Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M209241200 on October 29, 2002

J. Biol. Chem., Vol. 278, Issue 2, 718-723, January 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/718    most recent
M209241200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tischkau, S. A.
Right arrow Articles by Gillette, M. U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tischkau, S. A.
Right arrow Articles by Gillette, M. U.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Ca2+/cAMP Response Element-binding Protein (CREB)-dependent Activation of Per1 Is Required for Light-induced Signaling in the Suprachiasmatic Nucleus Circadian Clock*

Shelley A. TischkauDagger §, Jennifer W. MitchellDagger , Sheue-Houy TyanDagger §, Gordon F. Buchanan||, and Martha U. GilletteDagger §||**

From the Departments of Dagger  Cell and Structural Biology, || Molecular and Integrative Physiology, and the § Neuroscience Program, University of Illinois at Urbana-Champaign, B107 CLSL, Urbana, Illinois 61801

Received for publication, September 9, 2002, and in revised form, October 29, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Light is a prominent stimulus that synchronizes endogenous circadian rhythmicity to environmental light/dark cycles. Nocturnal light elevates mRNA of the Period1 (Per1) gene and induces long term state changes, expressed as phase shifts of circadian rhythms. The cellular mechanism for Per1 elevation and light-induced phase advance in the suprachiasmatic nucleus (SCN), a process initiated primarily by glutamatergic neurotransmission from the retinohypothalamic tract, was examined. Glutamate (GLU)-induced phase advances in the rat SCN were blocked by antisense oligodeoxynucleotide (ODN) against Per1 and Ca2+/cAMP response element (CRE)-decoy ODN. CRE-decoy ODN also blocked light-induced phase advances in vivo. Furthermore, the CRE-decoy blocked GLU-induced accumulation of Per1 mRNA. Thus, Ca2+/cAMP response element-binding protein (CREB) and Per1 are integral components of the pathway transducing light-stimulated GLU neurotransmission into phase advance of the circadian clock.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mammalian circadian rhythmicity is generated by endogenous alternations in transcription/translation of putative clock genes within the suprachiasmatic nucleus (SCN)1 of the basal hypothalamus. As a projection site of the retinohypothalamic tract, the SCN is poised to respond to retinal light information, mediated primarily by glutamatergic (GLU) neurotransmission, to assure time-of-day congruence between the endogenous pacemaker and the external environment. The mechanisms by which the SCN decodes and processes light information are complex and change as the biochemical clock states progress through their 24-h cycle (1). Light resets the clock throughout the night via glutamatergic-N-methyl-D-aspartate receptor-mediated Ca2+ influx, which activates nitric-oxide synthase to liberate nitric oxide (NO) (2). At this point, the light signaling pathway diverges. In the early night, the light-induced state change, which delays subsequent rhythms, proceeds through NO-dependent activation of a neuronal ryanodine receptor. Light-induced state changes in the late night are independent of ryanodine receptor activation, but require activation of protein kinase G (PKG) (3-5).

The discovery of several specific genes associated with circadian rhythmicity, including Period (Per) and Timeless (Tim) (for review, see Ref. 6), raises questions regarding the mechanisms that interface nocturnal light signals with the molecular clockwork. Throughout the night, light stimuli sufficient to cause long term state changes, or phase shifts, of circadian rhythms of rodent wheel running correlate with increased phosphorylation of the transcription factor, Ca2+/cAMP response element-binding protein (CREB) (7, 8), activation of Ca2+/cAMP response element (CRE)-mediated transcription (9), and a rise in Per1 mRNA (10-15). This investigation was undertaken to determine whether CRE-mediated activation of Per1 is required for light/GLU-induced phase resetting of the SCN clock. We hypothesized that the GLU-induced phase advance requires activation of CRE and elevation of Per1 mRNA. Therefore, we examined the ability of an oligodeoxynucleotide (ODN) decoy (CRE-decoy) to 1) sequester CREB and inhibit CRE-mediated transcription, 2) inhibit GLU-induced phase advances of SCN electrical activity and light-induced phase advances of wheel running activity, and 3) block GLU-induced up-regulation of Per1 levels.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Animals and Circadian Time-- Long-Evans rats (6-12 weeks old) from our inbred line were used for all in vitro experiments. After greater than 35 generations of inbreeding, this line surpasses the requirements for genetic homogeneity, resulting in low variation for physiological experiments. Rats were entrained to a daily cycle of 12-h light:12-h dark and provided food and water ad libitum. Because the rat SCN generates stable 24-h rhythms of electrical activity when maintained in vitro over the 2-3 days of experimentation, in vitro clock time was determined from the lighting cycle in the donor colony. Circadian time 0 (CT 0) is designated as the time of lights on in the donor colony; subjective day is CT 0-12. Subjective night (CT 12-24) corresponds to the dark portion of the donor's cycle.

For in vivo behavioral experiments, male B6129PF1/J mice obtained from The Jackson Laboratory (Bar Harbor, ME) at ~4 weeks of age were placed in individual cages (27 × 21 × 14 cm) equipped with running wheels (12-cm diameter). Mice were entrained to a 12-h light: 12-h dark (12:12 light-dark; 100-lux white light) cycle and then released into constant darkness.

Behavioral Wheel Running Activity Data Acquisition-- Circadian rhythms of behavior were assessed by monitoring the wheel-running activity of individually housed mice as described previously (16). Activity was conveyed to a Pentium III computer (Micron, Inc.) equipped with Clocklab Acquisition software (David Ferster, Northwestern University) running in LabView (National Instruments, Inc., Austin, TX). Rhythms were plotted in an actogram with Clocklab Analysis software (David Ferster, Northwestern University) running in Matlab (Mathworks Co., Natick, MA).

Intra-SCN Cannula Implantation and Injection-- A guide cannula (26 gauge; 11.2 mm total length; Plastics One, Inc., Roanoke, VA) was stereotaxically implanted unilaterally into the SCN under deep anesthesia (60 mg/kg sodium pentobarbital) using a stereotaxic apparatus (Stoelting, Wood Dale, IL). Surgical coordinates from bregma were -0.3-mm anterior-posterior, -0.1-mm medial-lateral, and -1.8-mm dorsal-ventral (from the surface of dura). The cannula was secured with small machine screws (Small Parts, Inc., Miami Lakes, FL) inserted into the skull and cranioplastic cement (Plastics One, Inc., Roanoke, VA). Following establishment of a well defined, free-running rhythm for at least 10 days, pharmacological manipulations were performed under dim (<1 lux) red illumination. A 10-µl Hamilton syringe (Hamilton Co., Reno, NV) fitted with a 1.5-cm piece of polyethylene tubing and a 33-gauge infusion cannula (Plastics One, Inc., Roanoke, VA) was employed to administer 0.3 µl of 100 µM CRE-decoy ODN (tgacgtcatgacgtcatgacgtca) or a 100 µM concentration of a mismatched sequence of the same nucleotide bases, CRE-mis (tgtggtcatgtggtcatgtggtca) through the guide cannula and into the SCN at CT 21.75. CRE-mis and certain CRE-decoy injections were followed 15 min later (CT 22) by 15-min, 20-lux light pulses. Injection sites were verified histologically, and data from only those animals in which the tip of the injection cannula penetrated the dorsal border of the SCN were used for analyses.

Isolation of SCN 2.2 Nuclear Extract and Electromobility Shift Assay-- Nuclear extracts were isolated as described (17). Briefly, confluent SCN 2.2 cells were scraped in wash solution (15 mM HEPES, pH 7.2, 250 mM sucrose, 60 mM KCl, 10 mM NaCl, 1 mM EGTA, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 2 mM NaF, 2 mM NaPPi, 5 µM mycrocystin-LR] and centrifuged at 2000 × g for 10 min. Pellets were resuspended in cell lysis solution (10 mM HEPES, pH 7.2, 1.5 mM MgCl2, 10 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 5 µM microcystin-LR, 2 mM NaF, 2 mM NaPPi) and centrifuged at 4000 × g for 10 min to isolate nuclei. The pellet was resuspended in nuclei lysis solution (100 mM HEPES, pH 7.2, 1.5 mM MgCl2, 1 mM EDTA, 800 mM NaCl, 2 mM NaF, 2 mM NaPPi, 1 mM phenylmethylsulfonyl fluoride, 5 µM microcystin-LR, 25% glycerol and centrifuged at 14,000 × g for 30 min to pellet debris. Supernatant was stored at -20 °C until use. The electromobility of the CRE-decoy was adapted from (18). 5 µg of nuclear extract from SCN 2.2 cells transfected with 75 nM CRE-decoy or CRE-mis using Effectene (Qiagen) was incubated in 100 ng/µl poly(dI-dC), 300 nM dithiothreitol, 12 mM Tris pH 8.0, 2 mM MgCl2, 60 mM KCl, 120 nM EDTA, pH 8.0, 12.5% glycerol for 30 min at 4 °C. 10,000 cpm of 32P-end-labeled CRE-decoy was added and incubated at 37 °C for 10 min. The samples were separated by 8% PAGE and exposed on a phosphorimager screen.

Luciferase Assay-- Culture extracts were prepared by resuspending frozen SCN cultures stably transfected with a CRE-luciferase construct (45) with cell culture lysis buffer (Promega) at ~25 µl of cell culture lysis buffer/cm2 cell culture surface area. Samples were centrifuged (2000 × g for 5 min) and supernatant collected for luciferase assay. Luciferase assays were performed using the Luciferase Assay System (Promega) and measured on an MLX microtiter plate luminometer (Dynex Technologies) by luc-50. Protein concentration of samples was determined by BCA protein assay kit (Pierce) against bovine serum albumin standards in cell culture lysis buffer. Relative luciferase activity/µg of protein was determined for each culture.

Preparation and Treatment of Brain Slices-- Coronal brain slices (500 µm) were prepared at least 2 h prior to the onset of the dark phase of the light:dark cycle to avoid phase shifts during preparation (19). Slices maintained at 37 °C (95% 02, 5% C02) in a Hatton-style brain slice chamber were continuously perfused with minimal salts (Earle's balanced salt solution, pH 7.25) and glucose (24 mM). Perifusion was stopped during treatment. GLU (10 mM, 10 min) was applied by microdrop (1 µl) to the top of each slice. For antisense experiments, antisense sequence (alpha ODN) against the 5' start site of Per1 (taggggaccactcatgtct), Per2 (tatccattcatgtcg), or Tim (acaagtccatacacc) was applied at a concentration of 10 µM, 2 h prior to the time of GLU treatment by replacing the bath with medium containing the experimental reagent.

Single Unit Recordings of SCN Neuronal Activity-- The phase-shifting effects of stimuli applied to SCN slices in vitro were assessed using the standard extracellular single unit recording technique (19). Spontaneous firing rates of individual neurons were grouped into 2-h running averages using 15-min lags. The time-of-peak for each experiment was determined by visual inspection of a plot of 2-h running averages for the symmetrically highest point. A characteristic sinusoidal pattern of change, such that activity was low at night and peaked near circadian time 7 (CT 7, 7 h after the onset of light in the donor colony) was observed in vehicle-treated control slices. Phase shifts were determined by comparing the mean time-of-peak from treatment groups to vehicle-treated controls. Certain recordings were performed with the experimenter blind to the treatment conditions.

In Situ Hybridization-- Sixty minutes following the initiation of GLU treatment, slices were fixed overnight at 4 °C in 4% paraformaldehyde, followed by cryoprotection in 20% sucrose. Hybridization was performed on 10-µm sections using digoxygenin-labeled riboprobes (cRNA), as described previously (16, 20). Analysis of mPer1-positive cells was made in a midcaudal section of the SCN by an individual blind to the experimental design and identity of the samples.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CRE-decoy Blocks the Light/GLU-induced Phase Advance-- The CRE-decoy is a synthetic single-stranded ODN that self-hybridizes to form duplex/hairpins (18). Theoretically, the CRE-decoy will sequester phospho-CREB, preventing its binding and activation of genes containing CRE in their promoters. CRE-decoy and CRE-mis ODN were used to determine whether activation of CRE sites is required for GLU-induced phase advance of the SCN neuronal firing rate rhythm. Two initial experiments were performed to demonstrate that CRE-decoy acts as predicted. The CRE-decoy (75 nM) blocked CRE-CREB binding in SCN 2.2 cells (Fig. 1) and inhibited reporter activity in SCN 2.2 cells stably transfected with a luciferase construct driven by 8 tandem repeats of the CRE-palindrome (Fig. 2). CRE-mis did not block CRE-CREB binding or alter CRE-driven luciferase activity. These data are in agreement with a previous study by Park et al. (18) demonstrating that the CRE-decoy can penetrate cells, bind CREB, and prevent transcriptional activation from CRE sites.


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1.   CRE-decoy blocks binding at CRE sites in SCN 2.2 cells. Electromobility shift assay of a CRE probe incubated with nuclear extracts of SCN 2.2 cells non-transfected (lane 1) or transfected with the transfection reaction reagent, Effectene (lane 2), 75 nM CRE-decoy (lane 3), or 75 nM CRE-mis (lane 4). The arrow indicates the retarded mobility of the CRE probe due to binding of CREB. This DNA-protein interaction is absent in the SCN 2.2 cells transfected with the CRE-decoy.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2.   CRE-activated transcription is inhibited by the addition of the CRE-decoy. Luciferase activity was quantitated from a SCN 2.2 cell line stably transfected with a luciferase construct driven by eight CRE sites (45). The relative light units (RLU) normalized to protein concentrations of cells transfected with just the transfection reagent, Effectene, or CRE-mis were similar that of the non-transfected cells (media). However, the cells transfected with the CRE-decoy demonstrated a significant inhibition in CRE-activated luciferase activity. ** indicates statistically significant differences (p < 0.01) as determined by ANOVA with Tukey's post hoc analysis.

To determine whether CRE-mediated transcription is required for GLU-induced phase resetting within the SCN, CRE-decoy (1 µM) was applied to SCN slices prior to stimulation with GLU. Spontaneous SCN neuronal activity peaked near CT 7 in control slices (Fig. 3a, mean time-of-peak = CT 6.78 + 0.10, n = 8). CRE-decoy did not alter the timing of the SCN electrical activity rhythm when applied alone (Fig. 3, b and f, mean time-of-peak CT 6.25 + 0.14, n = 3). Application of GLU to SCN slices at CT 20 caused a phase advance of the SCN electrical activity rhythm (Fig. 3, c and f, mean time-of-peak = CT 3.41 + 0.18, n = 6). CRE-decoy (Fig. 3, d and f, mean time-of-peak CT 6.50 + 0.25, n = 3), but not CRE-mis (Fig. 3, e and f, mean time-of-peak CT 3.47 + 0.12, n = 3), blocked the GLU-induced phase advance.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Inhibiting CRE activation blocks GLU-induced phase advances in vitro. a, a representative control neuronal activity rhythm with a peak near CT 7 on days 1 and 2 in vitro. b, application of CRE-sense (1 µM) alone from CT 18-20 had no effect on the time-of-peak electrical activity in vitro. c, at CT 20, GLU (10 mM) induced a ~3.5-h phase advance in the SCN electrical activity rhythm. d, CRE-sense (1 µM) blocked the GLU-induced phase advance. e, CRE-mismatch did not block the GLU-induced phase advance. The bar graph of mean data (n = 3/condition) demonstrates samples treated with CRE-decoy are not significantly different from controls, and GLU treatment samples treated with CRE-mis are not significantly different from GLU treatment alone. Statistical treatments were the same as in Fig. 1.

To determine whether CRE-mediated transcription is required for the phase resetting that occurs in response to light signals, CRE-decoy (100 µM) was injected into the SCN 15 min before exposure to a light pulse at CT 22. Neither CRE-decoy nor CRE-mis caused a phase shift of activity rhythms when injected alone (Fig. 4). Light pulses caused a characteristic 1.1-h phase advance. Phase resetting effects of light were blocked in the presence of the CRE-decoy. CRE-mis had no effect on light-induced phase shifts. These data suggest that transcriptional activation at CRE sites is required for the light-induced phase advance of circadian behavioral patterns.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4.   Inhibiting CRE activation blocks light-induced phase advances in vivo. a-c, representative double-plotted actograms of wheel-running activity patterns of 2 days in tandem/line. Using activity onset as phase marker, the data depict unaffected light-induced phase shift following CRE-mis treatment (a), lack of light-induced phase advance following CRE-decoy treatment (b), and unaffected wheel-running rhythm following CRE-decoy treatment without light pulse (c). Each horizontal line represents 48-h of wheel-running activity with the second 24 h of each line redrawn as the first 24 h on the next line. Vertical marks represent 6-min bins of activity plotted relative to the maximum activity of the animals for the duration of the record. Diagonal lines are drawn to ease visualization of phase shifts. d, summary bar graph depicting magnitudes of responses following the three conditions as indicated. CRE-decoy + light pulse and CRE-decoy alone do not induce significant changes in phase of these activity rhythms. * = p < 0.05;   = time of light pulse.

Elevation of Per1 mRNA Is Required for GLU-induced Phase Advance-- Alterations in the circadian timing of wheel-running activity and SCN firing rate rhythms represent behavioral and physiological changes associated with light at night. Likewise, induction of Per1 has become a marker of the molecular response to nocturnal light/GLU. To determine whether mRNA for Per1, Per2, or Tim is required for GLU-induced phase advance, alpha ODN surrounding the 5' start site of each mRNA was applied to the SCN slice in the presence or absence of GLU (Fig. 5). Spontaneous SCN neuronal activity peaked near CT 7 in control slices (Fig. 5a, mean time-of-peak = CT 6.78 + 0.10, n = 8). GLU induced a ~3.5-h phase advance in the time-of-peak neuronal activity compared with controls (Fig. 5b, mean time-of-peak CT 3.42 + 0.14, n = 6). Per1 alpha ODN alone did not alter the time-of-peak (Fig. 5c, mean time-of-peak = CT 6.42 + 0.35, n = 3). Upon GLU stimulation, Per1 alpha ODN blocked the usual ~3.5-h phase advance (Fig. 5d, mean time-of-peak = 6.56 + 0.21, n = 3). A Per1 sense ODN (Fig. 5e, mean time-of-peak = 3.75 + 0.12, n = 3), and a Per1 ODN carrying three mismatched nucleotides (Fig. 5f, mean time-of peak = 3.53 + 0.35, n = 3) had no effect on GLU-induced phase advances. Thus, Per1 mRNA induction is required for GLU-induced clock resetting in the late night. On the other hand, Tim alpha ODN (Fig. 5g, mean time-of-peak CT 3.6 + 0.22, n = 3) or Per2 (Fig. 5g, time-of-peak CT 3.11 + 0.75, n = 3) did not effect the GLU-induced phase advances.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Per1 is required for GLU to induce phase shifts in vitro. a, the spontaneous electrical activity rhythm peaks near CT 7 in controls. b, at CT 20, GLU (10 mM, 10 min) advanced the electrical activity rhythm by ~3.5 h. c, Per1 alpha ODN (10 µM) applied from CT 18-20 had no effect on the time-of-peak electrical activity. d, Per1 alpha ODN blocked the GLU-induced phase advance at CT 20. e, Per sense ODN (10 µM) applied from CT 18-20 had no effect on the GLU-induced advance in time-of-peak electrical activity. f, Per missense ODN did not block the GLU-induced phase advance at CT 20. g, summary of the effects of Per1, Per2, and Tim antisense ODNs on GLU-induced phase advances at CT 20. ** indicates statistically significant differences (p < 0.01) as determined by ANOVA with Tukey's post hoc analysis.

CRE Activation Regulates GLU Induction of Per1-- To determine whether the rise in Per1 mRNA induced by GLU and required for the phase shift is mediated by CREB activation, SCN slices were treated and analyzed for Per1 by in situ hybridization. The number of Per1-positive cells increased 400% by 60 min after GLU treatment at CT 20 (Fig. 6, p < 0.01), consistent with previous results (16). Whereas treatment with CRE-decoy alone did not affect Per1 levels, the decoy blocked GLU induction of Per1 (Fig. 6). These data suggest that activation of CREB-regulated transcription is required to induce Per1 mRNA.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 6.   Effects of inhibiting CRE activation on GLU-induced Per1 mRNA levels in the SCN at CT 20. a, a digoxygenin-labeled cRNA probe detected low basal levels of Per1 mRNA in control sections. b, GLU significantly elevated Per1 mRNA 60 min after GLU treatment at CT 20. c, inhibition of CRE-mediated transcription blocked GLU-induced Per1 at CT 20. d, for quantitation, positive cells were counted from one SCN in a single, midcaudal section by an experimenter blind to the treatment. Bars represent mean ± S.E. of four to six independent experiments. * represents statistically significant differences compared with control values at the same circadian time as determined by ANOVA (p < 0.01) with Tukey's post hoc analysis.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mechanisms coupling environmental light signals to molecular changes that lead to long term state changes within the circadian clock are emerging as complex and multifunctional. Nocturnal light resets the circadian clock through glutamatergic neurotransmission of retinohypothalamic tract origin (2, 21-24). Throughout the night, light/GLU phosphorylates CREB (7, 8), activates CRE-mediated transcription (9), and stimulates immediate early genes (25-28) and the clock gene Per1 (10-15). Our data provide definitive evidence that CRE-regulated activation of mPer1 mRNA is required for light/GLU-induced phase advances during the late subjective night as predicted from the studies of Travnickova-Benova et al. on transfected JEG3 cells (29).

Inhibition of CRE-mediated transcription by an exogenous CRE sequence (CRE-decoy) that binds CREB, thereby outcompeting its binding to endogenous CRE, conclusively demonstrates that CREB/CRE-activated transcriptional events are required for the light/GLU-induced phase advance. These results extend the findings of a previous study that defined a requirement for CREB phosphorylation on Ser142 for light-induced phase shifts (30) by demonstrating that CRE-activated transcriptional events are also required.

The presence of CRE-elements (31) capable of binding CREB and responding to forskolin and EGF (29) in the Per1 promoter has suggested that one critical function of light/GLU-induced CRE-mediated transcription is generation of new Per1 mRNA. Elevation of Per1 mRNA in response to light is a hallmark of the response of the mammalian molecular clockworks to light. Induction of Per1 is required for light/GLU-induced phase shifts in both early (32) and late night (Fig. 5). Blockage of GLU-induced Per1 accumulation in the presence of the CRE-decoy provides compelling evidence that CRE-mediated transcription contributes to increased levels of Per1. Whereas our data do not exclude a role for ATF-1 or ATF-2 interaction with CRE elements, a previous study indicates that ATF-1 and ATF-2 do not bind the CRE-element in the Per1 promoter (29). We also did not examine the role of CREM in the Per1 promoter. However, because CREM inhibits CRE-mediated transcription, it is unlikely that induction of Per1 mRNA is mediated by CREM.

Our data designate Per1 as an integral component of the input pathway for light/GLU signaling and reveal a critical distinction between induction of Per1 and Per2/Tim. ODN against Per2 and Tim had no effect on GLU-induced phase shifts when applied in a 2-h window before and during the stimulus. Per2, which also contains a canonical CRE within its promoter (29), may also be induced by light (14, 33). Our data suggest that Per2 is not required for light/GLU-induced phase advance. CREB-142 knock-out mice (30), which show increased Per2 despite a severely attenuated phase-shifting reponse to light, are consistent with our data and suggest different roles for Per1 versus Per2. Because elevation of Tim by light is restricted to early night (20), it is unlikely that Tim mRNA plays a role in the late night. We hypothesize that any light/GLU-induced alteration in Per2 or Tim is a consequence of the reestablishment of the new circadian phase, which happens in less than 1 h in response to the phase-shifting event (34).

These data raise a fundamental question with regard to the role of Per1 within the molecular clockwork. Is Per1 part of the core clock mechanism or exclusively a component of an input or entrainment pathway? The absence of free-running circadian rhythms in mice lacking Per2, Cry1, and Cry2 has established those genes as core elements in the mammalian clock (35-37). The data from Per1 knock-out mice are less definitive. Per1 knock-outs generated by two separate groups of investigators display rhythmicity, albeit with a shortened free-running period (38, 39). Per1 knock-outs from a third group have disrupted rhythms only after an extended period in constant darkness (40). Thus, aggregate data argue for the placing of Per1 on an input pathway leading from light/GLU. Interestingly, the overall behavior of Per1 in the SCN is remarkably similar to that of several immediate early genes, especially the fos and jun families (26, 37, 41-43). The mRNAs for several fos and jun family members oscillate with a peak immediately proceeding that of Per1. Light responsiveness reveals additional similarity: nocturnal light causes rapid, transient fluctuations in Per1 and fos and jun family members (11-15, 31, 37, 41), possibly via common CRE-elements in their promoters (13, 31, 33).

Cellular mechanisms that couple the light/GLU signal to activation of CREB and, subsequently, induction of Per1 remain unclear. A number of kinases are known to phosphorylate CREB and activate CRE-mediated transcription. A recent study suggests that activation of cAMP/PKA and MAPK pathways can activate CRE-mediated induction of Per1 in transfected human choriocarcinoma JEG3 cells (29). Caution must be employed when equating signal transduction in transfected cells to native SCN neurons that may or may not contain the same innate signaling elements and networks. Whereas our data clearly indicate that light/GLU phase shifts and Per1 induction are completely blocked in the absence of CREB-activated transcription in the SCN, activation of PKA and MAPK are insufficient to account for these data. The MAPK pathway is activated by nocturnal light signals, but inhibition of MAPK only partially blocks light/GLU-induced phase shifts (16, 44). cAMP is elevated after nocturnal GLU stimulus, and inhibition of PKA blocks GLU-induced phase delays, but exogenous activation of PKA does not reset the clock at night; inhibition of PKA actually augments light/GLU-phase advances (16, 46). On the other hand, phosphorylation of CREB on Ser142, a site identified as a substrate for only casein kinase II (47) and CaMKII (48-50), is required for light-induced phase shifting (30). However, inhibition of CaMK only attenuates light-induced phase shifts (51-53); effects of casein kinase II on CREB activation in the SCN and phase-shifts are unknown.

Thus, many of these signaling pathways cannot by themselves account fully for the transduction of the light response to the transcriptional apparatus. However, Ca2+ pathways that act via NO are entirely necessary. A Ca2+-exclusive activation mechanism may provide a basis for neuron-specific/Ca2+-selective induction of gene programs (54), such as light/GLU-induced phase shifting in the SCN. GLU, the neurotransmitter that conveys the light signal to the SCN, activates N-methyl-D-aspartate receptors to increase intracellular Ca2+ and eventually to release of nitric oxide. Nitric-oxide synthase inhibitors fully block light/GLU-induced phase shifts (2). In early night, GLU-induced NO release leads to ryanodine receptor-mediated Ca2+-induced Ca2+ release, a step limited to and necessary for phase delay (5). In late night, GLU-induced NO release activates the cGMP/PKG signaling cascade, a pathway also requiring Ca2+ activation. Unlike inhibition of MAPK or CaMK, PKG inhibition completely blocks light/GLU-induced phase advances (3-5). Understanding PKG, MAPK, CaMK, and CREB signaling will elucidate their targets and interrelationships. Thus, signaling that can activate CREB and induce phase shifts in the SCN is complex, and the present data are incomplete.

Overall, our demonstration of critical roles for CRE activation and Per1 production emphasize the roles these elements play in transforming the light/GLU signal into broad transcriptional activation of many genes (55). Many promoters contain CRE sites. Why should the CREs of Per1 be the first activated and the gatekeepers of the genomic response to light? How do the multiplicity of signals that impinge on the Per1 promoter not only activate it, but do so in a way that permits decoding of the light signal so that intensity and time-of-day are integrated in an adaptive response? The aggregate physiological data emerging from analysis of the integrated physiological response, phase-shifting in native tissue, argue for a central role for NO/Ca2+-signaling via CREB activation of Per1. While multiple kinases have been identified as modulatory to CREB (PKA, MAPK, CaMK), their effects do not explain why CREB activation is essential. Nor do we know if additional regulatory elements in the Per1 promoter are contributory. Thus, a multiplicity of intracellular signals, each activated by the impinging light signal, are required to activate the transcriptosome leading to elevation of Per1 and, ultimately, resetting of the circadian clock. The importance of each of these signals remains the topic of future investigation.

    FOOTNOTES

* This work was supported by United States Public Health Service Grants NS22155 and HL67007 (to M. U. G), NS10170 (to S. A. T.), NS11158 (to J. W. M.), and MH12351 (to G. F. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Current address: Dept. of Veterinary Biosciences, 3615 VMBSB, 2001 S. Lincoln Ave., Urbana, IL 61802.

** To whom correspondence should be addressed: Dept. of Cell & Structural Biology, University of Illinois, B107 CLSL, 601 S. Goodwin Ave., Urbana, IL 61801. Tel.: 217-244-1355; Fax: 217-333-4561; E-mail: mgillett@uiuc.edu.

Published, JBC Papers in Press, October 29, 2002, DOI 10.1074/jbc.M209241200

    ABBREVIATIONS

The abbreviations used are: SCN, suprachiasmatic nucleus; GLU, glutamate; PKG, protein kinase G; PKA, protein kinase A; CRE, Ca2+/cAMP response element; CREB, Ca2+/cAMP response element-binding protein; ODN, oligodeoxynucleotide; CT, circadian time; CREM, Ca2+/cAMP response element modulator; MAPK, mitogen-activated protein kinase; CaMK, calmodulin kinase; ANOVA, analysis of variance.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Gillette, M. U., and Tischkau, S. A. (1999) Recent Prog. Horm. Res. 54, 33-59[Medline] [Order article via Infotrieve]
2. Ding, J. M., Chen, D., Weber, E. T., Faiman, L. E., Rea, M. A., and Gillette, M. U. (1994) Science 266, 1713-1717[Abstract/Free Full Text]
3. Weber, E. T., Gannon, R. L., and Rea, M. A. (1995) Neurosci. Lett. 197, 227-230[CrossRef][Medline] [Order article via Infotrieve]
4. Mathur, A., Golombek, D. A., and Ralph, M. R. (1996) Am. J. Physiol. 270, R1031-R1036[Medline] [Order article via Infotrieve]
5. Ding, J. M., Buchanan, G. F., Tischkau, S. A., Chen, D., Kuriashkina, L. R., Faiman, L. E., Alster, J. M., McPherson, P. S., Campbell, K. P., and Gillette, M. U. (1998) Nature 384, 381-384
6. King, D. P., and Takahashi, J. S. (2000) Annu. Rev. Neurosci. 23, 713-742[CrossRef][Medline] [Order article via Infotrieve]
7. Ginty, D. D., Kornhauser, J. M., Thompson, M. A., Bading, H., Mayo, K. E., Takahashi, J. S., and Greenberg, M. E. (1993) Science 260, 238-241[Abstract/Free Full Text]
8. Ding, J. M., Faiman, L. E., Hurst, W. J., Kuriashkina, L. R., and Gillette, M. U. (1997) J. Neurosci. 17, 667-675[Abstract/Free Full Text]
9. Obrietan, K., Impey, S., Smith, D., Athos, J., and Storm, D. R. (1999) J. Biol. Chem. 274, 17748-17756[Abstract/Free Full Text]
10. Albrecht, U., Sun, Z. S., Eichele, G., and Lee, C. C. (1997) Cell 91, 1055-1064[CrossRef][Medline] [Order article via Infotrieve]
11. Shearman, L. P., Zylka, M. J., Weaver, D. R., Kolakowski, J., L. F., and Reppert, S. M. (1997) Neuron 19, 1261-1269[CrossRef][Medline] [Order article via Infotrieve]
12. Shigeyoshi, Y., Taguchi, K., Yamamoto, S., Takekida, S., Yan, L., Tei, H., Moriya, T., Shibata, S., Loros, J. J., Dunlap, J. C., and Okamura, H. (1997) Cell 91, 1043-1053[CrossRef][Medline] [Order article via Infotrieve]
13. Takumi, T., Matsubara, C., Shigeyoshi, Y., Taguchi, K., Yagita, K., Maebayashi, Y., Sakakida, Y., Okumura, K., Takashima, N., and Okamura, H. (1998) Genes Cells 3, 167-176[Abstract]
14. Zylka, M. J., Shearman, L. P., Weaver, D. R., and Reppert, S. M. (1998) Neuron 20, 1103-1110[CrossRef][Medline] [Order article via Infotrieve]
15. Miyake, S., Sumi, Y., Yan, L., Takekida, S., Fukuyama, T., Ishida, Y., Yamaguchi, S., Yagita, K., and Okamura, H. (2000) Neurosci. Lett. 294, 41-44[CrossRef][Medline] [Order article via Infotrieve]
16. Tischkau, S. A., Gallman, E. A., Buchanan, G. F., and Gillette, M. U. (2000) J. Neurosci. 20, 7830-7837[Abstract/Free Full Text]
17. Dash, P. K., Moore, A. N., and Dixon, C. E. (1995) J. Neurosci. 15, 2030-2039[Abstract]
18. Park, Y. G., Nesterova, M., Agrawal, S., and Cho-Chung, Y. S. (1999) J. Biol. Chem. 274, 1573-1580[Abstract/Free Full Text]
19. Prosser, R. A., and Gillette, M. U. (1989) J. Neurosci. 9, 1073-1081[Abstract]
20. Tischkau, S. A., Barnes, J. A., Lin, F.-J., Myers, E., Barnes, J. W., Meyer-Bernstein, E., Hurst, W. J., Burgoon, P. W., Chen, D., Sehgal, A., and Gillette, M. U. (1999) J. Neurosci. RC15, 1-6
21. Colwell, C. S., and Menaker, M. (1992) J. Biol. Rhythms 7, 125-136[Abstract/Free Full Text]
22. Shibata, S., Watanabe, A., Hamada, T., Tominaga, K., and Watanabe, S. (1994) Am. J. Physiol. 267, R360-R364[Medline] [Order article via Infotrieve]
23. Shirakawa, T., and Moore, R. Y. (1994) Neurosci. Lett. 178, 47-50[CrossRef][Medline] [Order article via Infotrieve]
24. Mintz, E. M., Marvel, C. L., Gillespie, C. F., Price, K. M., and Albers, H. E. (1999) J. Neurosci. 19, 5124-5130[Abstract/Free Full Text]
25. Edelstein, K., Beaule, C., D'Abramo, R., and Amir, S. (2000) Brain Res. 870, 54-65[CrossRef][Medline] [Order article via Infotrieve]
26. Guido, M. E., de Guido, L. B., Goguen, D., Robertson, H. A., and Rusak, B. (1999) J. Biol. Rhythms 14, 275-280[Abstract/Free Full Text]
27. Beaule, C., and Amir, S. (1999) Brain Res. 821, 95-100[CrossRef][Medline] [Order article via Infotrieve]
28. Kornhauser, J. M., Mayo, K. E., and Takahashi, J. S. (1996) Behav. Genet. 26, 221-240[CrossRef][Medline] [Order article via Infotrieve]
29. Travnickova-Bendova, Z., Cermakian, N., Reppert, S. M., and Sassone-Corsi, P. (2002) Proc. Natl. Acad. Sci. U. S. A.  99, 7728-7733[Abstract/Free Full Text]
30. Gau, D., Lemberger, T., von Gall, C., Kretz, O., Le, Minh, N., Gass, P., Schmid, W., Schibler, U., Korf, H., and Schutz, G. (2002) Neuron 34, 245-253[CrossRef][Medline] [Order article via Infotrieve]
31. Yamaguchi, S., Mitsui, S., Miyake, S., Yan, L., Onishi, H., Yagita, K., Suzuki, M., Shibata, S., Kobayashi, K., and Okamura, H. (2000) Curr. Biol. 10, 873-876[CrossRef][Medline] [Order article via Infotrieve]
32. Akiyama, M., Kouzu, Y., Takahashi, S., Wakamatsu, H., Moriya, T., Maetani, M., Watanabe, S., Tei, H., Sakaki, Y., and Shibata, S. (1999) J. Neurosci. 19, 1115-1121[Abstract/Free Full Text]
33. Takumi, T., Taguchi, K., Miyake, S., Sakakida, Y., Takashima, N., Matsubara, C., Maebayashi, Y., Okamura, K., Takekida, S., Yamamoto, S., Yagita, K., Yan, L., Young, M., and Okamura, H. (1998) EMBO J. 17, 4753-4759[CrossRef][Medline] [Order article via Infotrieve]
34. Best, J. D., Maywood, E. S., Smith, K. L., and Hastings, M. H. (1999) J. Neurosci. 19, 828-835[Abstract/Free Full Text]
35. van der Horst, G. T., Muijtjens, M., Kobayashi, K., Takano, R., Kanno, S., Takao, M., de Wit, J., Verkerk, A., Eker, A. P., van Leenan, D., Buijs, R. M., Bootsma, D., J. H., H., and Yasui, A. (1999) Nature 398, 627-630[CrossRef][Medline] [Order article via Infotrieve]
36. Zheng, B., Larkin, D. W., Albrecht, U., Sun, Z. S., Sage, M., Eichele, G., Lee, C., and Bradley, A. (1999) Nature 400, 169-173[CrossRef][Medline] [Order article via Infotrieve]
37. Kornhauser, J. M., Nelson, D. E., Mayo, K. E., and Takahashi, J. S. (1990) Neuron 5, 127-134[CrossRef][Medline] [Order article via Infotrieve]
38. Cermakian, N., Monaco, L., Pando, M., Dierich, A., and Sassone-Corsi, P. (2001) EMBO J. 20, 3967-3974[CrossRef][Medline] [Order article via Infotrieve]
39. Zheng, B., Albrecht, U., Kaasik, K., Sage, M., Lu, W., Vaishnav, S., Li, Q., Sun, Z. S., Eichele, G., Bradley, A., and Lee, C. (2001) Cell 105, 683-694[CrossRef][Medline] [Order article via Infotrieve]
40. Bae, K., Jin, X., Maywood, E. S., Hastings, M. H., Reppert, S. M., and Weaver, D. R. (2001) Neuron 30, 525-536[CrossRef][Medline] [Order article via Infotrieve]
41. Kornhauser, J. M., Nelson, D. E., Mayo, K. E., and Takahashi, J. S. (1992) Science 255, 1581-1584[Abstract/Free Full Text]
42. Rusak, B., Robertson, H. A., Wisden, W., and Hunt, S. P. (1990) Science 248, 1237-1240[Abstract/Free Full Text]
43. Rusak, B., McNaughton, L., Robertson, H. A., and Hunt, S. P. (1992) Brain Res. Mol. Brain Res. 28, 831-835
44. Obrietan, K., Impey, S., and Storm, D. R. (1998) Nat. Neurosci. 1, 693-700[CrossRef][Medline] [Order article via Infotrieve]
45. Hurst, W. J., Mitchell, J. W., and Gillette, M. U. (2002) Biochem. Biophys. Res. Commun. 298, 133-143[CrossRef][Medline] [Order article via Infotrieve]
46. Chen, D., Buchanan, G. F., Ding, J. M., Hannibal, J., and Gillette, M. U. (1999) Proc. Natl. Acad. Sci. U. S. A.  96, 13468-13473[Abstract/Free Full Text]
47. Parker, D., Ulupi, S. J., Radhakrishnan, I., Yaffe, M. B., Reyes, C., Shulman, A. I., Cantley, L. C., Wright, P. E., and Montminy, M. (1998) Mol. Cell 2, 353-359[CrossRef][Medline] [Order article via Infotrieve]
48. Enslen, H., Sun, P., Brickey, D., Soderling, S. H., Klamo, E., and Soderling, T. R. (1994) J. Biol. Chem 269, 15520-15527[Abstract/Free Full Text]
49. Sun, P., Enslen, H., Myung, P., and Maurer, R. (1994) Genes Dev. 8, 2527-2539[Abstract/Free Full Text]
50. Matthews, R. P., Guthrie, C. R., Wailes, L. M., Zhao, X., Means, A. R., and McKnight, G. S. (1994) Mol. Cell. Biol. 14, 6107-6116[Abstract/Free Full Text]
51. Fukushima, T., Shimazoe, T., Shibata, S., Watanabe, A., Ono, M., Hamada, T., and Watanabe, S. (1997) Neurosci. Lett. 227, 45-48[CrossRef][Medline] [Order article via Infotrieve]
52. Golombek, D. A., and Ralph, M. R. (1994) Neuroreport 5, 1638-1640[Medline] [Order article via Infotrieve]
53. Yokota, S., Yamamoto, M., Moriya, T., Akiyama, M., Fukunaga, K., Miyamoto, E., and Shibata, S. (2001) J. Neurochem. 77, 618-627[CrossRef][Medline] [Order article via Infotrieve]
54. Kornhauser, J. M., Cowan, C. W., Shaywitz, A. J., Dolmetsch, R. E., Griffith, E. C., Hu, L. S., Haddad, C., Xia, Z., and Greenberg, M. E. (2002) Neuron 34, 221-233[CrossRef][Medline] [Order article via Infotrieve]
55. Panda, S., Antoch, M. P., Miller, B. H., Su, A. I., Schook, A. B., Straume, M., Schultz, P. G., Kay, S. A., Takahashi, J. S., and Hogenesch, J. B. (2002) Cell 109, 307-320[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
M. Pfeffer, C. M. Muller, J. Mordel, H. Meissl, N. Ansari, T. Deller, H.-W. Korf, and C. von Gall
The Mammalian Molecular Clockwork Controls Rhythmic Expression of Its Own Input Pathway Components
J. Neurosci., May 13, 2009; 29(19): 6114 - 6123.
[Abstract] [Full Text] [PDF]


Home page
J Biol RhythmsHome page
C. Beaule, J. W. Mitchell, P. T. Lindberg, R. Damadzic, L. E. Eiden, and M. U. Gillette
Temporally restricted role of retinal PACAP: integration of the phase-advancing light signal to the SCN.
J Biol Rhythms, April 1, 2009; 24(2): 126 - 134.
[Abstract] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. M. Vosko, M. H. Hagenauer, D. L. Hummer, and T. M. Lee
Period gene expression in the diurnal degu (Octodon degus) differs from the nocturnal laboratory rat (Rattus norvegicus)
Am J Physiol Regulatory Integrative Comp Physiol, February 1, 2009; 296(2): R353 - R361.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Kunieda, T. Minamino, K. Miura, T. Katsuno, K. Tateno, H. Miyauchi, S. Kaneko, C. A. Bradfield, G. A. FitzGerald, and I. Komuro
Reduced Nitric Oxide Causes Age-Associated Impairment of Circadian Rhythmicity
Circ. Res., March 14, 2008; 102(5): 607 - 614.
[Abstract] [Full Text] [PDF]


Home page
J Biol RhythmsHome page
J. C. Ehlen, C. M. Novak, M. C. Karom, K. L. Gamble, and H. E. Albers
Interactions of GABAA Receptor Activation and Light on Period mRNA Expression in the Suprachiasmatic Nucleus
J Biol Rhythms, February 1, 2008; 23(1): 16 - 25.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. R. Pulivarthy, N. Tanaka, D. K. Welsh, L. De Haro, I. M. Verma, and S. Panda
Reciprocity between phase shifts and amplitude changes in the mammalian circadian clock
PNAS, December 18, 2007; 104(51): 20356 - 20361.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
K. L. Gamble, G. C. Allen, T. Zhou, and D. G. McMahon
Gastrin-Releasing Peptide Mediates Light-Like Resetting of the Suprachiasmatic Nucleus Circadian Pacemaker through cAMP Response Element-Binding Protein and Per1 Activation
J. Neurosci., October 31, 2007; 27(44): 12078 - 12087.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. V. Agostino, S. A. Plano, and D. A. Golombek
Sildenafil accelerates reentrainment of circadian rhythms after advancing light schedules
PNAS, June 5, 2007; 104(23): 9834 - 9839.
[Abstract] [Full Text] [PDF]


Home page
J Biol RhythmsHome page
M. Doi, S. Cho, I. Yujnovsky, J. Hirayama, N. Cermakian, A. C. B. Cato, and P. Sassone-Corsi
Light-Inducible and Clock-Controlled Expression of MAP Kinase Phosphatase 1 in Mouse Central Pacemaker Neurons
J Biol Rhythms, April 1, 2007; 22(2): 127 - 139.
[Abstract] [PDF]


Home page
GENES CELLSHome page
N. Takashima, A. Fujioka, N. Hayasaka, A. Matsuo, J. Takasaki, and Y. Shigeyoshi
Gq/11-induced intracellular calcium mobilization mediates Per2 acute induction in Rat-1 fibroblasts.
Genes Cells, September 1, 2006; 11(9): 1039 - 1049.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
K. Koh, X. Zheng, and A. Sehgal
JETLAG resets the Drosophila circadian clock by promoting light-induced degradation of TIMELESS.
Science, June 23, 2006; 312(5781): 1809 - 1812.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Numano, S. Yamazaki, N. Umeda, T. Samura, M. Sujino, R.-i. Takahashi, M. Ueda, A. Mori, K. Yamada, Y. Sakaki, et al.
Constitutive expression of the Period1 gene impairs behavioral and molecular circadian rhythms.
PNAS, March 7, 2006; 103(10): 3716 - 3721.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
T. Kunieda, T. Minamino, T. Katsuno, K. Tateno, J.-i. Nishi, H. Miyauchi, M. Orimo, S. Okada, and I. Komuro
Cellular Senescence Impairs Circadian Expression of Clock Genes In Vitro and In Vivo
Circ. Res., March 3, 2006; 98(4): 532 - 539.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Yamamoto, Y. Nakahata, M. Tanaka, M. Yoshida, H. Soma, K. Shinohara, A. Yasuda, T. Mamine, and T. Takumi
Acute Physical Stress Elevates Mouse Period1 mRNA Expression in Mouse Peripheral Tissues via a Glucocorticoid-responsive Element
J. Biol. Chem., December 23, 2005; 280(51): 42036 - 42043.
[Abstract] [Full Text] [PDF]


Home page
J Biol RhythmsHome page
M. Noshiro, M. Furukawa, S. Honma, T. Kawamoto, T. Hamada, K.-i. Honma, and Y. Kato
Tissue-Specific Disruption of Rhythmic Expression of Dec1 and Dec2 in Clock Mutant Mice
J Biol Rhythms, October 1, 2005; 20(5): 404 - 418.
[Abstract] [PDF]


Home page
J. Immunol.Home page
A. Arjona and D. K. Sarkar
Circadian Oscillations of Clock Genes, Cytolytic Factors, and Cytokines in Rat NK Cells
J. Immunol., June 15, 2005; 174(12): 7618 - 7624.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. C. Zambon, L. Zhang, S. Minovitsky, J. R. Kanter, S. Prabhakar, N. Salomonis, K. Vranizan, I. Dubchak, B. R. Conklin, and P. A. Insel
Gene expression patterns define key transcriptional events in cell-cycle regulation by cAMP and protein kinase A
PNAS, June 14, 2005; 102(24): 8561 - 8566.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
W. Nakamura, S. Yamazaki, N. N. Takasu, K. Mishima, and G. D. Block
Differential Response of Period 1 Expression within the Suprachiasmatic Nucleus
J. Neurosci., June 8, 2005; 25(23): 5481 - 5487.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. Q. Butcher, B. Lee, H.-Y. M. Cheng, and K. Obrietan
Light Stimulates MSK1 Activation in the Suprachiasmatic Nucleus via a PACAP-ERK/MAP Kinase-Dependent Mechanism
J. Neurosci., June 1, 2005; 25(22): 5305 - 5313.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Naruse, K. Oh-hashi, N. Iijima, M. Naruse, H. Yoshioka, and M. Tanaka
Circadian and Light-Induced Transcription of Clock Gene Per1 Depends on Histone Acetylation and Deacetylation
Mol. Cell. Biol., July 15, 2004; 24(14): 6278 - 6287.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Tsuchiya and E. Nishida
Mammalian Cultured Cells as a Model System of Peripheral Circadian Clocks
J. Biochem., December 1, 2003; 134(6): 785 - 790.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. W. Barnes, S. A. Tischkau, J. A. Barnes, J. W. Mitchell, P. W. Burgoon, J. R. Hickok, and M. U. Gillette
Requirement of Mammalian Timeless for Circadian Rhythmicity
Science, October 17, 2003; 302(5644): 439 - 442.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. A. Tischkau, E. T. Weber, S. M. Abbott, J. W. Mitchell, and M. U. Gillette
Circadian Clock-Controlled Regulation of cGMP-Protein Kinase G in the Nocturnal Domain
J. Neurosci., August 20, 2003; 23(20): 7543 - 7550.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
R. N. Van Gelder, E. D. Herzog, W. J. Schwartz, and P. H. Taghert
Circadian Rhythms: In the Loop at Last
Science, June 6, 2003; 300(5625): 1534 - 1535.
[Abstract] [Full Text] [PDF]


Home page
J Biol RhythmsHome page
J. H. Meijer and W. J. Schwartz
In Search of the Pathways for Light-Induced Pacemaker Resetting in the Suprachiasmatic Nucleus
J Biol Rhythms, June 1, 2003; 18(3): 235 - 249.
[Abstract] [PDF]


Home page
J Biol RhythmsHome page
K. Bae and D. R. Weaver
Light-Induced Phase Shifts in Mice Lacking mPER1 or mPER2
J Biol Rhythms, April 1, 2003; 18(2): 123 - 133.
[Abstract] [PDF]


Home page
J. Neurosci.Home page
A. N. Coogan and H. D. Piggins
Circadian and Photic Regulation of Phosphorylation of ERK1/2 and Elk-1 in the Suprachiasmatic Nuclei of the Syrian Hamster
J. Neurosci., April 1, 2003; 23(7): 3085 - 3093.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/718    most recent
M209241200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tischkau, S. A.
Right arrow Articles by Gillette, M. U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tischkau, S. A.
Right arrow Articles by Gillette, M. U.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement