|
Originally published In Press as doi:10.1074/jbc.M205636200 on October 4, 2002
J. Biol. Chem., Vol. 278, Issue 2, 1086-1093, January 10, 2003
Cell Killing by HIV-1 Protease*
Raquel
Blanco §,
Luis
Carrasco , and
Iván
Ventoso¶
From the Centro de Biología Molecular Severo
Ochoa Consejo Superior Investigaciones Cientificas-Universidad
Autónoma de Madrid and the ¶ Centro Nacional de
Biotecnología, CSIC, Departamento de Bioquímica y
Biología Celular, Universidad Autónoma de Madrid,
Cantoblanco 28049, Madrid, Spain
Received for publication, June 6, 2002, and in revised form, October 4, 2002
 |
ABSTRACT |
The human immunodeficiency virus protease (HIV-1
PR) was expressed both in the yeast Saccharomyces
cerevisiae and in mammalian cells. Inducible expression of HIV-1
PR arrested yeast growth, which was followed by cell lysis. The lytic
phenotype included loss of plasma membrane integrity and cell wall
breakage leading to the release of cell content to the medium. Given
that neither poliovirus 2A protease nor 2BC protein, both being highly
toxic for S. cerevisiae, were able to produce similar
effects, it seems that this lytic phenotype is specific of HIV-1 PR.
Drastic alterations in membrane permeability preceded the lysis in
yeast expressing HIV-1 PR. Cell killing and lysis provoked by HIV-1 PR
were also observed in mammalian cells. Thus, COS7 cells expressing the
protease showed increased plasma membrane permeability and underwent
lysis by necrosis with no signs of apoptosis. Strikingly, the
morphological alterations induced by HIV-1 PR in yeast and mammalian
cells were similar in many aspects. To our knowledge, this is the first
report of a viral protein with such an activity. These findings
contribute to the present knowledge on HIV-1-induced cytopathogenesis.
 |
INTRODUCTION |
Replication of lytic viruses in susceptible cells is accompanied
by a number of morphological and metabolic alterations that culminate
in host cell lysis. For human immunodeficiency virus (HIV-1),1 progressive loss of
CD4+ lymphocytes is considered the hallmark of progression
to AIDS (1, 2). Although the main cause of T-cell depletion by HIV-1 in vivo is still unclear, there is evidence that
CD4+ cell destruction is tightly linked to active viral
replication (3). Both a virus-induced cytopathic effect and
immunological clearance of infected cells are likely to contribute to
CD4+ cell loss (3).
HIV-1-induced cytopathic effect in cultured T-cells leads to individual
cell lysis or to cell fusion depending on the viral strain used (4).
Cell lysis is presumably the ultimate consequence of a number of
virus-induced modifications to the plasma membrane (4). Indeed, cells
acutely infected with HIV-1 show increased plasma membrane
permeability. Changes in ion gradients maintained by the
plasma membrane lead to increased cell volume (swelling), culminating
in cell lysis (5). These changes are consistent with a necrotic process
of cell death (6). However, apoptosis has also been observed in
HIV-1-infected cells, including in vitro cultured peripheral
blood lymphocytes from AIDS patients (7, 8).
A large body of evidence links the cytopathic potential of
HIV-1 to the activity of the viral envelope glycoproteins gp120 and
gp41 (9). The binding of viral glycoproteins to the CD4 receptor on
adjacent cells induces cell fusion giving rise to syncytia formation
(10). In addition, recent data suggest that intracellular interaction
of gp120/gp41 with the CD4 receptor can also trigger membrane fusion,
thus contributing to single cell lysis (11, 12).
The expression of other HIV-1 proteins such as Tat, Nef, and
Vpr has also been related to detrimental effects on cell functions (13-15). Furthermore, HIV-1 protease exhibits cytotoxicity when expressed in a variety of cells, including bacteria and mammalian cells
(16, 17). Transient expression of HIV-1 PR in COS cells has been
reported to induce apoptosis preceded by cleavage of the anti-apoptotic
protein Bcl-2 (17).
A major function of HIV-1 PR in the virus life cycle is to
proteolytically process the gag and gag-pol
precursors to yield mature virion proteins. The protease is initially
synthesized in an inactive form as part of the gag-pol
precursor and is activated at the final stages of the virus life cycle.
This activation gives rise to the formation of the isolated protease as
well as to the mature enzymes reverse transcriptase and
integrase, and the virion core structural proteins MA, CA, NC,
and p6 (18-20). Protease activation is required for virion maturation,
because inhibition of PR activity gives rise to immature virus
particles containing unprocessed gag-pol precursors that are
unable to re-infect cells (21).
Apart from viral-encoded substrates, the cleavage of cell
proteins by HIV-1 PR is well documented (22-24). Thus, the
cytoskeletal proteins vimentin, desmin, and glial fibrillary acidic
protein are cleaved in vitro by recombinant HIV-1 PR (25).
In addition, HIV-1 PR proteolyzes actin, troponin C, Alzheimer amyloid
precursor protein, and pro-interleukin 1 in vitro (26).
Nevertheless, only the cleavage of vimentin has been reported to occur
in HIV-infected cells (27). This raises the possibility that HIV-1 PR
might play a role in virus-induced cytopathology, although there are no
direct data supporting this rationale.
The yeast Saccharomyces cerevisiae has emerged as a
powerful tool for exploring the functions of heterologous proteins of diverse origin (28). This system has been successfully employed to test
the cytotoxic potential of viral proteins, including proteases (29,
30). In the present report, we describe a novel lytic activity of HIV-1
PR in both yeast and mammalian cells.
 |
EXPERIMENTAL PROCEDURES |
Microbial Strains--
Escherichia coli DH5 was
used for the construction of expression plasmids as described elsewhere
(31). The S. cerevisiae strain FYBL-1 (Mata,
ura3-851, lys2-202, leu2-1,
his3-200) was generously provided by Dr. J. P. G. Ballesta (Centro de Biología Molecular, Madrid, Spain).
DNA Recombinant Protocols--
Expression plasmids were
constructed according to standard procedures (31). The HIV-1 PR coding
sequence was amplified by PCR from clone BH10 of HIV-1 using the
primers 5' HIV-1 PR (GCGCGCCATGGGACCTCAGATCACTCTTTGG) (artificial initiation codon in italics) and 3'HIV-1PR
(CGCGGATCCTTACTAAAAATTTAAAGTGCAACCAATCTG). The 300-bp product was
digested with a BamHI enzyme and cloned into the expression
vector pEMBL-yex4 (32). PKS5'LGAG-PR plasmid encodes gag and
pr genes under the entire 5'-leader region of HIV-1 derived
from pNL4.3 plasmid. Its construction involved cloning the 3-kbp
PCR-amplified DNA fragment into pKSBluescript (Stratagene) using
NotI and BamHI enzymes. Primers used were 5'NCRH
(CGACGCGGCCGCGGTCTCTCTGGTTAGACC) and 3'HIV-1 PR.
pEMBL-2Apro, pEMBL-2BC, pTM1-HIV-1 PR,
pTM1-2Apro, pTM1-2BC, and pTM1-3Cpro have
been described previously (33-35).
Yeast Media, Growth, Transformation, and Induction--
Yeast
cells transformed by the lithium acetate method using the indicated
plasmid were selected on minimal yeast nitrogen bases
(YNB)-glucose plates supplemented with 20 mg/liter of the required
amino acids or bases according to auxotrophic markers, as described
previously (34). For induction of the UASGAL-CYC promoter on agar
plates, glucose was replaced by galactose at a final concentration of
2%. For induction in liquid medium, cells were grown in YNB-lactate
and induced by the addition of 2% galactose.
Obtaining Yeast Extracts and Western Blot Analysis--
Yeast
extracts for Western blot analysis were prepared by trichloroacetic
acid precipitation as described previously (36). For yeast expressing
HIV-1 PR, both cells and media were precipitated with trichloroacetic
acid. Proteins were separated on 17% SDS-PAGE, transferred to
nitrocellulose membranes, and probed with the indicated antibody. Goat
antiserum against HIV-1 PR and a monoclonal antibody against HIV-1
p55/p24 were provided by the EU Program EVA/MRC Centralised Facility
for AIDS Reagents, NIBSC, UK and used at dilutions
1:700 and 1:500, respectively. Antibodies against human PARP
(Pharmingen), Bcl-2 (Santa Cruz Biotechnology, Inc.), and actin (Sigma)
were used at dilutions of 1/500. Detection was performed using the ECL
system (Amersham Biosciences).
Mammalian Cells and Transfection--
COS7 cells were
grown in Dulbecco's modified Eagle's medium supplemented with 10%
fetal calf serum. Transient transfection of pTM-1 plasmids coupled to
vT7 infection has been previously described in detail (37). Briefly,
0.5 µg of each plasmid was mixed with 2 µg of LipofectAMINE
reagent® (Invitrogen) and added to COS7 cells growing in 24-well
plates at 70% confluency. Cell viability was scored by the trypan
blue exclusion method.
Measurement of Cell Lysis--
Yeast cell lysis was estimated by
the release of intracellular proteins into the medium. Induced yeast
cultures (1 ml) were centrifuged at 10,000 rpm for 10 min, and
supernatants were used directly to determine protein concentration by
the Bio-Rad Bradford assay. Alternatively, cells were stained with
0.005% propidium iodide (PI) in phosphate-buffered saline for 15 min,
washed three times with phosphate-buffered saline, and analyzed by
fluorescence-activated cell sorting (FACS). Lysis in mammalian cells
was determined using the cytotoxicity detection kit (LDH) (Roche
Molecular Biochemicals).
Electron Microscopy--
For the ultrastructural analysis of
yeast, we followed the electron microscopy protocol described by Wright
et al. (38) with a few modifications: cells were fixed for
2 h at room temperature in 2% glutaraldehide-1% tannic
acid in 0.1 M cacodylate buffer, pH 6.8, and finally
embedded in London resin white resin. The same procedure was
applied for mammalian cells, except for the buffer used in this case,
0.2 M Hepes, pH 7.2.
 |
RESULTS |
Inducible Expression of HIV-1 PR in S. cerevisiae--
Our initial
aim was to analyze the effect of HIV-1 PR expression in the yeast
S. cerevisiae. To this end, the coding sequence of HIV-1
pr was cloned into the expression plasmid pEMBLyex4 (32) under the galactose-inducible promoter. The yeast strain FYBL-1 was
chosen for transformation. First, cells bearing the pEMBL-HIV-1PR plasmid were induced on galactose-containing plates. As control, yeast
transformants that synthesize poliovirus proteins 2Apro or
2BC were induced in parallel, because these proteins are highly toxic
for yeast (29, 39). Fig. 1A
shows that induction of HIV-1 PR synthesis arrested cell growth to a
similar extent as 2Apro and 2BC. This toxic effect was
prevented by the addition of 2 µM saquinavir, a specific
inhibitor of HIV-1 PR, indicating that the proteolytic activity of the
enzyme is indeed responsible for its cytotoxicity. To further
characterize this cytotoxic effect, HIV-1 PR was induced in liquid
medium. Yeast growth was monitored by measuring the optical cell
density of the cultures. Cell extracts were obtained at different time
points after induction to detect the expression of HIV-1 PR by Western
blotting. During the first 12 h post induction (h.p.i.), cells
expressing HIV-1 PR grew at a rate similar to those transformed by the
vector alone (Fig. 1A, middle panel). However,
growth of cells expressing HIV-1 PR was abruptly halted at 14-18
h.p.i. This inhibition was concomitant to peak HIV-1 PR synthesis at
18-24 h.p.i., determined by Western blotting (Fig. 1A,
lower panel). Surprisingly, after this arrest of cell
growth, cultures expressing HIV-1 PR underwent a subsequent decrease in
optical density corresponding to a 20-30% loss in cell number 24 h.p.i. This finding was confirmed in over 10 independent experiments
performed using different yeast transformants. The phenotype of cells
expressing HIV-1 PR is clearly different from that of cells expressing
poliovirus 2Apro and 2BC. Even though poliovirus
2Apro and 2BC expression induced an early arrest of yeast
growth, the number of cells in these cultures remained constant until
30 h.p.i. This suggests that HIV-1 PR expression is cytocidal,
whereas expression of poliovirus 2Apro or 2BC is
cytostatic. The survival curve shows that about 80% of the cells died
upon HIV-1PR induction (Fig. 1B). The explanation for the
remaining 20% of cells that survived HIV-1PR expression is not
obvious.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of HIV-1 PR induces cell growth
arrest and lysis. A, upper panel. FYBL-1
cells transformed with vector (V) (1) or plasmids
expressing HIV-1PR (2), 2Apro (3), or
2BC (4), were induced on galactose-containing plates in the
absence (left) or presence (right) of the HIV-1PR
inhibitor saquinavir (5 µM). Middle panel,
Growth arrest of yeast transformed using pEMBL-HIV-1 PR analyzed in
liquid medium. The arrow indicates the time point when cell
density begins to decline for yeast expressing HIV-1PR. The lower
panel shows Western blotting against HIV-1 PR. The 9-kDa protein
corresponding to HIV-1 PR is indicated. B, survival curve.
At the time points indicated, cells from induced cultures were grown on
glucose-containing plates. C, measurement of protein
released into the medium upon HIV-1PR expression. At the indicated time
points, the protein concentration of cell-free culture media was
determined by the Bradford assay.
|
|
To further explore the lytic activity of HIV-1 PR in yeast, the release
of intracellular protein into the medium was measured at different time
points after induction of protease expression. Fig. 1C shows
that HIV-1 PR expression led to an increasing protein concentration in
the medium, which reached 15 µg/ml at 24 h.p.i. This would be
consistent with the idea that cell integrity is extensively damaged. In
contrast, no release of intracellular protein was detected in yeast
transformed with the vector alone or in cells expressing poliovirus
2Apro or 2BC. These data further demonstrate that induction
of lysis is a feature specific to HIV-1 PR.
Ultrastructural Alterations in Yeast Cells That Synthesize HIV-1
PR--
To better characterize the lytic phenotype induced by HIV-1
PR, yeast cells synthesizing HIV-1 PR were fixed and examined by
electron microscopy at different times after induction. At 18 h.p.i., before undergoing lysis, yeast cells expressing HIV-1 PR showed
a number of morphological alterations, compared with cells transformed
with the vector alone. These changes included increased cell size and
disintegration of the vacuole into multiple smaller bodies. They were
also observed in cells that synthesize poliovirus 2BC protein (Fig.
2B) or 2Apro (data
not shown), suggesting that they are common features to cells
expressing cytotoxic proteins. The plasma membrane, in turn, displayed
specific alterations in cells expressing HIV-1 PR. In control yeast
cells and in cells expressing poliovirus 2Apro or 2BC
proteins, the plasma membrane is closely associated with the inner
layer of the cell wall and shows a typical smooth contour. However, the
plasma membrane of cells expressing HIV-1 PR was notably wrinkled and
started to detach from the cell wall (Fig. 2C). Other
organelles, including the nucleus, retained their normal appearance for
longer periods. Further incubation of cells expressing HIV-1 PR led to
a profound loss of cell integrity and lysis at 24 h.p.i. (Fig. 2,
D and F). Thus, the plasma membrane became completely detached from the cell wall, and finally, the cell wall
broke down causing the release of cell content into the medium. Interestingly, this rupture of the cell wall frequently occurred on
budding scars, which are the thinnest area of the cell wall. In
contrast, the overall integrity of yeast expressing poliovirus 2Apro or 2BC proteins was not compromised, even though
these cells underwent extensive modifications in sub-cellular
structures.

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 2.
Ultrastructural alterations in yeast
expressing HIV-1 PR. Thin section electron microscopy of cells
bearing empty vector (A) or cells expressing poliovirus 2BC
protein (B) or HIV-1 PR (C, D, and
F). Cells were fixed at either 18 h.p.t.
(A-C) or 24 h.p.t. (D-F). E,
HIV-1PR-expressing cells were treated with 5 µM
saquinavir. Shown in panel F is a representative cell at
higher magnification transformed with pTM1- HIV-1PR. N,
nucleus; V, vacuole; black arrow, cell wall;
white arrow, plasma membrane; white arrowhead,
hole in cell wall.
|
|
Altered Membrane Permeability in Cells Expressing HIV-1 PR--
In
the next stage, we undertook experiments designed to establish the
major toxic effect of HIV-1 PR on yeast. The electron microscopy data
suggested that the lytic phenotype induced by HIV-1 PR expression could
be the final result of early damage on the plasma membrane. To test
this possibility, the permeability of the plasma membrane toward
propidium iodide (PI) was measured in yeast expressing HIV-1 PR before
cell lysis occurred (12-18 h.p.i.). It was shown by FACS analysis that
this dye was unable to penetrate yeast transformed with the vector
alone (Fig. 3A). However, PI
uptake became evident in cells expressing HIV-1 PR as early as 12 h.p.i., and PI entry into cells was further enhanced at 18 h.p.i.
Cells expressing HIV-1 PR showed no morphological changes at this stage
(data not shown), suggesting that membrane alteration is an early event
that precedes cell lysis.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Changes in membrane permeability
shown by yeast expressing HIV-1 PR. A, FACS
analysis of cells that took up propidium iodide (PI)
analyzed at 12 h.p.i. (upper panels) or 18 h.p.i.
(lower panel). V, cells transformed with vector
alone. HIV-1PR, cells transformed with the HIV-1
PR-expressing plasmid. B, the addition of osmoregulators
fails to prevent HIV-1 PR-induced cell growth arrest (upper
panel) and lysis (lower panel). Yeast cells transformed
with empty vector (1), HIV-1PR (2),
2Apro (3), or poliovirus 2BC (4),
were streaked on glucose- or galactose-containing plates supplemented
with 0.5 M sorbitol. The presence of saquinavir in the
medium (right plate) allowed growth of HIV-1PR-expressing
yeast. The lower panel shows the release of protein into the
culture medium induced by HIV-1PR expression at 24 h.p.i. in the
presence or the absence of 0.5 M sorbitol.
|
|
It is well known that changes in yeast cell wall architecture can lead
to cell lysis. This is true of yeast cells bearing thermosensitive
mutations in genes involved in maintenance of cell wall integrity,
which undergo lysis upon incubation at the restricted temperature (40).
In this situation, lysis can be effectively prevented by osmotic
stabilizers such as sorbitol or NaCl (41). It was, therefore, of
interest to establish whether sorbitol could prevent HIV-1 PR-induced
cell lysis. Yeast transformed with pEMBL-HIV-1 PR were induced on
galactose plates and liquid medium both containing 0.5 M
sorbitol. As shown in Fig. 3B, sorbitol failed to affect
both the extent of growth arrest and the cell lysis provoked by HIV-1
PR. Similar results were obtained when 1 M NaCl was used as
osmoregulator instead of sorbitol (data not shown). It is thus proposed
that lethal alterations other than cell wall breakage give rise to the
lytic phenotype of HIV-1 PR-expressing cells.
Expression of HIV-1 PR in COS Cells Causes Lysis--
Next, we
determined whether the lytic activity of HIV-1 PR also affects
mammalian cells. To this end, COS7 cells were transfected with the
protease-encoding plasmid pTM1-HIV-1 PR coupled to vaccinia virus vT7
infection (37). HIV-1 PR is detected as a band of ~9 kDa upon
labeling of cells with [35S]Met/Cys 16 h post
transfection (h.p.t.) (Fig.
4A). On microscopy, it was
observed that cells synthesizing HIV-1 PR displayed a number of
cytopathic alterations (see below for details). To search for changes
in membrane permeability, lactate dehydrogenase (LDH) release to the
culture medium was determined, because enhanced leakage of this enzyme
reflects loss of plasma membrane integrity. It was not possible to
detect LDH activity in culture media from cells transfected with the
vector alone. In contrast, LDH did leak out of cells expressing HIV-1
PR (Fig. 4B). Based on these data, we estimated that
20-25% of cells transfected with pTM1-HIV-1 PR underwent lysis. LDH
leakage requires the proteolytic activity of HIV-1 PR, because addition
of saquinavir prevented this leakage, although not completely. Probably
the high level of HIV-1PR expression using this system makes it
difficult to inhibit all HIV-1PR molecules by saquinavir. To determine
whether plasma membrane damage is a feature specific of HIV-1 PR, the
release of LDH was checked in the culture media of cells transfected
with plasmids encoding poliovirus 2Apro, 3Cpro,
or 2BC proteins. As mentioned above, these poliovirus proteins are
cytotoxic for mammalian cells (34, 42). Fig. 4B shows that
only synthesis of the 2BC protein induced cell lysis to an extent
similar to that provoked by HIV-1 PR, and it is in agreement with the
idea that 2BC expression enhances plasma membrane permeability, as
previously described in detail (33). In contrast, expression of
poliovirus 3Cpro failed to induce LDH release despite the
fact that 3C protease causes massive cell death by apoptosis (42).
These findings suggest that cell death by HIV-1 PR occurs by necrosis
rather than apoptosis, as initially suggested by Strack and colleagues (17).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
Transient expression of HIV-1 PR in mammalian
cells causes lysis. A, left panel, COS7 cells
transfected with the indicated plasmids were labeled with
[35S]Met/Cys at 16 h.p.t. Equal amounts of protein
were analyzed by SDS-PAGE and autoradiography. The right
panel shows that the size of purified protease (purified
PR) seen by Coomassie Brilliant Blue staining, and the size of
protease expressed from transfected COS 7 cells, seen by
autoradiography are the same. B, effect of HIV-1 PR
expression on plasma membrane integrity. LDH activity released from
COS7 cells transfected with the plasmid encoding the indicated proteins
was determined as described under "Experimental Procedures."
C, expression of HIV-1PR induces early changes in membrane
permeability. Transfected cells were labeled at 8 h.p.t. with
[35S]Met/Cys in the absence or presence of 0.6 mM hygromycin B (HygB). Autoradiography of
labeled proteins is shown. Quantification was by densitometric scanning
of protein bands.
|
|
Early alterations in membrane permeability in cells expressing HIV-1 PR
were then examined. As a test of membrane permeabilization, the
sensitivity of cellular translation to the inhibitor hygromycin B was
tested (33). This translation inhibitor does not enter into cells that
possess an intact plasma membrane. Addition of 0.6 mM
hygromycin B to cells transfected with pTM1-HIV-1 PR reduced protein
synthesis by 40-50% (Fig. 4C). This degree of inhibition is probably related to the proportion of transfected cells. In the
presence of 2 µM saquinavir, entry of hygromycin B
into cells was not observed.
HIV-1 PR Kills COS Cells by Necrosis--
The nuclear morphology
of cells expressing HIV-1 PR was examined to gain knowledge on
the mode of HIV-1 PR-induced cell death. Fragmented nuclei, a sign of
apoptosis, were observed in COS7 cells expressing poliovirus
3Cpro. Nuclear fragmentation, however, did not occur in
cells transfected with pTM1-HIV-1 PR (Fig.
5A).

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 5.
Lack of apoptotic features in COS7 cells
expressing HIV-1 PR. A, 4',6-diamidino-2-phenylindole
staining of nuclei in cells transfected with pTM1 (V),
pTM1-HIV-1PR, or pTM1-3Cpro. Arrows indicate
fragmented apoptotic nuclei. B, Western blot analysis of
PARP, Bcl-2, and actin proteins from cells transfected with pTM1,
pTM1-2Apro, pTM1-2BC, pTM1-3Cpro, or
pTM1-HIV-1 PR. Cell extracts were prepared at 16 h.p.t. and probed
with the specific antibodies. +SQ, cells treated with 2 µM saquinavir; Act D, cells treated with
actinomycin D (2 µg/ml) for 16 h. Cleavage products
(c.p.) derived from the proteins indicated are shown.
|
|
Caspase-mediated cleavage of poly(ADP-ribose) polymerase (PARP), a
biochemical marker of apoptosis, was also measured. PARP is cleaved in
cells expressing poliovirus 3Cpro and in actinomycin
D-induced apoptotic cells, giving rise to a distinct
pattern of cleavage products (Fig. 5B). In contrast, no
cleavage of PARP was observed in cells transfected with pTM1-HIV-1 PR.
The integrity of Bcl-2 in cells expressing HIV-1PR was then examined.
Under our experimental conditions, Bcl-2 did not undergo proteolysis
upon expression of HIV-1 PR in COS7 cells (Fig. 5B). The
translation initiation factor eIF4G was cleaved in cells expressing HIV-1 PR and poliovirus 2Apro as described recently (data
not shown) (35). Surprisingly, Bcl-2 protein was cleaved in cells
expressing poliovirus 3Cpro but remained intact in
actinomycin D-induced apoptotic cells. This suggests that
3Cpro may induce Bcl-2 cleavage via a caspase-independent
mechanism (Fig. 5B).
We then went on to examine the ultrastructure of COS7 cells expressing
HIV-1 PR. Cells were fixed at 16 h.p.t. and observed by electron
microscopy. A large percentage (40%) of COS7 cells transfected with
pTM1-HIV-1 PR showed marked morphological alterations (Fig.
6). These changes included swelling,
extensive vacuolization, and loss of plasma membrane integrity. In
addition, the cytoplasm of these cells showed reduced electrodensity,
which suggests cell emptying. Indeed, cell cultures expressing HIV-1 PR
accumulated large amounts of cell debris as a consequence of massive
cell lysis. In agreement with the results shown in Fig. 5, the nuclei of cells expressing HIV-1 PR remained recognizable with no sign of
fragmentation despite some peripheral condensation of chromatin. These
changes are clearly more consistent with a necrotic process of cell
death. Apoptotic features, such as nuclear fragmentation, membrane
blebbing, or the appearance of apoptotic bodies, were absent in cells
expressing HIV-1 PR (Fig. 6C). In contrast, cells expressing
poliovirus 3Cpro displayed these apoptotic changes as
described previously (Fig. 6B) (42).

View larger version (130K):
[in this window]
[in a new window]
|
Fig. 6.
Ultrastructural alterations in COS7 cells
expressing HIV-1PR. Cells were transfected with pTM1
(A), pTM1-3Cpro (B), or pTM1-HIV-1PR
(C and D) and examined by electron microscopy at
16 h.p.t. Cells shown in panel D were treated with 2 µM saquinavir. N, nucleus. The
arrow indicates a condensed nucleus typical of apoptosis.
Note the necrotic degeneration of cells transfected with
pTM1-HIV-1PR.
|
|
Cell Lysis Induced by HIV-1 PR Expressed in the Context of the Gag
Precursor--
The viral protease and the other pol-encoded
enzymes are synthesized at much lower levels than Gag precursors in
HIV-1-infected cells. To test whether the cytotoxic effect of HIV-1 PR
persists when lower levels of the enzyme are synthesized, Gag-PR HIV-1 sequences were expressed in COS7 cells (Fig.
7). Most translation events on gag-pro
mRNAs give rise to Gag, whereas only about 5% of the ribosomes
engaged in translation direct the synthesis of Gag-PR precursor by a
frame-shifting mechanism (43). Thus, cells transfected with
pKS5'L-GAG-PR synthesize much less HIV-1 PR than those
transfected with pTM1-HIV-PR. Western blotting against HIV-1 p-24 (CA)
protein showed that HIV-1PR is activated in the Gag-PR precursor. This
activation leads to processing of the Gag precursor, yielding CA-MA and
mature forms of CA (Fig. 7A). The level of expression of
viral proteins with this construct is comparable to that observed in
HIV-1-infected cells. As expected, Gag precursor processing was
partially prevented when cells were treated with saquinavir. The lytic
activity of Gag-PR precursor was comparable to that of HIV-1 PR alone.
Fig. 7B shows that transfection of COS7 cells with
pKS5'L-GAG-PR induced a similar degree of cell lysis to
that observed in cells expressing HIV-1 PR alone, as judged by the LDH
activity recovered in the culture medium. Notice that Gag-PR-induced
cell lysis was blocked by saquinavir, indicating it is HIV-1 PR
activity itself, and not that of the other gag-encoded proteins, is responsible for cell lysis. In this case, the
concentration of saquinavir used was enough to completely block
HIV-1PR-mediated cell lysis, because the level of expression of HIV-1PR
from pKS5'L-GAG-PR is lower as compared with that observed
from pTM1-HIV-1PR. This is consistent with data shown in Fig.
4B.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of HIV-1 PR in the context of the
Gag-PR precursor induces lysis in COS7 cells. A,
schematic diagram of the two reading frames in the
HIV-1Gag-PR-expressing plasmid, showing the natural leader region
(5'UTR) of HIV-1 and the coding regions of
protease and Gag-derived products. Lower panel, transient
expression of Gag-PR in COS7 cells in the absence or presence of 2 µM saquinavir. A sample of MT2 cells infected with HIV-1
(pNL4.3) at a multiplicity of infection of 5 plaque-forming
units/cell (48) was also included as a control of Gag-PR expression.
Extracts were subjected to Western blot analysis using an antibody
against HIV-1 p-24 (CA). Products derived from HIV-1
PR-mediated processing of p55 are shown. B, cell lysis
induced by Gag-PR expression in COS7. +SQ, cells treated
with 2 µM saquinavir. Arrowheads, cleavage
sites of HIV-1PR.
|
|
 |
DISCUSSION |
Induction of Cell Lysis by HIV-1 PR in Yeast and Mammalian
Cells--
By individually expressing animal virus proteins in
eukaryotic cells different cytopathogenic effects have been attributed to particular gene products. Thus, virus-induced alterations observed in infected cells have been ascribed, in some cases, to the action of
one or more particular viral products. This approach has opened new
avenues to improve our understanding on the molecular mechanisms used
by cytolytic viruses to disrupt cell function and provoke cell death.
In the present report, we show that the expression of HIV-1 PR in yeast
and mammalian cells induces cytopathogenic effects that culminate in
cell lysis. Indeed, there is a striking parallelism between the cell
damage induced by HIV-1 PR in the two cell types analyzed,
i.e. yeast and mammalian cells. Common detrimental effects
include plasma membrane damage, cytoplasm vacuolization, and loss of
cell integrity, whereas no major alterations were obvious in other
organelles such as the nucleus. This close similarity would suggest a
similar mechanism of action for HIV-1 PR in yeast and mammalian cells,
despite their evolutionary distance.
The yeast S. cerevisiae has been successfully employed to
assess alterations produced in mammalian cells by several viral proteins such as poliovirus 2Apro, 2BC, or HIV-1 Vpr (29,
39, 44). However, as far as we are aware, the present findings are the
first clear illustration of a lytic effect of a viral protein such as
HIV-1 PR on yeast. These data might also prove useful for the
development of a yeast-based model to test the lytic ability of other
proteins derived from animal viruses. Furthermore, this potential of
yeast genetics raises the possibility of searching for one or more
genes whose overexpression may suppress HIV-1 PR-mediated cytolysis.
An explanation for the observed HIV-1 PR-induced effects on yeast and
mammalian cells may be degradation of one or more proteins involved in
maintenance of plasma membrane architecture. However, further work is
required to fully understand the molecular mechanism by which HIV-1 PR
induces cell lysis. As shown by electron microscopy, before undergoing
lysis, the plasma membrane of yeast cells that express HIV-1 PR
collapses. This alteration was not observed in cells expressing
poliovirus 2BC despite dramatic modifications in plasma membrane
permeability (33) and indicates that simple plasma membrane
permeabilization does not necessarily lead to cell lysis. The reason
for cell wall breakage and lysis in HIV-1 PR-expressing yeast is not
obvious. However, the possibility that HIV-1 PR might be directly
involved in cell wall degradation seems very unlikely. The cell wall
affords mechanical protection to yeast cells against osmotic lysis (45,
46). Indeed, growth of lytic strains with mutations in genes involved
in cell wall integrity can be effectively restored by osmotic
stabilizers (41). The fact that HIV-1 PR-induced lysis was not
prevented by increasing osmotic pressure, suggests that lethal damages
other than cell wall degradation underlie this effect.
HIV-1 PR has been previously expressed in a wide variety of cells,
including bacteria, yeast, and mammalian cells, mainly to produce large
quantities of the protease. Expression of a secretable form of HIV-1 PR
in yeast showed no cytotoxic effects, further suggesting the cell wall
is not a direct target for HIV-1 PR. This lack of cytotoxicity toward
yeast cells may arise from translocation of the protease to the
E.R. lumen at the time of synthesis. Transient expression of
HIV-1 PR in COS7 cells leads to cell death. Features characteristic of
apoptosis, such as DNA fragmentation (17), have been correlated with
the observation that HIV-1 PR can induce degradation of the
anti-apoptotic protein Bcl-2 in vitro (17). Moreover,
overexpression of the Bcl-2 protein protects cells from HIV-1
PR-mediated cytotoxicity. Nevertheless, the significance of these
observations has been questioned, because infection with HIV-1 does not
result in cleavage of Bcl-2. Furthermore, overexpression of this
anti-apoptotic protein fails to protect cells against HIV-1-induced
lysis (47). The present results indicate that synthesis of HIV-1 PR,
both in its mature form and as part of the Gag-PR precursor, induces a
number of alterations in COS7 cells that are compatible with necrosis,
rather than apoptosis. Indeed, no caspase activation was detected in
COS7 cells expressing HIV-PR. It was not possible to detect markers of
apoptosis such as nuclear fragmentation, membrane blebbing, and PARP
cleavage. Furthermore, no signs of cleavage of Bcl-2 by HIV-1 PR in
COS7 cells were seen under our experimental conditions. Discrepancies between our results and those published by Strack et al.
(48) probably reflect differences in the amount and timing of HIV-1PR expression. Overexpression of Bcl-2 can also protect cells from necrotic injury and thus should not be regarded as definitive proof of apoptosis.
Implications of HIV-1 PR Activity in Virus-induced
Cytopathogenicity--
A role for HIV-1 PR in virus-induced cell
killing was previously suggested by the observation that HIV-1
engineered to encode a constitutively activated HIV-1 PR-linked dimer
showed increased lytic potential on CD4+ cells and caused
defects in virus assembly and budding (49). Interestingly, activation
of HIV-1 PR in acutely, but not chronically, infected cells, appears to
be initiated at an intracellular compartment before virus budding (50).
These results emphasize the importance of the appropriate spatial and
temporal activation of HIV-1 PR in infected cells to ensure a
productive lytic infection. The results presented here may clarify some
features of the HIV-1 life cycle. Thus, activation of HIV-1 PR during
late stages of infection may lead to plasma membrane damage and cell
lysis. Altered plasma membrane homeostasis is a major cytopathic
feature observed in CD4+ cells infected with HIV-1 (51). This
modification could facilitate the release of newly assembled HIV-1
particles from infected cells, particularly virus particles that bud
intracellularly and are trapped into vacuoles. This notion is supported
by earlier observations showing that intracellular activation of HIV-1
PR is required for virus release to occur with maximum efficiency (52).
 |
ACKNOWLEDGEMENTS |
We thank J. Arroyo and J. Lewis for
stimulating discussion and critical reading of the manuscript. The
technical support of M. A. Sanz is also acknowledged.
 |
FOOTNOTES |
*
This work was supported in part by the Fondo de
Investigaciones Sanitarias, Project 01/0042-02 and the Comunidad
Autónoma de Madrid, Project 08.2/0024/2000 2. The CBM was
awarded an institutional grant by the Fundación Ramón
Areces.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Holds a fellowship from the Ministerio de Ciencia y
Tecnología.
To whom correspondence should be addressed. Tel.:
34-1-585-4560; Fax: 34-1-585-4506; E-mail: iventoso@cnb.uam.es.
Published, JBC Papers in Press, October 4, 2002, DOI 10.1074/jbc.M205636200
 |
ABBREVIATIONS |
The abbreviations used are:
HIV-1, human
immunodeficiency virus, type 1;
HIV-1 PR, HIV protease;
PARP, poly(ADP-ribose) polymerase;
PI, propidium iodide;
FACS, fluorescence-activated cell sorting;
LDH, lactate dehydrogenase;
h.p.i., hours post induction;
h.p.t., hours post transfection.
 |
REFERENCES |
| 1.
|
Fauci, S. A.
(1993)
Science
262,
1011-1018[Abstract/Free Full Text]
|
| 2.
|
McCune, J. M.
(2001)
Nature
410,
974-979[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Ho, D. D.,
Neumann, A. U.,
Pelerson, A. S.,
Chen, W.,
Leonard, J. M.,
and Markowitz, M.
(1995)
Nature
373,
123-126[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Levy, J. A.
(1993)
Microbiol. Rev.
57,
183-289[Abstract/Free Full Text]
|
| 5.
|
Voss, T. G.,
Fermin, C. D.,
Levy, J. A.,
Vigh, S.,
Choi, B.,
and Garry, R. F.
(1996)
J. Virol.
70,
5447-5454[Abstract/Free Full Text]
|
| 6.
|
Plymale, D. R.,
Tang, D. S. N.,
Comardelle, A. M.,
Fermin, C. D.,
Lewis, D. E.,
and Garry, R. F.
(1999)
AIDS
13,
1827-1839[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Meyaard, L.,
Otto, A. A.,
Jonker, R. R.,
Mijnster, M. J.,
Keet, R. P. M.,
and Miedema, F.
(1992)
Science
257,
217-219[Abstract/Free Full Text]
|
| 8.
|
Terai, C.,
Kornbluth, R.,
Pauza, C. D.,
Richman, D. D.,
and Carson, D. A.
(1991)
J. Clin. Invest.
87,
1710-1715[Medline]
[Order article via Infotrieve]
|
| 9.
|
Fisher, A. G.,
Ratner, M.,
Mitsuya, H.,
Marselle, L. M.,
Harper, M. E.,
Broder, S.,
Gallo, R. C.,
and Wong-Staal, F.
(1986)
Science
233,
655-659[Abstract/Free Full Text]
|
| 10.
|
Sodroski, J.,
Gogh, W. C.,
Rosen, C. A.,
Campbell, K. A.,
and Haseltine, W. A.
(1986)
Nature
322,
3105-3111
|
| 11.
|
Cao, J.,
Park, I. W.,
Cooper, A.,
and Sodroski, J.
(1996)
J. Virol.
70,
1340-1354[Abstract]
|
| 12.
|
LaBonte, J.,
Patel, T.,
Hofmann, W.,
and Sodroski, J.
(2000)
J. Virol.
74,
10690-10698[Abstract/Free Full Text]
|
| 13.
|
Ayyavoo, V.,
Mahboubi, A.,
Mahalingam, S.,
Ramalingam, R.,
Kudchodkar, S.,
Willians, W. V.,
Green, D. R.,
and Weiner, D.
(1997)
Nat. Med.
3,
1117-1123[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
García, J. V.,
and Miller, A. D.
(1991)
Nature
350,
508-511[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Li, C. J.,
Friedman, D. J.,
Wang, C.,
Metelev, V.,
and Pardee, A. B.
(1995)
Science
268,
429-431[Abstract/Free Full Text]
|
| 16.
|
Baum, E. Z.,
Bebernitz, G. A.,
and Gluzman, Y.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
5573-5577[Abstract/Free Full Text]
|
| 17.
|
Strack, P. R.,
West Frey, M.,
Rizzo, C. J.,
Cordova, B.,
George, H. J.,
Meade, R.,
Peng Ho, S.,
Corman, J.,
Tritch, R.,
and Korant, B. D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9571-9576[Abstract/Free Full Text]
|
| 18.
|
Oroszlan, S.,
and Luftig, R. B.
(1990)
Curr. Top. Microbiol. Immunol.
157,
153-185[Medline]
[Order article via Infotrieve]
|
| 19.
|
Schneider, J.,
and Kent, S. B.
(1988)
Cell
54,
363-368[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Vogt, V. M.
(1996)
Curr. Top. Microbiol. Immunol.
214,
95-131[Medline]
[Order article via Infotrieve]
|
| 21.
|
Kohl, N. E.,
Emini, E. A.,
Schleif, W. A.,
Davis, L. J.,
Heimbach, J. C.,
Dixon, R. A.,
Scolnick, E. M.,
and Sigal, I. S.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
4686-4690[Abstract/Free Full Text]
|
| 22.
|
Riviere, Y.,
Blank, P.,
Kourilsky, P.,
and Israel, I.
(1991)
Nature (Lond.)
350,
625-626[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Shoeman, R. L.,
Hüttermann, C.,
Harting, R.,
and Traub, P.
(2001)
Mol. Biol. Cell
12,
143-154[Abstract/Free Full Text]
|
| 24.
|
Wallin, M.,
Deinum, J.,
Goobar, L.,
and Danielson, H.
(1990)
J. Gen. Virol.
71,
1985-1991[Abstract/Free Full Text]
|
| 25.
|
Shoeman, R. L.,
Höner, B.,
Stoller, T. J.,
Kesselmeier, C.,
Miedel, M. C.,
Traub, P.,
and Graves, M. C.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
6336-6340[Abstract/Free Full Text]
|
| 26.
|
Tomasselli, A. G.,
Hui, J. O.,
Adams, L.,
Chosay, J.,
Lowery, D.,
Greenl, B.,
Yem, A.,
Deibel, M. R.,
Zürcher-Neely, H.,
and Heinrikson, R. L.
(1991)
J. Biol. Chem.
266,
14548-14553[Abstract/Free Full Text]
|
| 27.
|
Konvalinka, J.,
Litterst, M. A.,
Welker, R.,
Kottler, H.,
Rippmann, F.,
Heuser, A. M.,
and Kräusslich, H. G.
(1995)
J. Virol.
69,
7180-7186[Abstract]
|
| 28.
|
Bonnet, D.,
and Spahr, P. F.
(1990)
J. Virol.
64,
5628-5632[Abstract/Free Full Text]
|
| 29.
|
Barco, A.,
and Carrasco, L.
(1995)
FEBS Lett.
371,
4-8[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Macreadi, I. G.,
Castelli, L. A.,
Hewish, D. R.,
Kirkpatrick, A.,
Ward, A. C.,
and Azard, A. A.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
74,
4835-4838
|
| 31.
|
Sambrook, K. J.,
Fritsch, E. R.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 32.
|
Baldani, C.,
and Cesareni, G.
(1985)
Gene (Amst.)
35,
27-32[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Aldabe, R.,
Barco, A.,
and Carrasco, L.
(1996)
J. Biol. Chem.
271,
23134-23137[Abstract/Free Full Text]
|
| 34.
|
Barco, A.,
and Carrasco, L.
(1995)
Gene (Amst.)
156,
19-25[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Ventoso, I.,
Blanco, R.,
Perales, C.,
and Carrasco, L.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
12966-12971[Abstract/Free Full Text]
|
| 36.
|
Yaffe, M. P.,
and Schatz, G.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
4819-4823[Abstract/Free Full Text]
|
| 37.
|
Fuerst, T. R.,
Earl, P. L.,
and Moss, B.
(1997)
Mol. Cel. Biol.
7,
2538-2544
|
| 38.
|
Wright, R.,
Basson, M.,
D'Ari, L.,
and Rine, J.
(1988)
J. Cell Biol.
107,
101-114[Abstract/Free Full Text]
|
| 39.
|
Barco, A.,
and Carrasco, L.
(1995)
EMBO J.
14,
3349-3364[Medline]
[Order article via Infotrieve]
|
| 40.
|
De la Fuente, J. M.,
Alvarez, A.,
Nombela, C.,
and Sánchez, M.
(1992)
Yeast
8,
39-45[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Andrews, P. D.,
and Stark, M. J. R.
(2000)
J. Cell Sci.
113,
507-520[Abstract]
|
| 42.
|
Barco, A.,
Feduchi, E.,
and Carrasco, L.
(2000)
Virology
266,
352-360[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Jaks, T.,
Power, M. D.,
Masiarz, F. R.,
Luciw, P. A.,
Barr, P. J.,
and Varmus, H. E.
(1989)
Nature
331,
280-283
|
| 44.
|
Gu, J.,
Emerman, M.,
and Sandmeyer, S.
(1997)
Mol. Cell Biol.
17,
4033-4042[Abstract]
|
| 45.
|
Cid, V. J.,
Durán, A.,
del Rey, F.,
Snyder, M. P.,
Nombela, C.,
and Sanchez, M.
(1995)
Microbiol. Rev.
59,
345-386[Abstract/Free Full Text]
|
| 46.
|
Takeo, K.,
Yamamura, M.,
and Kamihara, T.
(1989)
FEMS Microbiol. Lett.
61,
297-300
|
| 47.
|
Kolesnitchenko, V.,
King, L.,
Riva, A.,
Tani, Y.,
Korsmeyer, S. J.,
and Cohen, D. I.
(1997)
J. Virol.
71,
9753-9763[Abstract]
|
| 48.
|
Shimizu, S.,
Eguchi, Y.,
Kamiike, W.,
Waguri, S.,
Uchiyama, Y.,
Matsuda, H.,
and Tsujimoto, Y.
(1996)
Oncogene
12,
2045-2050[Medline]
[Order article via Infotrieve]
|
| 49.
|
Kräusslich, H. G.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3213-3217[Abstract/Free Full Text]
|
| 50.
|
Kaplan, A. H.,
and Swanstrom, R.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
4528-4532[Abstract/Free Full Text]
|
| 51.
|
Cloyd, M. W.,
and Lynn, W. S.
(1991)
Virology
181,
500-511[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Kaplan, A. H.,
Manchester, M.,
and Swanstrom, R.
(1994)
J. Virol.
68,
6782-6786[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Z. Nie, G. D. Bren, S. R. Vlahakis, A. A. Schimnich, J. M. Brenchley, S. A. Trushin, S. Warren, D. J. Schnepple, C. M. Kovacs, M. R. Loutfy, et al.
Human Immunodeficiency Virus Type 1 Protease Cleaves Procaspase 8 In Vivo
J. Virol.,
July 1, 2007;
81(13):
6947 - 6956.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Desfarges, J. San Filippo, M. Fournier, C. Calmels, A. Caumont-Sarcos, S. Litvak, P. Sung, and V. Parissi
Chromosomal integration of LTR-flanked DNA in yeast expressing HIV-1 integrase: down regulation by RAD51
Nucleic Acids Res.,
December 4, 2006;
34(21):
6215 - 6224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. O'Loughlin, W. M. Patrick, and I. Matsumura
Natural history as a predictor of protein evolvability
Protein Eng. Des. Sel.,
October 1, 2006;
19(10):
439 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Abdel-Latif, B. K. Murray, R. L. Renberg, K. L. O'Neill, H. Porter, J. B. Jensen, and F. B. Johnson
Cell death in bovine parvovirus-infected embryonic bovine tracheal cells is mediated by necrosis rather than apoptosis
J. Gen. Virol.,
September 1, 2006;
87(9):
2539 - 2548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. L. O'Loughlin, D. N. Greene, and I. Matsumura
Diversification and Specialization of HIV Protease Function During In Vitro Evolution
Mol. Biol. Evol.,
April 1, 2006;
23(4):
764 - 772.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|