.5-1.5 megaohms. Stimulation of the preparation and
data acquisition and analyses were performed using the pCLAMP 6.02 software (Axon Instruments) and a 586 personal computer interfaced with
a Digidata 1200 interface (Axon Instruments). Current signals were
filtered at 0.5 kHz and digitized at 2 kHz. Unless specified, the
holding potential was 80 mV. Leak subtraction was performed off-line,
using the Clampfit program of the pCLAMP 6.02 software. Data analysis
was performed using the Clampfit program (pCLAMP 8.1; Axon Instruments)
and Axograph 4.0 (Axon Instruments). All data were expressed as
mean ± S.E. Statistically significant differences between paired
groups were assessed by Student's t test.
 |
RESULTS |
Phosphorylation of Tyr124 of Kv2.1 by Src in
Vitro--
Previous studies have shown that tyrosine phosphorylation
of Kv2.1 by Src and Fyn up-regulates channel activity, whereas
dephosphorylation of Kv2.1 by cyt-PTP counters this effect (36).
This result suggests that both kinases, on the one hand, and
cyt-PTP , on the other hand, affect phosphorylation of the same set
of tyrosine residues in opposite manners. The Kv2.1 -subunit has 19 tyrosine residues, of which five are located in extracellular or in
membrane-spanning segments and are presumably inaccessible to cytosolic
or membrane-associated enzymes. Of the remaining 14 tyrosines, six are
located in the N-terminal cytosolic domain, seven are within the
C-terminal domain, and one is located in the short cytosolic loop
between the S4 and S5 membrane-spanning domains. Examination of the
tyrosine residues in Kv2.1 revealed that only one of these,
Tyr124 of the N-terminal cytosolic T1 domain, is embedded
in a sequence that is somewhat similar to the consensus sequence for
Src phosphorylation (121DEIYLES
versus consensus of EEIYG/EEF) (42).
In order to determine whether Src could phosphorylate
Tyr124 of Kv2.1 in vitro, we examined the
ability of Src to phosphorylate a peptide derived from the sequence of
Kv2.1, 119GIDEIYLESC, which was centered around
Tyr124 and in which this residue was the only tyrosine. A
similar peptide in which Tyr124 was replaced with a
nonphosphorylatable phenylalanine residue (119GIDEIFLESC) served as a negative control.
Both peptides were produced as glutathione S-transferase
(GST) fusion proteins in bacteria and were purified by
glutathione-agarose affinity chromatography and by subsequent elution
as described under "Experimental Procedures." Equal amounts of both
fusion proteins were mixed with Src and with
[ -32P]ATP, and phosphorylation was allowed to proceed
for 30 min. Some background phosphorylation of the GST-Y124F fusion
protein was evident in these studies (Fig.
1). Since the Kv2.1-derived sequence of
the GST-Y124F fusion protein lacks tyrosine residues, this finding
indicated that some of the 14 tyrosine residues of GST were
phosphorylated, in agreement with previous results (43). In agreement,
similar weak phosphorylation levels were detected in experiments using
purified GST protein to which no peptide had been added (not shown). In
contrast, phosphorylation of the GST-Y124 fusion protein, in
which Tyr124 was present, was considerably higher than that
of GST-Y124F (Fig. 1). This indicates that Tyr124 can be
phosphorylated by Src in vitro and is consistent with results presented below being mediated by phosphorylation at this residue.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 1.
Tyr124 of Kv2.1 is phosphorylated
by Src in vitro. A decapeptide containing
Tyr124 and the surrounding residues
(119GIDEIYLESC) was fused to GST (GST-Y124). This fusion
protein and a similar one containing the Y124F mutation (GST-Y124F)
were phosphorylated in vitro by Src in the presence of
[ -32P]ATP as described under "Experimental
Procedures." Aliquots of the phosphorylation reaction were analyzed
by SDS-PAGE and blotting. Top, 32P incorporated
into either GST fusion protein. The middle and
bottom panels depict hybridization of blots with
anti-GST and anti-Src antibodies, respectively, to indicate the amount
of GST fusion proteins and of Src kinase in the assays. Note that
despite a slight excess of Src in the GST-Y124F lane, this protein is
less phosphorylated than GST-Y124. Shown is one experiment
representative of two performed.
|
|
Reduced Phosphorylation of Y124F Kv2.1 by Src in Vivo--
In
order to examine the potential role of Tyr124 in regulation
of Kv2.1 in the context of the entire Kv2.1 protein, we mutated this
residue to phenylalanine. Upon expression in cells, WT and Y124F Kv2.1
localized to the cell membrane in similar manners, as indicated by
confocal microscopy analyses of cells expressing either protein (Fig.
2). Although cyt-PTP is predominantly
cytosolic, substantial amounts of cyt-PTP are targeted to the cell
membrane, and some cyt-PTP is found within the cell nucleus (35, 40, 44). As seen in Fig. 2, both WT and Y124F Kv2.1 co-localized with
membrane-associated cyt-PTP , indicating that both had similar opportunities to interact with the phosphatase. In addition, both WT
and Y124F Kv2.1 channels were expressed at similar levels following transfection into cells (Fig. 3). We
conclude that the Y124F mutation did not significantly affect the
subcellular localization or expression levels of Kv2.1.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 2.
Kv2.1 and cyt-PTP
co-localize at the cell membrane. Confocal microscopy
analysis of expression of Kv2.1 (red) and cyt-PTP
(green) in HEK 293 cells. WT or Y124F Kv2.1 was
expressed in the cells, either alone or together with FLAG-tagged
cyt-PTP , after which cells were processed as described under
"Experimental Procedures." Note the exclusively membranal
localization of WT and Y124F Kv2.1 molecules as well as nuclear,
cytosolic, and membranal expression of cyt-PTP . Original
magnification was ×600. Identical staining pattern of cyt-PTP was
obtained in cells that did not express either form of Kv2.1 (40) (data
not shown).
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
Reduced phosphorylation of Y124F Kv2.1 by
Src. HEK 293 cells were transiently transfected with activated
(Y527F) Src, together with WT or mutant (Y124F) Kv2.1. Cells were lysed
and immunoprecipitated with anti-phosphotyrosine antibodies, after
which precipitates were analyzed on 7% SDS-PAGE gels. Shown is
precipitated, tyrosine-phosphorylated Kv2.1 (top
panel); the middle and bottom
panels document expression of Kv2.1 and of Src in cell
lysates, respectively. Blots are from an experiment representative of
three performed. B, bar diagram
showing intensity of Kv2.1 phosphorylation, normalized to cellular
Kv2.1 protein expression. Data (average and S.E.) indicate that Y124F
Kv2.1 phosphorylation is 30.7 ± 12.1% of that of WT Kv2.1
(n = 3, p = 0.00293 by Welch's
t test).
|
|
Expression of WT Kv2.1 with constitutively active (Y527F) Src resulted
in robust phosphorylation of the channel, in agreement with previous
studies (36). In contrast, Src-mediated phosphorylation of Y124F Kv2.1
was reduced by ~70% under similar conditions (Fig. 3).
Interestingly, co-expression of cyt-PTP in the same system reduced
phosphorylation of both WT and Y124F Kv2.1 by Src (not shown). These
results confirm that cyt-PTP can counter Src-mediated phosphorylation of Kv2.1 at Tyr124 and most likely at other
sites as well. We have recently shown that PTP can dephosphorylate
and activate Src (45). The effect of cyt-PTP on Kv2.1 in the above
studies was not due to cyt-PTP affecting Src activity, since this
study utilized Y527F Src, which lacks the tyrosine that can be
dephosphorylated by PTP . Furthermore, dephosphorylation of Src by
cyt-PTP activates Src (45) and would have led to increased, rather
than decreased, phosphorylation of Kv2.1. These results, together with
the in vitro Src-mediated phosphorylation of
Tyr124 shown above, indicate that Tyr124 is a
significant site of phosphorylation by Src in Kv2.1.
Reduced Binding of Y124F Kv2.1 to a Substrate-trapping Mutant of
cyt-PTP --
In a separate series of experiments, binding of
the substrate-trapping mutant D245A cyt-PTP to Y124F Kv2.1 was
examined. Substrate-trapping mutants of this type are virtually
inactive but in many cases can recognize and bind their phosphorylated substrates stably enough to allow co-precipitation of the trapping mutant with its associated substrate (37). Indeed, D245A cyt-PTP bound and precipitated WT Kv2.1 from transfected cells (Fig.
4). However, ~60% less Y124F Kv2.1 was
co-precipitated with D245A cyt-PTP despite expression of similar
levels of WT and Y124F Kv2.1 channels in these cells (Fig. 4). Of note,
precipitation of either Kv channel with D245A cyt-PTP was
significantly reduced when these experiments were performed in the
presence of sodium pervanadate (not shown). Pervanadate oxidizes the
critical cysteine residue of the catalytic center of PTPs (46), thereby
disrupting the binding of D-to-A type PTP mutants to their putative
substrates (37). This last result indicated that the binding observed
was due to specific association of the catalytic site of cyt-PTP with phosphorylated tyrosines of Kv2.1. Importantly,
immunoprecipitation experiments using D245A cyt-PTP were performed
without co-expression of exogenous Src, thereby avoiding possible bias
in the results due to prior phosphorylation of specific tyrosines by
the exogenous kinase. In all, these results indicate that
Tyr124 is a significant site to which the catalytic center
of cyt-PTP binds and, by extension, dephosphorylates.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Reduced binding of Y124F Kv2.1 to a
substrate-trapping mutant of cyt-PTP .
A, HEK 293 cells were transiently transfected with D245A
cyt-PTP and with WT or Y124F Kv2.1 as indicated. Cells were lysed,
cyt-PTP was immunoprecipitated with anti-FLAG antibodies, and
precipitates were analyzed on 7% SDS-PAGE gels. Shown are amounts of
Kv2.1 that co-precipitated with D245A cyt-PTP (top
panel) as well as amounts of precipitated cyt-PTP
(middle panel) and expression of Kv2.1
(bottom panel). Blots are from an experiment
representative of four performed. B, bar
diagrams showing co-immunoprecipitated Kv2.1, normalized to
Kv2.1 expression in the cells. Data (average and S.E.) indicate that
Y124F Kv2.1 binding to D245A cyt-PTP is 40.3 ± 7.0% of that
of WT Kv2.1 (n = 4, p = 0.0034 by
Welch's t test).
|
|
Reduced Stimulation of Y124F Kv2.1 Channel Activity by Src--
To
investigate the impact of the Y124F mutation on Kv2.1 channel activity,
we expressed WT and Y124F Kv2.1 channels in Xenopus oocytes
in the presence or absence of constitutively active (Y527F) Src. Fig.
5 shows that expression of WT Kv2.1
channels generated delayed rectifier outward K+ currents
that activated above 20 mV. Active Src up-regulated WT Kv2.1 current
amplitude by more than 3-fold, with no significant changes in
activation kinetics and voltage dependence of activation. Mutant Y124F
Kv2.1 channels produced K+ currents that were very similar
to those generated by WT Kv2.1 with no significant differences either
in amplitude or in kinetics and voltage dependence of activation (Fig.
5). In contrast to WT Kv2.1 channels, active Src increased Y124F Kv2.1
current amplitude by only 35% (Fig. 5). The Y124F Kv2.1 channels are
therefore functional and are activated by depolarization in the absence
of Src in a manner similar to the nonmutant Tyr124 Kv2.1
channels. However, mutant Y124F Kv2.1 channels are severely and
specifically impaired in their ability to undergo up-regulation by
Src-mediated phosphorylation, underscoring the role of
Tyr124 in regulating this process.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of activated (Y527F) Src on WT and on
Y124F Kv2.1 K+ currents expressed in Xenopus
oocytes. A, current-voltage relations of WT Kv2.1
channels expressed in the absence (n = 11, empty squares) or presence of Y527F Src
(n = 13, solid squares). Y527F
Src significantly increases Kv2.1 currents by more than 3-fold
(p < 0.01). B, macroscopic K+
currents recorded from oocytes expressing WT Kv2.1 (left) or
WT Kv2.1 and Y527F Src (right) were elicited by depolarizing
pulses (500 ms) from a 80 mV holding potential to +30 mV in 10-mV
increments. C, current-voltage relations of Y124F Kv2.1
channels expressed in the absence (n = 15, empty squares) or presence of Y527F Src
(n = 15, solid squares). Active
Src increases Kv2.1 currents by only 35% (p < 0.05).
D, macroscopic K+ currents recorded from oocytes
expressing Y124F Kv2.1 (left) or Y124F Kv2.1 and Y527F Src
(right) were elicited as in Fig. 5B. Note
different scales of vertical axes in
graphs A and C.
|
|
 |
DISCUSSION |
Results presented here demonstrate the importance of
Tyr124 of Kv2.1 as a site that is phosphorylated by Src
in vitro and in vivo. Phosphorylation at
Tyr124 accounts for approximately two-thirds of Src
phosphorylation of Kv2.1, for a similar fraction of binding to D245A
cyt-PTP , and for ~80% of the ability of Src to enhance Kv2.1
activation by membrane depolarization. Whereas not all of the effects
of Src are mediated by Tyr124, the role of this residue is
nonetheless very significant. Of note, Kv channels are activated by
membrane depolarization, with phosphorylation acting as a modulator of
this effect. It is therefore not surprising that mutant Y124F and the
wild-type Tyr124 Kv2.1 channels were activated by
depolarization to the same extent in the absence of Src and that the
differential effect of Src phosphorylation was limited to their current
amplitude without affecting other electrical parameters. In fact, this
behavior, together with the conservative nature of the Y124F mutation
and the normal expression levels and correct subcellular localization of Y124F Kv2.1 channels, underscores the specific but otherwise limited
nature of the change introduced into Kv2.1 by the Y124F mutation. The
same results establish Tyr124 as a significant target site
for the mutually opposing effects of Src and cyt-PTP on Kv2.1.
Identification of particular tyrosine residues as sites for PTP
activity reflects substrate specificity of the PTP in question but also
specificities of PTKs that phosphorylate these residues beforehand.
Strong preference on the part of a PTK toward phosphorylating a
particular tyrosine may limit the range of phosphotyrosines available
to the PTP and bias the result obtained. For this reason, binding
studies of D245A cyt-PTP were performed without co-expression of
exogenous Src, relying entirely on phosphorylation of Kv2.1 by
endogenous PTKs present in HEK 293 cells. These cells express moderate
levels of endogenous Src as well as other tyrosine kinases. The fact
that under these circumstances the Y124F mutation was found to
profoundly affect cyt-PTP binding indicates the importance of this
site also in the absence of strong Src activity.
Despite its significant effect on current amplitude, results presented
here indicate that Src phosphorylation does not affect voltage-dependence and kinetics of activation of either WT or Y124F
Kv2.1. It is therefore possible that Src family tyrosine kinases
control the number of available active channels or, alternatively, that
tyrosine phosphorylation increases the channel open probability (Po), as previously described for
N-methyl-D-aspartate receptors (47). The
mechanism behind this effect is not known at present, but it is likely
mediated by conformational changes induced in the cytosolic T1 domain
by phosphorylation of Tyr124 and that affect properties of
the membrane-spanning regions of Kv2.1.
Of note, Tyr124 is conserved in the only other known Kv2
family member, Kv2.2, as well as in Kv11.1. This residue is not
conserved in most other families of Kv channel -subunits. For
example, all known Kv1 family members contain an alanine residue at the analogous position; Kv3 proteins contain aspartic acid, whereas Kv4
proteins contain leucine or isoleucine residues. Nevertheless, cyt-PTP has been shown to counter activation of Kv1.5 by Src and by
Fyn in HEK 293 cells and in Xenopus oocytes despite the absence of a tyrosine at the analogous position (36). This suggests that a similar mechanism of mutually antagonistic regulation by cyt-PTP and a Src family PTK may operate via another tyrosine residue in other Kv channels.
Modulation of Kv2.1 channels by PTKs and PTPs may be functionally
relevant for the control of cell excitability in different types of
neurons. In both pyramidal and inhibitory interneurons of the cortex
and hippocampus, Kv2.1 channels are clustered primarily on somata and
proximal dendrites but not on axons (48). Recent studies showed that
Kv2.1-containing channels play a role in regulating pyramidal neuron
somato-dendritic excitability primarily during episodes of high
frequency synaptic transmission (49). In this context, the fine tuning
of Kv2.1 current strength by PTKs and PTPs may play a role in synaptic
efficacy during high frequency synaptic transmission. Similarly,
Kv2.1-containing channels, which are found to regulate the tonic firing
of sympathetic neurons (50) and the discharge pattern of globus
pallidus neurons (51), may be potentially subject to such modulation by
PTKs and PTPs. In all, the fine tuning of Kv2.1 channel activity
through the tyrosine phosphorylation of its amino-terminal residue
Tyr124 may play a crucial role in regulating neuronal
excitability in various regions of the brain.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Sara Courtneidge, J. Barhanin,
and M. Lazdunski for generous gifts of cDNAs.
 |
FOOTNOTES |
*
This study was supported by the Israel Science Foundation,
founded by The Israel Academy of Sciences and Humanities (to A. E. and
B. A.) and the AFIRST (to B. A.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Holder of the Adolfo and Evelyn Blum Career Development Chair
in Cancer Research at the Weizmann Institute. To whom correspondence may be addressed. Tel.: 972-3-640-5116; Fax: 972-3-640-9113; E-mail: battali@post.tau.ac.il.
To whom correspondence may be addressed. Tel.: 972-8-934-2331;
Fax: 972-8-934-4108; E-mail: ari.elson@weizmann.ac.il.
Published, JBC Papers in Press, March 1, 2003, DOI 10.1074/jbc.M212766200
 |
ABBREVIATIONS |
The abbreviations used are:
Kv channel, delayed
rectifier, voltage-gated potassium channel;
cyt-PTP , nonreceptor
form of PTP ;
GST, glutathione S-transferase;
PTK, protein-tyrosine kinase;
PTP, protein-tyrosine phosphatase;
WT, wild-type.
 |
REFERENCES |
| 1.
|
Yi, B. A.,
Minor, D. L., Jr.,
Lin, Y. F.,
Jan, Y. N.,
and Jan, L. Y.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
11016-11023[Abstract/Free Full Text]
|
| 2.
|
Browne, D. L.,
Gancher, S. T.,
Nutt, J. G.,
Brunt, E. R.,
Smith, E. A.,
Kramer, P.,
and Litt, M.
(1994)
Nat. Genet.
8,
136-140[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Keating, M. T.,
and Sanguinetti, M. C.
(2001)
Cell
104,
569-580[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Weinreich, F.,
and Jentsch, T. J.
(2000)
Curr. Opin. Neurobiol.
10,
409-415[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Pongs, O.
(1995)
Semin. Neurosci.
7,
137-146
|
| 6.
|
Martens, J. R.,
Kwak, Y. G.,
and Tamkun, M. M.
(1999)
Trends Cardiovasc. Med.
9,
253-258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Yellen, G.
(2002)
Nature
419,
35-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Cushman, S. J.,
Nanao, M. H.,
Jahng, A. W.,
DeRubeis, D.,
Choe, S.,
and Pfaffinger, P. J.
(2000)
Nat. Struct. Biol.
7,
403-407[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Shen, N. V.,
and Pfaffinger, P. J.
(1995)
Neuron
14,
625-633[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Minor, D. L.,
Lin, Y. F.,
Mobley, B. C.,
Avelar, A.,
Jan, Y. N.,
Jan, L. Y.,
and Berger, J. M.
(2000)
Cell
102,
657-670[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Strang, C.,
Cushman, S. J.,
DeRubeis, D.,
Peterson, D.,
and Pfaffinger, P. J.
(2001)
J. Biol. Chem.
276,
28493-28502[Abstract/Free Full Text]
|
| 12.
|
Levitan, I. B.
(1999)
Adv. Second Messenger Phosphoprotein Res.
33,
3-22.13[Medline]
[Order article via Infotrieve]
|
| 13.
|
Siegelbaum, S. A.
(1994)
Curr. Biol.
4,
242-245[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Jonas, E. A.,
and Kaczmarek, L. K.
(1996)
Curr. Opin. Neurobiol.
6,
318-323[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Davis, M. J.,
Wu, X.,
Nurkiewicz, T. R.,
Kawasaki, J.,
Gui, P.,
Hill, M. A.,
and Wilson, E.
(2001)
Am. J. Physiol.
281,
H1835-H1862
|
| 16.
|
Holmes, T. C.,
Fadool, D. A,
Ren, R.,
and Levitan, I. B.
(1996)
Science
274,
2089-2091[Abstract/Free Full Text]
|
| 17.
|
Holmes, T. C.,
Berman, K.,
Swartz, J. E.,
Dagan, D.,
and Levitan, I. B.
(1997)
J. Neurosci.
17,
8964-8974[Abstract/Free Full Text]
|
| 18.
|
Fadool, D. A.,
and Levitan, I. B.
(1998)
J. Neurosci.
18,
6126-6137[Abstract/Free Full Text]
|
| 19.
|
Fadool, D. A.,
Holmes, T. C.,
Berman, K.,
Dagan, D.,
and Levitan, I. B.
(1997)
J. Neurophysiol.
78,
1563-1573[Abstract/Free Full Text]
|
| 20.
|
Szabo, I.,
Gulbins, E.,
Apfel, H.,
Zhang, X.,
Barth, P.,
Busch, A. E.,
Schlottmann, K.,
Pongs, O.,
and Lang, F.
(1996)
J. Biol. Chem.
271,
20465-20469[Abstract/Free Full Text]
|
| 21.
|
Gulbins, E.,
Szabo, I.,
Baltzer, K.,
and Lang, F.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7661-7666[Abstract/Free Full Text]
|
| 22.
|
Holmes, T. C.,
Fadool, D. A.,
and Levitan, I. B.
(1996)
J. Neurosci.
16,
1581-1590[Abstract/Free Full Text]
|
| 23.
|
MacFarlane, S. N.,
and Sontheimer, H.
(2000)
J. Neurosci.
20,
5245-5253[Abstract/Free Full Text]
|
| 24.
|
Peretz, A.,
Sobko, A.,
and Attali, B.
(1999)
J. Physiol.
519,
373-384[Abstract/Free Full Text]
|
| 25.
|
Sobko, A.,
Peretz, A.,
and Attali, B.
(1998)
EMBO J.
17,
4723-4734[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Strauss, O.,
Rosenthal, R.,
Dey, D.,
Beninde, J.,
Wollmann, G.,
Thieme, H,
and Wiederbolt, M.
(2002)
Invest. Ophtalmol. Vis. Sci.
43,
1645-1654[Abstract/Free Full Text]
|
| 27.
|
Nitabach, M. N.,
Llamas, D. A.,
Araneda, R. C.,
Intile, J. L.,
Thompson, I. J.,
Zhou, Y. I.,
and Holmes, T. C.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
705-710[Abstract/Free Full Text]
|
| 28.
|
Hunter, T.
(1995)
Cell
80,
225-236[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Tonks, N. K.,
and Neel, B. G.
(2001)
Curr. Opin. Cell Biol.
13,
182-195[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Andersen, J. N.,
Mortensen, O. H.,
Peters, G. H.,
Drake, P. G.,
Iversen, L. F.,
Olsen, O. H.,
Jansen, P. G.,
Andersen, H. S.,
Tonks, N. K.,
and Moller, N. P.
(2001)
Mol. Cell. Biol.
21,
7117-7136[Free Full Text]
|
| 31.
|
Sap, J.,
D'Eustachio, P.,
Givol, D.,
and Schlessinger, J.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
6112-6116[Abstract/Free Full Text]
|
| 32.
|
Krueger, N. X.,
Streuli, M.,
and Saito, H.
(1990)
EMBO J.
9,
3241-3252[Medline]
[Order article via Infotrieve]
|
| 33.
|
Tsai, W.,
Morielli, A. D.,
Cachero, T. G.,
and Peralta, E. G.
(1999)
EMBO J.
18,
109-118[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Imbrici, P.,
Tucker, S. J.,
D'Adamo, M. C.,
and Pessia, M.
(2000)
Pflugers Arch.
441,
257-262[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Elson, A.,
and Leder, P.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
12235-12239[Abstract/Free Full Text]
|
| 36.
|
Peretz, A.,
Gil-Henn, H.,
Sobko, A.,
Shinder, V.,
Attali, B.,
and Elson, A.
(2000)
EMBO J.
19,
4036-4045[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Flint, A. J.,
Tiganis, T.,
Barford, D.,
and Tonks, N. K.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
1680-1685[Abstract/Free Full Text]
|
| 38.
|
Elson, A.,
and Leder, P.
(1995)
J. Biol. Chem.
270,
26116-26122[Abstract/Free Full Text]
|
| 39.
|
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Abstract/Free Full Text]
|
| 40.
|
Gil-Henn, H.,
Volohonsky, G.,
Toledano-Katchalski, H.,
Gandre, S.,
and Elson, A.
(2000)
Oncogene
19,
4375-4384[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Abitbol, I.,
Peretz, A.,
Lerche, C.,
Busch, A. E.,
and Attali, B.
(1999)
EMBO J.
18,
4137-4148[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Songyang, Z.,
and Cantley, L. C.
(1995)
Trends Biochem. Sci.
20,
470-475[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Toledano-Katchalski, H.,
and Elson, A.
(1999)
Oncogene
18,
5024-5031[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Kraut, J.,
Volohonski, G.,
Toledano-Katchalski, H.,
and Elson, A.
(2002)
Exp. Cell Res.
281,
182-189[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
| Gil-Henn, H., and Elson, A. (February 21, 2003) J. Biol.
Chem. 10.1074/jbc.M210273200
|
| 46.
|
Huyer, G.,
Liu, S.,
Kelly, J.,
Moffat, J.,
Payette, P.,
Kennedy, B.,
Tsaprailis, G.,
Gresser, M. J.,
and Ramachandran, C.
(1997)
J. Biol. Chem.
272,
843-851[Abstract/Free Full Text]
|
| 47.
|
Yu, X.-M.,
Askalan, R.,
Keil II, G. J.,
and Salter, M. W.
(1997)
Science
275,
674-678[Abstract/Free Full Text]
|
| 48.
|
Du, J.,
Tao-Cheng, J. H.,
Zerfas, P.,
and McBain, C. J.
(1998)
Neuroscience
84,
37-48[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Du, J.,
Haak, L. L.,
Phillips-Tansey, E.,
Russell, J. T.,
and McBain, C. J.
(2000)
J. Physiol.
522,
19-31[Abstract/Free Full Text]
|
| 50.
|
Malin, S. A.,
and Nerbonne, J. M.
(2002)
J. Neurosci.
22,
10094-10105[Abstract/Free Full Text]
|
| 51.
|
Baranauskas, G.,
Tkatch, T.,
and Surmeier, D. J.
(1999)
J. Neurosci.
19,
6394-6404[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. Bocksteins, A. L. Raes, G. Van de Vijver, T. Bruyns, P.-P. Van Bogaert, and D. J. Snyders
Kv2.1 and silent Kv subunits underlie the delayed rectifier K+ current in cultured small mouse DRG neurons
Am J Physiol Cell Physiol,
June 1, 2009;
296(6):
C1271 - C1278.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sines, S. Granot-Attas, S. Weisman-Welcher, and A. Elson
Association of Tyrosine Phosphatase Epsilon with Microtubules Inhibits Phosphatase Activity and Is Regulated by the Epidermal Growth Factor Receptor
Mol. Cell. Biol.,
October 15, 2007;
27(20):
7102 - 7112.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Tiran, A. Peretz, T. Sines, V. Shinder, J. Sap, B. Attali, and A. Elson
Tyrosine Phosphatases {varepsilon} and {alpha} Perform Specific and Overlapping Functions in Regulation of Voltage-gated Potassium Channels in Schwann Cells
Mol. Biol. Cell,
October 1, 2006;
17(10):
4330 - 4342.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Tian, T. Cai, Z. Yuan, H. Wang, L. Liu, M. Haas, E. Maksimova, X.-Y. Huang, and Z.-J. Xie
Binding of Src to Na+/K+-ATPase Forms a Functional Signaling Complex
Mol. Biol. Cell,
January 1, 2006;
17(1):
317 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Wang, J. T. Hackett, M. E. Cox, M. van Hoek, J. M. Lindstrom, and S. J. Parsons
Regulation of the Neuronal Nicotinic Acetylcholine Receptor by Src Family Tyrosine Kinases
J. Biol. Chem.,
March 5, 2004;
279(10):
8779 - 8786.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. L. Muennich and R. E. W. Fyffe
Focal aggregation of voltage-gated, Kv2.1 subunit-containing, potassium channels at synaptic sites in rat spinal motoneurones
J. Physiol.,
February 1, 2004;
554(3):
673 - 685.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|