|
Originally published In Press as doi:10.1074/jbc.M206006200 on November 5, 2002
J. Biol. Chem., Vol. 278, Issue 2, 1380-1387, January 10, 2003
Transcriptional Activation of the Proglucagon Gene by Lithium and
-Catenin in Intestinal Endocrine L Cells*
Zuyao
Ni ,
Younes
Anini§¶,
Xianjun
Fang ,
Gordon
Mills ,
Patricia L
Brubaker§** , and
Tianru
Jin **§§¶¶
From the Division of Cell & Molecular Biology,
Toronto General Research Institute, University Health Network, Toronto,
Ontario M5G 2M1, Canada, the Departments of § Physiology,
** Medicine, §§ Laboratory Medicine
and Pathobiology, and the ¶¶ Institute of Medical Science,
University of Toronto, Toronto, Ontario M5S 1A8, Canada, and the
Department of Molecular Therapeutics, The University of Texas
M. D. Anderson Cancer Center, Houston, Texas 77030
Received for publication, June 29, 2002, and in revised form, October 28, 2002
 |
ABSTRACT |
The proglucagon gene encodes several peptide
hormones that regulate blood glucose homeostasis, growth of the small
intestine, and satiety. Among them, glucagon-like peptide 1 (GLP-1)
lowers blood glucose levels in patients with diabetes and inhibits
eating and drinking in fasted rats. Although proglucagon transcription and GLP-1 synthesis were shown to be activated by forskolin and other
protein kinase A (PKA) activators, deleting or mutating the
cAMP-response element (CRE) only moderately attenuates the proglucagon
gene promoter in response to PKA activation. Therefore, PKA may
activate proglucagon transcription via a mechanism independent of the
CRE motif. Recently, PKA was shown to phosphorylate and inactivate
GSK-3 , a key mediator in the Wnt signaling pathway. We show here
that lithium, an inhibitor of GSK-3 , activates proglucagon gene
transcription and stimulates GLP-1 synthesis in an intestinal endocrine
L cell line, GLUTag. The activation was also observed in primary fetal
rat intestinal cell (FRIC) cultures, but not in a pancreatic A cell
line. Co-transfection of -catenin, a downstream effector of
GSK-3 activities, activated the proglucagon gene promoter without a
CRE. Furthermore, forskolin and 8-Br-cAMP phosphorylated GSK-3 at
serine 9 in intestinal proglucagon-producing cells, and both lithium
and forskolin induced the accumulation of free -catenin in these
cell lines. These observations indicate that the proglucagon gene is
among the targets of the Wnt signaling pathway.
 |
INTRODUCTION |
The gene encoding proglucagon is expressed in pancreatic A cells
and enteroendocrine L cells as well as selective neurons of the central
nervous system (1). A single proglucagon mRNA transcript, derived
from a common transcription start site, is identical in all the three
tissues. Cell type-specific posttranslational processing, however,
gives rise to a different profile of proglucagon-derived peptides in
each tissue (1, 2). Glucagon is produced in the pancreatic A cells.
Glucagon-like peptide 1 (GLP-1)1 and glucagon-like
peptide 2 (GLP-2), however, are produced in the endocrine L cells and
in selected endocrine neurons in the brain (1, 2). GLP-1 is known as an
insulinotropic hormone. It possesses potent effects to stimulate
glucose-dependent insulin secretion, insulin gene
expression, and B cell cAMP formation. Other effects of GLP-1 include
inhibition of glucagon release and gastric emptying and, possibly,
enhancement of peripheral insulin sensitivity (1, 2). In addition,
intracerebroventricular administration of GLP-1 was found to
powerfully inhibit eating and drinking and alter body weight in fasted
rats (3, 4). Furthermore, a recent study shows that peripheral GLP-1
also plays a role in regulating macronutrient selection and food intake
(5). GLP-2 was initially identified as a growth factor for the small intestine (6). Recent observations indicate that GLP-2 and its receptor
also possess an overlapping function with GLP-1 in regulating gastric
emptying and controlling satiety (7, 8).
Numerous studies conducted in the past 15 years have identified more
than a dozen transcription factors and signaling molecules that play
roles in driving proglucagon gene expression (9-31). However, none of
the identified transcription factors or signaling molecules has been
found to be tissue type- or cell type-specific.
Protein kinase A (PKA) is able to stimulate proglucagon gene
transcription and glucagon or GLP-1 synthesis in both primary and
transformed intestinal endocrine cells as well as in rat primary pancreatic islet cultures (11-14, 17). However, deleting or mutating the cAMP-response element (CRE) in the proglucagon gene promoter only
partially attenuates its response to PKA activation in the small
intestinal proglucagon-producing cell line STC-1 (13, 17). This
indicates that PKA may up-regulate proglucagon gene expression via a
yet to be identified signaling pathway. Recently, PKA was found to
phosphorylate and inactivate the serine/threonine kinase glycogen
synthase kinase 3 (GSK-3 ) in several cell lineages (32, 33).
These observations prompted us to ask whether this newly identified
function of PKA is engaged in proglucagon gene transcription. GSK-3
is a major mediator of the Wnt signaling pathway (34-36). In normal
epithelial cells, adenomatous polyposis coli together with GSK-3
and Axin bind to and phosphorylate -catenin ( -cat), targeting
-cat for proteasomal mediated degradation. In embryonic cells, Wnt
signals inactivate GSK-3 , resulting in free -cat accumulation.
Free -cat then forms a bipartite transcription factor with a T cell
factor (TCF)/lymphoid enhancer factor (LEF), namely cat/TCF, activating
the Wnt responsive or cat/TCF target genes (36). Another notable
inhibitor of GSK-3 is lithium, which mimics the function of the Wnt
signals in embryonic cells (37, 38).
In this study, using cultivated intestinal endocrine cell lines as well
as primary intestinal cells in culture, we examined whether Wnt
signaling pathway/molecules mediate the effect of PKA in activating
proglucagon gene transcription and GLP-1 synthesis.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Tissue culture medium and serum and
oligonucleotides were purchased from Invitrogen. Radioisotopes
were obtained from Amersham Biosciences. Forskolin,
3-isobutyl-1-methylxanthine (IBMX), 8-Br-cAMP, and 8-Br-cGMP were
purchased from Sigma.
Plasmids--
Construction of the wild type and mutant rat
proglucagon/luciferase (LUC) reporter gene plasmids have been described
previously (15, 17, 39). -cat expression plasmids were provided by Dr. Eric Fearon (40). The TCF-TK-LUC reporter gene construct (TOPFLASH)
was provided by Dr. Burt Vogelstein (41). The G2-TK-LUC fusion
gene was generated by inserting one copy of the rat proglucagon gene G2 enhancer-like element (9) into the TK-LUC plasmid. The DNA
sequence for the top strain of G2 is
AGGCACAAGAGTAAATAAAAAGTTTCCGGGCCTCTG (9). It contains a
potential binding site (AAGTTTC) for the bipartite transcription factor
cat/TCF (35).
Cell Culture, Transfection, and LUC Reporter Gene
Analysis--
The intestinal GLUTag, STC-1, and the pancreatic InR1-G9
cell lines were grown and maintained in Dulbecco's modified Eagle's medium supplemented with appropriate serum (39). To examine the effects
of lithium and forskolin on proglucagon mRNA expression, GLP-1
synthesis, and secretion, cells were grown in the medium containing the
appropriate serum overnight. 6 h prior to the experiment, serum-containing medium was withdrawn, and serum-free medium was added.
For the LUC reporter gene analysis, the intestinal endocrine cell lines
GLUTag and STC-1 were transfected using LipofectAMINE (Invitrogen) per the manufacturer's instructions, whereas the InR1-G9
cell line was transfected by a method of calcium precipitation (42).
Fetal rat intestinal cell (FRIC) cultures were prepared using 19-21
days-of-gestation fetal Wistar rats (Charles River Canada, Saint
Constant, Quebec, Canada), as described in detail previously (11, 31).
In FRIC cultures, the endocrine L cells account for ~1% of the cell numbers.
RNA Extraction and Northern Blot Analysis--
The methods used
for RNA extraction and Northern blot analysis were described previously
(39).
Cell Fractionation and Immunoblotting--
The anti -catenin
antibody was purchased from BD Biosciences, and the
anti-phospho-GSK-3 and -3 antibodies were from New England
Biolabs (32). Cytoplasmic and membrane fractions were prepared based
the protocol by Shimizu et al. (43). The methods used for
immunoblotting and for examining the PKA phosphorylation of GSK-3 were
described previously (32).
Radioimmunoassay (RIA) for GLP-1--
As described previously
(14, 31), peptides from the media were extracted by adding 1% (v/v)
trifluoroacetic acid followed by passage twice through a cartridge of
C18 silica (C18 SepPak, Waters Corp., Milford, MA). Peptides contained
in the cells were extracted by homogenization in 1 N HCl
containing 5% HCOOH, 1% trifluoroacetic acid, and 1% NaCl, followed
by passage through a C18 SepPak. An RIA for immunoreactive GLP-1 was
carried out using an antiserum directed toward the C-terminal end of
GLP-17-36NH2 (Affinity Research Products Ltd.,
Mamhead, UK), which has previously been demonstrated to detect
predominantly GLP-17-36NH2 in GLUTag and FRIC cells
(14, 44).
 |
RESULTS |
Lithium Activates Proglucagon mRNA Expression--
Lithium is
a notable inhibitor of GSK-3 . We hypothesized that if PKA activates
proglucagon gene transcription via inactivating GSK-3 , lithium may
also activate proglucagon mRNA expression. We examined this
hypothesis in the mouse large intestinal GLUTag (13, 45-47) and the
mouse small intestinal STC-1 (14) cell lines, as well as in the primary
(FRIC) rat intestinal cultures. After incubation with 10 mM
LiCl (48) for 4 h, both cell lines demonstrated ~3-fold
increased proglucagon mRNA expression (Fig. 1). In the GLUTag cells, the activation
was still observable after 12 h (3.9-fold). After a 24-hour
incubation in two experiments, we still observed an enhanced
proglucagon mRNA expression. Results from one experiment are
presented in Fig. 1A. In two other experiments, however,
proglucagon mRNA expression returned to untreated levels by 24 h (data not shown). In the STC-1 cell line, activated proglucagon gene
expression was substantial during the whole experimental procedure
(Fig. 1B). Fig. 1A also shows that proglucagon
mRNA expression in the GLUTag cells is activated by the PKA
activators forskolin and IBMX as we demonstrated previously (14).
Similarly, an 8-h treatment of FRIC cultures with 10 mM
LiCl enhanced proglucagon mRNA expression >3-fold (Fig.
1C).

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
LiCl activates endogenous proglucagon
mRNA expression. GLUTag (A) and STC-1
(B) cell lines and FRIC cultures (C) were treated
with control media or media with 10 µM forskolin plus 10 µM IBMX, 10 mM LiCl, or 10 mM KCl
for the indicated periods of time. Total RNA was extracted for Northern
blot analyses using cDNA probes for rat proglucagon
(Glu) or tubulin (T). 10 µg of RNA was loaded
for each sample. For the cultivated cell lines, the membrane was
exposed to x-ray film 8-12 h. For the FRIC cultures, the membrane was
exposed for 8 days. After the densitometric analyses, the effects of
each chemical on proglucagon expression were calculated as the -fold
change versus the untreated cells normalized against
the tubulin mRNA.
|
|
Lithium Activates the Rat Proglucagon Gene Promoter--
The
effect of lithium on proglucagon mRNA levels could be a result of
enhanced transcription or reduced degradation or both. We therefore
examined whether lithium activates the proglucagon gene promoter. Fig.
2A shows that, after being
transfected into the GLUTag cells, the expression of the 1.1-kb and
the 472-bp promoter constructs was activated ~5-fold by forskolin.
The evolutionarily conserved CRE is located between 291 and 298 bp
(9). When the wild type 302-bp promoter was examined, ~6-fold
activation by forskolin was observed. However, even with the
CRE-mutated [ 302(M)] or deleted ( 290) reporter gene constructs,
forskolin still generated ~3-3.5-fold activation. This is consistent
with previous studies on the STC-1 cell line (13, 17). LiCl treatment also activated all the five promoter constructs examined by 2-3-fold, including those that carry a mutated [ 302(M)] or deleted ( 290) CRE. Lithium was also found to activate the proglucagon gene promoter constructs when transfected into the STC-1 cell line (Fig.
2B). The stimulatory effect of LiCl on the proglucagon
promoter was found to be dose-dependent (Fig.
2B) and was observable within 4 to 12 h after the
treatment (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
LiCl activates the expression of the
proglucagon gene promoter. GLUTag (A) and STC-1
(B) cells were transfected with 3 µg of the indicated
Glu-LUC reporter gene by LipofectAMINE overnight in serum-free medium.
The cells were then grown in serum-containing medium for 4 h
before the addition of 10 mM LiCl or KCl, 10 µM forskolin plus 10 µM IBMX
(For), or 100% ethanol (vehicle for forskolin/IBMX). After
another 12-hour incubation, cells were harvested for LUC reporter gene
analysis. Relative LUC reporter gene activity was calculated as the
-fold increase with the activity in the untreated cells defined as
1-fold (mean ± S.E., n = 3).
|
|
To determine whether lithium also activates proglucagon gene expression
in the pancreatic A cells, we conducted the above analyses against the
hamster pancreatic A cell line InR1-G9. No appreciable activation on
either proglucagon gene promoter or endogenous proglucagon mRNA
expression was observed by LiCl treatment in this cell line (data not shown).
Lithium Stimulates GLP-1 Synthesis--
We next examined the
effect of lithium on GLP-1 synthesis and secretion in the GLUTag cell
line and FRIC cultures. We demonstrated previously that GLP-1 synthesis
and secretion in those cells could be activated by forskolin or other
PKA activators (11, 14, 44-47). Incubating the GLUTag cells with 10 mM LiCl for 4 h did not affect either the synthesis or
secretion of GLP-1 (data not shown). When the incubation time was
extended to 8 h, a 1.7-fold increase in the GLP-1 content of cell
was observed (p < 0.01, Fig.
3A). In the same period, no
change in GLP-1 secretion was observed as determined by an RIA of the
cell free medium (Fig. 3B). Similarly, FRIC cultures were
treated without or with 10 mM LiCl or 10 mM KCl
(as control) for 8 h or 24 h before the assessment of GLP-1
synthesis and secretion. Consistent with the stimulatory effect of LiCl
on the GLUTag cells, LiCl also increased GLP-1 synthesis in FRIC
cultures to 1.5-fold of the control (p < 0.05) after a
24 h incubation (Fig. 4). No
substantial effects of LiCl on GLP-1 synthesis were observed at 8 h or on GLP-1 secretion at either 8 or 24 h (Fig. 4).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
LiCl activates GLP-1 synthesis in GLUTag
cells. GLUTag cells were treated with control medium alone or with
10 mM LiCl for 8 h. Cell and medium peptides were
extracted and analyzed by RIA. The data show the total amount of GLP-1
in the well (A, medium plus cell; n = 6; **,
p < 0.01) and the amount of GLP-1 in the medium
(B, n = 6, not significant).
|
|

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
LiCl activates GLP-1 synthesis in FRIC
cultures. FRIC cultures were treated with control medium alone or
with 10 mM LiCl or KCl for 8 or 24 h. Cell and medium
peptides were extracted and analyzed by RIA for immunoreactive GLP-1
levels. The data show the total amount of GLP-1 in the well
(A, medium plus cell; n = 3; *,
p < 0.05) and the amount of GLP-1 in the medium
(B, n = 3, not significant).
|
|
 Cat Transfection Activates the Proglucagon Gene Promoter
without a Functional CRE--
Lithium inactivates GSK-3 and induces
free -cat accumulation in other cell lineages (48). If lithium
indeed stimulates proglucagon transcription via inactivation of
GSK-3 , overexpressing -cat should mimic the effect of lithium
treatment. A reporter gene construct, namely TOPFLASH, has been widely
utilized to examine the cat-TCF activity in colon cancer and other cell
lines (41, 48-50). In this plasmid, the expression of a LUC reporter
gene is driven by a minimum TK promoter fused with three copies of the
TCF binding site. As shown in Fig. 5,
this fusion gene is dose dependently activated by LiCl but not by KCl
when transfected into the GLUTag cells.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 5.
LiCl activates the TCF-TK fusion
promoter. GLUTag cells were transfected with 3 µg of the
TCF-TK-LUC reporter gene, as described in Fig. 3. Relative LUC activity
was calculated as the -fold increase with activity in untreated cells
defined as 1-fold (mean ± S.E., n = 3).
For, forskolin.
|
|
We then directly examined the effect of the wild type and the
constitutively active mutant -cat, S33Y, on the expression of the
proglucagon gene promoter. The S33Y mutant -cat is resistant to
degradation because it cannot be phosphorylated by GSK-3 (41). Co-transfection with the wild type -cat cDNA stimulated all of the proglucagon gene promoter constructs examined, except for the
1.1-kb promoter construct, by 1.7-2.0-fold (Fig.
6). Compared with the wild type -cat,
the S33Y mutant -cat activated all five constructs more effectively,
varying from 2.5- to 4-fold (Fig. 6). In addition, the S33Y mutant
-cat was able to activate the 1.1 kb proglucagon gene promoter
construct. The activation was also independent of the CRE motif on the
proglucagon gene promoter (Fig. 6).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 6.
Co-transfection with
-catenin activates the proglucagon gene
promoter. GLUTag cells were transfected with 3 µg of the
indicated proglucagon-LUC fusion gene construct along with 3 µg of
either empty vector (PcDNA3), wild type -cat
(wt), or the S33Y mutant -cat (m)
(constitutively active). Relative LUC reporter gene activity was
calculated as the -fold increase with activity in
PcDNA3- transfected cells defined as 1-fold (mean ± S.E.,
n = 3).
|
|
The consensus binding site for cat/TCF has been suggested to be WWGTTTC
(35). We localized several potential cat/TCF binding sites on the
proglucagon gene promoter. One such binding site is downstream of 290
bp and is a part of the G2 enhancer-like element (9). This site is
conserved among the proglucagon genes of humans and rodents (9, 22). We
inserted one copy of the G2 element in front of the TK promoter in the
TK-LUC fusion gene plasmid, and the new fusion gene was named G2-TK-LUC
(Fig. 7). LiCl was found to dose
dependently activate G2-TK-LUC by up to 3-fold when transfected into
the GLUTag (Fig. 7) and STC-1 (data not shown) cells. Furthermore,
G2-TK-LUC was activated by forskolin by ~5-fold (Fig. 7).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 7.
Both LiCl and forskolin activate the
G2-TK-LUC fusion gene. GLUTag cells were transfected with 3 µg
of G2-TK-LUC reporter gene as described in the Fig. 3
legend. Relative LUC reporter gene activity was calculated as the -fold
increase with the activity in untreated cells defined as 1-fold
(mean ± S.E., n = 3). For,
forskolin.
|
|
PKA Phosphorylates GSK-3 , and Both LiCl and PKA Activators
Induce Free -Cat Accumulation--
Recent studies have shown that
PKA phosphorylates and inactivates GSK-3 in the HEK293 and NIH 3T3
cell lines (32). In addition, PKA was also found to phosphorylate and
inactivate GSK-3 in neuronal cells, and GSK-3 inactivation is
linked to the inhibition of neuronal cell apoptosis (33). To further
examine our hypothesis that Wnt pathway mediates the activation of
proglucagon gene transcription by PKA, we examined GSK-3
phosphorylation and inactivation by PKA in the intestinal endocrine
cell lines. As shown in Fig. 8, treating
the GLUTag cells with forskolin or 8-Br-cAMP induced the
phosphorylation of GSK-3 at serine 21 and GSK-3 at serine 9. In
contrast, treating the GLUTag cells with 8-Br-cGMP did not change the
phosphorylation status of GSK-3 or GSK-3 (Fig. 8).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 8.
PKA phosphorylates GSK-3
and GSK-3 in the GLUTag cell line.
GLUTag cells were starved in serum-free medium for 12 h and
stimulated with 8-Br-cGMP or 8-Br-cAMP (2 mM, 30 min), or
forskolin/IMBX (10 µM each, 30 min). Cell lysates were
prepared and analyzed for GSK-3 phosphorylation at serine 21 and serine
9 by Western blotting using a GSK-3 and a GSK-3 phospho-specific
antibody, respectively (32).
|
|
We then asked whether lithium treatment or PKA activation would lead to
free -cat accumulation in the two intestinal proglucagon-producing cell lines. The amount of -cat in cell membrane and cell cytosol was
examined by Western blot analysis following a cellular fractionation procedure (43). In four separate experiments we observed free -cat
accumulation in response to either LiCl or forskolin treatment, with
activation levels varying from 2.5 to 10-fold. Data from one experiment
are shown in Fig. 9. In this experiment,
incubating the GLUTag cells with 10 mM LiCl for 2 h
led to an ~3-fold increase in cytosolic -cat, whereas the change
in -cat in the membrane portion was minimal. Similarly, treating the
GLUTag cells with forskolin for 2 h led to a 2.9-fold increase in
cytosolic -cat accumulation, whereas the change of -cat in the
membrane portion was minimal (Fig. 9A). We also found that
treatment of the GLUTag cells with 10 nM insulin for
12 h generated an appreciable effect on free -cat accumulation
(2.9-fold), whereas the effect at 2 or 4 h was minimal (Fig.
9A). Similar results regarding free -cat accumulation in
response to these three reagents were obtained in examining the STC-1
cell line (Fig. 9B).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 9.
Both LiCl and forskolin stimulate free
-cat accumulation in intestinal endocrine cell
lines. GLUTag (A) and STC-1 (B) cells were
grown in the absence or presence of 10 nM insulin
(Ins), 10 mM LiCl, or 10 µM
forskolin (For) plus 10 µM IBMX for the
indicated periods of time. Cytosolic and membrane -cat were examined
by Western blot analysis as described under "Experimental
Procedures." The same membranes were stripped followed by
hybridization with an anti- -actin antibody (loading control). After
the densitometric analyses of the photograms, the effect of each
chemical on -cat appearance in both cytosol and membrane fractions
were calculated as the -fold change versus the untreated
cells normalized against -actin.
|
|
 |
DISCUSSION |
In mammals, a single proglucagon gene encodes three major peptide
hormones expressed in three different tissues (1). These hormones play
critical roles in blood glucose homeostasis, the growth of small
intestines, and satiety (1-8). Uniquely, different hormones encoded by
the same proglucagon gene may possess opposite roles, such as glucagon
versus GLP-1 in blood glucose homeostasis, or overlapping
roles, such as GLP-1 and GLP-2 in mediating satiety (7, 8). Therefore,
it is desirable and interesting to explore the molecular mechanisms
that underlie proglucagon gene transcription and the biosynthesis of
each individual hormone in a cell-specific manner. Although previous
studies have identified numerous transcription factors and signals that
may up- or down-regulate proglucagon gene transcription, none of the
identified factors specifically regulate proglucagon transcription in
pancreatic A cells only or in intestinal endocrine cells only (9-26,
51-53). Our observations indicated that lithium (as an
inhibitory agent of GSK-3 ) and cat/TCF selectively up-regulates
proglucagon gene transcription and GLP-1 synthesis in the endocrine
cells of the gut but not in a pancreatic A cell line. It will be
interesting to explore the molecular mechanisms underlying this cell
type-specific transactivation event.
A typical CRE element is located on both human and rat proglucagon gene
promoters (9, 17, 22). Previous studies in the mouse small intestinal
STC-1 cell line have shown that deleting or mutating this CRE motif
generates only partial attenuation in response to PKA activation (13,
17). We show here that this is also true for the GLUTag cell line.
These observations further support our proposal that PKA stimulates
proglucagon gene transcription not only via phosphorylation of the
CRE-binding proteins (CREB) but also through pathways that cross-talk
with PKA.
The cross-talk between the Wnt signaling pathway and PKA or G
protein-coupled receptors has been realized very recently. Meigs et al. (54) have shown that constitutively activated
G 12 and G 13 interact with E-cadherin to
cause the release of -cat and the subsequent stimulation of
cat/TCF-mediated transcription. The chimeric receptor of the ligand
binding and transmembrane domains of the 2 adrenergic receptor and
the cytoplasmic domains of Frizzled-1 can also stimulate the cat/TCF
transcriptional activation through a mechanism that appears to involve
signaling through G q and/or G o (55).
Similarly, Fujino et al. (56) reported the phosphorylation
of GSK-3 and stimulated TCF-mediated transcription by prostaglandin
E2 through the EP2 or EP4 receptor, likely via PKA and
phosphatidylinositol 3-kinase, respectively. Furthermore, treating
fibroblasts and neuronal cells with forskolin or 8-Br-cAMP may lead to
enhanced phosphorylation and inactivation of GSK-3 (32, 33). Very
recently, Yusta et al. (57) reported that GLP-2 inhibits
cell apoptosis via its G protein-coupled receptor in association with
PKA-dependent inactivation of GSK-3 . Here we extend
these observations into the intestinal proglucagon-producing cell (Fig.
8). This, in combination with our observation that both lithium and
forskolin activated the G2-TK fusion promoter (Fig. 7), supports our
notion that PKA activates proglucagon gene transcription via cross-talk
with the Wnt pathway. Previous studies have implicated G2 in regulating
proglucagon gene expression via binding with members of the Foxa
transcription factor family (20, 51-53). In addition, by examining the
effect of membrane depolarization on proglucagon gene expression in
pancreatic A cell lines, Furstenau et al. (23) identified a
calcium-response element within this enhancer-like element (23).
Further studies are needed to examine the binding of cat/TCF to G2 and
determine how G2 is implicated in specifying cell type-specific
regulation of proglucagon gene transcription in response to lithium and
other signaling molecules.
Although phosphorylation and inactivation of GSK-3 by PKA, PKB/Akt,
and PKC have been demonstrated in several cell lineages (32, 33,
57-62), whether this inactivation leads to free -cat accumulation
has not been previously reported. Ding et al. (58) have
shown that a 2-hour insulin treatment, possibly through PKB activation,
leads to phosphorylation of GSK-3 at serine 9 and inactivation of
GSK-3 enzymatic activity in a number of epithelial cell lines.
However, free -cat levels were not altered in their study. In
contrast, both Wnt and lithium induced free -cat accumulation but
did not affect the phosphorylation status of GSK-3 (58). Based on
these observations, Ding et al. (58) hypothesized that insulin and the Wnt signals regulate GSK-3 through different mechanisms and therefore lead to a distinct downstream event and that
the phosphorylation of GSK-3 at serine 9 may not be sufficient to
induce free -cat accumulation. In our study, we also found that
treating the intestinal endocrine cell lines with 10 nM
insulin for 2 h generated no effect on free -cat accumulation.
However, the effect began to be observable after 4 h and was
enhanced after 12 h (Fig. 9). More importantly, we demonstrated
that, in the intestinal proglucagon producing cells, forskolin
treatment led to enhanced free -cat accumulation within 2 h. We
speculate that, in these particular endocrine cell lines,
phosphorylation of GSK-3 at serine 9 by PKA may be sufficient to
inactivate its ability to facilitate -cat degradation. However, at
this stage, we cannot eliminate the possibility that phosphorylation of
GSK-3 by PKA and the accumulation of free -cat in response to PKA
are two independent events. Nevertheless, our results clearly indicate that PKA activates proglucagon gene transcription in the endocrine L
cells at least in part through accumulation of free -cat. A model
illustrating our current understanding of the mechanisms underlying
proglucagon gene activation by PKA and lithium is shown in Fig.
10.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 10.
A diagram showing mechanisms for the
regulation of proglucagon gene transcription by lithium and PKA.
Lithium is able to inactivate GSK-3 and therefore induce the
accumulation of free -catenin, which will form a complex with a
given TCF. The bipartite transcription factor cat-TCF then stimulates
proglucagon mRNA transcription, possibly through interacting with
the G2 enhancer like element (9, 23). PKA is able to activate
proglucagon gene transcription via the evolutionarily conserved CRE
element on the proglucagon gene promoters (9, 11-14, 17). In addition,
PKA may also activate proglucagon gene transcription by inactivating
the GSK-3 and inducing the accumulation of free -catenin. It is
recognized however, that GSK-3 inactivation and free -cat
accumulation in response to PKA could be two separate events.
Glu, proglucagon gene. A dotted line
shows the CRE pathway documented previously (11-14, 17).
|
|
Our results also provide a potential molecular mechanism for the
similar effect of lithium and GLP-1 to suppress food and water intake
(3, 4, 63-70). Scientists have observed for a number of years that
peripheral administration of lithium in rats causes a spectrum of
effects, including reduced food/water intake, decreased salt ingestion
after sodium depletion, and induced robust conditioned taste aversions
(63-69). These effects can be mimicked by central
(intracerebroventricular) administration of GLP-1 (3). More
importantly, the effects provoked by lithium can be blocked by
pre-treating the animals with GLP-1 receptor antagonists (67, 68).
Taken together, it is reasonable to speculate that lithium mediates
satiety, at least in part, through up-regulation of the brain GLP-1
pathway. Unfortunately, there is currently no brain
proglucagon-producing cell line to examine this hypothesis. It will
therefore be necessary to develop other methodologies to examine
whether brain proglucagon mRNA transcription and GLP-1 synthesis
are modulated by lithium and other signaling molecules in the Wnt
signaling pathway.
We have reported previously that PKA activators regulate both the
synthesis and secretion of GLP-1 (11-14). Other molecules, such as PKC
activators, may stimulate GLP-1 secretion but not its synthesis (14).
In this study, although we obtained evidence that lithium significantly
enhanced GLP-1 synthesis, it had no significant effect on GLP-1
secretion. One may speculate that in the in vivo setting,
Wnt signaling molecules may cross-talk with other pathways that are
implicated in GLP-1 secretion. Alternatively, lithium may
simultaneously activate both the Wnt signaling pathway for GLP-1
synthesis and an as yet to be determined pathway that is engaged in
stimulating GLP-1 secretion. Furthermore, lithium may alter the
response of the intestinal L cells to known secretagogues, including
nutrients, as well as several neuro/endocrine gut hormones (31). We
have recently observed a similar synergistic effect of fatty acids on
glucose-dependent insulinotropic peptide (71) and of leptin
on gastrin-releasing peptide-stimulated GLP-1 secretion (72). These
hypotheses deserve further examination in vivo.
In summary, this study indicated that proglucagon is among the
downstream target genes of cat-TCF or the Wnt signaling pathway. Our
results provide a novel mechanism by which PKA up-regulates proglucagon
gene transcription in the intestinal endocrine L cells and a potential
explanation as to how lithium controls food/water intake. Additional
studies are required to examine proglucagon gene transcription and
GLP-1 synthesis in the brain in response to lithium and other Wnt
signaling molecules.
 |
ACKNOWLEDGEMENTS |
We thank Dr. James Woodgett and Dr. George
Fantus for providing valuable advice in conducting this study, Dr. Eric
Fearon for providing the wild type and S33Y mutant -catenin
cDNAs, and Drs. Donald Branch, Mingyao Liu, and Jim Hu for critical
reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by Canadian Institutes of
Health Research (CIHR) Grant MOP36398 (to T. J.) and grants from the
Canadian Diabetes Association (CDA) (to P. L. B. and T. J.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Supported by a Canadian Diabetes Association postdoctoral
fellowship (in the name of Margaret Francis).

Supported by the Canada Research Chair Program.

To whom correspondence should be addressed: Rm. 421, 67 College St., Toronto General Research Inst., University Health Network, Toronto, Ontario M5G 2M1, Canada. Tel.: 416-340-4800 (ext. 4768); Fax:
416-340-3453; E-mail: tianru.jin@utoronto.ca.
Published, JBC Papers in Press, November 5, 2002, DOI 10.1074/jbc.M206006200
 |
ABBREVIATIONS |
The abbreviations used are:
GLP-1, glucagon like
peptide 1;
CRE, cAMP-response element;
-cat, -catenin;
TCF, T
cell factor;
cat-TCF, the bipartite transcription factor containing
-catenin and a TCF;
FRIC, fetal rat intestinal cells;
GSK-3 , glycogen synthase kinase 3 ;
IBMX, 3-isobutyl-1-methylxanthine;
LUC, luciferase;
PKA, protein kinase A;
TK, thymidine kinase;
RIA, radioimmunoassay.
 |
REFERENCES |
| 1.
|
Kieffer, T. J.,
and Habener, J. F.
(1999)
Endocr. Rev.
20,
876-913[Abstract/Free Full Text]
|
| 2.
|
Drucker, D. J.
(2002)
Gastroenterology
122,
531-544[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Turton, M. D.,
O'Shea, D.,
Gunn, I.,
Beak, S. A.,
Edwards, C. M.,
Meeran, K.,
Choi, S. J.,
Taylor, G. M.,
Heath, M. M.,
Lambert, P. D.,
Wilding, J. P. H.,
Smith, D. M.,
Ghatei, M. A.,
Herbert, J.,
and Bloom, S. R.
(1996)
Nature
379,
69-72[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Meeran, K.,
O'Shea, D.,
Edwards, C. M.,
Turton, M. D.,
Heath, M. M.,
Gunn, I.,
Abusnana, S.,
Rossi, M.,
Smal, C. J.,
Goldstone, A. P.,
Taylor, G. M.,
Sunter, D.,
Steere, J.,
Choi, S. J.,
Ghatei, M. A.,
and Bloom, S. R.
(1999)
Endocrinology
140,
244-250[Abstract/Free Full Text]
|
| 5.
|
Peters, C. T.,
Choi, Y. H.,
Brubaker, P. L.,
and Anderson, G. H.
(2001)
J. Nutr.
131,
2164-2170[Abstract/Free Full Text]
|
| 6.
|
Drucker, D. J.,
Erlich, P.,
Asa, S. L.,
and Brubaker, P. L.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7911-7916[Abstract/Free Full Text]
|
| 7.
|
Lovshin, J.,
Estall, J.,
Yusta, B.,
Brown, T. J.,
and Drucker, D. J.
(2001)
J. Biol. Chem.
276,
21489-21499[Abstract/Free Full Text]
|
| 8.
|
Wojdemann, M.,
Wettergren, A.,
Hartmann, B.,
and Holst, J. J.
(1998)
Scand. J. Gastroenterol.
33,
828-832[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Philippe, J.,
Drucker, D. J,
Knepel, W.,
Jepeal, L.,
Misulovin, Z.,
and Habener, J. F.
(1988)
Mol. Cell. Biol.
8,
4877-4888[Abstract/Free Full Text]
|
| 10.
|
Drucker, D. J.,
and Asa, S.
(1988)
J. Biol. Chem.
263,
13475-13478[Abstract/Free Full Text]
|
| 11.
|
Drucker, D. J.,
and Brubaker, P. L.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
3953-3957[Abstract/Free Full Text]
|
| 12.
|
Drucker, D. J.,
Campos, R.,
Reynolds, R.,
Stobie, K.,
and Brubaker, P. L.
(1991)
Endocrinology.
128,
394-400[Abstract/Free Full Text]
|
| 13.
|
Gajic, D.,
and Drucker, D. J.
(1993)
Endocrinology
132,
1055-1062[Abstract/Free Full Text]
|
| 14.
|
Drucker, D. J.,
Jin, T.,
Asa, S.,
Young, T.,
and Brubaker, P.
(1994)
Mol. Endocrinol.
8,
1646-1655[Abstract/Free Full Text]
|
| 15.
|
Jin, T.,
and Drucker, D. J.
(1995)
Mol. Endocrinol.
9,
1306-1320[Abstract/Free Full Text]
|
| 16.
|
Wang, M.,
and Drucker, D. J.
(1995)
J. Biol. Chem.
270,
12646-12652[Abstract/Free Full Text]
|
| 17.
|
Lu, F.,
Jin, T.,
and Drucker, D. J.
(1996)
Endocrinology
137,
3710-3716[Abstract]
|
| 18.
|
Hussain, M, A.,
Lee, J.,
Miller, C. P.,
and Habener, J. F.
(1997)
Mol. Cell. Biol.
17,
7186-7194[Abstract]
|
| 19.
|
Cordier-Bussat, M.,
Bernard, C.,
Levenez, F.,
Klages, N.,
Laser-Ritz, B.,
Philippe, J.,
Chayvialle, J. A.,
and Cuber, J. C.
(1998)
Diabetes
47,
1038-1045[Abstract]
|
| 20.
|
Kaestner, K. H.,
Katz, J.,
Liu, Y.,
Drucker, D. J.,
and Schutz, G.
(1999)
Genes Dev.
13,
495-504[Abstract/Free Full Text]
|
| 21.
|
Beimesche, S.,
Neubauer, A.,
Herzig, S.,
Grzeskowiak, R.,
Diedrich, T.,
Cierny, I.,
Scholz, D.,
Alejel, T.,
and Knepel, W.
(1999)
Mol. Endocrinol.
13,
718-728[Abstract/Free Full Text]
|
| 22.
|
Nian, M.,
Drucker, D. J.,
and Irwin, D.
(1999)
Am. J. Physiol.
277,
G829-G837[Abstract/Free Full Text]
|
| 23.
|
Furstenau, U.,
Schwaninger, M.,
Blume, R.,
Jendrusch, E. M.,
and Knepel, W.
(1999)
J. Biol. Chem.
274,
5851-5860[Abstract/Free Full Text]
|
| 24.
|
Siemann, G.,
Blume, R.,
Grapentin, D.,
Oetjen, E.,
Schwaninger, M.,
and Knepel, W.
(1999)
Mol. Pharmacol.
55,
1094-1100[Abstract/Free Full Text]
|
| 25.
|
Herzig, S.,
Fuzesi, L.,
and Knepel, W.
(2000)
J. Biol. Chem.
275,
27989-27999[Abstract/Free Full Text]
|
| 26.
|
Ritz-Laser, B.,
Estreicher, A.,
Gauthier, B.,
and Philippe, J.
(2000)
J. Biol. Chem.
275,
32708-32715[Abstract/Free Full Text]
|
| 27.
|
Dhanvantari, S.,
Izzo, A.,
Jansen, E.,
and Brubaker, P. L.
(2001)
Endocrinology
142,
37-42[Abstract/Free Full Text]
|
| 28.
|
Xiao, Q.,
Boushey, R. P.,
Cino, M.,
Drucker, D. J.,
and Brubaker, P. L.
(2000)
Am. J. Physiol. Regul. Integr. Comp. Physiol.
278,
R1057-R1063[Abstract/Free Full Text]
|
| 29.
|
Lee, Y. C.,
Asa, S. L.,
and Drucker, D. J.
(1992)
J. Biol. Chem.
267,
10705-10708[Abstract/Free Full Text]
|
| 30.
|
Efrat, S.,
Teitelman, G.,
Anwar, M.,
Ruggiero, D.,
and Hanahan, D.
(1988)
Neuron.
1,
605-613[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Anini, Y.,
Hansotia, T.,
and Brubaker, P. L.
(2002)
Endocrinology.
143,
2420-2426[Abstract/Free Full Text]
|
| 32.
|
Fang, X., Yu, S. X., Lu, Y.,
Bast, R. C.,
Woodgett, J. R.,
and Mills, G. B.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
11960-11965[Abstract/Free Full Text]
|
| 33.
|
Li, M.,
Wang, X.,
Meintzer, M. K.,
Laessig, T.,
Birnbaum, M. J.,
and Heidenreich, K. A.
(2000)
Mol. Cell. Biol.
20,
9356-9363[Abstract/Free Full Text]
|
| 34.
|
Kinzler, K. W.,
Nilbert, M. C., Su, L. K.,
Vogelstein, B.,
Bryan, T. M.,
Levy, D. B.,
Smith, K. J.,
Preisinger, A. C.,
Hedge, P.,
McKechnie, D.,
Finnear, R.,
Markham, A.,
Groffen, J.,
Bokuski, M. S.,
Alschul, S. F.,
Horii, A.,
Ando, H.,
Miyoshi, Y.,
Miki, Y.,
Nishisyo, I.,
and Nakamura, Y.
(1991)
Science
253,
661-665[Abstract/Free Full Text]
|
| 35.
|
He, T. C.,
Sparks, A. B.,
Rago, C.,
Hermeking, H.,
Zawel, L.,
da Costa, L. T.,
Morin, P. J.,
Vogelstein, B.,
and Kinzler, K. W.
(1998)
Science
281,
1509-1512[Abstract/Free Full Text]
|
| 36.
|
van Es, J. H.,
Giles, R. H.,
and Clevers, H. C.
(2001)
Exp. Cell Res.
264,
126-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Kao, K. R.,
and Elinson, R. P.
(1998)
Biol. Cell
90,
585-589[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Salinas, P. C.
(1999)
Biochem. Soc. Symp.
65,
101-109[Medline]
[Order article via Infotrieve]
|
| 39.
|
Jin, T.,
and Drucker, D. J.
(1996)
Mol. Cell. Biol.
16,
19-26[Abstract]
|
| 40.
|
Kolligs, F. T., Hu, G.,
Dang, C. V.,
and Fearon, E. R.
(1999)
Mol. Cell. Biol.
19,
5696-5706[Abstract/Free Full Text]
|
| 41.
|
Morin, P. J.,
Sparks, A. B.,
Korinek, V.,
Barker, N.,
Clevers, H.,
Vogelstein, B.,
and Kinzler, K. W.
(1997)
Science
275,
1787-1790[Abstract/Free Full Text]
|
| 42.
|
Xu, F., Li, H.,
and Jin, T.
(1999)
J. Biol. Chem.
274,
34310-34316[Abstract/Free Full Text]
|
| 43.
|
Shimizu, H.,
Julius, M. A.,
Giarre, M.,
Zheng, Z.,
Brown, A. M.,
and Kitajewski, J.
(1997)
Cell Growth & Differ.
8,
1349-1358[Abstract]
|
| 44.
|
Huang, T. H. J.,
and Brubaker, P. L.
(1995)
Endocrine
3,
499-503[CrossRef]
|
| 45.
|
Brubaker, P. L.,
Schloos, J.,
and Drucker, D. J.
(1998)
Endocrinology
139,
4108-4114[Abstract/Free Full Text]
|
| 46.
|
Drucker, D. J.,
Lee, Y. C.,
Asa, S. L.,
and Brubaker, P. L.
(1992)
Mol. Endocrinol.
6,
2175-2184[Abstract/Free Full Text]
|
| 47.
|
Brubaker, P. L.,
Lee, Y. C.,
and Drucker, D. J.
(1992)
J. Biol. Chem.
267,
20728-20733[Abstract/Free Full Text]
|
| 48.
|
Stambolic, V.,
Ruel, L.,
and Woodgett, J. R.
(1996)
Curr. Biol.
6,
1664-1668[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Morin, P. J.,
Vogelstein, B.,
and Kinzler, K. W.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7950-7954[Abstract/Free Full Text]
|
| 50.
|
da Costa, L. T., He, T. C., Yu, J.,
Sparks, A. B.,
Morin, P. J.,
Polyak, K.,
Laken, S.,
Vogelstein, B.,
and Kinzler, K. W.
(1999)
Oncogene
18,
5010-5014[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Liu, Y.,
Shen, W.,
Brubaker, P. L.,
Kaestner, K. H.,
and Drucker, D. J.
(2002)
Biochem. J.
366,
633-641[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Gauthier, B. R.,
Schwitzgebel, V. M.,
Zaiko, M.,
Mamin, A.,
Ritz-Laser, B.,
and Philippe, J.
(2002)
Mol. Endocrinol.
16,
170-183[Abstract/Free Full Text]
|
| 53.
|
Diedrich, T.,
Furstenau, U.,
and Knepel, W.
(1997)
Biol. Chem.
378,
89-98[Medline]
[Order article via Infotrieve]
|
| 54.
|
Meigs, T. E.,
Fields, T. A.,
McKee, D. D.,
and Casey, P. J.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
519-524[Abstract/Free Full Text]
|
| 55.
|
Liu, T.,
DeCostanzo, A. J.,
Liu, X.,
Wang, H.,
Hallagan, S.,
Moon, R. T.,
and Malbon, C. C.
(2001)
Science
292,
1718-1722[Abstract/Free Full Text]
|
| 56.
|
Fujino, H.,
West, K. A.,
and Regan, J. W.
(2002)
J. Biol. Chem.
277,
2614-2619[Abstract/Free Full Text]
|
| 57.
|
Yusta, B.,
Estall, J.,
and Drucker, D. J.
(2002)
J. Biol. Chem.
277,
24896-24906[Abstract/Free Full Text]
|
| 58.
|
Ding, V. W.,
Chen, R. H.,
and McCormick, F.
(2000)
J. Biol. Chem.
275,
32475-32481[Abstract/Free Full Text]
|
| 59.
|
Chen, R. H.,
Ding, W. V.,
and McCormick, F.
(2000)
J. Biol. Chem.
275,
17894-17899[Abstract/Free Full Text]
|
| 60.
|
Cross, D. A.,
Alessi, D. R.,
Cohen, P.,
Andjelkovich, M.,
and Hemmings, B. A.
(1995)
Nature
378,
785-789[CrossRef][Medline]
[Order article via Infotrieve]
|
| 61.
|
Goode, N.,
Hughes, K.,
Woodgett, J. R.,
and Parker, P. J.
(1992)
J. Biol. Chem.
267,
16878-16882[Abstract/Free Full Text]
|
| 62.
|
Fang, X., Yu, S.,
Tanyi, J. L., Lu. Y.,
Woodgett, J. R.,
and Mills, G. B.
(2002)
Mol. Cell. Biol.
22,
2099-2110[Abstract/Free Full Text]
|
| 63.
|
Ritter, S.,
McGlone, J. J.,
and Kelley, K. W.
(1980)
Brain Res.
201,
501-506[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
McCann, M. J.,
Verbalis, J. G.,
and Stricker, E. M.
(1989)
Am. J. Physiol.
256,
R463-R468[Abstract/Free Full Text]
|
| 65.
|
van Dijk, G.,
and Thiele, T. E.
(1999)
Neuropeptides
33,
406-414[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Montrose-Rafizadeh, C.,
Yang, H.,
Rodgers, B. D.,
Beday, A.,
Pritchette, L. A.,
and Eng, J.
(1997)
J. Biol. Chem.
272,
21201-21206[Abstract/Free Full Text]
|
| 67.
|
Thiele, T. E.,
Seeley, R. J.,
D'Alessio, D.,
Eng, J.,
Bernstein, I. L.,
Woods, S. C.,
and van Dijk, G.
(1998)
Brain Res.
801,
164-170[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Rinaman, L.
(1999)
Am. J. Physiol.
277,
R1537-R1540
|
| 69.
|
Seeley, R. J.,
Blake, K.,
Rushing, P. A.,
Benoit, S.,
Eng, J.,
Woods, S. C.,
and D'Alessio, D.
(2000)
J. Neurosci.
20,
1616-1621[Abstract/Free Full Text]
|
| 70.
|
Rinaman, L.
(1999)
Am. J. Physiol.
277,
R582-R590
|
| 71.
| Anini, Y., and Brubaker, P. L. (2003) Diabetes
52, in press
|
| 72.
|
Rocca, A. S.,
and Brubaker, P. L.
(1999)
Endocrinology
140,
1687-1694[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Schinner, H. S Willenberg, M. Schott, and W. A Scherbaum
Pathophysiological aspects of Wnt-signaling in endocrine disease
Eur. J. Endocrinol.,
May 1, 2009;
160(5):
731 - 737.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Islam, N. Zhang, P. Wang, H. Li, P. L. Brubaker, H. Y. Gaisano, Q. Wang, and T. Jin
Epac is involved in cAMP-stimulated proglucagon expression and hormone production but not hormone secretion in pancreatic {alpha}- and intestinal L-cell lines
Am J Physiol Endocrinol Metab,
January 1, 2009;
296(1):
E174 - E181.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Kim and J. M. Egan
The Role of Incretins in Glucose Homeostasis and Diabetes Treatment
Pharmacol. Rev.,
December 1, 2008;
60(4):
470 - 512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Jin and L. Liu
Minireview: The Wnt Signaling Pathway Effector TCF7L2 and Type 2 Diabetes Mellitus
Mol. Endocrinol.,
November 1, 2008;
22(11):
2383 - 2392.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Jin
Mechanisms underlying proglucagon gene expression
J. Endocrinol.,
July 1, 2008;
198(1):
17 - 28.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Yi, J. Sun, G. E. Lim, I. G. Fantus, P. L. Brubaker, and T. Jin
Cross Talk between the Insulin and Wnt Signaling Pathways: Evidence from Intestinal Endocrine L Cells
Endocrinology,
May 1, 2008;
149(5):
2341 - 2351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lotfi, Z. Li, J. Sun, Y. Zuo, P. P. L. Lam, Y. Kang, M. Rahimi, D. Islam, P. Wang, H. Y. Gaisano, et al.
Role of the Exchange Protein Directly Activated by Cyclic Adenosine 5'-Monophosphate (Epac) Pathway in Regulating Proglucagon Gene Expression in Intestinal Endocrine L Cells
Endocrinology,
August 1, 2006;
147(8):
3727 - 3736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Yi, P. L. Brubaker, and T. Jin
TCF-4 Mediates Cell Type-specific Regulation of Proglucagon Gene Expression by {beta}-Catenin and Glycogen Synthase Kinase-3{beta}
J. Biol. Chem.,
January 14, 2005;
280(2):
1457 - 1464.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, Y. Cao, and D. F. Steiner
Regulation of Proglucagon Transcription by Activated Transcription Factor (ATF) 3 and a Novel Isoform, ATF3b, through the cAMP-response Element/ATF Site of the Proglucagon Gene Promoter
J. Biol. Chem.,
August 29, 2003;
278(35):
32899 - 32904.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|