Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M206006200 on November 5, 2002

J. Biol. Chem., Vol. 278, Issue 2, 1380-1387, January 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/1380    most recent
M206006200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ni, Z.
Right arrow Articles by Jin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ni, Z.
Right arrow Articles by Jin, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Transcriptional Activation of the Proglucagon Gene by Lithium and beta -Catenin in Intestinal Endocrine L Cells*

Zuyao NiDagger , Younes Anini§, Xianjun Fang||, Gordon Mills||, Patricia L Brubaker§**DaggerDagger, and Tianru JinDagger **§§¶¶||||

From the Dagger  Division of Cell & Molecular Biology, Toronto General Research Institute, University Health Network, Toronto, Ontario M5G 2M1, Canada, the Departments of § Physiology, ** Medicine, §§ Laboratory Medicine and Pathobiology, and the ¶¶ Institute of Medical Science, University of Toronto, Toronto, Ontario M5S 1A8, Canada, and the || Department of Molecular Therapeutics, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

Received for publication, June 29, 2002, and in revised form, October 28, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The proglucagon gene encodes several peptide hormones that regulate blood glucose homeostasis, growth of the small intestine, and satiety. Among them, glucagon-like peptide 1 (GLP-1) lowers blood glucose levels in patients with diabetes and inhibits eating and drinking in fasted rats. Although proglucagon transcription and GLP-1 synthesis were shown to be activated by forskolin and other protein kinase A (PKA) activators, deleting or mutating the cAMP-response element (CRE) only moderately attenuates the proglucagon gene promoter in response to PKA activation. Therefore, PKA may activate proglucagon transcription via a mechanism independent of the CRE motif. Recently, PKA was shown to phosphorylate and inactivate GSK-3beta , a key mediator in the Wnt signaling pathway. We show here that lithium, an inhibitor of GSK-3beta , activates proglucagon gene transcription and stimulates GLP-1 synthesis in an intestinal endocrine L cell line, GLUTag. The activation was also observed in primary fetal rat intestinal cell (FRIC) cultures, but not in a pancreatic A cell line. Co-transfection of beta -catenin, a downstream effector of GSK-3beta activities, activated the proglucagon gene promoter without a CRE. Furthermore, forskolin and 8-Br-cAMP phosphorylated GSK-3beta at serine 9 in intestinal proglucagon-producing cells, and both lithium and forskolin induced the accumulation of free beta -catenin in these cell lines. These observations indicate that the proglucagon gene is among the targets of the Wnt signaling pathway.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The gene encoding proglucagon is expressed in pancreatic A cells and enteroendocrine L cells as well as selective neurons of the central nervous system (1). A single proglucagon mRNA transcript, derived from a common transcription start site, is identical in all the three tissues. Cell type-specific posttranslational processing, however, gives rise to a different profile of proglucagon-derived peptides in each tissue (1, 2). Glucagon is produced in the pancreatic A cells. Glucagon-like peptide 1 (GLP-1)1 and glucagon-like peptide 2 (GLP-2), however, are produced in the endocrine L cells and in selected endocrine neurons in the brain (1, 2). GLP-1 is known as an insulinotropic hormone. It possesses potent effects to stimulate glucose-dependent insulin secretion, insulin gene expression, and B cell cAMP formation. Other effects of GLP-1 include inhibition of glucagon release and gastric emptying and, possibly, enhancement of peripheral insulin sensitivity (1, 2). In addition, intracerebroventricular administration of GLP-1 was found to powerfully inhibit eating and drinking and alter body weight in fasted rats (3, 4). Furthermore, a recent study shows that peripheral GLP-1 also plays a role in regulating macronutrient selection and food intake (5). GLP-2 was initially identified as a growth factor for the small intestine (6). Recent observations indicate that GLP-2 and its receptor also possess an overlapping function with GLP-1 in regulating gastric emptying and controlling satiety (7, 8).

Numerous studies conducted in the past 15 years have identified more than a dozen transcription factors and signaling molecules that play roles in driving proglucagon gene expression (9-31). However, none of the identified transcription factors or signaling molecules has been found to be tissue type- or cell type-specific.

Protein kinase A (PKA) is able to stimulate proglucagon gene transcription and glucagon or GLP-1 synthesis in both primary and transformed intestinal endocrine cells as well as in rat primary pancreatic islet cultures (11-14, 17). However, deleting or mutating the cAMP-response element (CRE) in the proglucagon gene promoter only partially attenuates its response to PKA activation in the small intestinal proglucagon-producing cell line STC-1 (13, 17). This indicates that PKA may up-regulate proglucagon gene expression via a yet to be identified signaling pathway. Recently, PKA was found to phosphorylate and inactivate the serine/threonine kinase glycogen synthase kinase 3beta (GSK-3beta ) in several cell lineages (32, 33). These observations prompted us to ask whether this newly identified function of PKA is engaged in proglucagon gene transcription. GSK-3beta is a major mediator of the Wnt signaling pathway (34-36). In normal epithelial cells, adenomatous polyposis coli together with GSK-3beta and Axin bind to and phosphorylate beta -catenin (beta -cat), targeting beta -cat for proteasomal mediated degradation. In embryonic cells, Wnt signals inactivate GSK-3beta , resulting in free beta -cat accumulation. Free beta -cat then forms a bipartite transcription factor with a T cell factor (TCF)/lymphoid enhancer factor (LEF), namely cat/TCF, activating the Wnt responsive or cat/TCF target genes (36). Another notable inhibitor of GSK-3beta is lithium, which mimics the function of the Wnt signals in embryonic cells (37, 38).

In this study, using cultivated intestinal endocrine cell lines as well as primary intestinal cells in culture, we examined whether Wnt signaling pathway/molecules mediate the effect of PKA in activating proglucagon gene transcription and GLP-1 synthesis.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Tissue culture medium and serum and oligonucleotides were purchased from Invitrogen. Radioisotopes were obtained from Amersham Biosciences. Forskolin, 3-isobutyl-1-methylxanthine (IBMX), 8-Br-cAMP, and 8-Br-cGMP were purchased from Sigma.

Plasmids-- Construction of the wild type and mutant rat proglucagon/luciferase (LUC) reporter gene plasmids have been described previously (15, 17, 39). beta -cat expression plasmids were provided by Dr. Eric Fearon (40). The TCF-TK-LUC reporter gene construct (TOPFLASH) was provided by Dr. Burt Vogelstein (41). The G2-TK-LUC fusion gene was generated by inserting one copy of the rat proglucagon gene G2 enhancer-like element (9) into the TK-LUC plasmid. The DNA sequence for the top strain of G2 is AGGCACAAGAGTAAATAAAAAGTTTCCGGGCCTCTG (9). It contains a potential binding site (AAGTTTC) for the bipartite transcription factor cat/TCF (35).

Cell Culture, Transfection, and LUC Reporter Gene Analysis-- The intestinal GLUTag, STC-1, and the pancreatic InR1-G9 cell lines were grown and maintained in Dulbecco's modified Eagle's medium supplemented with appropriate serum (39). To examine the effects of lithium and forskolin on proglucagon mRNA expression, GLP-1 synthesis, and secretion, cells were grown in the medium containing the appropriate serum overnight. 6 h prior to the experiment, serum-containing medium was withdrawn, and serum-free medium was added. For the LUC reporter gene analysis, the intestinal endocrine cell lines GLUTag and STC-1 were transfected using LipofectAMINE (Invitrogen) per the manufacturer's instructions, whereas the InR1-G9 cell line was transfected by a method of calcium precipitation (42).

Fetal rat intestinal cell (FRIC) cultures were prepared using 19-21 days-of-gestation fetal Wistar rats (Charles River Canada, Saint Constant, Quebec, Canada), as described in detail previously (11, 31). In FRIC cultures, the endocrine L cells account for ~1% of the cell numbers.

RNA Extraction and Northern Blot Analysis-- The methods used for RNA extraction and Northern blot analysis were described previously (39).

Cell Fractionation and Immunoblotting-- The anti beta -catenin antibody was purchased from BD Biosciences, and the anti-phospho-GSK-3alpha and -3beta antibodies were from New England Biolabs (32). Cytoplasmic and membrane fractions were prepared based the protocol by Shimizu et al. (43). The methods used for immunoblotting and for examining the PKA phosphorylation of GSK-3 were described previously (32).

Radioimmunoassay (RIA) for GLP-1-- As described previously (14, 31), peptides from the media were extracted by adding 1% (v/v) trifluoroacetic acid followed by passage twice through a cartridge of C18 silica (C18 SepPak, Waters Corp., Milford, MA). Peptides contained in the cells were extracted by homogenization in 1 N HCl containing 5% HCOOH, 1% trifluoroacetic acid, and 1% NaCl, followed by passage through a C18 SepPak. An RIA for immunoreactive GLP-1 was carried out using an antiserum directed toward the C-terminal end of GLP-17-36NH2 (Affinity Research Products Ltd., Mamhead, UK), which has previously been demonstrated to detect predominantly GLP-17-36NH2 in GLUTag and FRIC cells (14, 44).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Lithium Activates Proglucagon mRNA Expression-- Lithium is a notable inhibitor of GSK-3beta . We hypothesized that if PKA activates proglucagon gene transcription via inactivating GSK-3beta , lithium may also activate proglucagon mRNA expression. We examined this hypothesis in the mouse large intestinal GLUTag (13, 45-47) and the mouse small intestinal STC-1 (14) cell lines, as well as in the primary (FRIC) rat intestinal cultures. After incubation with 10 mM LiCl (48) for 4 h, both cell lines demonstrated ~3-fold increased proglucagon mRNA expression (Fig. 1). In the GLUTag cells, the activation was still observable after 12 h (3.9-fold). After a 24-hour incubation in two experiments, we still observed an enhanced proglucagon mRNA expression. Results from one experiment are presented in Fig. 1A. In two other experiments, however, proglucagon mRNA expression returned to untreated levels by 24 h (data not shown). In the STC-1 cell line, activated proglucagon gene expression was substantial during the whole experimental procedure (Fig. 1B). Fig. 1A also shows that proglucagon mRNA expression in the GLUTag cells is activated by the PKA activators forskolin and IBMX as we demonstrated previously (14). Similarly, an 8-h treatment of FRIC cultures with 10 mM LiCl enhanced proglucagon mRNA expression >3-fold (Fig. 1C).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1.   LiCl activates endogenous proglucagon mRNA expression. GLUTag (A) and STC-1 (B) cell lines and FRIC cultures (C) were treated with control media or media with 10 µM forskolin plus 10 µM IBMX, 10 mM LiCl, or 10 mM KCl for the indicated periods of time. Total RNA was extracted for Northern blot analyses using cDNA probes for rat proglucagon (Glu) or tubulin (T). 10 µg of RNA was loaded for each sample. For the cultivated cell lines, the membrane was exposed to x-ray film 8-12 h. For the FRIC cultures, the membrane was exposed for 8 days. After the densitometric analyses, the effects of each chemical on proglucagon expression were calculated as the -fold change versus the untreated cells normalized against the tubulin mRNA.

Lithium Activates the Rat Proglucagon Gene Promoter-- The effect of lithium on proglucagon mRNA levels could be a result of enhanced transcription or reduced degradation or both. We therefore examined whether lithium activates the proglucagon gene promoter. Fig. 2A shows that, after being transfected into the GLUTag cells, the expression of the -1.1-kb and the -472-bp promoter constructs was activated ~5-fold by forskolin. The evolutionarily conserved CRE is located between -291 and -298 bp (9). When the wild type -302-bp promoter was examined, ~6-fold activation by forskolin was observed. However, even with the CRE-mutated [-302(M)] or deleted (-290) reporter gene constructs, forskolin still generated ~3-3.5-fold activation. This is consistent with previous studies on the STC-1 cell line (13, 17). LiCl treatment also activated all the five promoter constructs examined by 2-3-fold, including those that carry a mutated [-302(M)] or deleted (-290) CRE. Lithium was also found to activate the proglucagon gene promoter constructs when transfected into the STC-1 cell line (Fig. 2B). The stimulatory effect of LiCl on the proglucagon promoter was found to be dose-dependent (Fig. 2B) and was observable within 4 to 12 h after the treatment (data not shown).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   LiCl activates the expression of the proglucagon gene promoter. GLUTag (A) and STC-1 (B) cells were transfected with 3 µg of the indicated Glu-LUC reporter gene by LipofectAMINE overnight in serum-free medium. The cells were then grown in serum-containing medium for 4 h before the addition of 10 mM LiCl or KCl, 10 µM forskolin plus 10 µM IBMX (For), or 100% ethanol (vehicle for forskolin/IBMX). After another 12-hour incubation, cells were harvested for LUC reporter gene analysis. Relative LUC reporter gene activity was calculated as the -fold increase with the activity in the untreated cells defined as 1-fold (mean ± S.E., n = 3).

To determine whether lithium also activates proglucagon gene expression in the pancreatic A cells, we conducted the above analyses against the hamster pancreatic A cell line InR1-G9. No appreciable activation on either proglucagon gene promoter or endogenous proglucagon mRNA expression was observed by LiCl treatment in this cell line (data not shown).

Lithium Stimulates GLP-1 Synthesis-- We next examined the effect of lithium on GLP-1 synthesis and secretion in the GLUTag cell line and FRIC cultures. We demonstrated previously that GLP-1 synthesis and secretion in those cells could be activated by forskolin or other PKA activators (11, 14, 44-47). Incubating the GLUTag cells with 10 mM LiCl for 4 h did not affect either the synthesis or secretion of GLP-1 (data not shown). When the incubation time was extended to 8 h, a 1.7-fold increase in the GLP-1 content of cell was observed (p < 0.01, Fig. 3A). In the same period, no change in GLP-1 secretion was observed as determined by an RIA of the cell free medium (Fig. 3B). Similarly, FRIC cultures were treated without or with 10 mM LiCl or 10 mM KCl (as control) for 8 h or 24 h before the assessment of GLP-1 synthesis and secretion. Consistent with the stimulatory effect of LiCl on the GLUTag cells, LiCl also increased GLP-1 synthesis in FRIC cultures to 1.5-fold of the control (p < 0.05) after a 24 h incubation (Fig. 4). No substantial effects of LiCl on GLP-1 synthesis were observed at 8 h or on GLP-1 secretion at either 8 or 24 h (Fig. 4).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   LiCl activates GLP-1 synthesis in GLUTag cells. GLUTag cells were treated with control medium alone or with 10 mM LiCl for 8 h. Cell and medium peptides were extracted and analyzed by RIA. The data show the total amount of GLP-1 in the well (A, medium plus cell; n = 6; **, p < 0.01) and the amount of GLP-1 in the medium (B, n = 6, not significant).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.   LiCl activates GLP-1 synthesis in FRIC cultures. FRIC cultures were treated with control medium alone or with 10 mM LiCl or KCl for 8 or 24 h. Cell and medium peptides were extracted and analyzed by RIA for immunoreactive GLP-1 levels. The data show the total amount of GLP-1 in the well (A, medium plus cell; n = 3; *, p < 0.05) and the amount of GLP-1 in the medium (B, n = 3, not significant).

beta -Cat Transfection Activates the Proglucagon Gene Promoter without a Functional CRE-- Lithium inactivates GSK-3beta and induces free beta -cat accumulation in other cell lineages (48). If lithium indeed stimulates proglucagon transcription via inactivation of GSK-3beta , overexpressing beta -cat should mimic the effect of lithium treatment. A reporter gene construct, namely TOPFLASH, has been widely utilized to examine the cat-TCF activity in colon cancer and other cell lines (41, 48-50). In this plasmid, the expression of a LUC reporter gene is driven by a minimum TK promoter fused with three copies of the TCF binding site. As shown in Fig. 5, this fusion gene is dose dependently activated by LiCl but not by KCl when transfected into the GLUTag cells.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 5.   LiCl activates the TCF-TK fusion promoter. GLUTag cells were transfected with 3 µg of the TCF-TK-LUC reporter gene, as described in Fig. 3. Relative LUC activity was calculated as the -fold increase with activity in untreated cells defined as 1-fold (mean ± S.E., n = 3). For, forskolin.

We then directly examined the effect of the wild type and the constitutively active mutant beta -cat, S33Y, on the expression of the proglucagon gene promoter. The S33Y mutant beta -cat is resistant to degradation because it cannot be phosphorylated by GSK-3beta (41). Co-transfection with the wild type beta -cat cDNA stimulated all of the proglucagon gene promoter constructs examined, except for the -1.1-kb promoter construct, by 1.7-2.0-fold (Fig. 6). Compared with the wild type beta -cat, the S33Y mutant beta -cat activated all five constructs more effectively, varying from 2.5- to 4-fold (Fig. 6). In addition, the S33Y mutant beta -cat was able to activate the -1.1 kb proglucagon gene promoter construct. The activation was also independent of the CRE motif on the proglucagon gene promoter (Fig. 6).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 6.   Co-transfection with beta -catenin activates the proglucagon gene promoter. GLUTag cells were transfected with 3 µg of the indicated proglucagon-LUC fusion gene construct along with 3 µg of either empty vector (PcDNA3), wild type beta -cat (wt), or the S33Y mutant beta -cat (m) (constitutively active). Relative LUC reporter gene activity was calculated as the -fold increase with activity in PcDNA3- transfected cells defined as 1-fold (mean ± S.E., n = 3).

The consensus binding site for cat/TCF has been suggested to be WWGTTTC (35). We localized several potential cat/TCF binding sites on the proglucagon gene promoter. One such binding site is downstream of -290 bp and is a part of the G2 enhancer-like element (9). This site is conserved among the proglucagon genes of humans and rodents (9, 22). We inserted one copy of the G2 element in front of the TK promoter in the TK-LUC fusion gene plasmid, and the new fusion gene was named G2-TK-LUC (Fig. 7). LiCl was found to dose dependently activate G2-TK-LUC by up to 3-fold when transfected into the GLUTag (Fig. 7) and STC-1 (data not shown) cells. Furthermore, G2-TK-LUC was activated by forskolin by ~5-fold (Fig. 7).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7.   Both LiCl and forskolin activate the G2-TK-LUC fusion gene. GLUTag cells were transfected with 3 µg of G2-TK-LUC reporter gene as described in the Fig. 3 legend. Relative LUC reporter gene activity was calculated as the -fold increase with the activity in untreated cells defined as 1-fold (mean ± S.E., n = 3). For, forskolin.

PKA Phosphorylates GSK-3beta , and Both LiCl and PKA Activators Induce Free beta -Cat Accumulation-- Recent studies have shown that PKA phosphorylates and inactivates GSK-3beta in the HEK293 and NIH 3T3 cell lines (32). In addition, PKA was also found to phosphorylate and inactivate GSK-3beta in neuronal cells, and GSK-3beta inactivation is linked to the inhibition of neuronal cell apoptosis (33). To further examine our hypothesis that Wnt pathway mediates the activation of proglucagon gene transcription by PKA, we examined GSK-3 phosphorylation and inactivation by PKA in the intestinal endocrine cell lines. As shown in Fig. 8, treating the GLUTag cells with forskolin or 8-Br-cAMP induced the phosphorylation of GSK-3alpha at serine 21 and GSK-3beta at serine 9. In contrast, treating the GLUTag cells with 8-Br-cGMP did not change the phosphorylation status of GSK-3alpha or GSK-3beta (Fig. 8).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 8.   PKA phosphorylates GSK-3alpha and GSK-3beta in the GLUTag cell line. GLUTag cells were starved in serum-free medium for 12 h and stimulated with 8-Br-cGMP or 8-Br-cAMP (2 mM, 30 min), or forskolin/IMBX (10 µM each, 30 min). Cell lysates were prepared and analyzed for GSK-3 phosphorylation at serine 21 and serine 9 by Western blotting using a GSK-3alpha and a GSK-3beta phospho-specific antibody, respectively (32).

We then asked whether lithium treatment or PKA activation would lead to free beta -cat accumulation in the two intestinal proglucagon-producing cell lines. The amount of beta -cat in cell membrane and cell cytosol was examined by Western blot analysis following a cellular fractionation procedure (43). In four separate experiments we observed free beta -cat accumulation in response to either LiCl or forskolin treatment, with activation levels varying from 2.5 to 10-fold. Data from one experiment are shown in Fig. 9. In this experiment, incubating the GLUTag cells with 10 mM LiCl for 2 h led to an ~3-fold increase in cytosolic beta -cat, whereas the change in beta -cat in the membrane portion was minimal. Similarly, treating the GLUTag cells with forskolin for 2 h led to a 2.9-fold increase in cytosolic beta -cat accumulation, whereas the change of beta -cat in the membrane portion was minimal (Fig. 9A). We also found that treatment of the GLUTag cells with 10 nM insulin for 12 h generated an appreciable effect on free beta -cat accumulation (2.9-fold), whereas the effect at 2 or 4 h was minimal (Fig. 9A). Similar results regarding free beta -cat accumulation in response to these three reagents were obtained in examining the STC-1 cell line (Fig. 9B).


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 9.   Both LiCl and forskolin stimulate free beta -cat accumulation in intestinal endocrine cell lines. GLUTag (A) and STC-1 (B) cells were grown in the absence or presence of 10 nM insulin (Ins), 10 mM LiCl, or 10 µM forskolin (For) plus 10 µM IBMX for the indicated periods of time. Cytosolic and membrane beta -cat were examined by Western blot analysis as described under "Experimental Procedures." The same membranes were stripped followed by hybridization with an anti-beta -actin antibody (loading control). After the densitometric analyses of the photograms, the effect of each chemical on beta -cat appearance in both cytosol and membrane fractions were calculated as the -fold change versus the untreated cells normalized against beta -actin.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In mammals, a single proglucagon gene encodes three major peptide hormones expressed in three different tissues (1). These hormones play critical roles in blood glucose homeostasis, the growth of small intestines, and satiety (1-8). Uniquely, different hormones encoded by the same proglucagon gene may possess opposite roles, such as glucagon versus GLP-1 in blood glucose homeostasis, or overlapping roles, such as GLP-1 and GLP-2 in mediating satiety (7, 8). Therefore, it is desirable and interesting to explore the molecular mechanisms that underlie proglucagon gene transcription and the biosynthesis of each individual hormone in a cell-specific manner. Although previous studies have identified numerous transcription factors and signals that may up- or down-regulate proglucagon gene transcription, none of the identified factors specifically regulate proglucagon transcription in pancreatic A cells only or in intestinal endocrine cells only (9-26, 51-53). Our observations indicated that lithium (as an inhibitory agent of GSK-3beta ) and cat/TCF selectively up-regulates proglucagon gene transcription and GLP-1 synthesis in the endocrine cells of the gut but not in a pancreatic A cell line. It will be interesting to explore the molecular mechanisms underlying this cell type-specific transactivation event.

A typical CRE element is located on both human and rat proglucagon gene promoters (9, 17, 22). Previous studies in the mouse small intestinal STC-1 cell line have shown that deleting or mutating this CRE motif generates only partial attenuation in response to PKA activation (13, 17). We show here that this is also true for the GLUTag cell line. These observations further support our proposal that PKA stimulates proglucagon gene transcription not only via phosphorylation of the CRE-binding proteins (CREB) but also through pathways that cross-talk with PKA.

The cross-talk between the Wnt signaling pathway and PKA or G protein-coupled receptors has been realized very recently. Meigs et al. (54) have shown that constitutively activated Galpha 12 and Galpha 13 interact with E-cadherin to cause the release of beta -cat and the subsequent stimulation of cat/TCF-mediated transcription. The chimeric receptor of the ligand binding and transmembrane domains of the beta 2 adrenergic receptor and the cytoplasmic domains of Frizzled-1 can also stimulate the cat/TCF transcriptional activation through a mechanism that appears to involve signaling through Galpha q and/or Galpha o (55). Similarly, Fujino et al. (56) reported the phosphorylation of GSK-3beta and stimulated TCF-mediated transcription by prostaglandin E2 through the EP2 or EP4 receptor, likely via PKA and phosphatidylinositol 3-kinase, respectively. Furthermore, treating fibroblasts and neuronal cells with forskolin or 8-Br-cAMP may lead to enhanced phosphorylation and inactivation of GSK-3beta (32, 33). Very recently, Yusta et al. (57) reported that GLP-2 inhibits cell apoptosis via its G protein-coupled receptor in association with PKA-dependent inactivation of GSK-3beta . Here we extend these observations into the intestinal proglucagon-producing cell (Fig. 8). This, in combination with our observation that both lithium and forskolin activated the G2-TK fusion promoter (Fig. 7), supports our notion that PKA activates proglucagon gene transcription via cross-talk with the Wnt pathway. Previous studies have implicated G2 in regulating proglucagon gene expression via binding with members of the Foxa transcription factor family (20, 51-53). In addition, by examining the effect of membrane depolarization on proglucagon gene expression in pancreatic A cell lines, Furstenau et al. (23) identified a calcium-response element within this enhancer-like element (23). Further studies are needed to examine the binding of cat/TCF to G2 and determine how G2 is implicated in specifying cell type-specific regulation of proglucagon gene transcription in response to lithium and other signaling molecules.

Although phosphorylation and inactivation of GSK-3beta by PKA, PKB/Akt, and PKC have been demonstrated in several cell lineages (32, 33, 57-62), whether this inactivation leads to free beta -cat accumulation has not been previously reported. Ding et al. (58) have shown that a 2-hour insulin treatment, possibly through PKB activation, leads to phosphorylation of GSK-3beta at serine 9 and inactivation of GSK-3beta enzymatic activity in a number of epithelial cell lines. However, free beta -cat levels were not altered in their study. In contrast, both Wnt and lithium induced free beta -cat accumulation but did not affect the phosphorylation status of GSK-3beta (58). Based on these observations, Ding et al. (58) hypothesized that insulin and the Wnt signals regulate GSK-3beta through different mechanisms and therefore lead to a distinct downstream event and that the phosphorylation of GSK-3beta at serine 9 may not be sufficient to induce free beta -cat accumulation. In our study, we also found that treating the intestinal endocrine cell lines with 10 nM insulin for 2 h generated no effect on free beta -cat accumulation. However, the effect began to be observable after 4 h and was enhanced after 12 h (Fig. 9). More importantly, we demonstrated that, in the intestinal proglucagon producing cells, forskolin treatment led to enhanced free beta -cat accumulation within 2 h. We speculate that, in these particular endocrine cell lines, phosphorylation of GSK-3beta at serine 9 by PKA may be sufficient to inactivate its ability to facilitate beta -cat degradation. However, at this stage, we cannot eliminate the possibility that phosphorylation of GSK-3beta by PKA and the accumulation of free beta -cat in response to PKA are two independent events. Nevertheless, our results clearly indicate that PKA activates proglucagon gene transcription in the endocrine L cells at least in part through accumulation of free beta -cat. A model illustrating our current understanding of the mechanisms underlying proglucagon gene activation by PKA and lithium is shown in Fig. 10.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 10.   A diagram showing mechanisms for the regulation of proglucagon gene transcription by lithium and PKA. Lithium is able to inactivate GSK-3beta and therefore induce the accumulation of free beta -catenin, which will form a complex with a given TCF. The bipartite transcription factor cat-TCF then stimulates proglucagon mRNA transcription, possibly through interacting with the G2 enhancer like element (9, 23). PKA is able to activate proglucagon gene transcription via the evolutionarily conserved CRE element on the proglucagon gene promoters (9, 11-14, 17). In addition, PKA may also activate proglucagon gene transcription by inactivating the GSK-3beta and inducing the accumulation of free beta -catenin. It is recognized however, that GSK-3beta inactivation and free beta -cat accumulation in response to PKA could be two separate events. Glu, proglucagon gene. A dotted line shows the CRE pathway documented previously (11-14, 17).

Our results also provide a potential molecular mechanism for the similar effect of lithium and GLP-1 to suppress food and water intake (3, 4, 63-70). Scientists have observed for a number of years that peripheral administration of lithium in rats causes a spectrum of effects, including reduced food/water intake, decreased salt ingestion after sodium depletion, and induced robust conditioned taste aversions (63-69). These effects can be mimicked by central (intracerebroventricular) administration of GLP-1 (3). More importantly, the effects provoked by lithium can be blocked by pre-treating the animals with GLP-1 receptor antagonists (67, 68). Taken together, it is reasonable to speculate that lithium mediates satiety, at least in part, through up-regulation of the brain GLP-1 pathway. Unfortunately, there is currently no brain proglucagon-producing cell line to examine this hypothesis. It will therefore be necessary to develop other methodologies to examine whether brain proglucagon mRNA transcription and GLP-1 synthesis are modulated by lithium and other signaling molecules in the Wnt signaling pathway.

We have reported previously that PKA activators regulate both the synthesis and secretion of GLP-1 (11-14). Other molecules, such as PKC activators, may stimulate GLP-1 secretion but not its synthesis (14). In this study, although we obtained evidence that lithium significantly enhanced GLP-1 synthesis, it had no significant effect on GLP-1 secretion. One may speculate that in the in vivo setting, Wnt signaling molecules may cross-talk with other pathways that are implicated in GLP-1 secretion. Alternatively, lithium may simultaneously activate both the Wnt signaling pathway for GLP-1 synthesis and an as yet to be determined pathway that is engaged in stimulating GLP-1 secretion. Furthermore, lithium may alter the response of the intestinal L cells to known secretagogues, including nutrients, as well as several neuro/endocrine gut hormones (31). We have recently observed a similar synergistic effect of fatty acids on glucose-dependent insulinotropic peptide (71) and of leptin on gastrin-releasing peptide-stimulated GLP-1 secretion (72). These hypotheses deserve further examination in vivo.

In summary, this study indicated that proglucagon is among the downstream target genes of cat-TCF or the Wnt signaling pathway. Our results provide a novel mechanism by which PKA up-regulates proglucagon gene transcription in the intestinal endocrine L cells and a potential explanation as to how lithium controls food/water intake. Additional studies are required to examine proglucagon gene transcription and GLP-1 synthesis in the brain in response to lithium and other Wnt signaling molecules.

    ACKNOWLEDGEMENTS

We thank Dr. James Woodgett and Dr. George Fantus for providing valuable advice in conducting this study, Dr. Eric Fearon for providing the wild type and S33Y mutant beta -catenin cDNAs, and Drs. Donald Branch, Mingyao Liu, and Jim Hu for critical reading of the manuscript.

    FOOTNOTES

* This work was supported in part by Canadian Institutes of Health Research (CIHR) Grant MOP36398 (to T. J.) and grants from the Canadian Diabetes Association (CDA) (to P. L. B. and T. J.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by a Canadian Diabetes Association postdoctoral fellowship (in the name of Margaret Francis).

Dagger Dagger Supported by the Canada Research Chair Program.

|||| To whom correspondence should be addressed: Rm. 421, 67 College St., Toronto General Research Inst., University Health Network, Toronto, Ontario M5G 2M1, Canada. Tel.: 416-340-4800 (ext. 4768); Fax: 416-340-3453; E-mail: tianru.jin@utoronto.ca.

Published, JBC Papers in Press, November 5, 2002, DOI 10.1074/jbc.M206006200

    ABBREVIATIONS

The abbreviations used are: GLP-1, glucagon like peptide 1; CRE, cAMP-response element; beta -cat, beta -catenin; TCF, T cell factor; cat-TCF, the bipartite transcription factor containing beta -catenin and a TCF; FRIC, fetal rat intestinal cells; GSK-3beta , glycogen synthase kinase 3beta ; IBMX, 3-isobutyl-1-methylxanthine; LUC, luciferase; PKA, protein kinase A; TK, thymidine kinase; RIA, radioimmunoassay.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kieffer, T. J., and Habener, J. F. (1999) Endocr. Rev. 20, 876-913[Abstract/Free Full Text]
2. Drucker, D. J. (2002) Gastroenterology 122, 531-544[CrossRef][Medline] [Order article via Infotrieve]
3. Turton, M. D., O'Shea, D., Gunn, I., Beak, S. A., Edwards, C. M., Meeran, K., Choi, S. J., Taylor, G. M., Heath, M. M., Lambert, P. D., Wilding, J. P. H., Smith, D. M., Ghatei, M. A., Herbert, J., and Bloom, S. R. (1996) Nature 379, 69-72[CrossRef][Medline] [Order article via Infotrieve]
4. Meeran, K., O'Shea, D., Edwards, C. M., Turton, M. D., Heath, M. M., Gunn, I., Abusnana, S., Rossi, M., Smal, C. J., Goldstone, A. P., Taylor, G. M., Sunter, D., Steere, J., Choi, S. J., Ghatei, M. A., and Bloom, S. R. (1999) Endocrinology 140, 244-250[Abstract/Free Full Text]
5. Peters, C. T., Choi, Y. H., Brubaker, P. L., and Anderson, G. H. (2001) J. Nutr. 131, 2164-2170[Abstract/Free Full Text]
6. Drucker, D. J., Erlich, P., Asa, S. L., and Brubaker, P. L. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7911-7916[Abstract/Free Full Text]
7. Lovshin, J., Estall, J., Yusta, B., Brown, T. J., and Drucker, D. J. (2001) J. Biol. Chem. 276, 21489-21499[Abstract/Free Full Text]
8. Wojdemann, M., Wettergren, A., Hartmann, B., and Holst, J. J. (1998) Scand. J. Gastroenterol. 33, 828-832[CrossRef][Medline] [Order article via Infotrieve]
9. Philippe, J., Drucker, D. J, Knepel, W., Jepeal, L., Misulovin, Z., and Habener, J. F. (1988) Mol. Cell. Biol. 8, 4877-4888[Abstract/Free Full Text]
10. Drucker, D. J., and Asa, S. (1988) J. Biol. Chem. 263, 13475-13478[Abstract/Free Full Text]
11. Drucker, D. J., and Brubaker, P. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3953-3957[Abstract/Free Full Text]
12. Drucker, D. J., Campos, R., Reynolds, R., Stobie, K., and Brubaker, P. L. (1991) Endocrinology. 128, 394-400[Abstract/Free Full Text]
13. Gajic, D., and Drucker, D. J. (1993) Endocrinology 132, 1055-1062[Abstract/Free Full Text]
14. Drucker, D. J., Jin, T., Asa, S., Young, T., and Brubaker, P. (1994) Mol. Endocrinol. 8, 1646-1655[Abstract/Free Full Text]
15. Jin, T., and Drucker, D. J. (1995) Mol. Endocrinol. 9, 1306-1320[Abstract/Free Full Text]
16. Wang, M., and Drucker, D. J. (1995) J. Biol. Chem. 270, 12646-12652[Abstract/Free Full Text]
17. Lu, F., Jin, T., and Drucker, D. J. (1996) Endocrinology 137, 3710-3716[Abstract]
18. Hussain, M, A., Lee, J., Miller, C. P., and Habener, J. F. (1997) Mol. Cell. Biol. 17, 7186-7194[Abstract]
19. Cordier-Bussat, M., Bernard, C., Levenez, F., Klages, N., Laser-Ritz, B., Philippe, J., Chayvialle, J. A., and Cuber, J. C. (1998) Diabetes 47, 1038-1045[Abstract]
20. Kaestner, K. H., Katz, J., Liu, Y., Drucker, D. J., and Schutz, G. (1999) Genes Dev. 13, 495-504[Abstract/Free Full Text]
21. Beimesche, S., Neubauer, A., Herzig, S., Grzeskowiak, R., Diedrich, T., Cierny, I., Scholz, D., Alejel, T., and Knepel, W. (1999) Mol. Endocrinol. 13, 718-728[Abstract/Free Full Text]
22. Nian, M., Drucker, D. J., and Irwin, D. (1999) Am. J. Physiol. 277, G829-G837[Abstract/Free Full Text]
23. Furstenau, U., Schwaninger, M., Blume, R., Jendrusch, E. M., and Knepel, W. (1999) J. Biol. Chem. 274, 5851-5860[Abstract/Free Full Text]
24. Siemann, G., Blume, R., Grapentin, D., Oetjen, E., Schwaninger, M., and Knepel, W. (1999) Mol. Pharmacol. 55, 1094-1100[Abstract/Free Full Text]
25. Herzig, S., Fuzesi, L., and Knepel, W. (2000) J. Biol. Chem. 275, 27989-27999[Abstract/Free Full Text]
26. Ritz-Laser, B., Estreicher, A., Gauthier, B., and Philippe, J. (2000) J. Biol. Chem. 275, 32708-32715[Abstract/Free Full Text]
27. Dhanvantari, S., Izzo, A., Jansen, E., and Brubaker, P. L. (2001) Endocrinology 142, 37-42[Abstract/Free Full Text]
28. Xiao, Q., Boushey, R. P., Cino, M., Drucker, D. J., and Brubaker, P. L. (2000) Am. J. Physiol. Regul. Integr. Comp. Physiol. 278, R1057-R1063[Abstract/Free Full Text]
29. Lee, Y. C., Asa, S. L., and Drucker, D. J. (1992) J. Biol. Chem. 267, 10705-10708[Abstract/Free Full Text]
30. Efrat, S., Teitelman, G., Anwar, M., Ruggiero, D., and Hanahan, D. (1988) Neuron. 1, 605-613[CrossRef][Medline] [Order article via Infotrieve]
31. Anini, Y., Hansotia, T., and Brubaker, P. L. (2002) Endocrinology. 143, 2420-2426[Abstract/Free Full Text]
32. Fang, X., Yu, S. X., Lu, Y., Bast, R. C., Woodgett, J. R., and Mills, G. B. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 11960-11965[Abstract/Free Full Text]
33. Li, M., Wang, X., Meintzer, M. K., Laessig, T., Birnbaum, M. J., and Heidenreich, K. A. (2000) Mol. Cell. Biol. 20, 9356-9363[Abstract/Free Full Text]
34. Kinzler, K. W., Nilbert, M. C., Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., Finnear, R., Markham, A., Groffen, J., Bokuski, M. S., Alschul, S. F., Horii, A., Ando, H., Miyoshi, Y., Miki, Y., Nishisyo, I., and Nakamura, Y. (1991) Science 253, 661-665[Abstract/Free Full Text]
35. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998) Science 281, 1509-1512[Abstract/Free Full Text]
36. van Es, J. H., Giles, R. H., and Clevers, H. C. (2001) Exp. Cell Res. 264, 126-134[CrossRef][Medline] [Order article via Infotrieve]
37. Kao, K. R., and Elinson, R. P. (1998) Biol. Cell 90, 585-589[CrossRef][Medline] [Order article via Infotrieve]
38. Salinas, P. C. (1999) Biochem. Soc. Symp. 65, 101-109[Medline] [Order article via Infotrieve]
39. Jin, T., and Drucker, D. J. (1996) Mol. Cell. Biol. 16, 19-26[Abstract]
40. Kolligs, F. T., Hu, G., Dang, C. V., and Fearon, E. R. (1999) Mol. Cell. Biol. 19, 5696-5706[Abstract/Free Full Text]
41. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997) Science 275, 1787-1790[Abstract/Free Full Text]
42. Xu, F., Li, H., and Jin, T. (1999) J. Biol. Chem. 274, 34310-34316[Abstract/Free Full Text]
43. Shimizu, H., Julius, M. A., Giarre, M., Zheng, Z., Brown, A. M., and Kitajewski, J. (1997) Cell Growth & Differ. 8, 1349-1358[Abstract]
44. Huang, T. H. J., and Brubaker, P. L. (1995) Endocrine 3, 499-503[CrossRef]
45. Brubaker, P. L., Schloos, J., and Drucker, D. J. (1998) Endocrinology 139, 4108-4114[Abstract/Free Full Text]
46. Drucker, D. J., Lee, Y. C., Asa, S. L., and Brubaker, P. L. (1992) Mol. Endocrinol. 6, 2175-2184[Abstract/Free Full Text]
47. Brubaker, P. L., Lee, Y. C., and Drucker, D. J. (1992) J. Biol. Chem. 267, 20728-20733[Abstract/Free Full Text]
48. Stambolic, V., Ruel, L., and Woodgett, J. R. (1996) Curr. Biol. 6, 1664-1668[CrossRef][Medline] [Order article via Infotrieve]
49. Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7950-7954[Abstract/Free Full Text]
50. da Costa, L. T., He, T. C., Yu, J., Sparks, A. B., Morin, P. J., Polyak, K., Laken, S., Vogelstein, B., and Kinzler, K. W. (1999) Oncogene 18, 5010-5014[CrossRef][Medline] [Order article via Infotrieve]
51. Liu, Y., Shen, W., Brubaker, P. L., Kaestner, K. H., and Drucker, D. J. (2002) Biochem. J. 366, 633-641[CrossRef][Medline] [Order article via Infotrieve]
52. Gauthier, B. R., Schwitzgebel, V. M., Zaiko, M., Mamin, A., Ritz-Laser, B., and Philippe, J. (2002) Mol. Endocrinol. 16, 170-183[Abstract/Free Full Text]
53. Diedrich, T., Furstenau, U., and Knepel, W. (1997) Biol. Chem. 378, 89-98[Medline] [Order article via Infotrieve]
54. Meigs, T. E., Fields, T. A., McKee, D. D., and Casey, P. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 519-524[Abstract/Free Full Text]
55. Liu, T., DeCostanzo, A. J., Liu, X., Wang, H., Hallagan, S., Moon, R. T., and Malbon, C. C. (2001) Science 292, 1718-1722[Abstract/Free Full Text]
56. Fujino, H., West, K. A., and Regan, J. W. (2002) J. Biol. Chem. 277, 2614-2619[Abstract/Free Full Text]
57. Yusta, B., Estall, J., and Drucker, D. J. (2002) J. Biol. Chem. 277, 24896-24906[Abstract/Free Full Text]
58. Ding, V. W., Chen, R. H., and McCormick, F. (2000) J. Biol. Chem. 275, 32475-32481[Abstract/Free Full Text]
59. Chen, R. H., Ding, W. V., and McCormick, F. (2000) J. Biol. Chem. 275, 17894-17899[Abstract/Free Full Text]
60. Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M., and Hemmings, B. A. (1995) Nature 378, 785-789[CrossRef][Medline] [Order article via Infotrieve]
61. Goode, N., Hughes, K., Woodgett, J. R., and Parker, P. J. (1992) J. Biol. Chem. 267, 16878-16882[Abstract/Free Full Text]
62. Fang, X., Yu, S., Tanyi, J. L., Lu. Y., Woodgett, J. R., and Mills, G. B. (2002) Mol. Cell. Biol. 22, 2099-2110[Abstract/Free Full Text]
63. Ritter, S., McGlone, J. J., and Kelley, K. W. (1980) Brain Res. 201, 501-506[CrossRef][Medline] [Order article via Infotrieve]
64. McCann, M. J., Verbalis, J. G., and Stricker, E. M. (1989) Am. J. Physiol. 256, R463-R468[Abstract/Free Full Text]
65. van Dijk, G., and Thiele, T. E. (1999) Neuropeptides 33, 406-414[CrossRef][Medline] [Order article via Infotrieve]
66. Montrose-Rafizadeh, C., Yang, H., Rodgers, B. D., Beday, A., Pritchette, L. A., and Eng, J. (1997) J. Biol. Chem. 272, 21201-21206[Abstract/Free Full Text]
67. Thiele, T. E., Seeley, R. J., D'Alessio, D., Eng, J., Bernstein, I. L., Woods, S. C., and van Dijk, G. (1998) Brain Res. 801, 164-170[CrossRef][Medline] [Order article via Infotrieve]
68. Rinaman, L. (1999) Am. J. Physiol. 277, R1537-R1540
69. Seeley, R. J., Blake, K., Rushing, P. A., Benoit, S., Eng, J., Woods, S. C., and D'Alessio, D. (2000) J. Neurosci. 20, 1616-1621[Abstract/Free Full Text]
70. Rinaman, L. (1999) Am. J. Physiol. 277, R582-R590
71. Anini, Y., and Brubaker, P. L. (2003) Diabetes 52, in press
72. Rocca, A. S., and Brubaker, P. L. (1999) Endocrinology 140, 1687-1694[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
S. Schinner, H. S Willenberg, M. Schott, and W. A Scherbaum
Pathophysiological aspects of Wnt-signaling in endocrine disease
Eur. J. Endocrinol., May 1, 2009; 160(5): 731 - 737.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. Islam, N. Zhang, P. Wang, H. Li, P. L. Brubaker, H. Y. Gaisano, Q. Wang, and T. Jin
Epac is involved in cAMP-stimulated proglucagon expression and hormone production but not hormone secretion in pancreatic {alpha}- and intestinal L-cell lines
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E174 - E181.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
W. Kim and J. M. Egan
The Role of Incretins in Glucose Homeostasis and Diabetes Treatment
Pharmacol. Rev., December 1, 2008; 60(4): 470 - 512.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
T. Jin and L. Liu
Minireview: The Wnt Signaling Pathway Effector TCF7L2 and Type 2 Diabetes Mellitus
Mol. Endocrinol., November 1, 2008; 22(11): 2383 - 2392.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
T. Jin
Mechanisms underlying proglucagon gene expression
J. Endocrinol., July 1, 2008; 198(1): 17 - 28.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Yi, J. Sun, G. E. Lim, I. G. Fantus, P. L. Brubaker, and T. Jin
Cross Talk between the Insulin and Wnt Signaling Pathways: Evidence from Intestinal Endocrine L Cells
Endocrinology, May 1, 2008; 149(5): 2341 - 2351.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Lotfi, Z. Li, J. Sun, Y. Zuo, P. P. L. Lam, Y. Kang, M. Rahimi, D. Islam, P. Wang, H. Y. Gaisano, et al.
Role of the Exchange Protein Directly Activated by Cyclic Adenosine 5'-Monophosphate (Epac) Pathway in Regulating Proglucagon Gene Expression in Intestinal Endocrine L Cells
Endocrinology, August 1, 2006; 147(8): 3727 - 3736.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yi, P. L. Brubaker, and T. Jin
TCF-4 Mediates Cell Type-specific Regulation of Proglucagon Gene Expression by {beta}-Catenin and Glycogen Synthase Kinase-3{beta}
J. Biol. Chem., January 14, 2005; 280(2): 1457 - 1464.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, Y. Cao, and D. F. Steiner
Regulation of Proglucagon Transcription by Activated Transcription Factor (ATF) 3 and a Novel Isoform, ATF3b, through the cAMP-response Element/ATF Site of the Proglucagon Gene Promoter
J. Biol. Chem., August 29, 2003; 278(35): 32899 - 32904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/1380    most recent
M206006200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ni, Z.
Right arrow Articles by Jin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ni, Z.
Right arrow Articles by Jin, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement