Originally published In Press as doi:10.1074/jbc.M208696200 on November 4, 2002
J. Biol. Chem., Vol. 278, Issue 2, 919-926, January 10, 2003
The NF-
B Activation in Lymphotoxin
Receptor Signaling
Depends on the Phosphorylation of p65 at Serine 536*
Xu
Jiang
§,
Naoko
Takahashi
,
Nobuo
Matsui§,
Toshifumi
Tetsuka
, and
Takashi
Okamoto
¶
From the Departments of
Molecular Genetics and
§ Orthopedic Surgery, Nagoya City University Medical
School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan
Received for publication, August 25, 2002, and in revised form, October 24, 2002
 |
ABSTRACT |
NF-
B-inducing kinase (NIK) has been shown to
play an essential role in the NF-
B activation cascade elicited by
lymphotoxin
receptor (LT
R) signaling. However, the molecular
mechanism of this pathway remains unclear. In this report we
demonstrate that both NIK and I
B kinase
(IKK
) are involved in
LT
R signaling and that the phosphorylation of the p65
subunit at serine 536 in its transactivation domain 1 (TA1) plays an
essential role. We also found that NF-
B could be activated in the
LT
R pathway without altering the level of the phosphorylation of
I
B and nuclear localization of p65. By using a heterologous
transactivation system in which Gal4-dependent reporter
gene is activated by the Gal4 DNA-binding domain in fusion with various
portions of p65, we found that TA1 serves as a direct target in the
NIK-IKK
pathway. In addition, mutation studies have revealed the
essential role of Ser-536 within TA1 of p65 in transcriptional control
mediated by NIK-IKK
. Furthermore, we found that Ser-536 was
phosphorylated following the stimulation of LT
R, and this
phosphorylation was inhibited by the kinase-dead dominant-negative
mutant of either NIK or IKK
. These observations provide
evidence for a crucial role of the NIK-IKK
cascade for NF-
B
activation in LT
R signaling.
 |
INTRODUCTION |
The lymphotoxin (LT)1
system plays crucial roles in the embryonic development of lymphoid
organ, the maintenance of lymphoid architecture, and the formation of
ectopic lymphoid tissue adjacent to chronic inflammatory sites (1-3).
LT is a heterotrimer complex consisting of
(LT
) and
(LT
)
subunits (as LT
1
2), which bind to its specific receptor (LT
R)
(1). LT
R signaling involves NF-
B-inducing kinase (NIK), which
eventually activates nuclear factor
B (NF-
B) (4, 5). The
involvement of NIK in the LT
R signaling has been suggested by the
shared phenotypes of gene knock-out mice of LT
, LT
, and LT
R
(1, 6, 7) and alymphoplasia mice (aly/aly) (8) in which
spontaneous mutations of NIK were found responsible (9-11). Moreover,
LT
R signaling was shown to involve both NIK and IKK
for NF-
B
activation (4). It has also been shown that NIK is indispensable for
LT
R signaling but not for tumor necrosis factor (TNF) signaling (5).
However, the molecular mechanism by which NF-
B is activated by
LT
R signaling has not been clarified.
NF-
B represents a family of eukaryotic transcription factors
participating in the regulation of immune response, cell growth, and
survival (12-16). There are five members of the NF-
B/Rel family in
mammalian cells: the proto-oncogene c-Rel, RelA (p65), RelB, NF-
B1 (p50 and its precursor p105), and NF-
B2 (p52 and its
precursor p100). The most prevalent form of NF-
B is a heterodimer of
the p50 subunit and p65 that contains transactivation domains necessary for gene induction (17-20).
In cells, NF-
B is largely cytoplasmic and therefore remains
transcriptionally inactive until a cell receives an appropriate stimulus. In response to proinflammatory cytokines such as TNF and
interleukin-1
(IL-1
), the I
B proteins become phosphorylated on
two serine residues located in the N-terminal region (21). Phosphorylation of I
B proteins results in rapid ubiquitination and
subsequent proteolysis by the 26 S proteasome (15, 22, 23), which
allows the liberated NF-
B to translocate to the nucleus and
participate in target gene transactivation (12-15). The large
molecular weight complex consisting of two catalytic subunits, I
B
kinases
and
(IKK
and IKK
), and a regulatory subunit
IKK
was identified and shown to be responsible for phosphorylating I
B proteins (24-29). It has recently been shown that IKK
is not required for I
B degradation or induction of NF-
B DNA binding but
essential for the generation of transcriptionally competent NF-
B
(30). The kinase activity of IKKs is induced by a wide variety of
NF-
B inducers such as TNF or IL-1
, and mediated by the upstream
kinases including NIK and the extracellular signal-regulated kinase
kinase kinase 1/3 (31-34). NIK was originally identified as a protein
interacting with the TNF receptor-associated factor 2 component of the
TNF receptor complex (35). NIK physically interacts via its C-terminal
region with IKK
and IKK
and stimulates their catalytic activity
as an upstream effector kinase (32, 36-39).
The NF-
B p65 subunit contains at least two independent
transactivation (TA) domains (TA1 and TA2) within its C-terminal
120 amino acids and is responsible for binding to the basal
transcription factor TFIIB and CBP/p300 coactivators (19, 20). The
TNF-mediated signaling was shown to involve phosphorylation of Ser-529
within TA1 by casein kinase II (CKII) (40, 41). Similarly,
overexpression of IKK
induced phosphorylation of p65 at Ser-536
(42). These two serine residues within p65 TA1 were also shown to be
essential for Ras-mediated NF-
B activation involving
phosphatidylinositol 3-kinase and Akt serine/threonine kinase (43).
These signal-induced p65 phosphorylation events appear to induce
NF-
B-dependent gene expression by augmenting the
transcriptional activity of NF-
B (p65) rather than by inducing I
B
phosphorylation and promoting its nuclear translocation. Interestingly,
recent studies revealed the presence of NF-
B and I
B in the
nucleus even in the resting unstimulated cells (44-47), thus making
NF-
B susceptible for regulatory phosphorylation in the nucleus.
In this study, we have attempted to clarify the molecular mechanism by
which NIK activates NF-
B and found that the TA1 domain of p65
subunit is indispensable for NF-
B transcriptional activity. We
demonstrate that the phosphorylation of p65 at Ser-536, mediated by
NIK-IKK
, is crucial for LT
R signaling.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Constructs--
Mammalian expression vectors, pM-p65,
pM-p65-(286-551), pM-p65-(286-520), pM-p65-(521-551),
pM-p65-(286-551:
443-476), and pcDNA3.1-p65 were created as
previously described (48). pM-p65-(1-286) was generated by amplifying
the corresponding p65 fragment by PCR using the oligonucleotide primers
5'-CGGGATCCCGATGGACGAACTGTTCCCCCTCAT-3' and
5'-GCTCTAGAGCGAATTCCATGGGCTCACTGAGCT-3' containing BamHI and XbaI sites. pM-p65-(431-551) was generated by PCR using the
oligonucleotides 5'-CGGGATCCCGACCCAGGCTGGGGAAGGAA-3' and
5'-GCTCTAGAGCCGCGTTAGGAGCTGATCTG-3' containing BamHI and
XbaI sites. pM-p65-(521-551:S529A) was
generated by PCR using the oligonucleotides 5'-GGAATT
CCCGGGGCTCCCCAATGGCCTCCTTGCAGGAGATGA-3' and 5'-CGCGGATCCGC
GCGTTAGGAGCTGATCTGACTCAGCAGGGCT-3' containing EcoRI
and BamHI sites. In order to construct
pM-p65-(521-551:S536A), the p65-(521-551:S536A) fragment was
generated by PCR using pM-p65 as a template with the oligonucleotide
primers 5'-GCTCTA
GAGCCCACCATGGACTACAAAGACGATGACGACAAGATGGACGAACTGTTCCCCCTCATCTTCCCGGCAGAGCCAGCCC-3' and 5'-CGCGGATCCGCGTTAGGAGCT
GATCTGACTCAGCAGGGCTGAGAAGTCCATGTCCGCAATGGCGGAGAAGTCTTCATCTCCTGAAAGGAGGCC-3', and this PCR product was cut with SmaI and BamHI.
These PCR fragments were inserted into the pM vector at respective
restriction sites. The plasmid expressing the FLAG-tagged p65,
pcDNA3.1(
)-FLAG-p65, was generated by PCR using the
oligonucleotides 5'-GCTCTAGAGCCCACCATGGACTACAAAGACGATGACGAC AAGATGGACGAACTGTTCCCCCTCATCTTCCCGGCAGAGCCAGCCC-3' and
5'-CGCGGATCCGCGTTAGGAGCTGATCTGACTCAGCAGGGCTGAGAAGTCCATGTCCGC-3' containing XbaI and BamHI sites. The PCR product
was cloned into pcDNA3.1(
) (Invitrogen). pCR2FL-IKK
,
pCR2FL-IKK
, pCR2FL-IKK
(KM), and pCR2FL-IKK
(KM) expression
vectors encoding the wild-type and dominant-negative mutant of IKK
and IKK
, respectively, were kindly provided by H. Nakano (31).
pcDNA3-NIK and pcDNA3-NIK(KM) encoding wild-type NIK and mutant
NIK (K429A/K430A) were generous gifts from D. Wallach (35). The
N-terminal deletion mutant of I
B
(I
B
N) encoding amino
acids 37-317 (pcDNA3-I
B
N) was constructed as described
previously (49, 50). The plasmid expressing the Myc-tagged I
B
phosphorylation-defective mutant, pcDNA-Myc-I
B
(S32A/S36A),
was kindly provided by S. Hatakeyama (51). The construction of
luciferase (luc) reporter plasmids of 4
Bw-luc
containing four tandem copies of the HIV
B sequence located upstream
of minimal SV40 promoter and 4
Bm-luc harboring four
mutated inactive
B sites have been described previously (52).
Another luciferase reporter plasmid, Gal4-luc
(pFR-luc, Stratagene), containing five tandem copies of the
Gal4 binding site upstream of TATA box was used for the evaluation of
the transcriptional activity of pM-p65 and its derivatives. All PCR
amplification reactions used ExpandTM high fidelity system
(Roche Molecular Biochemicals). All the constructs were confirmed by
dideoxynucleotide sequencing using ABI PRISMTM dye
terminator cycle sequencing ready kit (PerkinElmer Life Sciences) on an
Applied Biosystems 313 automated DNA sequencer.
Cell Culture and Transfection--
293 cells were grown at
37 °C in Dulbecco's modified Eagle's medium (Sigma) with 10%
heat-inactivated fetal bovine serum (IBL, Maebashi, Japan). Cells were
transfected using FuGENETM 6 transfection reagent (Roche
Molecular Biochemicals) according to the manufacturer's
recommendations. HT29 cells were grown at 37 °C in McCoy's 5A
Medium Modified (Sigma) with 10% heat-inactivated fetal bovine serum
(IBL), and cells were transfected using LipofectAMINETM
reagent (Invitrogen) according to the manufacturer's recommendations. At 48-h post-transfection, the cells were harvested, and the cell extracts were prepared for the luciferase assay. Luciferase activity was measured using the luciferase assay system (Promega) as described previously (52). Transfection efficiency was monitored by
Renilla luciferase activity using the pRL-TK plasmid
(Promega) as an internal control, and the luciferase activity was
normalized by the Renilla luciferase activity. For each
transfection, 50 ng of the luc reporter plasmid and 25 ng of
internal control plasmid pRL-TK were used. pUC19 was used to adjust the
total amount of DNA (500 ng) transfected. Cells without the stimulation
of TNF were lysed 48 h after transfection, and the luciferase
activity was measured. Other cells, as indicated, were stimulated with
10 ng/ml of TNF after 24 h of transfection and lysed after an
additional incubation for 24 h or stimulated with 2 µg/ml of
agonistic anti-LT
R monoclonal antibody (mAb) (AC.H6) (53) 10 h
before cells were harvested. The data are presented as the fold
increase in luciferase activity (mean ± S.D.) relative to the
control of three independent transfections.
Immunostaining--
The intracellular localization of p65 in
HT29 cells was examined by immunostaining as described previously (50).
Briefly, HT29 cells were cultured in 2-well chamber slides and after
stimulating with 10 ng/ml of TNF for 15 min or 2 µg/ml of agonistic
anti-LT
R mAb for 40 min, cells were fixed in 4% (w/v)
paraformaldehyde/PBS at room temperature for 20 min and then
permeabilized by 0.5% Triton X-100/PBS for 20 min at room temperature.
They were then incubated with rabbit polyclonal antibody against p65
(Santa Cruz Biotechnology) for 1 h at 37 °C, rinsed three timed
with 0.05% Triton X-100/PBS, and incubated with secondary antibody,
fluorescein-conjugated goat anti-rabbit IgG (CAPPEL; ICN
Pharmaceuticals), for 1 h at 37 °C. The slides were rinsed
three times with PBS and mounted with buffered glycerol for fluorescent
microscopic examination. Primary and secondary antibodies were diluted
at 1:100 and 1:200 in PBS containing 3% bovine serum albumin, respectively.
Western Blotting--
In order to monitor the phosphorylation of
I
B, HT29 cells were stimulated with TNF or agonist anti-LT
R mAb,
and the cells were lysed in 350 µl of ice-cold lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM
EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM
dithiothreitol, 0.2% Nonidet P-40, 10 mM sodium fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin A).
To evaluate the protein level of p65, 293 cells were harvested 48 h after transfection. Whole cell extracts were lysed in 350 µl of
ice-cold lysis buffer. In order to evaluate the protein level of p65,
NIK(KM), IKK
(KM), and I
B(S32A/S36A), 48 h after transfection, cells were stimulated by 2 µg/ml of agonist anti-LT
R mAb for 40 min, lysed, cleared by centrifugation, and determined for
the protein concentration using Bio-Rad DC protein assay kit (Bio-Rad).
The cell lysate was resolved by SDS-PAGE and transferred on
polyvinylidene difluoride membranes (Millipore). The membranes were
incubated with antibodies to anti-I
B
(New England Biolabs), anti-phospho-I
B
(New England Biolabs), anti-
-tubulin
(MONOSAN), anti-Gal4 (Santa Cruz Biotechnology), anti-FLAG epitope (M2
antibody; Sigma), or anti-Myc epitope (Santa Cruz Biotechnology). The
immunoreactive proteins were visualized by enhanced chemilluminescence
(ECL) (Amersham Biosciences).
Immunoprecipitation--
To detect the phosphorylated p65 at
Ser-536, HT29 cells were transfected with the indicated plasmids
including pcDNA3.1(
)-FLAG-p65, treated with 2 µg/ml of
anti-LT
R mAb for 40 min, and lysed by incubation at 4 °C for 30 min in 2 ml of ice-cold lysis buffer (50 mM Tris, pH 7.8, 300 mM KCl, 1 mM EDTA, 10% of glycerol, 0.3% Nonidet P-40, 1× Complete (Roche Molecular Biochemicals), 5 mM sodium fluoride, 0.4 mM sodium
orthovanadate). The lysates were cleared by centrifugation, and the
supernatants were incubated with anti-FLAG M2 affinity gel (Kodak) for
1 h at 4 °C. The beads were washed five times with 1 ml of
lysis buffer, and the bound proteins were eluted with an equal volume
of 2× SDS loading buffer and resolved on 7.5% SDS-PAGE. Western blot
was conducted by using anti-phospho-p65 NF-
B (Ser-536) antibody
(Cell Signaling).
 |
RESULTS |
Activation of NF-
B-mediated Gene Expression by TNF and
LT
R--
In Fig. 1A, the
effects of TNF and LT
R signaling on NF-
B-mediated gene expression
were compared. TNF stimulated NF-
B-dependent gene
expression in both 293 and HT29 cells. However, the agonistic LT
R
mAb stimulated gene expression only in the LT
R-expressing HT29 cells
as reported (54). Overexpression of NIK stimulated gene expression in
both cells, indicating that the differences in these cells depend on
LT
R. In addition, overexpression of IKK
alone did not
significantly activate the NF-
B-dependent gene
expression in both cells whereas that of IKK
activated the gene
expression by 3- and 1.8-fold in 293 and HT29 cells, respectively. In
fact, whereas IKK
overexpression induced I
B
degradation, IKK
overexpression did not (data not shown). These findings
suggested that the upstream signal is required for optimal activation
as previously reported (24, 26).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1.
The distinct NF- B
activation cascades by TNF and LT R signaling.
A, effects of TNF, agonist anti-LT R mAb, NIK, IKK , and
IKK on the NF- B-dependent luciferase (luc)
gene expression. 293 cells and HT29 cells were transfected with 50 ng
of 4× Bw-luc (containing wild-type NF- B binding
sites) (closed bar) or 4× Bm-luc (mutant
NF- B sites) (open bar) reporter plasmids together with
either pcDNA3-NIK (20 ng), pCR2FL-IKK (50 ng), or pCR2FL-IKK
(50 ng) expression plasmids. Alternatively, transfected cells were
stimulated with 10 ng/ml of TNF for 24 h or 2 µg/ml of agonist
anti-LT R mAb for 10 h. Since 293 cells do not have LT R, we
used HT29 cells to assess the effect of LT R signaling as reported
previously (49). The luciferase activity was normalized by
Renilla luciferase activity that was co-transfected as an
internal control. The data are presented as the fold increase in
luciferase activities (mean ± S.D.) relative to control
transfection of three independent experiments. B,
phosphorylation and degradation of I B induced by TNF but not by
agonistic anti-LT R mAb. HT29 cells were stimulated with 10 ng/ml of
TNF or 2 µg/ml of anti-LT R mAb, the levels of I B protein and
its phosphorylated form were detected by Western blotting using
specific antibodies. The Western blotting using anti- -tubulin
antibody indicated that equivalent amounts of protein prepared from
each fraction were resolved on each loading. C, nuclear
localization of p65 in HT29 cells induced by TNF but not by anti-LT R
mAb. After treating with 10 ng/ml of TNF for 15 min or 2 µg of
agonistic anti-LT R mAb for 40 min, HT29 cells were immunostained
using primary (rabbit polyclonal antibody against p65) and secondary
(fluorescein-conjugated goat anti-rabbit IgG) antibodies, and the
intracelluar location of p65 was examined by fluorescence
microscopy.
|
|
As demonstrated in Fig. 1B, TNF stimulation induced the
phosphorylation of I
B
and subsequent degradation in HT29 cells. However, stimulation of LT
R did not induce either I
B
phosphorylation or its degradation, yet induced
NF-
B-dependent gene expression. Moreover, whereas TNF
induced the nuclear translocation of NF-
B in HT29 cells, LT
R did
not (Fig. 1C). The presence of NF-
B in the nucleus even
in the resting cells has been demonstrated recently by Birbach et
al. (44) (see also Ref. 55 for review). These findings suggest
that the LT
R signaling stimulates NF-
B activity without inducing
I
B
degradation or NF-
B nuclear translocation as reported by
Yin et al. (5) and that the activation of NF-
B by the
LT
R signaling is not through alteration of intracellular localization of NF-
B but presumably by augmenting its
transcriptional activity.
NIK-IKK
Plays a Key Role in Regulating the Transcriptional
Activity of NF-
B during LT
R Signaling--
In a series of
experiments using transient
B luciferase assays, we have explored
the kinase responsible for NF-
B activation in the LT
R cascade by
using the dominant-negative kinase mutants of NIK (NIK(KM)), IKK
(IKK
(KM)), and IKK
(IKK
(KM)). As demonstrated in Fig.
2A, when NIK(KM), IKK
(KM),
or IKK
(KM) were overexpressed in 293 cells, the TNF-induced NF-
B
activation was greatly inhibited by either of these mutants, more
remarkable by IKK
(KM). A similar observation was obtained with HT29
cells (data not shown). These results are consistent with the fact that
the TNF-mediated NF-
B activation was abolished in the IKK
gene
knock-out mice but could not entirely be abolished in IKK
and NIK
knock-out mice (5, 56-60). Interestingly, the induction of
NF-
B-dependent gene expression by agonist anti-LT
R
mAb was strongly inhibited by NIK(KM) or IKK
(KM) in HT29 cells but
not by IKK
(KM). In Fig. 2B, synergistic activation of
gene expression was investigated. When wild-type NIK, IKK
, or IKK
were overexpressed together with TNF signaling in 293 cells, there was
no significant augmentation by IKK
as compared from TNF alone.
However, either NIK or IKK
augmented the effect of TNF in inducing
NF-
B-dependent gene expression, which were statistically
significant (p < 0.01 and p < 0.05, respectively). On the other hand, in HT29 cells, the gene expression
elicited by anti-LT
R mAb was augmented significantly by IKK
and
NIK (p < 0.05 and p < 0.01, respectively) but not at all by IKK
. These data
collectively indicated that the TNF-induced NF-
B activation is
mainly through IKK
but the NF-
B activation in LT
R pathway is
mediated by NIK and IKK
, which was consistent with the previous study (4, 5). The results of Fig. 2C demonstrated that the synergism between NIK and IKK
or IKK
was observed irrespective of
the presence or absence of LT
R in cells. Moreover, the abolishment of the effect of NIK by IKK
(KM), not by IKK
(KM), was observed equally in both cells. These observations suggest that activation of
NIK is mainly coupled with IKK
but not IKK
.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2.
The essential roles of NIK and
IKK in the transcriptional activation of
NF- B induced by LT R
signaling. A, distinct inhibition profiles by
kinase-defective mutants of NIK and IKK in the LT R and TNF
signaling. Their effects on the NF- B-dependent
luc gene expression were evaluated. Expression plasmids for
dominant-negative NIK (pcDNA3-NIK(KM)), IKK
(pCR2FL-IKK (KM)), or IKK (pCR2FL-IKK (KM)) were
cotransfected with 4× Bw-luc, and the extent of
stimulation was compared when NF- B was activated either by TNF or
agonistic anti-LT R mAb. After transfection with the indicated
plasmids, 293 cells and HT29 cells were stimulated by TNF (10 ng/ml)
for 24 h and anti-LT R mAb (2 µg/ml) for 10 h,
respectively. Note that the LT R signaling was blocked by NIK(KM) or
IKK (KM) but not by IKK (KM). B, synergism between the
signaling effectors in NF- B activation. In 293 cells, the
synergistic activation was examined between TNF and wild-type NIK,
IKK , or IKK . Similarly, in HT29 cells, the synergistic activation
was examined between anti-LT R mAb and IKK or IKK .
C, synergism between NIK and the downstream kinases in the
NF- B activation. NIK was overexpressed together with wild-type
IKK , IKK , or their kinase-defective mutants, and the effect on
NF- B-dependent gene expression was determined. Note that
IKK and IKK augmented the effect of NIK, yet only IKK (KM)
inhibited the effect of NIK. There was no effect of IKK , IKK , or
NIK overexpression on the levels of endogenous p65 (data not shown).
The data are presented as the fold increase in luciferase activities
(mean ± S.D.) relative to the control of three independent
transfections.
|
|
Involvement of the p65 C-terminal TA Domain in Signaling Mediated
by NIK-IKK
--
Since NIK-IKK
was shown to activate the
NF-
B-dependent gene expression by augmenting the
transcriptional activity of NF-
B independently of the I
B
degradation pathway, we examined whether the p65 subunit is directly
involved. In Fig. 3, we
adopted a heterologous luciferase reporter system with
Gal4-luc from which gene expression is under the control of
Gal4. As shown in Fig. 3B, pM-p65, expressing the Gal4-p65
(full-length) fusion protein, augmented the gene expression from the
Gal4-dependent promoter when NIK was overexpressed.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
The determination of the target region within
p65 in the NF- B activation mediated by
NIK-IKK . A, schematic representation of the
functional domains in p65 and its mutant constructs. Locations of
functional domains including DNA-binding/dimerization domain, nuclear
localization signal (NLS), and transcriptional activation
(TA) domains are indicated. The indicated regions of p65
were cloned into a vector (pM) producing fusion proteins with the Gal4
DNA-binding domain. B, effect of NIK on the
Gal4-dependent gene expression driven by various p65 fusion
proteins with the Gal4 DNA-binding domain. 293 cells were transfected
with 50 ng of 5× Gal4-TATA-luc reporter plasmid
(Gal4-luc) in the presence (closed bar) or
absence (open bar) of pcDNA3-NIK (20 ng) together with
various pM-p65 constructs (50 ng). The data are presented as the fold
increase in luciferase activities (mean ± S.D.) relative to
control transfection of three independent experiments. C,
dominant-negative mutant of IKK (KM)) inhibited the effect of NIK on the transcriptional
activity of Gal4 fusion p65 mutants. 293 cells were transfected with
Gal4-luc, pcDNA3-NIK in the presence or absence of
pCR2FL-IKK (KM) (50 ng) together with various pM-p65 constructs. The
data are presented as the relative folds relative to control
transfection of three independent experiments. Similar observation was
obtained in HT29 cells (data not shown).
|
|
In order to determine which portion of p65 is responsible for this
action of NIK, we have created a series of plasmids expressing various
portions of p65 in fusion with the Gal4 DNA-binding domain (Fig.
3A): pM-p65, containing full-size p65-(1-551);
pM-p65-(1-286), containing RHD; pM-p65-(286-551), containing NLS but
lacking RHD; pM-p65-(286-551:
443-476), containing NLS but lacking
both RHD and TA2; pM-p65-(286-520), containing NLS but lacking RHD and TA1; pM-p65-(431-551), containing only TA2 and TA1; pM-p65-(521-551), containing only the TA1 domain of p65. In Fig. 3B, NIK
stimulated the p65 (full-length)-mediated transactivation by 5.8-fold.
Likewise, NIK stimulated the effect of pM-p65-(286-551),
pM-p65-(286-551:
443-476), and pM-p65-(286-520), by 3.2-, 3.2-, and 3.4-fold, respectively. Interestingly, NIK stimulated
pM-p65-(431-551), containing only TA2 and TA1, by 6.3-fold, and its
transcriptional activity as well as the susceptibility to the
NIK-mediated activation was similar to pM-p65 (containing full-size
p65). Moreover, the Gal4-p65-(521-551) containing only the TA1 domain
had the highest susceptibility for the NIK-mediated transactivation
(19.7-fold, comparing lanes 15 and 16)
although the basal transcription level was relatively low.
pM-p65-(1-286) containing only RHD and pM-p65-(286-430) lacking both
TA2 and TA1 supported no effect of NIK. These results suggested that
the effect of NIK was mainly mediated by TA1.
As it was demonstrated that the activation of NIK was coupled with
IKK
(4, 61) (Fig. 2C), we next examined whether the dominant-negative IKK
mutant could block these effects of NIK. As
shown in Fig. 3C, NIK-mediated activation of the
transcriptional activity of Gal4-p65 fusion proteins was inhibited by
the overexpression of IKK
(KM). There was no significant effect with
IKK
(KM) (data not shown). Similar results were obtained with HT29
cells (data not shown). These data collectively demonstrated that
NF-
B transcriptional activation elicited by NIK-IKK
was mediated
through the C-terminal TA1 domain of p65.
Serine 536 in the p65 TA1 Domain Is Responsible for the Effect of
NIK--
Since the effect of NIK-IKK
on p65 was primarily mediated
by the TA1 domain of p65, we further examined the effect of mutation in
Ser-536 within TA1. We also addressed whether I
B
could block the
effect of NIK since it was recently demonstrated that I
B
is
present in the nucleus and exhibits the inhibition of NF-
B transcriptional activity (41, 42, 44-47). In Fig.
4, the Gal4-luc reporter
plasmid was co-transfected with pM-p65-(521-551),
pM-p65-(521-551:S529A), and pM-p65-(521-551:S536A) with or without
pcDNA3-NIK (expressing the wild-type NIK). When I
B
N (a
superactive mutant of I
B
) was expressed, the effect of NIK was
inhibited. Although NIK stimulated the transcriptional activities of
pM-p65-(521-551) and pM-p65-(521-551:S529A) similarly as
in Fig. 3, B and C, the extent of stimulation was significantly reduced with pM-p65-(521-551:S536A), indicating that
Ser-536 is indispensable for the transcriptional activity of p65 in
response to the LT
R signaling mediated by NIK-IKK
. These findings
indicated that the effect of NIK on the p65 TA1 domain might depend on
the phosphorylation of p65 at serine 536, and this action of NIK could
be inhibited by I
B
.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Involvement of Ser-536 located in p65 TA1 in
the NIK-mediated transcriptional activation. Effects of mutations
of Ser-529 and Ser-536 in TA1 domain of p65 were examined on the
NIK-mediated induction of the transcriptional activity of Gal4-p65 TA1
fusion protein. 293 cells were transfected with Gal4-luc,
pcDNA3-NIK, and various pM-p65 TA1 constructs including
pM-p65-(521-551) (A), pM-p65-(521-551: S529A)
(B), and pM-p65-(521-551: S536A) (C). Effects of
I B N were also examined. The constructs of these plasmids are
described in the legend to Fig. 3. Lower panels show the
results of Western blotting using anti-Gal4 antibody indicating that
equivalent amounts of pM-p65 TA1 and its mutants were expressed in each
transfection irrespective of cotransfection with pcDNA3-NIK or
pcDNA3-I B N.
|
|
Phosphorylation of p65 at Ser-536 in LT
R Pathway--
In Fig.
5, we further examined whether Ser-536 in
p65 is essential for the LT
R signaling involving NIK and IKK
,and
could be phosphorylated in HT29 cells when stimulated with the agonist anti-LT
R mAb. We first addressed whether the mutant p65, in which Ser-536 is substituted by Ala, is still responsive to LT
R signaling. As demonstrated in Fig. 5A, although anti-LT
R mAb
stimulated the transcriptional activity of pM-p65-(521-551), its
action was completely abolished when Ser-536 was substituted by Ala. In
addition, when dominant-negative mutants of NIK and IKK
were
expressed, this action of LT
R signaling was blocked, suggesting that
the effect of LT
R is mediated by NIK and IKK
leading to the
phosphorylation at Ser-536 in p65. We examined more directly whether
Ser-536 is phosphorylated in response to the LT
R signaling (Fig.
5B). When full-length p65 (FLAG-tagged) was expressed,
Ser-536 phosphorylation was detected by the specific antibody
(anti-phospho-p65 NF-
B (Ser-536)), and this phosphorylation was
blocked upon coexpression of dominant-negative mutants of
NIK or IKK
, or phosphodefective I
B
(Myc-tagged
I
B
(S32A/S36A)). These data clearly indicate that LT
R signaling
eventually leads to the phosphorylation of p65 at Ser-536. Both NIK and
IKK
are involved, and this process can be blocked by I
B
.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5.
Phosphorylation of p65 at Ser-536 during
LT R signaling. A, involvement of
Ser-536 in the TA1-mediated transcriptional activation upon LT R
signaling. HT29 cells were transfected with Gal4-luc
together with pM-p65-(521-551) or pM-p65-(521-551: S536A) (50 ng
each), and the effects of NIK(KM), IKK (KM), or IKK (KM) in the
LT R signaling were examined. B, phosphorylation of p65 at
Ser-536 by LT R signaling. HT29 cells were co-transfected with
various combinations of plasmids expressing FLAG-tagged p65 (FLAG-p65),
NIK(KM), FLAG-tagged IKK (KM), and Myc-tagged I B (S32A/S36A)
(I B mutant in which phosphorylation target Ser residues were
substituted by Ala). After stimulation with agonist anti-LT R mAb for
40 min, cell extracts were prepared and immunoprecipitated with
anti-FLAG M2 affinity gel. The immunoprecipitates were fractionated by
SDS-PAGE and immunoblotted with anti-phospho-p65 NF- B (Ser-536)
antibody (upper panel). Lower panels show the
immunoblotting detection of NIK(KM), p65, IKK (KM), and
I B (S32A/S36A) proteins by respective antibodies. Results of p65
detection indicate that equivalent amounts of FLAG-p65 were expressed
in each transfection. Note the detection of the phosphorylation of p65
at Ser-536 upon LT R signaling and its abrogation by overexpression
of NIK(KM) or IKK (KM), kinase-deficient mutants of the corresponding
effector kinases or phosphorylation-defective I B
(I B S32A/S36A).
|
|
 |
DISCUSSION |
In this study we have explored a mechanism by which NF-
B is
activated by LT
R signaling. We found that both NIK and IKK
are
critically involved in this pathway since either the kinase-deficient mutant of NIK or IKK
, but not IKK
, could block LT
R-mediated NF-
B activation and that the LT
R-mediated NF-
B activation did not induce phosphorylation and subsequent degradation of I
B
. We
also found that serine 536 phosphorylation in its TA1 transactivation domain is essential. These findings collectively demonstrate the presence of a novel signaling mechanism in the NF-
B activation, which is unique to the LT
R signaling.
Matsushima et al. (4) found that NIK and IKK
were
indispensable for NF-
B activation in the LT
R signaling using
aly/aly mice in which formation of the secondary lymphoid
tissues was affected although the TNF- and IL-1-mediated NF-
B
activation signaling remained intact. Similar observations were
reported with IKK
-deficient mice (57) and NIK-deficient mice (5). In
addition, Cao et al. (62) has recently reported another
interesting feature of the IKK
pathway with the mutant IKK
knock-in mice that the signal transduction of receptor activator of
NF-
B (RANK) leading to NF-
B activation was abolished and thus the
inducible expression of target cyclin D1 gene was affected. Whereas the responsiveness to proinflammatory stimuli including TNF, IL-1, and LPS
are largely dependent on the IKK
, other stimuli such as LT
, RANK
ligand, and Blys/BAFF depend on IKK
-mediated signaling (55). These
biological features of IKK
explain the characteristic developmental
defect of the secondary lymphophoid tissues in the IKK
knock-out
mice. Thus, although IKK
and IKK
are cross-related and both serve
as the catalytic subunits of IKK complex, these findings illustrate the
functional heterogeneity of IKK
and IKK
.
Although a major step that regulates NF-
B activity is the removal of
I
B from the NF-
B/I
B complex, the capacity of nuclear NF-
B
to drive transcription is also a regulated process. A number of studies
support the possibility that p65 phosphorylation regulates the
transcriptional competence of nuclear NF-
B (41, 63-67). Although
the role of PKA in phosphorylating p65 is still controversial (68-70),
regulation of the transcriptional competence of p65 by phosphorylation
has been widely accepted. Protein kinases such as CKII, PKC
, and IKK
have been implicated in this process (40-42, 67). For example, Wang
and Baldwin (40) reported that the phosphorylation of Ser-529 at the
TA1 domain of p65 is associated with the TNF-induced NF-
B
activation. They later found that CKII interacts with p65 and directly
phosphorylates p65 at Ser-529 (41). In addition, Sakurai et
al. (42) reported that TNF induced phosphorylation of p65 at
Ser-536 in the cell and showed that the p65 could be phosphorylated at
Ser-536 by IKK
at least in vitro. Moreover, Madrid
et al. (43) have recently demonstrated that
phosphatidylinositol 3-kinase activates Akt, which subsequently activates IKK
and leads to p65 phosphorylation at Ser-536.
One of the possible mechanisms of p65 phosphorylation at its TA domain
in controlling its transcriptional competency is to recruit coactivator
proteins such as histone acetyl transferases (71, 72) and TLS (73) to
NF-
B when it binds to the target promoter sequence. Alternatively,
p65 phosphorylation may preclude the recruitment of corepressor
proteins such as Groucho family proteins that is known to interact with
the p65 TA domain (48) and histone deacetylases (HDACs) (74-77). For
example, it was reported that cAMP-dependent kinase
(PKA)-mediated phosphorylation of p65 caused the p65 association with
CBP in vitro (72). The same group has recently demonstrated
with cultured cells that p65 was associated with HDAC-1 in unstimulated
cells, and it was dissociated from HDAC1 but associated with CBP upon
cotransfection with the PKA catalytic subunit (77). Thus, it is
possible that p65 phosphorylation may act as a determinant for
selecting the interacting partner of NF-
B.
The results in this study revealed that LT
R signaling induced the
p65 phosphorylation at Ser-536 by using phosphorylation-specific antibody. This finding was confirmed with the Ser-536 mutant of p65
TA1, which could not mediate the effect of LT
R signaling. Then,
where is NF-
B (p65) phosphorylated in the cell? In fact, a number of
studies have revealed that NF-
B and I
B shuttle in and out of the
nucleus (44-47). Therefore, NF-
B is present in the nucleus even in
the unstimulated cells, although to a lesser amount than that in the
cytoplasm. More importantly, Birbach et al. (44) found that
the treatment of cells with leptomycin B, an inhibitor of CRM1 and a
blocking agent of nuclear export, resulted in the nuclear accumulation
of NIK and IKK
, but not IKK
, indicating that these kinases also
shuttle between the cytoplasm and the nucleus. IKK
has been
initially identified as NIK-interacting protein in yeast two-hybrid
screens (36). Thus, IKK
appears to preferentially associate with NIK
where the large IKK complex is not found, such as in the nucleus.
Interestingly, when IKK
was mutated at lysine 44, the shuttle of
IKK
between cytoplasm and nucleus was prevented because it is known
that the lysine residue at position 44 was also essential for the
kinase activity (44), which is consistent with our observation that
either dominant-negative IKK
(IKK
(KM)) or
phosphorylation-defective mutant I
B
(I
Bs
N) efficiently
blocked LT
R signaling. Together with our findings, it is likely that
the p65 subunit of NF-
B is phosphorylated by the NIK/IKK
cascade
in the nucleus.
 |
ACKNOWLEDGEMENTS |
We thank Drs. H. Nakano, D. Wallach, and S. Hatakeyama for their generosity in providing the expression vectors
encoding wild types and mutants of IKK
and IKK
, NIK, and
Myc-I
B
(S32A/S36A), respectively.
 |
FOOTNOTES |
*
This work was supported in part by grants-in-aid from the
Ministry of Health, Labor and Welfare, the Ministry of Education, Culture, Sports, Science, and Technology of Japan and the Japanease Health Sciences Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of Molecular
Genetics, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku Nagoya, Aichi 467-8601, Japan. Tel.:
81-52-853-8204; Fax: 81-52-859-1235; E-mail:
tokamoto@med.nagoya-cu.ac.jp.
Published, JBC Papers in Press, November 4, 2002, DOI 10.1074/jbc.M208696200
 |
ABBREVIATIONS |
The abbreviations used are:
LT, lymphotoxin;
NF-
B, nuclear factor
B;
TA, transactivation domain;
NIK, NF-
B-inducing kinase;
LT
R, lymphotoxin
receptor;
RHD, Rel
homology domain;
TNF, tumor necrosis factor;
IL-1
, interleukin-1
;
IKK, I
B kinase;
luc, luciferase;
HDAC, histone deacetylase;
CKII, casein kinase II;
mAb, monoclonal antibody;
PBS, phosphate-buffered
saline;
HIV, human immunodeficiency virus.
 |
REFERENCES |
| 1.
|
Fu, Y. X.,
and Chaplin, D. D.
(1999)
Annu. Rev. Immunol.
17,
399-433[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Luther, S. A.,
Lopez, T.,
Bai, W.,
Hanahan, D.,
and Cyster, J. G.
(2000)
Immunity
12,
471-481[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Hjelmstrom, P.,
Fjell, J.,
Nakagawa, T.,
Sacca, R.,
Cuff, C. A.,
and Ruddle, N. H.
(2000)
Am. J. Pathol.
156,
1133-1138[Abstract/Free Full Text]
|
| 4.
|
Matsushima, A.,
Kaisho, T.,
Rennert, P. D.,
Nakano, H.,
Kurosawa, K.,
Uchida, D.,
Takeda, K.,
Akira, S.,
and Matsumoto, M.
(2001)
J. Exp. Med.
193,
631-636[Abstract/Free Full Text]
|
| 5.
|
Yin, L., Wu, L.,
Wesche, H.,
Arthur, C. D.,
Michael White, J.,
Goeddel, D. V.,
and Schreiber, R. D.
(2001)
Science
291,
2162-2165[Abstract/Free Full Text]
|
| 6.
|
Matsumoto, M., Fu, Y. X.,
Molina, H.,
and Chaplin, D. D.
(1997)
Immunol. Rev.
156,
137-144[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Futterer, A.,
Mink, K.,
Luz, A.,
Kosco-Vilbois, M. H.,
and Pfeffer, K.
(1998)
Immunity
9,
59-70[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Miyawaki, S.,
Nakamura, Y.,
Suzuka, H.,
Koba, M.,
Yasumizu, R.,
Ikehara, S.,
and Shibata, Y.
(1994)
Eur. J. Immunol.
24,
429-434[Medline]
[Order article via Infotrieve]
|
| 9.
|
Shinkura, R.,
Kitada, K.,
Matsuda, F.,
Tashiro, K.,
Ikuta, K.,
Suzuki, M.,
Kogishi, K.,
Serikawa, T.,
and Honjo, T.
(1999)
Nat. Genet.
22,
74-77[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Garceau, N.,
Kosaka, Y.,
Masters, S.,
Hambor, J.,
Shinkura, R.,
Honjo, T.,
and Noelle, R. J.
(2000)
J. Exp. Med.
191,
381-385[Abstract/Free Full Text]
|
| 11.
|
Fagarasan, S.,
Shinkura, R.,
Kamata, T.,
Nogaki, F.,
Ikuta, K.,
Tashiro, K.,
and Honjo, T.
(2000)
J. Exp. Med.
191,
1477-1486[Abstract/Free Full Text]
|
| 12.
|
Baldwin, A. S., Jr.
(1996)
Annu. Rev. Immunol.
14,
649-683[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Baeuerle, P. A.,
and Baichwal, V. R.
(1997)
Adv. Immunol.
65,
111-137[Medline]
[Order article via Infotrieve]
|
| 14.
|
Okamoto, T.,
Sakurada, S.,
Yang, J. P.,
and Merin, J. P.
(1997)
Curr. Top. Cell Regul.
35,
149-161[Medline]
[Order article via Infotrieve]
|
| 15.
|
Ghosh, S.,
May, M. J.,
and Kopp, E. B.
(1998)
Annu. Rev. Immunol.
16,
225-260[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Barkett, M.,
and Gilmore, T. D.
(1999)
Oncogene
18,
6910-6924[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Moore, P. A.,
Ruben, S. M.,
and Rosen, C. A.
(1993)
Mol. Cell. Biol.
13,
1666-1674[Abstract/Free Full Text]
|
| 18.
|
Schmitz, M. L.,
and Baeuerle, P. A.
(1991)
EMBO J.
10,
3805-3817[Medline]
[Order article via Infotrieve]
|
| 19.
|
Schmitz, M. L.,
dos Santos Silva, M. A.,
and Baeuerle, P. A.
(1995)
J. Biol. Chem.
270,
15576-15584[Abstract/Free Full Text]
|
| 20.
|
Schmitz, M. L.,
Stelzer, G.,
Altmann, H.,
Meisterernst, M.,
and Baeuerle, P. A.
(1995)
J. Biol. Chem.
270,
7219-7226[Abstract/Free Full Text]
|
| 21.
|
Traenckner, E. B.,
Pahl, H. L.,
Henkel, T.,
Schmidt, K. N.,
Wilk, S.,
and Baeuerle, P. A.
(1995)
EMBO J.
14,
2876-2883[Medline]
[Order article via Infotrieve]
|
| 22.
|
Mercurio, F.,
and Manning, A. M.
(1999)
Curr. Opin. Cell Biol.
11,
226-232[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Zandi, E.,
and Karin, M.
(1999)
Mol. Cell. Biol.
19,
4547-4551[Free Full Text]
|
| 24.
|
DiDonato, J. A.,
Hayakawa, M.,
Rothwarf, D. M.,
Zandi, E.,
and Karin, M.
(1997)
Nature
388,
548-554[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Mercurio, F.,
Zhu, H.,
Murray, B. W.,
Shevchenko, A.,
Bennett, B. L., Li, J. W.,
Young, D. B.,
Barbosa, M.,
Mann, M.,
Manning, A.,
and Rao, A.
(1997)
Science
278,
860-866[Abstract/Free Full Text]
|
| 26.
|
Zandi, E.,
Rothwarf, D. M.,
Delhase, M.,
Hayakawa, M.,
and Karin, M.
(1997)
Cell
91,
243-252[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Zandi, E.,
Chen, Y.,
and Karin, M.
(1998)
Science
281,
1360-1363[Abstract/Free Full Text]
|
| 28.
|
Rothwarf, D. M.,
Zandi, E.,
Natoli, G.,
and Karin, M.
(1998)
Nature
395,
297-300[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Yamaoka, S.,
Courtois, G.,
Bessia, C.,
Whiteside, S. T.,
Weil, R.,
Agou, F.,
Kirk, H. E.,
Kay, R. J.,
and Israel, A.
(1998)
Cell
93,
1231-1240[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Sizemore, N.,
Lerner, N.,
Dombrowski, N.,
Sakurayi, H.,
and Stark, G. R.
(2002)
J. Biol. Chem.
277,
3863-3869[Abstract/Free Full Text]
|
| 31.
|
Nakano, H.,
Shindo, M.,
Sakno, S.,
Nishinaka, S.,
Mihara, M.,
Yagita, H.,
and Okumura, K.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3537-3542[Abstract/Free Full Text]
|
| 32.
|
Ling, L.,
Cao, Z.,
and Goeddel, D. V.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3792-3797[Abstract/Free Full Text]
|
| 33.
|
Lee, F. S.,
Peters, R. T.,
Dang, L. C.,
and Maniatis, T.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9319-9324[Abstract/Free Full Text]
|
| 34.
|
Yang, J. H.,
Lin, Y.,
Guo, Z. J.,
Cheng, J. K.,
Huang, J. Y.,
Deng, L.,
Liao, W.,
Chen, Z. J.,
Liu, Z. G.,
and Su, B.
(2001)
Nat. Immunol.
2,
620-624[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Malinin, N. L.,
Boldin, M. P.,
Kovalenko, A. V.,
and Wallach, D.
(1997)
Nature
385,
540-544[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Regnier, C. H.,
Song, H. Y.,
Gao, X.,
Goeddel, D. V.,
Cao, Z.,
and Rothe, M.
(1997)
Cell
90,
373-383[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Woronicz, J. D.,
Gao, X.,
Cao, Z.,
Rothe, M.,
and Goeddel, D. V.
(1997)
Science
278,
866-870[Abstract/Free |