Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M205636200 on October 4, 2002

J. Biol. Chem., Vol. 278, Issue 2, 1086-1093, January 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/1086    most recent
M205636200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanco, R.
Right arrow Articles by Ventoso, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco, R.
Right arrow Articles by Ventoso, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Cell Killing by HIV-1 Protease*

Raquel BlancoDagger §, Luis CarrascoDagger , and Iván Ventoso||

From the Dagger  Centro de Biología Molecular Severo Ochoa Consejo Superior Investigaciones Cientificas-Universidad Autónoma de Madrid and the  Centro Nacional de Biotecnología, CSIC, Departamento de Bioquímica y Biología Celular, Universidad Autónoma de Madrid, Cantoblanco 28049, Madrid, Spain

Received for publication, June 6, 2002, and in revised form, October 4, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The human immunodeficiency virus protease (HIV-1 PR) was expressed both in the yeast Saccharomyces cerevisiae and in mammalian cells. Inducible expression of HIV-1 PR arrested yeast growth, which was followed by cell lysis. The lytic phenotype included loss of plasma membrane integrity and cell wall breakage leading to the release of cell content to the medium. Given that neither poliovirus 2A protease nor 2BC protein, both being highly toxic for S. cerevisiae, were able to produce similar effects, it seems that this lytic phenotype is specific of HIV-1 PR. Drastic alterations in membrane permeability preceded the lysis in yeast expressing HIV-1 PR. Cell killing and lysis provoked by HIV-1 PR were also observed in mammalian cells. Thus, COS7 cells expressing the protease showed increased plasma membrane permeability and underwent lysis by necrosis with no signs of apoptosis. Strikingly, the morphological alterations induced by HIV-1 PR in yeast and mammalian cells were similar in many aspects. To our knowledge, this is the first report of a viral protein with such an activity. These findings contribute to the present knowledge on HIV-1-induced cytopathogenesis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Replication of lytic viruses in susceptible cells is accompanied by a number of morphological and metabolic alterations that culminate in host cell lysis. For human immunodeficiency virus (HIV-1),1 progressive loss of CD4+ lymphocytes is considered the hallmark of progression to AIDS (1, 2). Although the main cause of T-cell depletion by HIV-1 in vivo is still unclear, there is evidence that CD4+ cell destruction is tightly linked to active viral replication (3). Both a virus-induced cytopathic effect and immunological clearance of infected cells are likely to contribute to CD4+ cell loss (3).

HIV-1-induced cytopathic effect in cultured T-cells leads to individual cell lysis or to cell fusion depending on the viral strain used (4). Cell lysis is presumably the ultimate consequence of a number of virus-induced modifications to the plasma membrane (4). Indeed, cells acutely infected with HIV-1 show increased plasma membrane permeability. Changes in ion gradients maintained by the plasma membrane lead to increased cell volume (swelling), culminating in cell lysis (5). These changes are consistent with a necrotic process of cell death (6). However, apoptosis has also been observed in HIV-1-infected cells, including in vitro cultured peripheral blood lymphocytes from AIDS patients (7, 8).

A large body of evidence links the cytopathic potential of HIV-1 to the activity of the viral envelope glycoproteins gp120 and gp41 (9). The binding of viral glycoproteins to the CD4 receptor on adjacent cells induces cell fusion giving rise to syncytia formation (10). In addition, recent data suggest that intracellular interaction of gp120/gp41 with the CD4 receptor can also trigger membrane fusion, thus contributing to single cell lysis (11, 12).

The expression of other HIV-1 proteins such as Tat, Nef, and Vpr has also been related to detrimental effects on cell functions (13-15). Furthermore, HIV-1 protease exhibits cytotoxicity when expressed in a variety of cells, including bacteria and mammalian cells (16, 17). Transient expression of HIV-1 PR in COS cells has been reported to induce apoptosis preceded by cleavage of the anti-apoptotic protein Bcl-2 (17).

A major function of HIV-1 PR in the virus life cycle is to proteolytically process the gag and gag-pol precursors to yield mature virion proteins. The protease is initially synthesized in an inactive form as part of the gag-pol precursor and is activated at the final stages of the virus life cycle. This activation gives rise to the formation of the isolated protease as well as to the mature enzymes reverse transcriptase and integrase, and the virion core structural proteins MA, CA, NC, and p6 (18-20). Protease activation is required for virion maturation, because inhibition of PR activity gives rise to immature virus particles containing unprocessed gag-pol precursors that are unable to re-infect cells (21).

Apart from viral-encoded substrates, the cleavage of cell proteins by HIV-1 PR is well documented (22-24). Thus, the cytoskeletal proteins vimentin, desmin, and glial fibrillary acidic protein are cleaved in vitro by recombinant HIV-1 PR (25). In addition, HIV-1 PR proteolyzes actin, troponin C, Alzheimer amyloid precursor protein, and pro-interleukin 1beta in vitro (26). Nevertheless, only the cleavage of vimentin has been reported to occur in HIV-infected cells (27). This raises the possibility that HIV-1 PR might play a role in virus-induced cytopathology, although there are no direct data supporting this rationale.

The yeast Saccharomyces cerevisiae has emerged as a powerful tool for exploring the functions of heterologous proteins of diverse origin (28). This system has been successfully employed to test the cytotoxic potential of viral proteins, including proteases (29, 30). In the present report, we describe a novel lytic activity of HIV-1 PR in both yeast and mammalian cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Microbial Strains-- Escherichia coli DH5alpha was used for the construction of expression plasmids as described elsewhere (31). The S. cerevisiae strain FYBL-1 (Mata, ura3-851, lys2-202, leu2-1, his3-200) was generously provided by Dr. J. P. G. Ballesta (Centro de Biología Molecular, Madrid, Spain).

DNA Recombinant Protocols-- Expression plasmids were constructed according to standard procedures (31). The HIV-1 PR coding sequence was amplified by PCR from clone BH10 of HIV-1 using the primers 5' HIV-1 PR (GCGCGCCATGGGACCTCAGATCACTCTTTGG) (artificial initiation codon in italics) and 3'HIV-1PR (CGCGGATCCTTACTAAAAATTTAAAGTGCAACCAATCTG). The 300-bp product was digested with a BamHI enzyme and cloned into the expression vector pEMBL-yex4 (32). PKS5'LGAG-PR plasmid encodes gag and pr genes under the entire 5'-leader region of HIV-1 derived from pNL4.3 plasmid. Its construction involved cloning the 3-kbp PCR-amplified DNA fragment into pKSBluescript (Stratagene) using NotI and BamHI enzymes. Primers used were 5'NCRH (CGACGCGGCCGCGGTCTCTCTGGTTAGACC) and 3'HIV-1 PR. pEMBL-2Apro, pEMBL-2BC, pTM1-HIV-1 PR, pTM1-2Apro, pTM1-2BC, and pTM1-3Cpro have been described previously (33-35).

Yeast Media, Growth, Transformation, and Induction-- Yeast cells transformed by the lithium acetate method using the indicated plasmid were selected on minimal yeast nitrogen bases (YNB)-glucose plates supplemented with 20 mg/liter of the required amino acids or bases according to auxotrophic markers, as described previously (34). For induction of the UASGAL-CYC promoter on agar plates, glucose was replaced by galactose at a final concentration of 2%. For induction in liquid medium, cells were grown in YNB-lactate and induced by the addition of 2% galactose.

Obtaining Yeast Extracts and Western Blot Analysis-- Yeast extracts for Western blot analysis were prepared by trichloroacetic acid precipitation as described previously (36). For yeast expressing HIV-1 PR, both cells and media were precipitated with trichloroacetic acid. Proteins were separated on 17% SDS-PAGE, transferred to nitrocellulose membranes, and probed with the indicated antibody. Goat antiserum against HIV-1 PR and a monoclonal antibody against HIV-1 p55/p24 were provided by the EU Program EVA/MRC Centralised Facility for AIDS Reagents, NIBSC, UK and used at dilutions 1:700 and 1:500, respectively. Antibodies against human PARP (Pharmingen), Bcl-2 (Santa Cruz Biotechnology, Inc.), and actin (Sigma) were used at dilutions of 1/500. Detection was performed using the ECL system (Amersham Biosciences).

Mammalian Cells and Transfection-- COS7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Transient transfection of pTM-1 plasmids coupled to vT7 infection has been previously described in detail (37). Briefly, 0.5 µg of each plasmid was mixed with 2 µg of LipofectAMINE reagent® (Invitrogen) and added to COS7 cells growing in 24-well plates at 70% confluency. Cell viability was scored by the trypan blue exclusion method.

Measurement of Cell Lysis-- Yeast cell lysis was estimated by the release of intracellular proteins into the medium. Induced yeast cultures (1 ml) were centrifuged at 10,000 rpm for 10 min, and supernatants were used directly to determine protein concentration by the Bio-Rad Bradford assay. Alternatively, cells were stained with 0.005% propidium iodide (PI) in phosphate-buffered saline for 15 min, washed three times with phosphate-buffered saline, and analyzed by fluorescence-activated cell sorting (FACS). Lysis in mammalian cells was determined using the cytotoxicity detection kit (LDH) (Roche Molecular Biochemicals).

Electron Microscopy-- For the ultrastructural analysis of yeast, we followed the electron microscopy protocol described by Wright et al. (38) with a few modifications: cells were fixed for 2 h at room temperature in 2% glutaraldehide-1% tannic acid in 0.1 M cacodylate buffer, pH 6.8, and finally embedded in London resin white resin. The same procedure was applied for mammalian cells, except for the buffer used in this case, 0.2 M Hepes, pH 7.2.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inducible Expression of HIV-1 PR in S. cerevisiae-- Our initial aim was to analyze the effect of HIV-1 PR expression in the yeast S. cerevisiae. To this end, the coding sequence of HIV-1 pr was cloned into the expression plasmid pEMBLyex4 (32) under the galactose-inducible promoter. The yeast strain FYBL-1 was chosen for transformation. First, cells bearing the pEMBL-HIV-1PR plasmid were induced on galactose-containing plates. As control, yeast transformants that synthesize poliovirus proteins 2Apro or 2BC were induced in parallel, because these proteins are highly toxic for yeast (29, 39). Fig. 1A shows that induction of HIV-1 PR synthesis arrested cell growth to a similar extent as 2Apro and 2BC. This toxic effect was prevented by the addition of 2 µM saquinavir, a specific inhibitor of HIV-1 PR, indicating that the proteolytic activity of the enzyme is indeed responsible for its cytotoxicity. To further characterize this cytotoxic effect, HIV-1 PR was induced in liquid medium. Yeast growth was monitored by measuring the optical cell density of the cultures. Cell extracts were obtained at different time points after induction to detect the expression of HIV-1 PR by Western blotting. During the first 12 h post induction (h.p.i.), cells expressing HIV-1 PR grew at a rate similar to those transformed by the vector alone (Fig. 1A, middle panel). However, growth of cells expressing HIV-1 PR was abruptly halted at 14-18 h.p.i. This inhibition was concomitant to peak HIV-1 PR synthesis at 18-24 h.p.i., determined by Western blotting (Fig. 1A, lower panel). Surprisingly, after this arrest of cell growth, cultures expressing HIV-1 PR underwent a subsequent decrease in optical density corresponding to a 20-30% loss in cell number 24 h.p.i. This finding was confirmed in over 10 independent experiments performed using different yeast transformants. The phenotype of cells expressing HIV-1 PR is clearly different from that of cells expressing poliovirus 2Apro and 2BC. Even though poliovirus 2Apro and 2BC expression induced an early arrest of yeast growth, the number of cells in these cultures remained constant until 30 h.p.i. This suggests that HIV-1 PR expression is cytocidal, whereas expression of poliovirus 2Apro or 2BC is cytostatic. The survival curve shows that about 80% of the cells died upon HIV-1PR induction (Fig. 1B). The explanation for the remaining 20% of cells that survived HIV-1PR expression is not obvious.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of HIV-1 PR induces cell growth arrest and lysis. A, upper panel. FYBL-1 cells transformed with vector (V) (1) or plasmids expressing HIV-1PR (2), 2Apro (3), or 2BC (4), were induced on galactose-containing plates in the absence (left) or presence (right) of the HIV-1PR inhibitor saquinavir (5 µM). Middle panel, Growth arrest of yeast transformed using pEMBL-HIV-1 PR analyzed in liquid medium. The arrow indicates the time point when cell density begins to decline for yeast expressing HIV-1PR. The lower panel shows Western blotting against HIV-1 PR. The 9-kDa protein corresponding to HIV-1 PR is indicated. B, survival curve. At the time points indicated, cells from induced cultures were grown on glucose-containing plates. C, measurement of protein released into the medium upon HIV-1PR expression. At the indicated time points, the protein concentration of cell-free culture media was determined by the Bradford assay.

To further explore the lytic activity of HIV-1 PR in yeast, the release of intracellular protein into the medium was measured at different time points after induction of protease expression. Fig. 1C shows that HIV-1 PR expression led to an increasing protein concentration in the medium, which reached 15 µg/ml at 24 h.p.i. This would be consistent with the idea that cell integrity is extensively damaged. In contrast, no release of intracellular protein was detected in yeast transformed with the vector alone or in cells expressing poliovirus 2Apro or 2BC. These data further demonstrate that induction of lysis is a feature specific to HIV-1 PR.

Ultrastructural Alterations in Yeast Cells That Synthesize HIV-1 PR-- To better characterize the lytic phenotype induced by HIV-1 PR, yeast cells synthesizing HIV-1 PR were fixed and examined by electron microscopy at different times after induction. At 18 h.p.i., before undergoing lysis, yeast cells expressing HIV-1 PR showed a number of morphological alterations, compared with cells transformed with the vector alone. These changes included increased cell size and disintegration of the vacuole into multiple smaller bodies. They were also observed in cells that synthesize poliovirus 2BC protein (Fig. 2B) or 2Apro (data not shown), suggesting that they are common features to cells expressing cytotoxic proteins. The plasma membrane, in turn, displayed specific alterations in cells expressing HIV-1 PR. In control yeast cells and in cells expressing poliovirus 2Apro or 2BC proteins, the plasma membrane is closely associated with the inner layer of the cell wall and shows a typical smooth contour. However, the plasma membrane of cells expressing HIV-1 PR was notably wrinkled and started to detach from the cell wall (Fig. 2C). Other organelles, including the nucleus, retained their normal appearance for longer periods. Further incubation of cells expressing HIV-1 PR led to a profound loss of cell integrity and lysis at 24 h.p.i. (Fig. 2, D and F). Thus, the plasma membrane became completely detached from the cell wall, and finally, the cell wall broke down causing the release of cell content into the medium. Interestingly, this rupture of the cell wall frequently occurred on budding scars, which are the thinnest area of the cell wall. In contrast, the overall integrity of yeast expressing poliovirus 2Apro or 2BC proteins was not compromised, even though these cells underwent extensive modifications in sub-cellular structures.


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 2.   Ultrastructural alterations in yeast expressing HIV-1 PR. Thin section electron microscopy of cells bearing empty vector (A) or cells expressing poliovirus 2BC protein (B) or HIV-1 PR (C, D, and F). Cells were fixed at either 18 h.p.t. (A-C) or 24 h.p.t. (D-F). E, HIV-1PR-expressing cells were treated with 5 µM saquinavir. Shown in panel F is a representative cell at higher magnification transformed with pTM1- HIV-1PR. N, nucleus; V, vacuole; black arrow, cell wall; white arrow, plasma membrane; white arrowhead, hole in cell wall.

Altered Membrane Permeability in Cells Expressing HIV-1 PR-- In the next stage, we undertook experiments designed to establish the major toxic effect of HIV-1 PR on yeast. The electron microscopy data suggested that the lytic phenotype induced by HIV-1 PR expression could be the final result of early damage on the plasma membrane. To test this possibility, the permeability of the plasma membrane toward propidium iodide (PI) was measured in yeast expressing HIV-1 PR before cell lysis occurred (12-18 h.p.i.). It was shown by FACS analysis that this dye was unable to penetrate yeast transformed with the vector alone (Fig. 3A). However, PI uptake became evident in cells expressing HIV-1 PR as early as 12 h.p.i., and PI entry into cells was further enhanced at 18 h.p.i. Cells expressing HIV-1 PR showed no morphological changes at this stage (data not shown), suggesting that membrane alteration is an early event that precedes cell lysis.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3.   Changes in membrane permeability shown by yeast expressing HIV-1 PR. A, FACS analysis of cells that took up propidium iodide (PI) analyzed at 12 h.p.i. (upper panels) or 18 h.p.i. (lower panel). V, cells transformed with vector alone. HIV-1PR, cells transformed with the HIV-1 PR-expressing plasmid. B, the addition of osmoregulators fails to prevent HIV-1 PR-induced cell growth arrest (upper panel) and lysis (lower panel). Yeast cells transformed with empty vector (1), HIV-1PR (2), 2Apro (3), or poliovirus 2BC (4), were streaked on glucose- or galactose-containing plates supplemented with 0.5 M sorbitol. The presence of saquinavir in the medium (right plate) allowed growth of HIV-1PR-expressing yeast. The lower panel shows the release of protein into the culture medium induced by HIV-1PR expression at 24 h.p.i. in the presence or the absence of 0.5 M sorbitol.

It is well known that changes in yeast cell wall architecture can lead to cell lysis. This is true of yeast cells bearing thermosensitive mutations in genes involved in maintenance of cell wall integrity, which undergo lysis upon incubation at the restricted temperature (40). In this situation, lysis can be effectively prevented by osmotic stabilizers such as sorbitol or NaCl (41). It was, therefore, of interest to establish whether sorbitol could prevent HIV-1 PR-induced cell lysis. Yeast transformed with pEMBL-HIV-1 PR were induced on galactose plates and liquid medium both containing 0.5 M sorbitol. As shown in Fig. 3B, sorbitol failed to affect both the extent of growth arrest and the cell lysis provoked by HIV-1 PR. Similar results were obtained when M NaCl was used as osmoregulator instead of sorbitol (data not shown). It is thus proposed that lethal alterations other than cell wall breakage give rise to the lytic phenotype of HIV-1 PR-expressing cells.

Expression of HIV-1 PR in COS Cells Causes Lysis-- Next, we determined whether the lytic activity of HIV-1 PR also affects mammalian cells. To this end, COS7 cells were transfected with the protease-encoding plasmid pTM1-HIV-1 PR coupled to vaccinia virus vT7 infection (37). HIV-1 PR is detected as a band of ~9 kDa upon labeling of cells with [35S]Met/Cys 16 h post transfection (h.p.t.) (Fig. 4A). On microscopy, it was observed that cells synthesizing HIV-1 PR displayed a number of cytopathic alterations (see below for details). To search for changes in membrane permeability, lactate dehydrogenase (LDH) release to the culture medium was determined, because enhanced leakage of this enzyme reflects loss of plasma membrane integrity. It was not possible to detect LDH activity in culture media from cells transfected with the vector alone. In contrast, LDH did leak out of cells expressing HIV-1 PR (Fig. 4B). Based on these data, we estimated that 20-25% of cells transfected with pTM1-HIV-1 PR underwent lysis. LDH leakage requires the proteolytic activity of HIV-1 PR, because addition of saquinavir prevented this leakage, although not completely. Probably the high level of HIV-1PR expression using this system makes it difficult to inhibit all HIV-1PR molecules by saquinavir. To determine whether plasma membrane damage is a feature specific of HIV-1 PR, the release of LDH was checked in the culture media of cells transfected with plasmids encoding poliovirus 2Apro, 3Cpro, or 2BC proteins. As mentioned above, these poliovirus proteins are cytotoxic for mammalian cells (34, 42). Fig. 4B shows that only synthesis of the 2BC protein induced cell lysis to an extent similar to that provoked by HIV-1 PR, and it is in agreement with the idea that 2BC expression enhances plasma membrane permeability, as previously described in detail (33). In contrast, expression of poliovirus 3Cpro failed to induce LDH release despite the fact that 3C protease causes massive cell death by apoptosis (42). These findings suggest that cell death by HIV-1 PR occurs by necrosis rather than apoptosis, as initially suggested by Strack and colleagues (17).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4.   Transient expression of HIV-1 PR in mammalian cells causes lysis. A, left panel, COS7 cells transfected with the indicated plasmids were labeled with [35S]Met/Cys at 16 h.p.t. Equal amounts of protein were analyzed by SDS-PAGE and autoradiography. The right panel shows that the size of purified protease (purified PR) seen by Coomassie Brilliant Blue staining, and the size of protease expressed from transfected COS 7 cells, seen by autoradiography are the same. B, effect of HIV-1 PR expression on plasma membrane integrity. LDH activity released from COS7 cells transfected with the plasmid encoding the indicated proteins was determined as described under "Experimental Procedures." C, expression of HIV-1PR induces early changes in membrane permeability. Transfected cells were labeled at 8 h.p.t. with [35S]Met/Cys in the absence or presence of 0.6 mM hygromycin B (HygB). Autoradiography of labeled proteins is shown. Quantification was by densitometric scanning of protein bands.

Early alterations in membrane permeability in cells expressing HIV-1 PR were then examined. As a test of membrane permeabilization, the sensitivity of cellular translation to the inhibitor hygromycin B was tested (33). This translation inhibitor does not enter into cells that possess an intact plasma membrane. Addition of 0.6 mM hygromycin B to cells transfected with pTM1-HIV-1 PR reduced protein synthesis by 40-50% (Fig. 4C). This degree of inhibition is probably related to the proportion of transfected cells. In the presence of 2 µM saquinavir, entry of hygromycin B into cells was not observed.

HIV-1 PR Kills COS Cells by Necrosis-- The nuclear morphology of cells expressing HIV-1 PR was examined to gain knowledge on the mode of HIV-1 PR-induced cell death. Fragmented nuclei, a sign of apoptosis, were observed in COS7 cells expressing poliovirus 3Cpro. Nuclear fragmentation, however, did not occur in cells transfected with pTM1-HIV-1 PR (Fig. 5A).


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 5.   Lack of apoptotic features in COS7 cells expressing HIV-1 PR. A, 4',6-diamidino-2-phenylindole staining of nuclei in cells transfected with pTM1 (V), pTM1-HIV-1PR, or pTM1-3Cpro. Arrows indicate fragmented apoptotic nuclei. B, Western blot analysis of PARP, Bcl-2, and actin proteins from cells transfected with pTM1, pTM1-2Apro, pTM1-2BC, pTM1-3Cpro, or pTM1-HIV-1 PR. Cell extracts were prepared at 16 h.p.t. and probed with the specific antibodies. +SQ, cells treated with 2 µM saquinavir; Act D, cells treated with actinomycin D (2 µg/ml) for 16 h. Cleavage products (c.p.) derived from the proteins indicated are shown.

Caspase-mediated cleavage of poly(ADP-ribose) polymerase (PARP), a biochemical marker of apoptosis, was also measured. PARP is cleaved in cells expressing poliovirus 3Cpro and in actinomycin D-induced apoptotic cells, giving rise to a distinct pattern of cleavage products (Fig. 5B). In contrast, no cleavage of PARP was observed in cells transfected with pTM1-HIV-1 PR. The integrity of Bcl-2 in cells expressing HIV-1PR was then examined. Under our experimental conditions, Bcl-2 did not undergo proteolysis upon expression of HIV-1 PR in COS7 cells (Fig. 5B). The translation initiation factor eIF4G was cleaved in cells expressing HIV-1 PR and poliovirus 2Apro as described recently (data not shown) (35). Surprisingly, Bcl-2 protein was cleaved in cells expressing poliovirus 3Cpro but remained intact in actinomycin D-induced apoptotic cells. This suggests that 3Cpro may induce Bcl-2 cleavage via a caspase-independent mechanism (Fig. 5B).

We then went on to examine the ultrastructure of COS7 cells expressing HIV-1 PR. Cells were fixed at 16 h.p.t. and observed by electron microscopy. A large percentage (40%) of COS7 cells transfected with pTM1-HIV-1 PR showed marked morphological alterations (Fig. 6). These changes included swelling, extensive vacuolization, and loss of plasma membrane integrity. In addition, the cytoplasm of these cells showed reduced electrodensity, which suggests cell emptying. Indeed, cell cultures expressing HIV-1 PR accumulated large amounts of cell debris as a consequence of massive cell lysis. In agreement with the results shown in Fig. 5, the nuclei of cells expressing HIV-1 PR remained recognizable with no sign of fragmentation despite some peripheral condensation of chromatin. These changes are clearly more consistent with a necrotic process of cell death. Apoptotic features, such as nuclear fragmentation, membrane blebbing, or the appearance of apoptotic bodies, were absent in cells expressing HIV-1 PR (Fig. 6C). In contrast, cells expressing poliovirus 3Cpro displayed these apoptotic changes as described previously (Fig. 6B) (42).


View larger version (130K):
[in this window]
[in a new window]
 
Fig. 6.   Ultrastructural alterations in COS7 cells expressing HIV-1PR. Cells were transfected with pTM1 (A), pTM1-3Cpro (B), or pTM1-HIV-1PR (C and D) and examined by electron microscopy at 16 h.p.t. Cells shown in panel D were treated with 2 µM saquinavir. N, nucleus. The arrow indicates a condensed nucleus typical of apoptosis. Note the necrotic degeneration of cells transfected with pTM1-HIV-1PR.

Cell Lysis Induced by HIV-1 PR Expressed in the Context of the Gag Precursor-- The viral protease and the other pol-encoded enzymes are synthesized at much lower levels than Gag precursors in HIV-1-infected cells. To test whether the cytotoxic effect of HIV-1 PR persists when lower levels of the enzyme are synthesized, Gag-PR HIV-1 sequences were expressed in COS7 cells (Fig. 7). Most translation events on gag-pro mRNAs give rise to Gag, whereas only about 5% of the ribosomes engaged in translation direct the synthesis of Gag-PR precursor by a frame-shifting mechanism (43). Thus, cells transfected with pKS5'L-GAG-PR synthesize much less HIV-1 PR than those transfected with pTM1-HIV-PR. Western blotting against HIV-1 p-24 (CA) protein showed that HIV-1PR is activated in the Gag-PR precursor. This activation leads to processing of the Gag precursor, yielding CA-MA and mature forms of CA (Fig. 7A). The level of expression of viral proteins with this construct is comparable to that observed in HIV-1-infected cells. As expected, Gag precursor processing was partially prevented when cells were treated with saquinavir. The lytic activity of Gag-PR precursor was comparable to that of HIV-1 PR alone. Fig. 7B shows that transfection of COS7 cells with pKS5'L-GAG-PR induced a similar degree of cell lysis to that observed in cells expressing HIV-1 PR alone, as judged by the LDH activity recovered in the culture medium. Notice that Gag-PR-induced cell lysis was blocked by saquinavir, indicating it is HIV-1 PR activity itself, and not that of the other gag-encoded proteins, is responsible for cell lysis. In this case, the concentration of saquinavir used was enough to completely block HIV-1PR-mediated cell lysis, because the level of expression of HIV-1PR from pKS5'L-GAG-PR is lower as compared with that observed from pTM1-HIV-1PR. This is consistent with data shown in Fig. 4B.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7.   Expression of HIV-1 PR in the context of the Gag-PR precursor induces lysis in COS7 cells. A, schematic diagram of the two reading frames in the HIV-1Gag-PR-expressing plasmid, showing the natural leader region (5'UTR) of HIV-1 and the coding regions of protease and Gag-derived products. Lower panel, transient expression of Gag-PR in COS7 cells in the absence or presence of 2 µM saquinavir. A sample of MT2 cells infected with HIV-1 (pNL4.3) at a multiplicity of infection of 5 plaque-forming units/cell (48) was also included as a control of Gag-PR expression. Extracts were subjected to Western blot analysis using an antibody against HIV-1 p-24 (CA). Products derived from HIV-1 PR-mediated processing of p55 are shown. B, cell lysis induced by Gag-PR expression in COS7. +SQ, cells treated with 2 µM saquinavir. Arrowheads, cleavage sites of HIV-1PR.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Induction of Cell Lysis by HIV-1 PR in Yeast and Mammalian Cells-- By individually expressing animal virus proteins in eukaryotic cells different cytopathogenic effects have been attributed to particular gene products. Thus, virus-induced alterations observed in infected cells have been ascribed, in some cases, to the action of one or more particular viral products. This approach has opened new avenues to improve our understanding on the molecular mechanisms used by cytolytic viruses to disrupt cell function and provoke cell death. In the present report, we show that the expression of HIV-1 PR in yeast and mammalian cells induces cytopathogenic effects that culminate in cell lysis. Indeed, there is a striking parallelism between the cell damage induced by HIV-1 PR in the two cell types analyzed, i.e. yeast and mammalian cells. Common detrimental effects include plasma membrane damage, cytoplasm vacuolization, and loss of cell integrity, whereas no major alterations were obvious in other organelles such as the nucleus. This close similarity would suggest a similar mechanism of action for HIV-1 PR in yeast and mammalian cells, despite their evolutionary distance.

The yeast S. cerevisiae has been successfully employed to assess alterations produced in mammalian cells by several viral proteins such as poliovirus 2Apro, 2BC, or HIV-1 Vpr (29, 39, 44). However, as far as we are aware, the present findings are the first clear illustration of a lytic effect of a viral protein such as HIV-1 PR on yeast. These data might also prove useful for the development of a yeast-based model to test the lytic ability of other proteins derived from animal viruses. Furthermore, this potential of yeast genetics raises the possibility of searching for one or more genes whose overexpression may suppress HIV-1 PR-mediated cytolysis.

An explanation for the observed HIV-1 PR-induced effects on yeast and mammalian cells may be degradation of one or more proteins involved in maintenance of plasma membrane architecture. However, further work is required to fully understand the molecular mechanism by which HIV-1 PR induces cell lysis. As shown by electron microscopy, before undergoing lysis, the plasma membrane of yeast cells that express HIV-1 PR collapses. This alteration was not observed in cells expressing poliovirus 2BC despite dramatic modifications in plasma membrane permeability (33) and indicates that simple plasma membrane permeabilization does not necessarily lead to cell lysis. The reason for cell wall breakage and lysis in HIV-1 PR-expressing yeast is not obvious. However, the possibility that HIV-1 PR might be directly involved in cell wall degradation seems very unlikely. The cell wall affords mechanical protection to yeast cells against osmotic lysis (45, 46). Indeed, growth of lytic strains with mutations in genes involved in cell wall integrity can be effectively restored by osmotic stabilizers (41). The fact that HIV-1 PR-induced lysis was not prevented by increasing osmotic pressure, suggests that lethal damages other than cell wall degradation underlie this effect.

HIV-1 PR has been previously expressed in a wide variety of cells, including bacteria, yeast, and mammalian cells, mainly to produce large quantities of the protease. Expression of a secretable form of HIV-1 PR in yeast showed no cytotoxic effects, further suggesting the cell wall is not a direct target for HIV-1 PR. This lack of cytotoxicity toward yeast cells may arise from translocation of the protease to the E.R. lumen at the time of synthesis. Transient expression of HIV-1 PR in COS7 cells leads to cell death. Features characteristic of apoptosis, such as DNA fragmentation (17), have been correlated with the observation that HIV-1 PR can induce degradation of the anti-apoptotic protein Bcl-2 in vitro (17). Moreover, overexpression of the Bcl-2 protein protects cells from HIV-1 PR-mediated cytotoxicity. Nevertheless, the significance of these observations has been questioned, because infection with HIV-1 does not result in cleavage of Bcl-2. Furthermore, overexpression of this anti-apoptotic protein fails to protect cells against HIV-1-induced lysis (47). The present results indicate that synthesis of HIV-1 PR, both in its mature form and as part of the Gag-PR precursor, induces a number of alterations in COS7 cells that are compatible with necrosis, rather than apoptosis. Indeed, no caspase activation was detected in COS7 cells expressing HIV-PR. It was not possible to detect markers of apoptosis such as nuclear fragmentation, membrane blebbing, and PARP cleavage. Furthermore, no signs of cleavage of Bcl-2 by HIV-1 PR in COS7 cells were seen under our experimental conditions. Discrepancies between our results and those published by Strack et al. (48) probably reflect differences in the amount and timing of HIV-1PR expression. Overexpression of Bcl-2 can also protect cells from necrotic injury and thus should not be regarded as definitive proof of apoptosis.

Implications of HIV-1 PR Activity in Virus-induced Cytopathogenicity-- A role for HIV-1 PR in virus-induced cell killing was previously suggested by the observation that HIV-1 engineered to encode a constitutively activated HIV-1 PR-linked dimer showed increased lytic potential on CD4+ cells and caused defects in virus assembly and budding (49). Interestingly, activation of HIV-1 PR in acutely, but not chronically, infected cells, appears to be initiated at an intracellular compartment before virus budding (50). These results emphasize the importance of the appropriate spatial and temporal activation of HIV-1 PR in infected cells to ensure a productive lytic infection. The results presented here may clarify some features of the HIV-1 life cycle. Thus, activation of HIV-1 PR during late stages of infection may lead to plasma membrane damage and cell lysis. Altered plasma membrane homeostasis is a major cytopathic feature observed in CD4+ cells infected with HIV-1 (51). This modification could facilitate the release of newly assembled HIV-1 particles from infected cells, particularly virus particles that bud intracellularly and are trapped into vacuoles. This notion is supported by earlier observations showing that intracellular activation of HIV-1 PR is required for virus release to occur with maximum efficiency (52).

    ACKNOWLEDGEMENTS

We thank J. Arroyo and J. Lewis for stimulating discussion and critical reading of the manuscript. The technical support of M. A. Sanz is also acknowledged.

    FOOTNOTES

* This work was supported in part by the Fondo de Investigaciones Sanitarias, Project 01/0042-02 and the Comunidad Autónoma de Madrid, Project 08.2/0024/2000 2. The CBM was awarded an institutional grant by the Fundación Ramón Areces.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Holds a fellowship from the Ministerio de Ciencia y Tecnología.

|| To whom correspondence should be addressed. Tel.: 34-1-585-4560; Fax: 34-1-585-4506; E-mail: iventoso@cnb.uam.es.

Published, JBC Papers in Press, October 4, 2002, DOI 10.1074/jbc.M205636200

    ABBREVIATIONS

The abbreviations used are: HIV-1, human immunodeficiency virus, type 1; HIV-1 PR, HIV protease; PARP, poly(ADP-ribose) polymerase; PI, propidium iodide; FACS, fluorescence-activated cell sorting; LDH, lactate dehydrogenase; h.p.i., hours post induction; h.p.t., hours post transfection.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Fauci, S. A. (1993) Science 262, 1011-1018[Abstract/Free Full Text]
2. McCune, J. M. (2001) Nature 410, 974-979[CrossRef][Medline] [Order article via Infotrieve]
3. Ho, D. D., Neumann, A. U., Pelerson, A. S., Chen, W., Leonard, J. M., and Markowitz, M. (1995) Nature 373, 123-126[CrossRef][Medline] [Order article via Infotrieve]
4. Levy, J. A. (1993) Microbiol. Rev. 57, 183-289[Abstract/Free Full Text]
5. Voss, T. G., Fermin, C. D., Levy, J. A., Vigh, S., Choi, B., and Garry, R. F. (1996) J. Virol. 70, 5447-5454[Abstract/Free Full Text]
6. Plymale, D. R., Tang, D. S. N., Comardelle, A. M., Fermin, C. D., Lewis, D. E., and Garry, R. F. (1999) AIDS 13, 1827-1839[CrossRef][Medline] [Order article via Infotrieve]
7. Meyaard, L., Otto, A. A., Jonker, R. R., Mijnster, M. J., Keet, R. P. M., and Miedema, F. (1992) Science 257, 217-219[Abstract/Free Full Text]
8. Terai, C., Kornbluth, R., Pauza, C. D., Richman, D. D., and Carson, D. A. (1991) J. Clin. Invest. 87, 1710-1715[Medline] [Order article via Infotrieve]
9. Fisher, A. G., Ratner, M., Mitsuya, H., Marselle, L. M., Harper, M. E., Broder, S., Gallo, R. C., and Wong-Staal, F. (1986) Science 233, 655-659[Abstract/Free Full Text]
10. Sodroski, J., Gogh, W. C., Rosen, C. A., Campbell, K. A., and Haseltine, W. A. (1986) Nature 322, 3105-3111
11. Cao, J., Park, I. W., Cooper, A., and Sodroski, J. (1996) J. Virol. 70, 1340-1354[Abstract]
12. LaBonte, J., Patel, T., Hofmann, W., and Sodroski, J. (2000) J. Virol. 74, 10690-10698[Abstract/Free Full Text]
13. Ayyavoo, V., Mahboubi, A., Mahalingam, S., Ramalingam, R., Kudchodkar, S., Willians, W. V., Green, D. R., and Weiner, D. (1997) Nat. Med. 3, 1117-1123[CrossRef][Medline] [Order article via Infotrieve]
14. García, J. V., and Miller, A. D. (1991) Nature 350, 508-511[CrossRef][Medline] [Order article via Infotrieve]
15. Li, C. J., Friedman, D. J., Wang, C., Metelev, V., and Pardee, A. B. (1995) Science 268, 429-431[Abstract/Free Full Text]
16. Baum, E. Z., Bebernitz, G. A., and Gluzman, Y. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5573-5577[Abstract/Free Full Text]
17. Strack, P. R., West Frey, M., Rizzo, C. J., Cordova, B., George, H. J., Meade, R., Peng Ho, S., Corman, J., Tritch, R., and Korant, B. D. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9571-9576[Abstract/Free Full Text]
18. Oroszlan, S., and Luftig, R. B. (1990) Curr. Top. Microbiol. Immunol. 157, 153-185[Medline] [Order article via Infotrieve]
19. Schneider, J., and Kent, S. B. (1988) Cell 54, 363-368[CrossRef][Medline] [Order article via Infotrieve]
20. Vogt, V. M. (1996) Curr. Top. Microbiol. Immunol. 214, 95-131[Medline] [Order article via Infotrieve]
21. Kohl, N. E., Emini, E. A., Schleif, W. A., Davis, L. J., Heimbach, J. C., Dixon, R. A., Scolnick, E. M., and Sigal, I. S. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 4686-4690[Abstract/Free Full Text]
22. Riviere, Y., Blank, P., Kourilsky, P., and Israel, I. (1991) Nature (Lond.) 350, 625-626[CrossRef][Medline] [Order article via Infotrieve]
23. Shoeman, R. L., Hüttermann, C., Harting, R., and Traub, P. (2001) Mol. Biol. Cell 12, 143-154[Abstract/Free Full Text]
24. Wallin, M., Deinum, J., Goobar, L., and Danielson, H. (1990) J. Gen. Virol. 71, 1985-1991[Abstract/Free Full Text]
25. Shoeman, R. L., Höner, B., Stoller, T. J., Kesselmeier, C., Miedel, M. C., Traub, P., and Graves, M. C. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6336-6340[Abstract/Free Full Text]
26. Tomasselli, A. G., Hui, J. O., Adams, L., Chosay, J., Lowery, D., Greenl, B., Yem, A., Deibel, M. R., Zürcher-Neely, H., and Heinrikson, R. L. (1991) J. Biol. Chem. 266, 14548-14553[Abstract/Free Full Text]
27. Konvalinka, J., Litterst, M. A., Welker, R., Kottler, H., Rippmann, F., Heuser, A. M., and Kräusslich, H. G. (1995) J. Virol. 69, 7180-7186[Abstract]
28. Bonnet, D., and Spahr, P. F. (1990) J. Virol. 64, 5628-5632[Abstract/Free Full Text]
29. Barco, A., and Carrasco, L. (1995) FEBS Lett. 371, 4-8[CrossRef][Medline] [Order article via Infotrieve]
30. Macreadi, I. G., Castelli, L. A., Hewish, D. R., Kirkpatrick, A., Ward, A. C., and Azard, A. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 74, 4835-4838
31. Sambrook, K. J., Fritsch, E. R., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
32. Baldani, C., and Cesareni, G. (1985) Gene (Amst.) 35, 27-32[CrossRef][Medline] [Order article via Infotrieve]
33. Aldabe, R., Barco, A., and Carrasco, L. (1996) J. Biol. Chem. 271, 23134-23137[Abstract/Free Full Text]
34. Barco, A., and Carrasco, L. (1995) Gene (Amst.) 156, 19-25[CrossRef][Medline] [Order article via Infotrieve]
35. Ventoso, I., Blanco, R., Perales, C., and Carrasco, L. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 12966-12971[Abstract/Free Full Text]
36. Yaffe, M. P., and Schatz, G. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 4819-4823[Abstract/Free Full Text]
37. Fuerst, T. R., Earl, P. L., and Moss, B. (1997) Mol. Cel. Biol. 7, 2538-2544
38. Wright, R., Basson, M., D'Ari, L., and Rine, J. (1988) J. Cell Biol. 107, 101-114[Abstract/Free Full Text]
39. Barco, A., and Carrasco, L. (1995) EMBO J. 14, 3349-3364[Medline] [Order article via Infotrieve]
40. De la Fuente, J. M., Alvarez, A., Nombela, C., and Sánchez, M. (1992) Yeast 8, 39-45[CrossRef][Medline] [Order article via Infotrieve]
41. Andrews, P. D., and Stark, M. J. R. (2000) J. Cell Sci. 113, 507-520[Abstract]
42. Barco, A., Feduchi, E., and Carrasco, L. (2000) Virology 266, 352-360[CrossRef][Medline] [Order article via Infotrieve]
43. Jaks, T., Power, M. D., Masiarz, F. R., Luciw, P. A., Barr, P. J., and Varmus, H. E. (1989) Nature 331, 280-283
44. Gu, J., Emerman, M., and Sandmeyer, S. (1997) Mol. Cell Biol. 17, 4033-4042[Abstract]
45. Cid, V. J., Durán, A., del Rey, F., Snyder, M. P., Nombela, C., and Sanchez, M. (1995) Microbiol. Rev. 59, 345-386[Abstract/Free Full Text]
46. Takeo, K., Yamamura, M., and Kamihara, T. (1989) FEMS Microbiol. Lett. 61, 297-300
47. Kolesnitchenko, V., King, L., Riva, A., Tani, Y., Korsmeyer, S. J., and Cohen, D. I. (1997) J. Virol. 71, 9753-9763[Abstract]
48. Shimizu, S., Eguchi, Y., Kamiike, W., Waguri, S., Uchiyama, Y., Matsuda, H., and Tsujimoto, Y. (1996) Oncogene 12, 2045-2050[Medline] [Order article via Infotrieve]
49. Kräusslich, H. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3213-3217[Abstract/Free Full Text]
50. Kaplan, A. H., and Swanstrom, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4528-4532[Abstract/Free Full Text]
51. Cloyd, M. W., and Lynn, W. S. (1991) Virology 181, 500-511[CrossRef][Medline] [Order article via Infotrieve]
52. Kaplan, A. H., Manchester, M., and Swanstrom, R. (1994) J. Virol. 68, 6782-6786[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
Z. Nie, G. D. Bren, S. R. Vlahakis, A. A. Schimnich, J. M. Brenchley, S. A. Trushin, S. Warren, D. J. Schnepple, C. M. Kovacs, M. R. Loutfy, et al.
Human Immunodeficiency Virus Type 1 Protease Cleaves Procaspase 8 In Vivo
J. Virol., July 1, 2007; 81(13): 6947 - 6956.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Desfarges, J. San Filippo, M. Fournier, C. Calmels, A. Caumont-Sarcos, S. Litvak, P. Sung, and V. Parissi
Chromosomal integration of LTR-flanked DNA in yeast expressing HIV-1 integrase: down regulation by RAD51
Nucleic Acids Res., December 4, 2006; 34(21): 6215 - 6224.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
T. L. O'Loughlin, W. M. Patrick, and I. Matsumura
Natural history as a predictor of protein evolvability
Protein Eng. Des. Sel., October 1, 2006; 19(10): 439 - 442.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
L. Abdel-Latif, B. K. Murray, R. L. Renberg, K. L. O'Neill, H. Porter, J. B. Jensen, and F. B. Johnson
Cell death in bovine parvovirus-infected embryonic bovine tracheal cells is mediated by necrosis rather than apoptosis
J. Gen. Virol., September 1, 2006; 87(9): 2539 - 2548.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
T. L. O'Loughlin, D. N. Greene, and I. Matsumura
Diversification and Specialization of HIV Protease Function During In Vitro Evolution
Mol. Biol. Evol., April 1, 2006; 23(4): 764 - 772.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/1086    most recent
M205636200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Blanco, R.
Right arrow Articles by Ventoso, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Blanco, R.
Right arrow Articles by Ventoso, I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement