JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M208696200 on November 4, 2002

J. Biol. Chem., Vol. 278, Issue 2, 919-926, January 10, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/2/919    most recent
M208696200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, X.
Right arrow Articles by Okamoto, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, X.
Right arrow Articles by Okamoto, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The NF-kappa B Activation in Lymphotoxin beta  Receptor Signaling Depends on the Phosphorylation of p65 at Serine 536*

Xu JiangDagger §, Naoko TakahashiDagger , Nobuo Matsui§, Toshifumi TetsukaDagger , and Takashi OkamotoDagger

From the Departments of Dagger  Molecular Genetics and § Orthopedic Surgery, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan

Received for publication, August 25, 2002, and in revised form, October 24, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

NF-kappa B-inducing kinase (NIK) has been shown to play an essential role in the NF-kappa B activation cascade elicited by lymphotoxin beta  receptor (LTbeta R) signaling. However, the molecular mechanism of this pathway remains unclear. In this report we demonstrate that both NIK and Ikappa B kinase alpha  (IKKalpha ) are involved in LTbeta R signaling and that the phosphorylation of the p65 subunit at serine 536 in its transactivation domain 1 (TA1) plays an essential role. We also found that NF-kappa B could be activated in the LTbeta R pathway without altering the level of the phosphorylation of Ikappa B and nuclear localization of p65. By using a heterologous transactivation system in which Gal4-dependent reporter gene is activated by the Gal4 DNA-binding domain in fusion with various portions of p65, we found that TA1 serves as a direct target in the NIK-IKKalpha pathway. In addition, mutation studies have revealed the essential role of Ser-536 within TA1 of p65 in transcriptional control mediated by NIK-IKKalpha . Furthermore, we found that Ser-536 was phosphorylated following the stimulation of LTbeta R, and this phosphorylation was inhibited by the kinase-dead dominant-negative mutant of either NIK or IKKalpha . These observations provide evidence for a crucial role of the NIK-IKKalpha cascade for NF-kappa B activation in LTbeta R signaling.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The lymphotoxin (LT)1 system plays crucial roles in the embryonic development of lymphoid organ, the maintenance of lymphoid architecture, and the formation of ectopic lymphoid tissue adjacent to chronic inflammatory sites (1-3). LT is a heterotrimer complex consisting of alpha  (LTalpha ) and beta  (LTbeta ) subunits (as LTalpha 1beta 2), which bind to its specific receptor (LTbeta R) (1). LTbeta R signaling involves NF-kappa B-inducing kinase (NIK), which eventually activates nuclear factor kappa B (NF-kappa B) (4, 5). The involvement of NIK in the LTbeta R signaling has been suggested by the shared phenotypes of gene knock-out mice of LTalpha , LTbeta , and LTbeta R (1, 6, 7) and alymphoplasia mice (aly/aly) (8) in which spontaneous mutations of NIK were found responsible (9-11). Moreover, LTbeta R signaling was shown to involve both NIK and IKKalpha for NF-kappa B activation (4). It has also been shown that NIK is indispensable for LTbeta R signaling but not for tumor necrosis factor (TNF) signaling (5). However, the molecular mechanism by which NF-kappa B is activated by LTbeta R signaling has not been clarified.

NF-kappa B represents a family of eukaryotic transcription factors participating in the regulation of immune response, cell growth, and survival (12-16). There are five members of the NF-kappa B/Rel family in mammalian cells: the proto-oncogene c-Rel, RelA (p65), RelB, NF-kappa B1 (p50 and its precursor p105), and NF-kappa B2 (p52 and its precursor p100). The most prevalent form of NF-kappa B is a heterodimer of the p50 subunit and p65 that contains transactivation domains necessary for gene induction (17-20).

In cells, NF-kappa B is largely cytoplasmic and therefore remains transcriptionally inactive until a cell receives an appropriate stimulus. In response to proinflammatory cytokines such as TNF and interleukin-1beta (IL-1beta ), the Ikappa B proteins become phosphorylated on two serine residues located in the N-terminal region (21). Phosphorylation of Ikappa B proteins results in rapid ubiquitination and subsequent proteolysis by the 26 S proteasome (15, 22, 23), which allows the liberated NF-kappa B to translocate to the nucleus and participate in target gene transactivation (12-15). The large molecular weight complex consisting of two catalytic subunits, Ikappa B kinases alpha  and beta  (IKKalpha and IKKbeta ), and a regulatory subunit IKKgamma was identified and shown to be responsible for phosphorylating Ikappa B proteins (24-29). It has recently been shown that IKKalpha is not required for Ikappa B degradation or induction of NF-kappa B DNA binding but essential for the generation of transcriptionally competent NF-kappa B (30). The kinase activity of IKKs is induced by a wide variety of NF-kappa B inducers such as TNF or IL-1beta , and mediated by the upstream kinases including NIK and the extracellular signal-regulated kinase kinase kinase 1/3 (31-34). NIK was originally identified as a protein interacting with the TNF receptor-associated factor 2 component of the TNF receptor complex (35). NIK physically interacts via its C-terminal region with IKKalpha and IKKbeta and stimulates their catalytic activity as an upstream effector kinase (32, 36-39).

The NF-kappa B p65 subunit contains at least two independent transactivation (TA) domains (TA1 and TA2) within its C-terminal 120 amino acids and is responsible for binding to the basal transcription factor TFIIB and CBP/p300 coactivators (19, 20). The TNF-mediated signaling was shown to involve phosphorylation of Ser-529 within TA1 by casein kinase II (CKII) (40, 41). Similarly, overexpression of IKKbeta induced phosphorylation of p65 at Ser-536 (42). These two serine residues within p65 TA1 were also shown to be essential for Ras-mediated NF-kappa B activation involving phosphatidylinositol 3-kinase and Akt serine/threonine kinase (43). These signal-induced p65 phosphorylation events appear to induce NF-kappa B-dependent gene expression by augmenting the transcriptional activity of NF-kappa B (p65) rather than by inducing Ikappa B phosphorylation and promoting its nuclear translocation. Interestingly, recent studies revealed the presence of NF-kappa B and Ikappa B in the nucleus even in the resting unstimulated cells (44-47), thus making NF-kappa B susceptible for regulatory phosphorylation in the nucleus.

In this study, we have attempted to clarify the molecular mechanism by which NIK activates NF-kappa B and found that the TA1 domain of p65 subunit is indispensable for NF-kappa B transcriptional activity. We demonstrate that the phosphorylation of p65 at Ser-536, mediated by NIK-IKKalpha , is crucial for LTbeta R signaling.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Constructs-- Mammalian expression vectors, pM-p65, pM-p65-(286-551), pM-p65-(286-520), pM-p65-(521-551), pM-p65-(286-551:Delta 443-476), and pcDNA3.1-p65 were created as previously described (48). pM-p65-(1-286) was generated by amplifying the corresponding p65 fragment by PCR using the oligonucleotide primers 5'-CGGGATCCCGATGGACGAACTGTTCCCCCTCAT-3' and 5'-GCTCTAGAGCGAATTCCATGGGCTCACTGAGCT-3' containing BamHI and XbaI sites. pM-p65-(431-551) was generated by PCR using the oligonucleotides 5'-CGGGATCCCGACCCAGGCTGGGGAAGGAA-3' and 5'-GCTCTAGAGCCGCGTTAGGAGCTGATCTG-3' containing BamHI and XbaI sites. pM-p65-(521-551:S529A) was generated by PCR using the oligonucleotides 5'-GGAATT CCCGGGGCTCCCCAATGGCCTCCTTGCAGGAGATGA-3' and 5'-CGCGGATCCGC GCGTTAGGAGCTGATCTGACTCAGCAGGGCT-3' containing EcoRI and BamHI sites. In order to construct pM-p65-(521-551:S536A), the p65-(521-551:S536A) fragment was generated by PCR using pM-p65 as a template with the oligonucleotide primers 5'-GCTCTA GAGCCCACCATGGACTACAAAGACGATGACGACAAGATGGACGAACTGTTCCCCCTCATCTTCCCGGCAGAGCCAGCCC-3' and 5'-CGCGGATCCGCGTTAGGAGCT GATCTGACTCAGCAGGGCTGAGAAGTCCATGTCCGCAATGGCGGAGAAGTCTTCATCTCCTGAAAGGAGGCC-3', and this PCR product was cut with SmaI and BamHI. These PCR fragments were inserted into the pM vector at respective restriction sites. The plasmid expressing the FLAG-tagged p65, pcDNA3.1(-)-FLAG-p65, was generated by PCR using the oligonucleotides 5'-GCTCTAGAGCCCACCATGGACTACAAAGACGATGACGAC AAGATGGACGAACTGTTCCCCCTCATCTTCCCGGCAGAGCCAGCCC-3' and 5'-CGCGGATCCGCGTTAGGAGCTGATCTGACTCAGCAGGGCTGAGAAGTCCATGTCCGC-3' containing XbaI and BamHI sites. The PCR product was cloned into pcDNA3.1(-) (Invitrogen). pCR2FL-IKKalpha , pCR2FL-IKKbeta , pCR2FL-IKKalpha (KM), and pCR2FL-IKKbeta (KM) expression vectors encoding the wild-type and dominant-negative mutant of IKKalpha and IKKbeta , respectively, were kindly provided by H. Nakano (31). pcDNA3-NIK and pcDNA3-NIK(KM) encoding wild-type NIK and mutant NIK (K429A/K430A) were generous gifts from D. Wallach (35). The N-terminal deletion mutant of Ikappa Balpha (Ikappa Balpha Delta N) encoding amino acids 37-317 (pcDNA3-Ikappa Balpha Delta N) was constructed as described previously (49, 50). The plasmid expressing the Myc-tagged Ikappa B phosphorylation-defective mutant, pcDNA-Myc-Ikappa Balpha (S32A/S36A), was kindly provided by S. Hatakeyama (51). The construction of luciferase (luc) reporter plasmids of 4kappa Bw-luc containing four tandem copies of the HIV kappa B sequence located upstream of minimal SV40 promoter and 4kappa Bm-luc harboring four mutated inactive kappa B sites have been described previously (52). Another luciferase reporter plasmid, Gal4-luc (pFR-luc, Stratagene), containing five tandem copies of the Gal4 binding site upstream of TATA box was used for the evaluation of the transcriptional activity of pM-p65 and its derivatives. All PCR amplification reactions used ExpandTM high fidelity system (Roche Molecular Biochemicals). All the constructs were confirmed by dideoxynucleotide sequencing using ABI PRISMTM dye terminator cycle sequencing ready kit (PerkinElmer Life Sciences) on an Applied Biosystems 313 automated DNA sequencer.

Cell Culture and Transfection-- 293 cells were grown at 37 °C in Dulbecco's modified Eagle's medium (Sigma) with 10% heat-inactivated fetal bovine serum (IBL, Maebashi, Japan). Cells were transfected using FuGENETM 6 transfection reagent (Roche Molecular Biochemicals) according to the manufacturer's recommendations. HT29 cells were grown at 37 °C in McCoy's 5A Medium Modified (Sigma) with 10% heat-inactivated fetal bovine serum (IBL), and cells were transfected using LipofectAMINETM reagent (Invitrogen) according to the manufacturer's recommendations. At 48-h post-transfection, the cells were harvested, and the cell extracts were prepared for the luciferase assay. Luciferase activity was measured using the luciferase assay system (Promega) as described previously (52). Transfection efficiency was monitored by Renilla luciferase activity using the pRL-TK plasmid (Promega) as an internal control, and the luciferase activity was normalized by the Renilla luciferase activity. For each transfection, 50 ng of the luc reporter plasmid and 25 ng of internal control plasmid pRL-TK were used. pUC19 was used to adjust the total amount of DNA (500 ng) transfected. Cells without the stimulation of TNF were lysed 48 h after transfection, and the luciferase activity was measured. Other cells, as indicated, were stimulated with 10 ng/ml of TNF after 24 h of transfection and lysed after an additional incubation for 24 h or stimulated with 2 µg/ml of agonistic anti-LTbeta R monoclonal antibody (mAb) (AC.H6) (53) 10 h before cells were harvested. The data are presented as the fold increase in luciferase activity (mean ± S.D.) relative to the control of three independent transfections.

Immunostaining-- The intracellular localization of p65 in HT29 cells was examined by immunostaining as described previously (50). Briefly, HT29 cells were cultured in 2-well chamber slides and after stimulating with 10 ng/ml of TNF for 15 min or 2 µg/ml of agonistic anti-LTbeta R mAb for 40 min, cells were fixed in 4% (w/v) paraformaldehyde/PBS at room temperature for 20 min and then permeabilized by 0.5% Triton X-100/PBS for 20 min at room temperature. They were then incubated with rabbit polyclonal antibody against p65 (Santa Cruz Biotechnology) for 1 h at 37 °C, rinsed three timed with 0.05% Triton X-100/PBS, and incubated with secondary antibody, fluorescein-conjugated goat anti-rabbit IgG (CAPPEL; ICN Pharmaceuticals), for 1 h at 37 °C. The slides were rinsed three times with PBS and mounted with buffered glycerol for fluorescent microscopic examination. Primary and secondary antibodies were diluted at 1:100 and 1:200 in PBS containing 3% bovine serum albumin, respectively.

Western Blotting-- In order to monitor the phosphorylation of Ikappa B, HT29 cells were stimulated with TNF or agonist anti-LTbeta R mAb, and the cells were lysed in 350 µl of ice-cold lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 0.2% Nonidet P-40, 10 mM sodium fluoride, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin A). To evaluate the protein level of p65, 293 cells were harvested 48 h after transfection. Whole cell extracts were lysed in 350 µl of ice-cold lysis buffer. In order to evaluate the protein level of p65, NIK(KM), IKKalpha (KM), and Ikappa B(S32A/S36A), 48 h after transfection, cells were stimulated by 2 µg/ml of agonist anti-LTbeta R mAb for 40 min, lysed, cleared by centrifugation, and determined for the protein concentration using Bio-Rad DC protein assay kit (Bio-Rad). The cell lysate was resolved by SDS-PAGE and transferred on polyvinylidene difluoride membranes (Millipore). The membranes were incubated with antibodies to anti-Ikappa Balpha (New England Biolabs), anti-phospho-Ikappa Balpha (New England Biolabs), anti-beta -tubulin (MONOSAN), anti-Gal4 (Santa Cruz Biotechnology), anti-FLAG epitope (M2 antibody; Sigma), or anti-Myc epitope (Santa Cruz Biotechnology). The immunoreactive proteins were visualized by enhanced chemilluminescence (ECL) (Amersham Biosciences).

Immunoprecipitation-- To detect the phosphorylated p65 at Ser-536, HT29 cells were transfected with the indicated plasmids including pcDNA3.1(-)-FLAG-p65, treated with 2 µg/ml of anti-LTbeta R mAb for 40 min, and lysed by incubation at 4 °C for 30 min in 2 ml of ice-cold lysis buffer (50 mM Tris, pH 7.8, 300 mM KCl, 1 mM EDTA, 10% of glycerol, 0.3% Nonidet P-40, 1× Complete (Roche Molecular Biochemicals), 5 mM sodium fluoride, 0.4 mM sodium orthovanadate). The lysates were cleared by centrifugation, and the supernatants were incubated with anti-FLAG M2 affinity gel (Kodak) for 1 h at 4 °C. The beads were washed five times with 1 ml of lysis buffer, and the bound proteins were eluted with an equal volume of 2× SDS loading buffer and resolved on 7.5% SDS-PAGE. Western blot was conducted by using anti-phospho-p65 NF-kappa B (Ser-536) antibody (Cell Signaling).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Activation of NF-kappa B-mediated Gene Expression by TNF and LTbeta R-- In Fig. 1A, the effects of TNF and LTbeta R signaling on NF-kappa B-mediated gene expression were compared. TNF stimulated NF-kappa B-dependent gene expression in both 293 and HT29 cells. However, the agonistic LTbeta R mAb stimulated gene expression only in the LTbeta R-expressing HT29 cells as reported (54). Overexpression of NIK stimulated gene expression in both cells, indicating that the differences in these cells depend on LTbeta R. In addition, overexpression of IKKalpha alone did not significantly activate the NF-kappa B-dependent gene expression in both cells whereas that of IKKbeta activated the gene expression by 3- and 1.8-fold in 293 and HT29 cells, respectively. In fact, whereas IKKbeta overexpression induced Ikappa Balpha degradation, IKKalpha overexpression did not (data not shown). These findings suggested that the upstream signal is required for optimal activation as previously reported (24, 26).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 1.   The distinct NF-kappa B activation cascades by TNF and LTbeta R signaling. A, effects of TNF, agonist anti-LTbeta R mAb, NIK, IKKalpha , and IKKbeta on the NF-kappa B-dependent luciferase (luc) gene expression. 293 cells and HT29 cells were transfected with 50 ng of 4× kappa Bw-luc (containing wild-type NF-kappa B binding sites) (closed bar) or 4× kappa Bm-luc (mutant NF-kappa B sites) (open bar) reporter plasmids together with either pcDNA3-NIK (20 ng), pCR2FL-IKKalpha (50 ng), or pCR2FL-IKKbeta (50 ng) expression plasmids. Alternatively, transfected cells were stimulated with 10 ng/ml of TNF for 24 h or 2 µg/ml of agonist anti-LTbeta R mAb for 10 h. Since 293 cells do not have LTbeta R, we used HT29 cells to assess the effect of LTbeta R signaling as reported previously (49). The luciferase activity was normalized by Renilla luciferase activity that was co-transfected as an internal control. The data are presented as the fold increase in luciferase activities (mean ± S.D.) relative to control transfection of three independent experiments. B, phosphorylation and degradation of Ikappa Balpha induced by TNF but not by agonistic anti-LTbeta R mAb. HT29 cells were stimulated with 10 ng/ml of TNF or 2 µg/ml of anti-LTbeta R mAb, the levels of Ikappa Balpha protein and its phosphorylated form were detected by Western blotting using specific antibodies. The Western blotting using anti-beta -tubulin antibody indicated that equivalent amounts of protein prepared from each fraction were resolved on each loading. C, nuclear localization of p65 in HT29 cells induced by TNF but not by anti-LTbeta R mAb. After treating with 10 ng/ml of TNF for 15 min or 2 µg of agonistic anti-LTbeta R mAb for 40 min, HT29 cells were immunostained using primary (rabbit polyclonal antibody against p65) and secondary (fluorescein-conjugated goat anti-rabbit IgG) antibodies, and the intracelluar location of p65 was examined by fluorescence microscopy.

As demonstrated in Fig. 1B, TNF stimulation induced the phosphorylation of Ikappa Balpha and subsequent degradation in HT29 cells. However, stimulation of LTbeta R did not induce either Ikappa Balpha phosphorylation or its degradation, yet induced NF-kappa B-dependent gene expression. Moreover, whereas TNF induced the nuclear translocation of NF-kappa B in HT29 cells, LTbeta R did not (Fig. 1C). The presence of NF-kappa B in the nucleus even in the resting cells has been demonstrated recently by Birbach et al. (44) (see also Ref. 55 for review). These findings suggest that the LTbeta R signaling stimulates NF-kappa B activity without inducing Ikappa Balpha degradation or NF-kappa B nuclear translocation as reported by Yin et al. (5) and that the activation of NF-kappa B by the LTbeta R signaling is not through alteration of intracellular localization of NF-kappa B but presumably by augmenting its transcriptional activity.

NIK-IKKalpha Plays a Key Role in Regulating the Transcriptional Activity of NF-kappa B during LTbeta R Signaling-- In a series of experiments using transient kappa B luciferase assays, we have explored the kinase responsible for NF-kappa B activation in the LTbeta R cascade by using the dominant-negative kinase mutants of NIK (NIK(KM)), IKKalpha (IKKalpha (KM)), and IKKbeta (IKKbeta (KM)). As demonstrated in Fig. 2A, when NIK(KM), IKKalpha (KM), or IKKbeta (KM) were overexpressed in 293 cells, the TNF-induced NF-kappa B activation was greatly inhibited by either of these mutants, more remarkable by IKKbeta (KM). A similar observation was obtained with HT29 cells (data not shown). These results are consistent with the fact that the TNF-mediated NF-kappa B activation was abolished in the IKKbeta gene knock-out mice but could not entirely be abolished in IKKalpha and NIK knock-out mice (5, 56-60). Interestingly, the induction of NF-kappa B-dependent gene expression by agonist anti-LTbeta R mAb was strongly inhibited by NIK(KM) or IKKalpha (KM) in HT29 cells but not by IKKbeta (KM). In Fig. 2B, synergistic activation of gene expression was investigated. When wild-type NIK, IKKalpha , or IKKbeta were overexpressed together with TNF signaling in 293 cells, there was no significant augmentation by IKKalpha as compared from TNF alone. However, either NIK or IKKbeta augmented the effect of TNF in inducing NF-kappa B-dependent gene expression, which were statistically significant (p < 0.01 and p < 0.05, respectively). On the other hand, in HT29 cells, the gene expression elicited by anti-LTbeta R mAb was augmented significantly by IKKalpha and NIK (p < 0.05 and p < 0.01, respectively) but not at all by IKKbeta . These data collectively indicated that the TNF-induced NF-kappa B activation is mainly through IKKbeta but the NF-kappa B activation in LTbeta R pathway is mediated by NIK and IKKalpha , which was consistent with the previous study (4, 5). The results of Fig. 2C demonstrated that the synergism between NIK and IKKalpha or IKKbeta was observed irrespective of the presence or absence of LTbeta R in cells. Moreover, the abolishment of the effect of NIK by IKKalpha (KM), not by IKKbeta (KM), was observed equally in both cells. These observations suggest that activation of NIK is mainly coupled with IKKalpha but not IKKbeta .


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   The essential roles of NIK and IKKalpha in the transcriptional activation of NF-kappa B induced by LTbeta R signaling. A, distinct inhibition profiles by kinase-defective mutants of NIK and IKK in the LTbeta R and TNF signaling. Their effects on the NF-kappa B-dependent luc gene expression were evaluated. Expression plasmids for dominant-negative NIK (pcDNA3-NIK(KM)), IKKalpha (pCR2FL-IKKalpha (KM)), or IKKbeta (pCR2FL-IKKbeta (KM)) were cotransfected with 4× kappa Bw-luc, and the extent of stimulation was compared when NF-kappa B was activated either by TNF or agonistic anti-LTbeta R mAb. After transfection with the indicated plasmids, 293 cells and HT29 cells were stimulated by TNF (10 ng/ml) for 24 h and anti-LTbeta R mAb (2 µg/ml) for 10 h, respectively. Note that the LTbeta R signaling was blocked by NIK(KM) or IKKalpha (KM) but not by IKKbeta (KM). B, synergism between the signaling effectors in NF-kappa B activation. In 293 cells, the synergistic activation was examined between TNF and wild-type NIK, IKKalpha , or IKKbeta . Similarly, in HT29 cells, the synergistic activation was examined between anti-LTbeta R mAb and IKKalpha or IKKbeta . C, synergism between NIK and the downstream kinases in the NF-kappa B activation. NIK was overexpressed together with wild-type IKKalpha , IKKbeta , or their kinase-defective mutants, and the effect on NF-kappa B-dependent gene expression was determined. Note that IKKalpha and IKKbeta augmented the effect of NIK, yet only IKKalpha (KM) inhibited the effect of NIK. There was no effect of IKKalpha , IKKbeta , or NIK overexpression on the levels of endogenous p65 (data not shown). The data are presented as the fold increase in luciferase activities (mean ± S.D.) relative to the control of three independent transfections.

Involvement of the p65 C-terminal TA Domain in Signaling Mediated by NIK-IKKalpha -- Since NIK-IKKalpha was shown to activate the NF-kappa B-dependent gene expression by augmenting the transcriptional activity of NF-kappa B independently of the Ikappa B degradation pathway, we examined whether the p65 subunit is directly involved. In Fig. 3, we adopted a heterologous luciferase reporter system with Gal4-luc from which gene expression is under the control of Gal4. As shown in Fig. 3B, pM-p65, expressing the Gal4-p65 (full-length) fusion protein, augmented the gene expression from the Gal4-dependent promoter when NIK was overexpressed.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   The determination of the target region within p65 in the NF-kappa B activation mediated by NIK-IKKalpha . A, schematic representation of the functional domains in p65 and its mutant constructs. Locations of functional domains including DNA-binding/dimerization domain, nuclear localization signal (NLS), and transcriptional activation (TA) domains are indicated. The indicated regions of p65 were cloned into a vector (pM) producing fusion proteins with the Gal4 DNA-binding domain. B, effect of NIK on the Gal4-dependent gene expression driven by various p65 fusion proteins with the Gal4 DNA-binding domain. 293 cells were transfected with 50 ng of 5× Gal4-TATA-luc reporter plasmid (Gal4-luc) in the presence (closed bar) or absence (open bar) of pcDNA3-NIK (20 ng) together with various pM-p65 constructs (50 ng). The data are presented as the fold increase in luciferase activities (mean ± S.D.) relative to control transfection of three independent experiments. C, dominant-negative mutant of IKKalpha (KM)) inhibited the effect of NIK on the transcriptional activity of Gal4 fusion p65 mutants. 293 cells were transfected with Gal4-luc, pcDNA3-NIK in the presence or absence of pCR2FL-IKKalpha (KM) (50 ng) together with various pM-p65 constructs. The data are presented as the relative folds relative to control transfection of three independent experiments. Similar observation was obtained in HT29 cells (data not shown).

In order to determine which portion of p65 is responsible for this action of NIK, we have created a series of plasmids expressing various portions of p65 in fusion with the Gal4 DNA-binding domain (Fig. 3A): pM-p65, containing full-size p65-(1-551); pM-p65-(1-286), containing RHD; pM-p65-(286-551), containing NLS but lacking RHD; pM-p65-(286-551:Delta 443-476), containing NLS but lacking both RHD and TA2; pM-p65-(286-520), containing NLS but lacking RHD and TA1; pM-p65-(431-551), containing only TA2 and TA1; pM-p65-(521-551), containing only the TA1 domain of p65. In Fig. 3B, NIK stimulated the p65 (full-length)-mediated transactivation by 5.8-fold. Likewise, NIK stimulated the effect of pM-p65-(286-551), pM-p65-(286-551:Delta 443-476), and pM-p65-(286-520), by 3.2-, 3.2-, and 3.4-fold, respectively. Interestingly, NIK stimulated pM-p65-(431-551), containing only TA2 and TA1, by 6.3-fold, and its transcriptional activity as well as the susceptibility to the NIK-mediated activation was similar to pM-p65 (containing full-size p65). Moreover, the Gal4-p65-(521-551) containing only the TA1 domain had the highest susceptibility for the NIK-mediated transactivation (19.7-fold, comparing lanes 15 and 16) although the basal transcription level was relatively low. pM-p65-(1-286) containing only RHD and pM-p65-(286-430) lacking both TA2 and TA1 supported no effect of NIK. These results suggested that the effect of NIK was mainly mediated by TA1.

As it was demonstrated that the activation of NIK was coupled with IKKalpha (4, 61) (Fig. 2C), we next examined whether the dominant-negative IKKalpha mutant could block these effects of NIK. As shown in Fig. 3C, NIK-mediated activation of the transcriptional activity of Gal4-p65 fusion proteins was inhibited by the overexpression of IKKalpha (KM). There was no significant effect with IKKbeta (KM) (data not shown). Similar results were obtained with HT29 cells (data not shown). These data collectively demonstrated that NF-kappa B transcriptional activation elicited by NIK-IKKalpha was mediated through the C-terminal TA1 domain of p65.

Serine 536 in the p65 TA1 Domain Is Responsible for the Effect of NIK-- Since the effect of NIK-IKKalpha on p65 was primarily mediated by the TA1 domain of p65, we further examined the effect of mutation in Ser-536 within TA1. We also addressed whether Ikappa Balpha could block the effect of NIK since it was recently demonstrated that Ikappa Balpha is present in the nucleus and exhibits the inhibition of NF-kappa B transcriptional activity (41, 42, 44-47). In Fig. 4, the Gal4-luc reporter plasmid was co-transfected with pM-p65-(521-551), pM-p65-(521-551:S529A), and pM-p65-(521-551:S536A) with or without pcDNA3-NIK (expressing the wild-type NIK). When Ikappa Balpha Delta N (a superactive mutant of Ikappa Balpha ) was expressed, the effect of NIK was inhibited. Although NIK stimulated the transcriptional activities of pM-p65-(521-551) and pM-p65-(521-551:S529A) similarly as in Fig. 3, B and C, the extent of stimulation was significantly reduced with pM-p65-(521-551:S536A), indicating that Ser-536 is indispensable for the transcriptional activity of p65 in response to the LTbeta R signaling mediated by NIK-IKKalpha . These findings indicated that the effect of NIK on the p65 TA1 domain might depend on the phosphorylation of p65 at serine 536, and this action of NIK could be inhibited by Ikappa Balpha .


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   Involvement of Ser-536 located in p65 TA1 in the NIK-mediated transcriptional activation. Effects of mutations of Ser-529 and Ser-536 in TA1 domain of p65 were examined on the NIK-mediated induction of the transcriptional activity of Gal4-p65 TA1 fusion protein. 293 cells were transfected with Gal4-luc, pcDNA3-NIK, and various pM-p65 TA1 constructs including pM-p65-(521-551) (A), pM-p65-(521-551: S529A) (B), and pM-p65-(521-551: S536A) (C). Effects of Ikappa BDelta N were also examined. The constructs of these plasmids are described in the legend to Fig. 3. Lower panels show the results of Western blotting using anti-Gal4 antibody indicating that equivalent amounts of pM-p65 TA1 and its mutants were expressed in each transfection irrespective of cotransfection with pcDNA3-NIK or pcDNA3-Ikappa BDelta N.

Phosphorylation of p65 at Ser-536 in LTbeta R Pathway-- In Fig. 5, we further examined whether Ser-536 in p65 is essential for the LTbeta R signaling involving NIK and IKKalpha ,and could be phosphorylated in HT29 cells when stimulated with the agonist anti-LTbeta R mAb. We first addressed whether the mutant p65, in which Ser-536 is substituted by Ala, is still responsive to LTbeta R signaling. As demonstrated in Fig. 5A, although anti-LTbeta R mAb stimulated the transcriptional activity of pM-p65-(521-551), its action was completely abolished when Ser-536 was substituted by Ala. In addition, when dominant-negative mutants of NIK and IKKalpha were expressed, this action of LTbeta R signaling was blocked, suggesting that the effect of LTbeta R is mediated by NIK and IKKalpha leading to the phosphorylation at Ser-536 in p65. We examined more directly whether Ser-536 is phosphorylated in response to the LTbeta R signaling (Fig. 5B). When full-length p65 (FLAG-tagged) was expressed, Ser-536 phosphorylation was detected by the specific antibody (anti-phospho-p65 NF-kappa B (Ser-536)), and this phosphorylation was blocked upon coexpression of dominant-negative mutants of NIK or IKKalpha , or phosphodefective Ikappa Balpha (Myc-tagged Ikappa Balpha (S32A/S36A)). These data clearly indicate that LTbeta R signaling eventually leads to the phosphorylation of p65 at Ser-536. Both NIK and IKKalpha are involved, and this process can be blocked by Ikappa Balpha .


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   Phosphorylation of p65 at Ser-536 during LTbeta R signaling. A, involvement of Ser-536 in the TA1-mediated transcriptional activation upon LTbeta R signaling. HT29 cells were transfected with Gal4-luc together with pM-p65-(521-551) or pM-p65-(521-551: S536A) (50 ng each), and the effects of NIK(KM), IKKalpha (KM), or IKKbeta (KM) in the LTbeta R signaling were examined. B, phosphorylation of p65 at Ser-536 by LTbeta R signaling. HT29 cells were co-transfected with various combinations of plasmids expressing FLAG-tagged p65 (FLAG-p65), NIK(KM), FLAG-tagged IKKalpha (KM), and Myc-tagged Ikappa Balpha (S32A/S36A) (Ikappa Balpha mutant in which phosphorylation target Ser residues were substituted by Ala). After stimulation with agonist anti-LTbeta R mAb for 40 min, cell extracts were prepared and immunoprecipitated with anti-FLAG M2 affinity gel. The immunoprecipitates were fractionated by SDS-PAGE and immunoblotted with anti-phospho-p65 NF-kappa B (Ser-536) antibody (upper panel). Lower panels show the immunoblotting detection of NIK(KM), p65, IKKalpha (KM), and Ikappa Balpha (S32A/S36A) proteins by respective antibodies. Results of p65 detection indicate that equivalent amounts of FLAG-p65 were expressed in each transfection. Note the detection of the phosphorylation of p65 at Ser-536 upon LTbeta R signaling and its abrogation by overexpression of NIK(KM) or IKKalpha (KM), kinase-deficient mutants of the corresponding effector kinases or phosphorylation-defective Ikappa Balpha (Ikappa Balpha S32A/S36A).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study we have explored a mechanism by which NF-kappa B is activated by LTbeta R signaling. We found that both NIK and IKKalpha are critically involved in this pathway since either the kinase-deficient mutant of NIK or IKKalpha , but not IKKbeta , could block LTbeta R-mediated NF-kappa B activation and that the LTbeta R-mediated NF-kappa B activation did not induce phosphorylation and subsequent degradation of Ikappa Balpha . We also found that serine 536 phosphorylation in its TA1 transactivation domain is essential. These findings collectively demonstrate the presence of a novel signaling mechanism in the NF-kappa B activation, which is unique to the LTbeta R signaling.

Matsushima et al. (4) found that NIK and IKKalpha were indispensable for NF-kappa B activation in the LTbeta R signaling using aly/aly mice in which formation of the secondary lymphoid tissues was affected although the TNF- and IL-1-mediated NF-kappa B activation signaling remained intact. Similar observations were reported with IKKalpha -deficient mice (57) and NIK-deficient mice (5). In addition, Cao et al. (62) has recently reported another interesting feature of the IKKalpha pathway with the mutant IKKalpha knock-in mice that the signal transduction of receptor activator of NF-kappa B (RANK) leading to NF-kappa B activation was abolished and thus the inducible expression of target cyclin D1 gene was affected. Whereas the responsiveness to proinflammatory stimuli including TNF, IL-1, and LPS are largely dependent on the IKKbeta , other stimuli such as LTbeta , RANK ligand, and Blys/BAFF depend on IKKalpha -mediated signaling (55). These biological features of IKKalpha explain the characteristic developmental defect of the secondary lymphophoid tissues in the IKKalpha knock-out mice. Thus, although IKKalpha and IKKbeta are cross-related and both serve as the catalytic subunits of IKK complex, these findings illustrate the functional heterogeneity of IKKalpha and IKKbeta .

Although a major step that regulates NF-kappa B activity is the removal of Ikappa B from the NF-kappa B/Ikappa B complex, the capacity of nuclear NF-kappa B to drive transcription is also a regulated process. A number of studies support the possibility that p65 phosphorylation regulates the transcriptional competence of nuclear NF-kappa B (41, 63-67). Although the role of PKA in phosphorylating p65 is still controversial (68-70), regulation of the transcriptional competence of p65 by phosphorylation has been widely accepted. Protein kinases such as CKII, PKCzeta , and IKK have been implicated in this process (40-42, 67). For example, Wang and Baldwin (40) reported that the phosphorylation of Ser-529 at the TA1 domain of p65 is associated with the TNF-induced NF-kappa B activation. They later found that CKII interacts with p65 and directly phosphorylates p65 at Ser-529 (41). In addition, Sakurai et al. (42) reported that TNF induced phosphorylation of p65 at Ser-536 in the cell and showed that the p65 could be phosphorylated at Ser-536 by IKKbeta at least in vitro. Moreover, Madrid et al. (43) have recently demonstrated that phosphatidylinositol 3-kinase activates Akt, which subsequently activates IKKalpha and leads to p65 phosphorylation at Ser-536.

One of the possible mechanisms of p65 phosphorylation at its TA domain in controlling its transcriptional competency is to recruit coactivator proteins such as histone acetyl transferases (71, 72) and TLS (73) to NF-kappa B when it binds to the target promoter sequence. Alternatively, p65 phosphorylation may preclude the recruitment of corepressor proteins such as Groucho family proteins that is known to interact with the p65 TA domain (48) and histone deacetylases (HDACs) (74-77). For example, it was reported that cAMP-dependent kinase (PKA)-mediated phosphorylation of p65 caused the p65 association with CBP in vitro (72). The same group has recently demonstrated with cultured cells that p65 was associated with HDAC-1 in unstimulated cells, and it was dissociated from HDAC1 but associated with CBP upon cotransfection with the PKA catalytic subunit (77). Thus, it is possible that p65 phosphorylation may act as a determinant for selecting the interacting partner of NF-kappa B.

The results in this study revealed that LTbeta R signaling induced the p65 phosphorylation at Ser-536 by using phosphorylation-specific antibody. This finding was confirmed with the Ser-536 mutant of p65 TA1, which could not mediate the effect of LTbeta R signaling. Then, where is NF-kappa B (p65) phosphorylated in the cell? In fact, a number of studies have revealed that NF-kappa B and Ikappa B shuttle in and out of the nucleus (44-47). Therefore, NF-kappa B is present in the nucleus even in the unstimulated cells, although to a lesser amount than that in the cytoplasm. More importantly, Birbach et al. (44) found that the treatment of cells with leptomycin B, an inhibitor of CRM1 and a blocking agent of nuclear export, resulted in the nuclear accumulation of NIK and IKKalpha , but not IKKbeta , indicating that these kinases also shuttle between the cytoplasm and the nucleus. IKKalpha has been initially identified as NIK-interacting protein in yeast two-hybrid screens (36). Thus, IKKalpha appears to preferentially associate with NIK where the large IKK complex is not found, such as in the nucleus. Interestingly, when IKKalpha was mutated at lysine 44, the shuttle of IKKalpha between cytoplasm and nucleus was prevented because it is known that the lysine residue at position 44 was also essential for the kinase activity (44), which is consistent with our observation that either dominant-negative IKKalpha (IKKalpha (KM)) or phosphorylation-defective mutant Ikappa Balpha (Ikappa BsDelta N) efficiently blocked LTbeta R signaling. Together with our findings, it is likely that the p65 subunit of NF-kappa B is phosphorylated by the NIK/IKKalpha cascade in the nucleus.

    ACKNOWLEDGEMENTS

We thank Drs. H. Nakano, D. Wallach, and S. Hatakeyama for their generosity in providing the expression vectors encoding wild types and mutants of IKKalpha and IKKbeta , NIK, and Myc-Ikappa Balpha (S32A/S36A), respectively.

    FOOTNOTES

* This work was supported in part by grants-in-aid from the Ministry of Health, Labor and Welfare, the Ministry of Education, Culture, Sports, Science, and Technology of Japan and the Japanease Health Sciences Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Molecular Genetics, Nagoya City University Medical School, 1 Kawasumi, Mizuho-cho, Mizuho-ku Nagoya, Aichi 467-8601, Japan. Tel.: 81-52-853-8204; Fax: 81-52-859-1235; E-mail: tokamoto@med.nagoya-cu.ac.jp.

Published, JBC Papers in Press, November 4, 2002, DOI 10.1074/jbc.M208696200

    ABBREVIATIONS

The abbreviations used are: LT, lymphotoxin; NF-kappa B, nuclear factor kappa B; TA, transactivation domain; NIK, NF-kappa B-inducing kinase; LTbeta R, lymphotoxin beta  receptor; RHD, Rel homology domain; TNF, tumor necrosis factor; IL-1beta , interleukin-1beta ; IKK, Ikappa B kinase; luc, luciferase; HDAC, histone deacetylase; CKII, casein kinase II; mAb, monoclonal antibody; PBS, phosphate-buffered saline; HIV, human immunodeficiency virus.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Fu, Y. X., and Chaplin, D. D. (1999) Annu. Rev. Immunol. 17, 399-433[CrossRef][Medline] [Order article via Infotrieve]
2. Luther, S. A., Lopez, T., Bai, W., Hanahan, D., and Cyster, J. G. (2000) Immunity 12, 471-481[CrossRef][Medline] [Order article via Infotrieve]
3. Hjelmstrom, P., Fjell, J., Nakagawa, T., Sacca, R., Cuff, C. A., and Ruddle, N. H. (2000) Am. J. Pathol. 156, 1133-1138[Abstract/Free Full Text]
4. Matsushima, A., Kaisho, T., Rennert, P. D., Nakano, H., Kurosawa, K., Uchida, D., Takeda, K., Akira, S., and Matsumoto, M. (2001) J. Exp. Med. 193, 631-636[Abstract/Free Full Text]
5. Yin, L., Wu, L., Wesche, H., Arthur, C. D., Michael White, J., Goeddel, D. V., and Schreiber, R. D. (2001) Science 291, 2162-2165[Abstract/Free Full Text]
6. Matsumoto, M., Fu, Y. X., Molina, H., and Chaplin, D. D. (1997) Immunol. Rev. 156, 137-144[CrossRef][Medline] [Order article via Infotrieve]
7. Futterer, A., Mink, K., Luz, A., Kosco-Vilbois, M. H., and Pfeffer, K. (1998) Immunity 9, 59-70[CrossRef][Medline] [Order article via Infotrieve]
8. Miyawaki, S., Nakamura, Y., Suzuka, H., Koba, M., Yasumizu, R., Ikehara, S., and Shibata, Y. (1994) Eur. J. Immunol. 24, 429-434[Medline] [Order article via Infotrieve]
9. Shinkura, R., Kitada, K., Matsuda, F., Tashiro, K., Ikuta, K., Suzuki, M., Kogishi, K., Serikawa, T., and Honjo, T. (1999) Nat. Genet. 22, 74-77[CrossRef][Medline] [Order article via Infotrieve]
10. Garceau, N., Kosaka, Y., Masters, S., Hambor, J., Shinkura, R., Honjo, T., and Noelle, R. J. (2000) J. Exp. Med. 191, 381-385[Abstract/Free Full Text]
11. Fagarasan, S., Shinkura, R., Kamata, T., Nogaki, F., Ikuta, K., Tashiro, K., and Honjo, T. (2000) J. Exp. Med. 191, 1477-1486[Abstract/Free Full Text]
12. Baldwin, A. S., Jr. (1996) Annu. Rev. Immunol. 14, 649-683[CrossRef][Medline] [Order article via Infotrieve]
13. Baeuerle, P. A., and Baichwal, V. R. (1997) Adv. Immunol. 65, 111-137[Medline] [Order article via Infotrieve]
14. Okamoto, T., Sakurada, S., Yang, J. P., and Merin, J. P. (1997) Curr. Top. Cell Regul. 35, 149-161[Medline] [Order article via Infotrieve]
15. Ghosh, S., May, M. J., and Kopp, E. B. (1998) Annu. Rev. Immunol. 16, 225-260[CrossRef][Medline] [Order article via Infotrieve]
16. Barkett, M., and Gilmore, T. D. (1999) Oncogene 18, 6910-6924[CrossRef][Medline] [Order article via Infotrieve]
17. Moore, P. A., Ruben, S. M., and Rosen, C. A. (1993) Mol. Cell. Biol. 13, 1666-1674[Abstract/Free Full Text]
18. Schmitz, M. L., and Baeuerle, P. A. (1991) EMBO J. 10, 3805-3817[Medline] [Order article via Infotrieve]
19. Schmitz, M. L., dos Santos Silva, M. A., and Baeuerle, P. A. (1995) J. Biol. Chem. 270, 15576-15584[Abstract/Free Full Text]
20. Schmitz, M. L., Stelzer, G., Altmann, H., Meisterernst, M., and Baeuerle, P. A. (1995) J. Biol. Chem. 270, 7219-7226[Abstract/Free Full Text]
21. Traenckner, E. B., Pahl, H. L., Henkel, T., Schmidt, K. N., Wilk, S., and Baeuerle, P. A. (1995) EMBO J. 14, 2876-2883[Medline] [Order article via Infotrieve]
22. Mercurio, F., and Manning, A. M. (1999) Curr. Opin. Cell Biol. 11, 226-232[CrossRef][Medline] [Order article via Infotrieve]
23. Zandi, E., and Karin, M. (1999) Mol. Cell. Biol. 19, 4547-4551[Free Full Text]
24. DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E., and Karin, M. (1997) Nature 388, 548-554[CrossRef][Medline] [Order article via Infotrieve]
25. Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J. W., Young, D. B., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) Science 278, 860-866[Abstract/Free Full Text]
26. Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997) Cell 91, 243-252[CrossRef][Medline] [Order article via Infotrieve]
27. Zandi, E., Chen, Y., and Karin, M. (1998) Science 281, 1360-1363[Abstract/Free Full Text]
28. Rothwarf, D. M., Zandi, E., Natoli, G., and Karin, M. (1998) Nature 395, 297-300[CrossRef][Medline] [Order article via Infotrieve]
29. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay, R. J., and Israel, A. (1998) Cell 93, 1231-1240[CrossRef][Medline] [Order article via Infotrieve]
30. Sizemore, N., Lerner, N., Dombrowski, N., Sakurayi, H., and Stark, G. R. (2002) J. Biol. Chem. 277, 3863-3869[Abstract/Free Full Text]
31. Nakano, H., Shindo, M., Sakno, S., Nishinaka, S., Mihara, M., Yagita, H., and Okumura, K. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3537-3542[Abstract/Free Full Text]
32. Ling, L., Cao, Z., and Goeddel, D. V. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3792-3797[Abstract/Free Full Text]
33. Lee, F. S., Peters, R. T., Dang, L. C., and Maniatis, T. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9319-9324[Abstract/Free Full Text]
34. Yang, J. H., Lin, Y., Guo, Z. J., Cheng, J. K., Huang, J. Y., Deng, L., Liao, W., Chen, Z. J., Liu, Z. G., and Su, B. (2001) Nat. Immunol. 2, 620-624[CrossRef][Medline] [Order article via Infotrieve]
35. Malinin, N. L., Boldin, M. P., Kovalenko, A. V., and Wallach, D. (1997) Nature 385, 540-544[CrossRef][Medline] [Order article via Infotrieve]
36. Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Cell 90, 373-383[CrossRef][Medline] [Order article via Infotrieve]
37. Woronicz, J. D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D. V. (1997) Science 278, 866-870[Abstract/Free