|
Originally published In Press as doi:10.1074/jbc.M209241200 on October 29, 2002
J. Biol. Chem., Vol. 278, Issue 2, 718-723, January 10, 2003
Ca2+/cAMP Response Element-binding Protein
(CREB)-dependent Activation of Per1 Is Required
for Light-induced Signaling in the Suprachiasmatic Nucleus Circadian
Clock*
Shelley A.
Tischkau §¶,
Jennifer W.
Mitchell ,
Sheue-Houy
Tyan §,
Gordon F.
Buchanan , and
Martha U.
Gillette § **
From the Departments of Cell and Structural Biology,
Molecular and Integrative Physiology, and the
§ Neuroscience Program, University of Illinois at
Urbana-Champaign, B107 CLSL, Urbana, Illinois 61801
Received for publication, September 9, 2002, and in revised form, October 29, 2002
 |
ABSTRACT |
Light is a prominent stimulus that synchronizes
endogenous circadian rhythmicity to environmental light/dark cycles.
Nocturnal light elevates mRNA of the Period1
(Per1) gene and induces long term state changes, expressed
as phase shifts of circadian rhythms. The cellular mechanism for
Per1 elevation and light-induced phase advance in the
suprachiasmatic nucleus (SCN), a process initiated primarily by
glutamatergic neurotransmission from the retinohypothalamic tract, was
examined. Glutamate (GLU)-induced phase advances in the rat SCN were
blocked by antisense oligodeoxynucleotide (ODN) against
Per1 and Ca2+/cAMP response element (CRE)-decoy
ODN. CRE-decoy ODN also blocked light-induced phase advances in
vivo. Furthermore, the CRE-decoy blocked GLU-induced accumulation
of Per1 mRNA. Thus, Ca2+/cAMP response
element-binding protein (CREB) and Per1 are integral components of the pathway transducing light-stimulated GLU
neurotransmission into phase advance of the circadian clock.
 |
INTRODUCTION |
Mammalian circadian rhythmicity is generated by endogenous
alternations in transcription/translation of putative clock genes within the suprachiasmatic nucleus
(SCN)1 of the basal
hypothalamus. As a projection site of the retinohypothalamic tract, the
SCN is poised to respond to retinal light information, mediated
primarily by glutamatergic (GLU) neurotransmission, to assure
time-of-day congruence between the endogenous pacemaker and the
external environment. The mechanisms by which the SCN decodes and
processes light information are complex and change as the biochemical
clock states progress through their 24-h cycle (1). Light resets the
clock throughout the night via
glutamatergic-N-methyl-D-aspartate receptor-mediated Ca2+ influx, which activates nitric-oxide
synthase to liberate nitric oxide (NO) (2). At this point, the
light signaling pathway diverges. In the early night, the light-induced
state change, which delays subsequent rhythms, proceeds through
NO-dependent activation of a neuronal ryanodine receptor.
Light-induced state changes in the late night are independent of
ryanodine receptor activation, but require activation of protein kinase
G (PKG) (3-5).
The discovery of several specific genes associated with circadian
rhythmicity, including Period (Per) and
Timeless (Tim) (for review, see Ref. 6), raises
questions regarding the mechanisms that interface nocturnal light
signals with the molecular clockwork. Throughout the night, light
stimuli sufficient to cause long term state changes, or phase shifts,
of circadian rhythms of rodent wheel running correlate with increased
phosphorylation of the transcription factor, Ca2+/cAMP
response element-binding protein (CREB) (7, 8), activation of
Ca2+/cAMP response element (CRE)-mediated transcription
(9), and a rise in Per1 mRNA (10-15). This
investigation was undertaken to determine whether CRE-mediated
activation of Per1 is required for light/GLU-induced phase resetting of
the SCN clock. We hypothesized that the GLU-induced phase advance
requires activation of CRE and elevation of Per1 mRNA.
Therefore, we examined the ability of an oligodeoxynucleotide (ODN)
decoy (CRE-decoy) to 1) sequester CREB and inhibit CRE-mediated
transcription, 2) inhibit GLU-induced phase advances of SCN electrical
activity and light-induced phase advances of wheel running activity,
and 3) block GLU-induced up-regulation of Per1 levels.
 |
EXPERIMENTAL PROCEDURES |
Animals and Circadian Time--
Long-Evans rats (6-12 weeks
old) from our inbred line were used for all in vitro
experiments. After greater than 35 generations of inbreeding, this line
surpasses the requirements for genetic homogeneity, resulting in low
variation for physiological experiments. Rats were entrained to a daily
cycle of 12-h light:12-h dark and provided food and water ad
libitum. Because the rat SCN generates stable 24-h rhythms of
electrical activity when maintained in vitro over the 2-3
days of experimentation, in vitro clock time was determined
from the lighting cycle in the donor colony. Circadian time 0 (CT 0) is
designated as the time of lights on in the donor colony; subjective day
is CT 0-12. Subjective night (CT 12-24) corresponds to the dark
portion of the donor's cycle.
For in vivo behavioral experiments, male B6129PF1/J mice
obtained from The Jackson Laboratory (Bar Harbor, ME) at ~4 weeks of
age were placed in individual cages (27 × 21 × 14 cm)
equipped with running wheels (12-cm diameter). Mice were entrained to a 12-h light: 12-h dark (12:12 light-dark; 100-lux white light) cycle
and then released into constant darkness.
Behavioral Wheel Running Activity Data
Acquisition--
Circadian rhythms of behavior were assessed by
monitoring the wheel-running activity of individually housed mice as
described previously (16). Activity was conveyed to a Pentium III
computer (Micron, Inc.) equipped with Clocklab Acquisition software
(David Ferster, Northwestern University) running in LabView (National Instruments, Inc., Austin, TX). Rhythms were plotted in an actogram with Clocklab Analysis software (David Ferster, Northwestern
University) running in Matlab (Mathworks Co., Natick, MA).
Intra-SCN Cannula Implantation and Injection--
A guide
cannula (26 gauge; 11.2 mm total length; Plastics One, Inc.,
Roanoke, VA) was stereotaxically implanted unilaterally into the SCN
under deep anesthesia (60 mg/kg sodium pentobarbital) using a
stereotaxic apparatus (Stoelting, Wood Dale, IL). Surgical coordinates
from bregma were 0.3-mm anterior-posterior, 0.1-mm medial-lateral, and 1.8-mm dorsal-ventral (from the
surface of dura). The cannula was secured with small machine screws
(Small Parts, Inc., Miami Lakes, FL) inserted into the skull and
cranioplastic cement (Plastics One, Inc., Roanoke, VA). Following
establishment of a well defined, free-running rhythm for at least 10 days, pharmacological manipulations were performed under dim (<1 lux)
red illumination. A 10-µl Hamilton syringe (Hamilton Co., Reno, NV)
fitted with a 1.5-cm piece of polyethylene tubing and a 33-gauge
infusion cannula (Plastics One, Inc., Roanoke, VA) was employed to
administer 0.3 µl of 100 µM CRE-decoy ODN
(tgacgtcatgacgtcatgacgtca) or a 100 µM concentration of a
mismatched sequence of the same nucleotide bases, CRE-mis
(tgtggtcatgtggtcatgtggtca) through the guide cannula and into the SCN
at CT 21.75. CRE-mis and certain CRE-decoy injections were followed 15 min later (CT 22) by 15-min, 20-lux light pulses. Injection sites were
verified histologically, and data from only those animals in which the
tip of the injection cannula penetrated the dorsal border of the SCN
were used for analyses.
Isolation of SCN 2.2 Nuclear Extract and Electromobility Shift
Assay--
Nuclear extracts were isolated as described (17). Briefly,
confluent SCN 2.2 cells were scraped in wash solution (15 mM HEPES, pH 7.2, 250 mM sucrose, 60 mM KCl, 10 mM NaCl, 1 mM EGTA, 5 mM EDTA, 1 mM phenylmethylsulfonyl
fluoride, 2 mM NaF, 2 mM NaPPi, 5 µM mycrocystin-LR] and
centrifuged at 2000 × g for 10 min. Pellets were
resuspended in cell lysis solution (10 mM HEPES, pH 7.2, 1.5 mM MgCl2, 10 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 5 µM
microcystin-LR, 2 mM NaF, 2 mM
NaPPi) and centrifuged at 4000 × g for
10 min to isolate nuclei. The pellet was resuspended in nuclei lysis
solution (100 mM HEPES, pH 7.2, 1.5 mM
MgCl2, 1 mM EDTA, 800 mM NaCl, 2 mM NaF, 2 mM NaPPi, 1 mM phenylmethylsulfonyl fluoride, 5 µM
microcystin-LR, 25% glycerol and centrifuged at 14,000 × g for 30 min to pellet debris. Supernatant was stored at
20 °C until use. The electromobility of the CRE-decoy was adapted
from (18). 5 µg of nuclear extract from SCN 2.2 cells transfected
with 75 nM CRE-decoy or CRE-mis using Effectene (Qiagen) was incubated in 100 ng/µl poly(dI-dC), 300 nM
dithiothreitol, 12 mM Tris pH 8.0, 2 mM
MgCl2, 60 mM KCl, 120 nM EDTA, pH
8.0, 12.5% glycerol for 30 min at 4 °C. 10,000 cpm of
32P-end-labeled CRE-decoy was added and incubated at
37 °C for 10 min. The samples were separated by 8% PAGE and exposed
on a phosphorimager screen.
Luciferase Assay--
Culture extracts were prepared by
resuspending frozen SCN cultures stably transfected with a
CRE-luciferase construct (45) with cell culture lysis buffer (Promega)
at ~25 µl of cell culture lysis buffer/cm2 cell culture
surface area. Samples were centrifuged (2000 × g for 5 min) and supernatant collected for luciferase assay. Luciferase assays
were performed using the Luciferase Assay System (Promega) and measured
on an MLX microtiter plate luminometer (Dynex Technologies) by luc-50.
Protein concentration of samples was determined by BCA protein assay
kit (Pierce) against bovine serum albumin standards in cell culture
lysis buffer. Relative luciferase activity/µg of protein was
determined for each culture.
Preparation and Treatment of Brain Slices--
Coronal brain
slices (500 µm) were prepared at least 2 h prior to the onset of
the dark phase of the light:dark cycle to avoid phase shifts during
preparation (19). Slices maintained at 37 °C (95% 02,
5% C02) in a Hatton-style brain slice chamber were continuously perfused with minimal salts (Earle's balanced salt solution, pH 7.25) and glucose (24 mM). Perifusion was
stopped during treatment. GLU (10 mM, 10 min) was applied
by microdrop (1 µl) to the top of each slice. For antisense
experiments, antisense sequence ( ODN) against the 5' start site of
Per1 (taggggaccactcatgtct), Per2
(tatccattcatgtcg), or Tim (acaagtccatacacc) was applied at a
concentration of 10 µM, 2 h prior to the time of GLU
treatment by replacing the bath with medium containing the experimental reagent.
Single Unit Recordings of SCN Neuronal Activity--
The
phase-shifting effects of stimuli applied to SCN slices in
vitro were assessed using the standard extracellular single unit
recording technique (19). Spontaneous firing rates of individual neurons were grouped into 2-h running averages using 15-min lags. The
time-of-peak for each experiment was determined by visual inspection of
a plot of 2-h running averages for the symmetrically highest point. A
characteristic sinusoidal pattern of change, such that activity was low
at night and peaked near circadian time 7 (CT 7, 7 h after the
onset of light in the donor colony) was observed in vehicle-treated
control slices. Phase shifts were determined by comparing the mean
time-of-peak from treatment groups to vehicle-treated controls. Certain
recordings were performed with the experimenter blind to the treatment conditions.
In Situ Hybridization--
Sixty minutes following the
initiation of GLU treatment, slices were fixed overnight at 4 °C in
4% paraformaldehyde, followed by cryoprotection in 20% sucrose.
Hybridization was performed on 10-µm sections using
digoxygenin-labeled riboprobes (cRNA), as described previously (16,
20). Analysis of mPer1-positive cells was made in a
midcaudal section of the SCN by an individual blind to the experimental
design and identity of the samples.
 |
RESULTS |
CRE-decoy Blocks the Light/GLU-induced Phase
Advance--
The CRE-decoy is a synthetic single-stranded ODN that
self-hybridizes to form duplex/hairpins (18). Theoretically, the
CRE-decoy will sequester phospho-CREB, preventing its binding and
activation of genes containing CRE in their promoters. CRE-decoy and
CRE-mis ODN were used to determine whether activation of CRE sites is required for GLU-induced phase advance of the SCN neuronal firing rate
rhythm. Two initial experiments were performed to demonstrate that
CRE-decoy acts as predicted. The CRE-decoy (75 nM) blocked CRE-CREB binding in SCN 2.2 cells (Fig.
1) and inhibited reporter activity in SCN
2.2 cells stably transfected with a luciferase construct driven by 8 tandem repeats of the CRE-palindrome (Fig. 2). CRE-mis did not block CRE-CREB
binding or alter CRE-driven luciferase activity. These data are in
agreement with a previous study by Park et al. (18)
demonstrating that the CRE-decoy can penetrate cells, bind CREB, and
prevent transcriptional activation from CRE sites.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1.
CRE-decoy blocks binding at CRE sites in SCN
2.2 cells. Electromobility shift assay of a CRE probe incubated
with nuclear extracts of SCN 2.2 cells non-transfected (lane
1) or transfected with the transfection reaction reagent,
Effectene (lane 2), 75 nM CRE-decoy (lane
3), or 75 nM CRE-mis (lane 4). The
arrow indicates the retarded mobility of the CRE probe due
to binding of CREB. This DNA-protein interaction is absent in the SCN
2.2 cells transfected with the CRE-decoy.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 2.
CRE-activated transcription is inhibited by
the addition of the CRE-decoy. Luciferase activity was quantitated
from a SCN 2.2 cell line stably transfected with a luciferase construct
driven by eight CRE sites (45). The relative light units
(RLU) normalized to protein concentrations of cells
transfected with just the transfection reagent, Effectene, or CRE-mis
were similar that of the non-transfected cells (media). However, the
cells transfected with the CRE-decoy demonstrated a significant
inhibition in CRE-activated luciferase activity. ** indicates
statistically significant differences (p < 0.01) as
determined by ANOVA with Tukey's post hoc analysis.
|
|
To determine whether CRE-mediated transcription is required for
GLU-induced phase resetting within the SCN, CRE-decoy (1 µM) was applied to SCN slices prior to stimulation with
GLU. Spontaneous SCN neuronal activity peaked near CT 7 in control
slices (Fig. 3a, mean
time-of-peak = CT 6.78 + 0.10, n = 8). CRE-decoy
did not alter the timing of the SCN electrical activity rhythm when applied alone (Fig. 3, b and f, mean time-of-peak
CT 6.25 + 0.14, n = 3). Application of GLU to SCN
slices at CT 20 caused a phase advance of the SCN electrical activity
rhythm (Fig. 3, c and f, mean time-of-peak = CT 3.41 + 0.18, n = 6). CRE-decoy (Fig. 3, d
and f, mean time-of-peak CT 6.50 + 0.25, n = 3), but not CRE-mis (Fig. 3, e and f, mean
time-of-peak CT 3.47 + 0.12, n = 3), blocked the
GLU-induced phase advance.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibiting CRE activation blocks GLU-induced
phase advances in vitro. a, a
representative control neuronal activity rhythm with a peak near CT 7 on days 1 and 2 in vitro. b, application of
CRE-sense (1 µM) alone from CT 18-20 had no effect on
the time-of-peak electrical activity in vitro. c,
at CT 20, GLU (10 mM) induced a ~3.5-h phase advance in
the SCN electrical activity rhythm. d, CRE-sense (1 µM) blocked the GLU-induced phase advance. e,
CRE-mismatch did not block the GLU-induced phase advance. The bar
graph of mean data (n = 3/condition) demonstrates
samples treated with CRE-decoy are not significantly different from
controls, and GLU treatment samples treated with CRE-mis are not
significantly different from GLU treatment alone. Statistical
treatments were the same as in Fig. 1.
|
|
To determine whether CRE-mediated transcription is required for the
phase resetting that occurs in response to light signals, CRE-decoy
(100 µM) was injected into the SCN 15 min before exposure to a light pulse at CT 22. Neither CRE-decoy nor CRE-mis caused a phase
shift of activity rhythms when injected alone (Fig.
4). Light pulses caused a characteristic
1.1-h phase advance. Phase resetting effects of light were blocked in
the presence of the CRE-decoy. CRE-mis had no effect on light-induced
phase shifts. These data suggest that transcriptional activation at CRE
sites is required for the light-induced phase advance of circadian
behavioral patterns.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibiting CRE activation blocks
light-induced phase advances in vivo.
a-c, representative double-plotted actograms of
wheel-running activity patterns of 2 days in tandem/line. Using
activity onset as phase marker, the data depict unaffected
light-induced phase shift following CRE-mis treatment (a),
lack of light-induced phase advance following CRE-decoy treatment
(b), and unaffected wheel-running rhythm following CRE-decoy
treatment without light pulse (c). Each horizontal
line represents 48-h of wheel-running activity with the second
24 h of each line redrawn as the first 24 h on the next line.
Vertical marks represent 6-min bins of activity plotted
relative to the maximum activity of the animals for the duration of the
record. Diagonal lines are drawn to ease visualization of
phase shifts. d, summary bar graph depicting
magnitudes of responses following the three conditions as indicated.
CRE-decoy + light pulse and CRE-decoy alone do not induce significant
changes in phase of these activity rhythms. * = p < 0.05; = time of
light pulse.
|
|
Elevation of Per1 mRNA Is Required for GLU-induced Phase
Advance--
Alterations in the circadian timing of wheel-running
activity and SCN firing rate rhythms represent behavioral and
physiological changes associated with light at night. Likewise,
induction of Per1 has become a marker of the molecular
response to nocturnal light/GLU. To determine whether mRNA for
Per1, Per2, or Tim is required for
GLU-induced phase advance, ODN surrounding the 5' start site of each
mRNA was applied to the SCN slice in the presence or absence of GLU
(Fig. 5). Spontaneous SCN neuronal
activity peaked near CT 7 in control slices (Fig. 5a, mean
time-of-peak = CT 6.78 + 0.10, n = 8). GLU induced
a ~3.5-h phase advance in the time-of-peak neuronal activity compared
with controls (Fig. 5b, mean time-of-peak CT 3.42 + 0.14, n = 6). Per1 ODN alone did not alter the
time-of-peak (Fig. 5c, mean time-of-peak = CT 6.42 + 0.35, n = 3). Upon GLU stimulation, Per1
ODN blocked the usual ~3.5-h phase advance (Fig. 5d,
mean time-of-peak = 6.56 + 0.21, n = 3). A
Per1 sense ODN (Fig. 5e, mean time-of-peak = 3.75 + 0.12, n = 3), and a Per1 ODN carrying
three mismatched nucleotides (Fig. 5f, mean time-of
peak = 3.53 + 0.35, n = 3) had no effect on
GLU-induced phase advances. Thus, Per1 mRNA induction is
required for GLU-induced clock resetting in the late night. On the
other hand, Tim ODN (Fig. 5g, mean
time-of-peak CT 3.6 + 0.22, n = 3) or Per2
(Fig. 5g, time-of-peak CT 3.11 + 0.75, n = 3) did not effect the GLU-induced phase advances.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Per1 is required for GLU to induce
phase shifts in vitro. a, the
spontaneous electrical activity rhythm peaks near CT 7 in controls.
b, at CT 20, GLU (10 mM, 10 min) advanced the
electrical activity rhythm by ~3.5 h. c, Per1
ODN (10 µM) applied from CT 18-20 had no effect on
the time-of-peak electrical activity. d, Per1
ODN blocked the GLU-induced phase advance at CT 20. e,
Per sense ODN (10 µM) applied from CT 18-20
had no effect on the GLU-induced advance in time-of-peak electrical
activity. f, Per missense ODN did not block the
GLU-induced phase advance at CT 20. g, summary of the
effects of Per1, Per2, and Tim
antisense ODNs on GLU-induced phase advances at CT 20. ** indicates
statistically significant differences (p < 0.01) as
determined by ANOVA with Tukey's post hoc analysis.
|
|
CRE Activation Regulates GLU Induction of Per1--
To determine
whether the rise in Per1 mRNA induced by GLU and
required for the phase shift is mediated by CREB activation, SCN slices
were treated and analyzed for Per1 by in situ
hybridization. The number of Per1-positive cells increased
400% by 60 min after GLU treatment at CT 20 (Fig.
6, p < 0.01), consistent
with previous results (16). Whereas treatment with CRE-decoy alone did
not affect Per1 levels, the decoy blocked GLU induction of
Per1 (Fig. 6). These data suggest that activation of
CREB-regulated transcription is required to induce Per1
mRNA.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of inhibiting CRE activation on
GLU-induced Per1 mRNA levels in the SCN at CT
20. a, a digoxygenin-labeled cRNA probe detected low
basal levels of Per1 mRNA in control sections.
b, GLU significantly elevated Per1 mRNA 60 min after GLU treatment at CT 20. c, inhibition of
CRE-mediated transcription blocked GLU-induced Per1 at CT
20. d, for quantitation, positive cells were counted from
one SCN in a single, midcaudal section by an experimenter blind to the
treatment. Bars represent mean ± S.E. of four to six
independent experiments. * represents statistically significant
differences compared with control values at the same circadian time as
determined by ANOVA (p < 0.01) with Tukey's
post hoc analysis.
|
|
 |
DISCUSSION |
Mechanisms coupling environmental light signals to molecular
changes that lead to long term state changes within the circadian clock
are emerging as complex and multifunctional. Nocturnal light resets the
circadian clock through glutamatergic neurotransmission of
retinohypothalamic tract origin (2, 21-24). Throughout the night,
light/GLU phosphorylates CREB (7, 8), activates CRE-mediated transcription (9), and stimulates immediate early genes (25-28) and
the clock gene Per1 (10-15). Our data provide definitive
evidence that CRE-regulated activation of mPer1 mRNA is
required for light/GLU-induced phase advances during the late
subjective night as predicted from the studies of Travnickova-Benova
et al. on transfected JEG3 cells (29).
Inhibition of CRE-mediated transcription by an exogenous CRE sequence
(CRE-decoy) that binds CREB, thereby outcompeting its binding to
endogenous CRE, conclusively demonstrates that CREB/CRE-activated transcriptional events are required for the light/GLU-induced phase
advance. These results extend the findings of a previous study that
defined a requirement for CREB phosphorylation on Ser142
for light-induced phase shifts (30) by demonstrating that CRE-activated transcriptional events are also required.
The presence of CRE-elements (31) capable of binding CREB and
responding to forskolin and EGF (29) in the Per1 promoter has suggested that one critical function of light/GLU-induced CRE-mediated transcription is generation of new Per1
mRNA. Elevation of Per1 mRNA in response to light is
a hallmark of the response of the mammalian molecular clockworks to
light. Induction of Per1 is required for light/GLU-induced
phase shifts in both early (32) and late night (Fig. 5). Blockage of
GLU-induced Per1 accumulation in the presence of the
CRE-decoy provides compelling evidence that CRE-mediated transcription
contributes to increased levels of Per1. Whereas our data do
not exclude a role for ATF-1 or ATF-2 interaction with CRE elements, a
previous study indicates that ATF-1 and ATF-2 do not bind the
CRE-element in the Per1 promoter (29). We also did not examine the role
of CREM in the Per1 promoter. However, because CREM inhibits
CRE-mediated transcription, it is unlikely that induction of
Per1 mRNA is mediated by CREM.
Our data designate Per1 as an integral component of the
input pathway for light/GLU signaling and reveal a critical distinction between induction of Per1 and
Per2/Tim. ODN against Per2 and
Tim had no effect on GLU-induced phase shifts when applied
in a 2-h window before and during the stimulus. Per2, which
also contains a canonical CRE within its promoter (29), may also be
induced by light (14, 33). Our data suggest that Per2 is not
required for light/GLU-induced phase advance. CREB-142 knock-out mice
(30), which show increased Per2 despite a severely
attenuated phase-shifting reponse to light, are consistent with our
data and suggest different roles for Per1 versus Per2.
Because elevation of Tim by light is restricted to early
night (20), it is unlikely that Tim mRNA plays a role in
the late night. We hypothesize that any light/GLU-induced alteration in
Per2 or Tim is a consequence of the
reestablishment of the new circadian phase, which happens in less than
1 h in response to the phase-shifting event (34).
These data raise a fundamental question with regard to the role of
Per1 within the molecular clockwork. Is Per1 part
of the core clock mechanism or exclusively a component of an input or entrainment pathway? The absence of free-running circadian rhythms in
mice lacking Per2, Cry1, and Cry2 has
established those genes as core elements in the mammalian clock
(35-37). The data from Per1 knock-out mice are less
definitive. Per1 knock-outs generated by two separate groups
of investigators display rhythmicity, albeit with a shortened
free-running period (38, 39). Per1 knock-outs from a third
group have disrupted rhythms only after an extended period in constant
darkness (40). Thus, aggregate data argue for the placing of
Per1 on an input pathway leading from light/GLU. Interestingly, the overall behavior of Per1 in the SCN is
remarkably similar to that of several immediate early genes, especially
the fos and jun families (26, 37, 41-43). The
mRNAs for several fos and jun family members
oscillate with a peak immediately proceeding that of Per1.
Light responsiveness reveals additional similarity: nocturnal light
causes rapid, transient fluctuations in Per1 and fos and jun family members (11-15, 31, 37, 41),
possibly via common CRE-elements in their promoters (13, 31, 33).
Cellular mechanisms that couple the light/GLU signal to activation of
CREB and, subsequently, induction of Per1 remain unclear. A
number of kinases are known to phosphorylate CREB and activate CRE-mediated transcription. A recent study suggests that activation of
cAMP/PKA and MAPK pathways can activate CRE-mediated induction of
Per1 in transfected human choriocarcinoma JEG3 cells (29). Caution must be employed when equating signal transduction in transfected cells to native SCN neurons that may or may not contain the
same innate signaling elements and networks. Whereas our data clearly
indicate that light/GLU phase shifts and Per1 induction are
completely blocked in the absence of CREB-activated transcription in
the SCN, activation of PKA and MAPK are insufficient to account for
these data. The MAPK pathway is activated by nocturnal light signals,
but inhibition of MAPK only partially blocks light/GLU-induced phase
shifts (16, 44). cAMP is elevated after nocturnal GLU stimulus, and
inhibition of PKA blocks GLU-induced phase delays, but exogenous
activation of PKA does not reset the clock at night; inhibition of PKA
actually augments light/GLU-phase advances (16, 46). On the
other hand, phosphorylation of CREB on Ser142, a site
identified as a substrate for only casein kinase II (47) and CaMKII
(48-50), is required for light-induced phase shifting (30). However,
inhibition of CaMK only attenuates light-induced phase shifts (51-53);
effects of casein kinase II on CREB activation in the SCN and
phase-shifts are unknown.
Thus, many of these signaling pathways cannot by themselves account
fully for the transduction of the light response to the transcriptional
apparatus. However, Ca2+ pathways that act via NO are
entirely necessary. A Ca2+-exclusive activation mechanism
may provide a basis for neuron-specific/Ca2+-selective
induction of gene programs (54), such as light/GLU-induced phase
shifting in the SCN. GLU, the neurotransmitter that conveys the light
signal to the SCN, activates
N-methyl-D-aspartate receptors to
increase intracellular Ca2+ and eventually to release of
nitric oxide. Nitric-oxide synthase inhibitors fully block
light/GLU-induced phase shifts (2). In early night, GLU-induced NO
release leads to ryanodine receptor-mediated Ca2+-induced
Ca2+ release, a step limited to and necessary for phase
delay (5). In late night, GLU-induced NO release activates the cGMP/PKG
signaling cascade, a pathway also requiring Ca2+
activation. Unlike inhibition of MAPK or CaMK, PKG inhibition completely blocks light/GLU-induced phase advances (3-5).
Understanding PKG, MAPK, CaMK, and CREB signaling will elucidate
their targets and interrelationships. Thus, signaling that can activate
CREB and induce phase shifts in the SCN is complex, and the present data are incomplete.
Overall, our demonstration of critical roles for CRE activation and
Per1 production emphasize the roles these elements play in
transforming the light/GLU signal into broad transcriptional activation
of many genes (55). Many promoters contain CRE sites. Why should the
CREs of Per1 be the first activated and the gatekeepers of
the genomic response to light? How do the multiplicity of signals that
impinge on the Per1 promoter not only activate it, but do so
in a way that permits decoding of the light signal so that intensity
and time-of-day are integrated in an adaptive response? The aggregate
physiological data emerging from analysis of the integrated
physiological response, phase-shifting in native tissue, argue for a
central role for NO/Ca2+-signaling via CREB activation of
Per1. While multiple kinases have been identified as
modulatory to CREB (PKA, MAPK, CaMK), their effects do not explain why
CREB activation is essential. Nor do we know if additional regulatory
elements in the Per1 promoter are contributory. Thus, a
multiplicity of intracellular signals, each activated by the impinging
light signal, are required to activate the transcriptosome leading to
elevation of Per1 and, ultimately, resetting of the
circadian clock. The importance of each of these signals remains the
topic of future investigation.
 |
FOOTNOTES |
*
This work was supported by United States Public Health
Service Grants NS22155 and HL67007 (to M. U. G), NS10170 (to
S. A. T.), NS11158 (to J. W. M.), and MH12351 (to
G. F. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Current address: Dept. of Veterinary Biosciences, 3615 VMBSB,
2001 S. Lincoln Ave., Urbana, IL 61802.
**
To whom correspondence should be addressed: Dept. of Cell & Structural Biology, University of Illinois, B107 CLSL, 601 S. Goodwin
Ave., Urbana, IL 61801. Tel.: 217-244-1355; Fax: 217-333-4561; E-mail:
mgillett@uiuc.edu.
Published, JBC Papers in Press, October 29, 2002, DOI 10.1074/jbc.M209241200
 |
ABBREVIATIONS |
The abbreviations used are:
SCN, suprachiasmatic nucleus;
GLU, glutamate;
PKG, protein kinase G;
PKA, protein kinase A;
CRE, Ca2+/cAMP response element;
CREB, Ca2+/cAMP response element-binding protein;
ODN, oligodeoxynucleotide;
CT, circadian time;
CREM, Ca2+/cAMP response element modulator;
MAPK, mitogen-activated protein kinase;
CaMK, calmodulin kinase;
ANOVA, analysis of variance.
 |
REFERENCES |
| 1.
|
Gillette, M. U.,
and Tischkau, S. A.
(1999)
Recent Prog. Horm. Res.
54,
33-59[Medline]
[Order article via Infotrieve]
|
| 2.
|
Ding, J. M.,
Chen, D.,
Weber, E. T.,
Faiman, L. E.,
Rea, M. A.,
and Gillette, M. U.
(1994)
Science
266,
1713-1717[Abstract/Free Full Text]
|
| 3.
|
Weber, E. T.,
Gannon, R. L.,
and Rea, M. A.
(1995)
Neurosci. Lett.
197,
227-230[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Mathur, A.,
Golombek, D. A.,
and Ralph, M. R.
(1996)
Am. J. Physiol.
270,
R1031-R1036[Medline]
[Order article via Infotrieve]
|
| 5.
|
Ding, J. M.,
Buchanan, G. F.,
Tischkau, S. A.,
Chen, D.,
Kuriashkina, L. R.,
Faiman, L. E.,
Alster, J. M.,
McPherson, P. S.,
Campbell, K. P.,
and Gillette, M. U.
(1998)
Nature
384,
381-384
|
| 6.
|
King, D. P.,
and Takahashi, J. S.
(2000)
Annu. Rev. Neurosci.
23,
713-742[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Ginty, D. D.,
Kornhauser, J. M.,
Thompson, M. A.,
Bading, H.,
Mayo, K. E.,
Takahashi, J. S.,
and Greenberg, M. E.
(1993)
Science
260,
238-241[Abstract/Free Full Text]
|
| 8.
|
Ding, J. M.,
Faiman, L. E.,
Hurst, W. J.,
Kuriashkina, L. R.,
and Gillette, M. U.
(1997)
J. Neurosci.
17,
667-675[Abstract/Free Full Text]
|
| 9.
|
Obrietan, K.,
Impey, S.,
Smith, D.,
Athos, J.,
and Storm, D. R.
(1999)
J. Biol. Chem.
274,
17748-17756[Abstract/Free Full Text]
|
| 10.
|
Albrecht, U.,
Sun, Z. S.,
Eichele, G.,
and Lee, C. C.
(1997)
Cell
91,
1055-1064[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Shearman, L. P.,
Zylka, M. J.,
Weaver, D. R.,
Kolakowski, J., L. F.,
and Reppert, S. M.
(1997)
Neuron
19,
1261-1269[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Shigeyoshi, Y.,
Taguchi, K.,
Yamamoto, S.,
Takekida, S.,
Yan, L.,
Tei, H.,
Moriya, T.,
Shibata, S.,
Loros, J. J.,
Dunlap, J. C.,
and Okamura, H.
(1997)
Cell
91,
1043-1053[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Takumi, T.,
Matsubara, C.,
Shigeyoshi, Y.,
Taguchi, K.,
Yagita, K.,
Maebayashi, Y.,
Sakakida, Y.,
Okumura, K.,
Takashima, N.,
and Okamura, H.
(1998)
Genes Cells
3,
167-176[Abstract]
|
| 14.
|
Zylka, M. J.,
Shearman, L. P.,
Weaver, D. R.,
and Reppert, S. M.
(1998)
Neuron
20,
1103-1110[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Miyake, S.,
Sumi, Y.,
Yan, L.,
Takekida, S.,
Fukuyama, T.,
Ishida, Y.,
Yamaguchi, S.,
Yagita, K.,
and Okamura, H.
(2000)
Neurosci. Lett.
294,
41-44[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Tischkau, S. A.,
Gallman, E. A.,
Buchanan, G. F.,
and Gillette, M. U.
(2000)
J. Neurosci.
20,
7830-7837[Abstract/Free Full Text]
|
| 17.
|
Dash, P. K.,
Moore, A. N.,
and Dixon, C. E.
(1995)
J. Neurosci.
15,
2030-2039[Abstract]
|
| 18.
|
Park, Y. G.,
Nesterova, M.,
Agrawal, S.,
and Cho-Chung, Y. S.
(1999)
J. Biol. Chem.
274,
1573-1580[Abstract/Free Full Text]
|
| 19.
|
Prosser, R. A.,
and Gillette, M. U.
(1989)
J. Neurosci.
9,
1073-1081[Abstract]
|
| 20.
|
Tischkau, S. A.,
Barnes, J. A.,
Lin, F.-J.,
Myers, E.,
Barnes, J. W.,
Meyer-Bernstein, E.,
Hurst, W. J.,
Burgoon, P. W.,
Chen, D.,
Sehgal, A.,
and Gillette, M. U.
(1999)
J. Neurosci.
RC15,
1-6
|
| 21.
|
Colwell, C. S.,
and Menaker, M.
(1992)
J. Biol. Rhythms
7,
125-136[Abstract/Free Full Text]
|
| 22.
|
Shibata, S.,
Watanabe, A.,
Hamada, T.,
Tominaga, K.,
and Watanabe, S.
(1994)
Am. J. Physiol.
267,
R360-R364[Medline]
[Order article via Infotrieve]
|
| 23.
|
Shirakawa, T.,
and Moore, R. Y.
(1994)
Neurosci. Lett.
178,
47-50[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Mintz, E. M.,
Marvel, C. L.,
Gillespie, C. F.,
Price, K. M.,
and Albers, H. E.
(1999)
J. Neurosci.
19,
5124-5130[Abstract/Free Full Text]
|
| 25.
|
Edelstein, K.,
Beaule, C.,
D'Abramo, R.,
and Amir, S.
(2000)
Brain Res.
870,
54-65[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Guido, M. E.,
de Guido, L. B.,
Goguen, D.,
Robertson, H. A.,
and Rusak, B.
(1999)
J. Biol. Rhythms
14,
275-280[Abstract/Free Full Text]
|
| 27.
|
Beaule, C.,
and Amir, S.
(1999)
Brain Res.
821,
95-100[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Kornhauser, J. M.,
Mayo, K. E.,
and Takahashi, J. S.
(1996)
Behav. Genet.
26,
221-240[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Travnickova-Bendova, Z.,
Cermakian, N.,
Reppert, S. M.,
and Sassone-Corsi, P.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
7728-7733[Abstract/Free Full Text]
|
| 30.
|
Gau, D.,
Lemberger, T.,
von Gall, C.,
Kretz, O., Le,
Minh, N.,
Gass, P.,
Schmid, W.,
Schibler, U.,
Korf, H.,
and Schutz, G.
(2002)
Neuron
34,
245-253[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Yamaguchi, S.,
Mitsui, S.,
Miyake, S.,
Yan, L.,
Onishi, H.,
Yagita, K.,
Suzuki, M.,
Shibata, S.,
Kobayashi, K.,
and Okamura, H.
(2000)
Curr. Biol.
10,
873-876[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Akiyama, M.,
Kouzu, Y.,
Takahashi, S.,
Wakamatsu, H.,
Moriya, T.,
Maetani, M.,
Watanabe, S.,
Tei, H.,
Sakaki, Y.,
and Shibata, S.
(1999)
J. Neurosci.
19,
1115-1121[Abstract/Free Full Text]
|
| 33.
|
Takumi, T.,
Taguchi, K.,
Miyake, S.,
Sakakida, Y.,
Takashima, N.,
Matsubara, C.,
Maebayashi, Y.,
Okamura, K.,
Takekida, S.,
Yamamoto, S.,
Yagita, K.,
Yan, L.,
Young, M.,
and Okamura, H.
(1998)
EMBO J.
17,
4753-4759[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Best, J. D.,
Maywood, E. S.,
Smith, K. L.,
and Hastings, M. H.
(1999)
J. Neurosci.
19,
828-835[Abstract/Free Full Text]
|
| 35.
|
van der Horst, G. T.,
Muijtjens, M.,
Kobayashi, K.,
Takano, R.,
Kanno, S.,
Takao, M.,
de Wit, J.,
Verkerk, A.,
Eker, A. P.,
van Leenan, D.,
Buijs, R. M.,
Bootsma, D., J. H., H.,
and Yasui, A.
(1999)
Nature
398,
627-630[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Zheng, B.,
Larkin, D. W.,
Albrecht, U.,
Sun, Z. S.,
Sage, M.,
Eichele, G.,
Lee, C.,
and Bradley, A.
(1999)
Nature
400,
169-173[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Kornhauser, J. M.,
Nelson, D. E.,
Mayo, K. E.,
and Takahashi, J. S.
(1990)
Neuron
5,
127-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Cermakian, N.,
Monaco, L.,
Pando, M.,
Dierich, A.,
and Sassone-Corsi, P.
(2001)
EMBO J.
20,
3967-3974[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Zheng, B.,
Albrecht, U.,
Kaasik, K.,
Sage, M., Lu, W.,
Vaishnav, S., Li, Q.,
Sun, Z. S.,
Eichele, G.,
Bradley, A.,
and Lee, C.
(2001)
Cell
105,
683-694[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Bae, K.,
Jin, X.,
Maywood, E. S.,
Hastings, M. H.,
Reppert, S. M.,
and Weaver, D. R.
(2001)
Neuron
30,
525-536[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Kornhauser, J. M.,
Nelson, D. E.,
Mayo, K. E.,
and Takahashi, J. S.
(1992)
Science
255,
1581-1584[Abstract/Free Full Text]
|
| 42.
|
Rusak, B.,
Robertson, H. A.,
Wisden, W.,
and Hunt, S. P.
(1990)
Science
248,
1237-1240[Abstract/Free Full Text]
|
| 43.
|
Rusak, B.,
McNaughton, L.,
Robertson, H. A.,
and Hunt, S. P.
(1992)
Brain Res. Mol. Brain Res.
28,
831-835
|
| 44.
|
Obrietan, K.,
Impey, S.,
and Storm, D. R.
(1998)
Nat. Neurosci.
1,
693-700[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Hurst, W. J.,
Mitchell, J. W.,
and Gillette, M. U.
(2002)
Biochem. Biophys. Res. Commun.
298,
133-143[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Chen, D.,
Buchanan, G. F.,
Ding, J. M.,
Hannibal, J.,
and Gillette, M. U.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
13468-13473[Abstract/Free Full Text]
|
| 47.
|
Parker, D.,
Ulupi, S. J.,
Radhakrishnan, I.,
Yaffe, M. B.,
Reyes, C.,
Shulman, A. I.,
Cantley, L. C.,
Wright, P. E.,
and Montminy, M.
(1998)
Mol. Cell
2,
353-359[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Enslen, H.,
Sun, P.,
Brickey, D.,
Soderling, S. H.,
Klamo, E.,
and Soderling, T. R.
(1994)
J. Biol. Chem
269,
15520-15527[Abstract/Free Full Text]
|
| 49.
|
Sun, P.,
Enslen, H.,
Myung, P.,
and Maurer, R.
(1994)
Genes Dev.
8,
2527-2539[Abstract/Free Full Text]
|
| 50.
|
Matthews, R. P.,
Guthrie, C. R.,
Wailes, L. M.,
Zhao, X.,
Means, A. R.,
and McKnight, G. S.
(1994)
Mol. Cell. Biol.
14,
6107-6116[Abstract/Free Full Text]
|
| 51.
|
Fukushima, T.,
Shimazoe, T.,
Shibata, S.,
Watanabe, A.,
Ono, M.,
Hamada, T.,
and Watanabe, S.
(1997)
Neurosci. Lett.
227,
45-48[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Golombek, D. A.,
and Ralph, M. R.
(1994)
Neuroreport
5,
1638-1640[Medline]
[Order article via Infotrieve]
|
| 53.
|
Yokota, S.,
Yamamoto, M.,
Moriya, T.,
Akiyama, M.,
Fukunaga, K.,
Miyamoto, E.,
and Shibata, S.
(2001)
J. Neurochem.
77,
618-627[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Kornhauser, J. M.,
Cowan, C. W.,
Shaywitz, A. J.,
Dolmetsch, R. E.,
Griffith, E. C., Hu, L. S.,
Haddad, C.,
Xia, Z.,
and Greenberg, M. E.
(2002)
Neuron
34,
221-233[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Panda, S.,
Antoch, M. P.,
Miller, B. H., Su, A. I.,
Schook, A. B.,
Straume, M.,
Schultz, P. G.,
Kay, S. A.,
Takahashi, J. S.,
and Hogenesch, J. B.
(2002)
Cell
109,
307-320[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Pfeffer, C. M. Muller, J. Mordel, H. Meissl, N. Ansari, T. Deller, H.-W. Korf, and C. von Gall
The Mammalian Molecular Clockwork Controls Rhythmic Expression of Its Own Input Pathway Components
J. Neurosci.,
May 13, 2009;
29(19):
6114 - 6123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Beaule, J. W. Mitchell, P. T. Lindberg, R. Damadzic, L. E. Eiden, and M. U. Gillette
Temporally restricted role of retinal PACAP: integration of the phase-advancing light signal to the SCN.
J Biol Rhythms,
April 1, 2009;
24(2):
126 - 134.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Vosko, M. H. Hagenauer, D. L. Hummer, and T. M. Lee
Period gene expression in the diurnal degu (Octodon degus) differs from the nocturnal laboratory rat (Rattus norvegicus)
Am J Physiol Regulatory Integrative Comp Physiol,
February 1, 2009;
296(2):
R353 - R361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kunieda, T. Minamino, K. Miura, T. Katsuno, K. Tateno, H. Miyauchi, S. Kaneko, C. A. Bradfield, G. A. FitzGerald, and I. Komuro
Reduced Nitric Oxide Causes Age-Associated Impairment of Circadian Rhythmicity
Circ. Res.,
March 14, 2008;
102(5):
607 - 614.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Ehlen, C. M. Novak, M. C. Karom, K. L. Gamble, and H. E. Albers
Interactions of GABAA Receptor Activation and Light on Period mRNA Expression in the Suprachiasmatic Nucleus
J Biol Rhythms,
February 1, 2008;
23(1):
16 - 25.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Pulivarthy, N. Tanaka, D. K. Welsh, L. De Haro, I. M. Verma, and S. Panda
Reciprocity between phase shifts and amplitude changes in the mammalian circadian clock
PNAS,
December 18, 2007;
104(51):
20356 - 20361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Gamble, G. C. Allen, T. Zhou, and D. G. McMahon
Gastrin-Releasing Peptide Mediates Light-Like Resetting of the Suprachiasmatic Nucleus Circadian Pacemaker through cAMP Response Element-Binding Protein and Per1 Activation
J. Neurosci.,
October 31, 2007;
27(44):
12078 - 12087.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. V. Agostino, S. A. Plano, and D. A. Golombek
Sildenafil accelerates reentrainment of circadian rhythms after advancing light schedules
PNAS,
June 5, 2007;
104(23):
9834 - 9839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Doi, S. Cho, I. Yujnovsky, J. Hirayama, N. Cermakian, A. C. B. Cato, and P. Sassone-Corsi
Light-Inducible and Clock-Controlled Expression of MAP Kinase Phosphatase 1 in Mouse Central Pacemaker Neurons
J Biol Rhythms,
April 1, 2007;
22(2):
127 - 139.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Takashima, A. Fujioka, N. Hayasaka, A. Matsuo, J. Takasaki, and Y. Shigeyoshi
Gq/11-induced intracellular calcium mobilization mediates Per2 acute induction in Rat-1 fibroblasts.
Genes Cells,
September 1, 2006;
11(9):
1039 - 1049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Koh, X. Zheng, and A. Sehgal
JETLAG resets the Drosophila circadian clock by promoting light-induced degradation of TIMELESS.
Science,
June 23, 2006;
312(5781):
1809 - 1812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Numano, S. Yamazaki, N. Umeda, T. Samura, M. Sujino, R.-i. Takahashi, M. Ueda, A. Mori, K. Yamada, Y. Sakaki, et al.
Constitutive expression of the Period1 gene impairs behavioral and molecular circadian rhythms.
PNAS,
March 7, 2006;
103(10):
3716 - 3721.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kunieda, T. Minamino, T. Katsuno, K. Tateno, J.-i. Nishi, H. Miyauchi, M. Orimo, S. Okada, and I. Komuro
Cellular Senescence Impairs Circadian Expression of Clock Genes In Vitro and In Vivo
Circ. Res.,
March 3, 2006;
98(4):
532 - 539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yamamoto, Y. Nakahata, M. Tanaka, M. Yoshida, H. Soma, K. Shinohara, A. Yasuda, T. Mamine, and T. Takumi
Acute Physical Stress Elevates Mouse Period1 mRNA Expression in Mouse Peripheral Tissues via a Glucocorticoid-responsive Element
J. Biol. Chem.,
December 23, 2005;
280(51):
42036 - 42043.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Noshiro, M. Furukawa, S. Honma, T. Kawamoto, T. Hamada, K.-i. Honma, and Y. Kato
Tissue-Specific Disruption of Rhythmic Expression of Dec1 and Dec2 in Clock Mutant Mice
J Biol Rhythms,
October 1, 2005;
20(5):
404 - 418.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Arjona and D. K. Sarkar
Circadian Oscillations of Clock Genes, Cytolytic Factors, and Cytokines in Rat NK Cells
J. Immunol.,
June 15, 2005;
174(12):
7618 - 7624.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Zambon, L. Zhang, S. Minovitsky, J. R. Kanter, S. Prabhakar, N. Salomonis, K. Vranizan, I. Dubchak, B. R. Conklin, and P. A. Insel
Gene expression patterns define key transcriptional events in cell-cycle regulation by cAMP and protein kinase A
PNAS,
June 14, 2005;
102(24):
8561 - 8566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Nakamura, S. Yamazaki, N. N. Takasu, K. Mishima, and G. D. Block
Differential Response of Period 1 Expression within the Suprachiasmatic Nucleus
J. Neurosci.,
June 8, 2005;
25(23):
5481 - 5487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Q. Butcher, B. Lee, H.-Y. M. Cheng, and K. Obrietan
Light Stimulates MSK1 Activation in the Suprachiasmatic Nucleus via a PACAP-ERK/MAP Kinase-Dependent Mechanism
J. Neurosci.,
June 1, 2005;
25(22):
5305 - 5313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Naruse, K. Oh-hashi, N. Iijima, M. Naruse, H. Yoshioka, and M. Tanaka
Circadian and Light-Induced Transcription of Clock Gene Per1 Depends on Histone Acetylation and Deacetylation
Mol. Cell. Biol.,
July 15, 2004;
24(14):
6278 - 6287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Tsuchiya and E. Nishida
Mammalian Cultured Cells as a Model System of Peripheral Circadian Clocks
J. Biochem.,
December 1, 2003;
134(6):
785 - 790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. W. Barnes, S. A. Tischkau, J. A. Barnes, J. W. Mitchell, P. W. Burgoon, J. R. Hickok, and M. U. Gillette
Requirement of Mammalian Timeless for Circadian Rhythmicity
Science,
October 17, 2003;
302(5644):
439 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Tischkau, E. T. Weber, S. M. Abbott, J. W. Mitchell, and M. U. Gillette
Circadian Clock-Controlled Regulation of cGMP-Protein Kinase G in the Nocturnal Domain
J. Neurosci.,
August 20, 2003;
23(20):
7543 - 7550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. N. Van Gelder, E. D. Herzog, W. J. Schwartz, and P. H. Taghert
Circadian Rhythms: In the Loop at Last
Science,
June 6, 2003;
300(5625):
1534 - 1535.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Meijer and W. J. Schwartz
In Search of the Pathways for Light-Induced Pacemaker Resetting in the Suprachiasmatic Nucleus
J Biol Rhythms,
June 1, 2003;
18(3):
235 - 249.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Bae and D. R. Weaver
Light-Induced Phase Shifts in Mice Lacking mPER1 or mPER2
J Biol Rhythms,
April 1, 2003;
18(2):
123 - 133.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
A. N. Coogan and H. D. Piggins
Circadian and Photic Regulation of Phosphorylation of ERK1/2 and Elk-1 in the Suprachiasmatic Nuclei of the Syrian Hamster
J. Neurosci.,
April 1, 2003;
23(7):
3085 - 3093.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|