Originally published In Press as doi:10.1074/jbc.M208993200 on November 8, 2002
J. Biol. Chem., Vol. 278, Issue 2, 991-997, January 10, 2003
Nak1, an Essential Germinal Center (GC) Kinase Regulates Cell
Morphology and Growth in Schizosaccharomyces pombe*
Timothy Y.
Huang
,
Nancy A.
Markley§, and
Dallan
Young¶
From the Department of Biochemistry & Molecular Biology, University
of Calgary, Calgary, Alberta T2N 4N1, Canada
Received for publication, September 3, 2002, and in revised form, October 24, 2002
 |
ABSTRACT |
We have identified and characterized Nak1, a
652- amino acid NH2-terminal kinase belonging to
the group II germinal center kinase (GCK) family, in
Schizosaccharomyces pombe. We found that nak1
is essential for cell proliferation. Furthermore, partial repression of
nak1, under regulation of an integrated nmt1
promoter, resulted in an aberrant round cellular morphology, actin and
microtubule mislocalization, slow growth, and cell division defects.
Overexpression of either a kinase-inactive mutant
(Nak1K39R) or the non-catalytic domain resulted in similar
phenotypes, suggesting dominant-negative effects. By deletion analysis,
we mapped the region responsible for this dominant-negative effect to
the COOH-terminal 99 residues. Furthermore, we found that deletion of
the COOH-terminal 99 residues inhibited Nak1 autophosphorylation, and
expression of a partially inactive (Nak1T171A) or truncated
(Nak11-562) protein only weakly suppressed morphological
and growth phenotypes, indicating that both kinase and COOH-terminal
regions are important for Nak1 function. GFP-Nak1 localized uniformly
throughout the cytoplasm, unlike many other proteins which influence
cell polarity that preferentially localize to cell ends. Together, our
results implicate Nak1 in the regulation of cell polarity, growth, and division and suggest that the COOH-terminal end plays an important role
in the regulation of this kinase.
 |
INTRODUCTION |
Schizosaccharomyces pombe are cylindrical shaped cells
that elongate by polarized growth at the cell ends during interphase. The establishment of polarity and symmetrical directionality is essential in growth and developmental processes of most eukaryotic cell
types (1-4). The study of various model systems has identified many
genetic elements involved in providing cells with positional information during growth and development. For example, studies of cell
morphogenic processes in fission yeast have led to the identification
of numerous proteins such as Cdc42 (5), Scd1 (6), casein kinase II (7),
Tea1 (8), Orb6 (9, 10), and Pom1 (11) that are involved in mediating
polar cell growth. Through such studies it is evident that polarized
cell growth involves the coordinated function of positional signals
within the cell, regulation of signal transduction pathways, and
cytoskeletal reorganization (3, 12). However, the mechanisms by which such proteins regulate cell morphogenesis and the mode by which their
dysfunction results in loss of cell polarity remain unclear.
The p21-activated kinases
(PAKs)1 have been implicated
in the regulation of cell morphology and cytoskeletal dynamics (13), various signaling pathways (14-19), and apoptotic responses (20, 21).
PAK-related kinases are grouped into two main families based on the
arrangement of their respective functional domains (22, 23). The true
PAKs, originally characterized as primary downstream effectors for
Rac/Cdc42 small molecular weight GTPases, have a COOH-terminal kinase
domain and an NH2-terminal regulatory region. The
NH2-terminal domain contains a conserved CRIB (Cdc42/Rac interactive binding) motif that mediates Cdc42/Rac binding to PAKs,
resulting in their consequent activation (24, 25). In fission yeast,
Shk1/Pak1 is a critical effector for Cdc42, and it has been shown to
play roles in the regulation of cell morphology, sexual
differentiation, and mitosis (16, 26-29). Genetic analyses suggest
that the functions of the two fission yeast PAKs (Pak1/Shk1 and
Pak2/Shk2) are largely redundant (29, 30).
A second PAK-related kinase family, the GCKs (germinal center kinases),
comprise highly conserved NH2-terminal kinase domains and
less conserved COOH-terminal regulatory domains. Unlike the true PAKs,
GCKs do not have CRIB motifs and do not bind Rac/Cdc42 GTPases. GCKs
can be subdivided into two groups based on their structural and
functional properties. Group I GCKs are most similar to mammalian Gck1
and have homologous carboxyl termini containing at least two PEST
motifs, two polyproline SH3 domain binding sites, and an additional
~350-amino acid highly conserved region (22). Various group I
GCKs have been implicated in mediating stress response and cytoskeletal
arrangement (22, 23, 31). The function and regulation of group II GCKs
are less well characterized. Studies in fission yeast have shown that
Sid1, a group II GCK, is essential in mediating cytokinesis, most
likely by localizing and phosphorylating downstream targets at spindle
pole bodies between anaphase and septation (32, 33). Cdc14 was recently shown to positively regulate Sid1 by binding the COOH-terminal region
of this kinase (34). Previous biochemical evidence suggested that the
carboxyl-terminal region of some group II GCKs contains an
autoinhibitory domain, although Sid1 requires the regulatory region for
optimal activity (34-36).
In this paper, we describe the identification and characterization of
Nak1, a fission yeast group II GCK. Our results indicate that Nak1 is
required for bipolar cell morphology and cell growth and suggest that
the COOH-terminal region plays an important role in the regulation of
this kinase.
 |
EXPERIMENTAL PROCEDURES |
Yeast Strains and Methods--
Genotypes of S. pombe
strains used in this study are listed in Table
I. Methodology employed in culturing
yeast strains, transformation, iodine staining, and transformations was
undertaken according to procedures described previously (37).
Identification of nak1--
A DNA fragment encoding an
NH2-terminal Nak1 peptide was amplified from a S. pombe cDNA library, as described previously (38). The
amplified nak1 DNA fragment was used as a probe to isolate several clones containing the nak1 gene from a S. pombe genomic DNA library constructed in the pWH5 vector (gift of
D. Beach); a 7-kb XbaI DNA fragment encoding the entire
nak1 gene was subcloned into pBluescript II SK
(Stratagene) to generate pNak1. The nak1 DNA sequence was
determined and has been deposited in the GenBankTM database
(accession number AF091345).
Plasmids--
Techniques used in PCR amplification, restriction
digestion, and other cloning procedures have been described previously
(39). pREP3XHA-Nak1, pREP3XHA-Nak1481-652, and
pREP3XHA- NAK242-562 deletion plasmids were constructed
by inserting SpeI/BglII Nak1-coding DNA fragments
amplified from S. pombe genomic DNA into
SpeI/BamHI sites of pREP3XHA (40).
pREP3XHA-Nak1K39R was constructed by (i) amplification of
Nak1 using the mutagenic primer
5'-AAATTAAGAATCCTGATGGCAACAG and the T1 forward
primer 5'-GCTTCGACTAGTATGGAAAATAACACTGCTTCT; (ii) the 128-bp product was used to amplify a Nak1K39R fragment with the T5 reverse
primer 5'-GCTTCGAGATCTGTGCCAAATTCCCCAACC; (iii) the amplified
1089-bp SpeI/BglII fragment was cloned into pREP3XHA SpeI/BamHI sites and sequenced; (iv) a
756-bp SpeI/BamHI fragment from this construct
replaced the corresponding fragment in pREP3XHA-Nak1.
pREP3XHA-NAK1-562, K39R was constructed by inserting a
SpeI/BglII fragment amplified from
pREP3XHA-Nak1K39R into the pREP3XHA
SpeI/BamHI sites. pAALNHA was constructed by inserting the HA epitope coding sequence
(CTGCAGATCTCGAGATGTATCCTTATGACGTGCCTGACTATGCCAGCCTGGGAGGACCGTCGACAACTAGTAGCGGCCGCAGGATCC) into PstI/BamHI sites in pAALN (41). pAALNHA-Nak1
was constructed by inserting a 2074-bp SpeI/BamHI
fragment encoding Nak1 into pAALNHA SpeI/BamHI
sites. pAALNHA-Nak1T171A was constructed by (i) amplifying
a 571-bp fragment with a 5'-ACGTTTATTGGAGCGCCTTATTGG mutagenic primer and T1 forward primer; (ii) the amplified product was
used as a primer to amplify a 1089-bp SpeI/BglII
fragment with the T5 reverse primer; (iii) the resulting fragment was
inserted into pAALNHA SpeI/BamHI sites and
sequenced to verify incorporation of the appropriate mutation; and (iv)
a 756-bp SpeI/BamHI Nak1T171A
fragment from this construct was used to replace the corresponding SpeI/BamHI fragment from pAALNHA-Nak1.
pAALNHA-Nak11-562 was constructed by inserting a 1801 bp
amplified fragment encoding a truncated Nak1 into pAALNHA
SpeI/BamHI sites. The atb2p coding sequence was amplified by PCR from S. pombe genomic DNA, and
inserted into the SpeI/BamHI sites in pAALNGFPHA
(42) to generate pAALNGFPHA-Atb2. pAALNeGFP was constructed by
insertion of a amplified XhoI/BglII fragment
encoding GFP into XhoI/BamHI sites of pAALNHA.
pAALNGFPHANak1, pAALNGFPHANak11-562, and
pAALNGFPHANak1481-652 were cloned by inserting
PCR-amplified SpeI/BglII fragments encoding the
corresponding regions of Nak1 into SpeI/BamHI
sites in pAALNGFPHA. Expression plasmids encoding COOH-terminal
HA-tagged Nak1 proteins were constructed by inserting the Nak1 coding
sequence into pREP3XC-HA. This vector was constructed by amplifying the
HA-epitope coding sequence using the primers
5'-GATCCTCGAGACTAGTAGCGGCCGCAGGATCCGGAGGAATGTATCCTTATGACGTGCCTGAC and 5'-GATCAGATCTTCATGTCGACGGTCCTCCCAGGCTG and ligating the
XhoI/BglII product into the
XhoI/BamHI sites of pREP3X.
SpeI/BglII Nak1-coding fragments from
pREP3XHA-Nak1, pREP3XHA-Nak1T171A, and
pREP3XHA-Nak1K39R were amplified by PCR and ligated into
the SpeI/BamHI sites of pREP3XC-HA to make
pREP3XCHA-Nak1, pREP3xC-HA Nak11-562,
pREP3XCHA-Nak1T171A, and
pREP3XCHA-Nak1K39R.
nak1 Gene and Promoter Replacement--
The region encoding the
Nak1 catalytic domain was replaced with the ura4 selectable
marker in the S. pombe diploid strain SP826 by the gene
replacement method as follows (43, 44). pNak1
Ura was derived from
pNak1 by replacing the 653-bp BsiWI-NdeI fragment
with a 1.8-kb fragment containing ura4. SP826 was
transformed with the 6.4-kb XbaI insert of pNak1
Ura, and
Ura+ transformants were selected on PMA + Leu medium.
Independent transformants were tested for stability of the Ura+
phenotype, and Southern blot analysis was performed to confirm that
they contained the proper disruption in one copy of the endogenous
nak1 genes. h90/h+N revertants of
these strains, which occur at a frequency of ~10
3, were
detected by the iodine vapor staining test. Diploid strains were
analyzed by tetrad analysis.
The endogenous nak1 promoter was replaced with the
repressible nmt1 promoter in the haploid S. pombe
strain RL143. pGEM-nmt1-nak1 was constructed as follows: (i) a 1016-bp
fragment was amplified from S. pombe strain RL143 genomic
DNA using primers XK3F and B3REV, appended with an additional 3' dA
overhang, and cloned into pGEM-T (Promega) to produce pGEM-3RE; (ii) a
2951-bp ura4/nmt1 promoter fragment, amplified
from pREP82x using a XF and KR primers, was cloned into
XhoI/KpnI sites of pGEM-3RE to produce
pGEM-3RE/UN; (iii) a 998-bp fragment, amplified from S. pombe (strain RL143) genomic DNA using a X5F and N5REV primers,
was inserted into the XhoI/NheI sites of
pGEM-3RE/UN. The 4927-bp NotI/SphI DNA fragment from pGEM-nmt1-Nak1 was used to replace the endogenous nak1
promoter with the pREP82X nmt1 promoter. S. pombe
(strain RL143) was transformed with the nmt1-nak1
replacement cassette, and Ura+ transformants were passaged
on non-selective minimal medium (PMA with Leu and Ura) to select
for stable Ura+ integrants. Southern blot analysis was
performed to confirm integration of the nmt1-nak1 regulatory
cassette into the correct locus.
Fluorescence Microscopy--
Actin staining and localization was
undertaken according to methods described previously (45).
pAALNGFPHA-Atb2, encoding GFP-atb2p (
-tubulin 2) was used to
visualize microtubule distribution (46, 47).
Cell Cycle Analysis--
nmt1-nak1 cells were grown
in the absence or presence of 100 µg/ml thiamine and rapidly fixed in
70% ethanol. Cells were stained with propidium iodide by methods
described previously (45), analyzed for cell cycle distribution by flow
cytometry, and viewed under isothiocyanate optics for DNA staining.
Fluorescence micrographs were compared with corresponding DIC images
for the presence of dinucleated cells and the presence of a septum.
Immunoprecipitation and Kinase Assays--
Yeast cultures were
grown in minimal medium with adenine (PMA) to saturation in the
presence of thiamine (100 µg/ml), washed once with PMA, diluted into
thiamine-free medium, and grown to an OD600 = 0.8. Cells were subsequently collected by centrifugation and resuspended in
yeast lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.1% Nonidet P-40, 10 µg/ml leupeptin, 1 µg/ml pepstatin A, 100 µg/ml
phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin). Yeast cells
were vortexed with glass beads, and crude lysates were cleared by
centrifugation at 7000 rpm for 1 min. Relative protein concentrations
were subsequently determined by Bio-Rad protein assay.
Immunoprecipitation of HA-tagged proteins from yeast cell lysates were
undertaken by preclearing equal quantities of yeast cell lysate with
protein A-Sepharose slurry for 20 min prior to incubation with 12CA5
(anti-HA) antibody cross-linked to protein A-Sepharose for 2 h at
4 °C. Immune complexes were centrifuged at 6000 rpm and washed three
times with yeast lysis buffer (750 µl per wash); samples were divided
evenly upon the last wash. Half of the samples were resuspended in
SDS-PAGE protein sample buffer, boiled, separated by SDS-PAGE, Western
blotted onto nitrocellulose, and probed with 12CA5 antibody to detect
HA-epitope tagged proteins. The other half of the immunoprecipitates
were resuspended in kinase buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 10 mM MgCl2, 1 mM MnCl2, 5 µCi [
-32P]ATP, 5 µM ATP, 1 µg of myelin basic protein) and incubated at 30 °C for 25 min. Kinase reactions were terminated by boiling in
Laemelli buffer for 5 min, resolved by SDS-PAGE electrophoresis, and
stained with Coomassie Blue. The resulting gels were destained, dried,
and visualized by autoradiography.
 |
RESULTS |
Nak1 Belongs to the Group II GCK Family--
We previously
identified kinases from a fission yeast cDNA library by PCR using
degenerate oligonucleotides derived from conserved regions of kinase
catalytic domains as primers (38). The PCR products were cloned, and
their DNA sequences were determined. One clone we identified encoded a
region of a novel kinase that we have named Nak1. We used this clone to
generate a probe to screen a S. pombe genomic DNA library,
and we identified and determined the DNA sequence of a 7-kb DNA insert
containing the entire nak1 gene (see "Experimental
Procedures"). The DNA sequence of nak1 revealed three
exons encoding a 652-amino acid residue protein that exhibits a high
degree of sequence identity with PAKs and is most closely related to
the group II GCKs (Fig. 1). Like other GCKs, Nak1 has an NH2-terminal catalytic region containing
the PAK GTPY/FWMAPE signature motif and other conserved domains typical of GCKs. In addition, Nak1 contains a 411-residue COOH-terminal non-catalytic domain that does not share significant sequence identity
with other proteins. Similar to group II GCKs, Nak1 lacks a CRIB
CDC42/RAC-binding motif characteristic of PAKs, or SH3-binding motifs
unique to PAKs and group I GCKs.

View larger version (122K):
[in this window]
[in a new window]
|
Fig. 1.
Nak1 is a GC kinase. The catalytic
kinase domains of human GCK1 (accession number AAA20968), MST4
(accession number AF344882), MST3 (accession number NP_003567), SOK1
(accession number O00506), Dictyostelium discoideum SEVK
(accession number AAC24522), and S. pombe NAK1 (accession
number AAC63343) were aligned using the CLUSTALW alignment algorithm
(56). Identical corresponding amino acid residues are shaded.
|
|
Nak1 Is Essential for Viability, and nak1 Repression Results in
Loss of Cell Polarity and Growth Inhibition--
To investigate the
function of Nak1, we constructed and examined the phenotypes of
S. pombe strains in which nak1 is deleted. One
copy of the nak1 open reading frame was replaced with the ura4 selectable marker in a diploid S. pombe
strain (see "Experimental Procedures"). Sporulation and tetrad
analysis of several independently derived Ura+ diploid
strains consistently resulted in two viable Ura
spores,
indicating that nak1 is essential for germination and/or cell growth. On closer examination, it was clear that the other two
spores in each tetrad had germinated and given rise to microcolonies (2-8 cells) prior to growth arrest. The cells in these small colonies exhibited an abnormal round shape (data not shown).
To further investigate the function of Nak1, we generated a strain in
which the endogenous nak1 promoter was replaced with the
thiamine-repressible nmt1 promoter (see "Experimental
Procedures"). We observed that 12 h after addition of thiamine
to repress nak1 expression, cells were smaller and more
oval-shaped, rather than exhibiting the normal rod-shaped morphology of
fission yeast (Fig. 2A). This
indicates that cells have begun to lose normal polarity, but suggests
that they still retain sufficient levels of Nak1 to maintain partial
cell polarity. Although the small cell size could reflect a reduced
G1 phase, this effect appears to be temporary, since many
cells become large and completely round by 18 h after addition of
thiamine. Also, at the 18-h time point, actin was no longer polarized
and was redistributed around the cellular circumference. We also
observed that actin still localized to medial sites of division after
loss of cell polarity. Also, microtubules, which normally extend along
the long axis of cells, are short and appear to be scattered in
differing directions within the cell 12 h after nak1
repression and subsequently lengthen around the radial axis as cells
became round and enlarged 18 h after repression. In addition,
nak1-repressed cells exhibited a slow growth phenotype,
which was more severe at high temperature and high salt concentration
(Fig. 2B). We also examined cell cycle progression of
nak1-repressed cells by flow cytometry. Actively growing
fission yeast spend ~70% of their time in G2, with a 2C DNA content. Nuclear division occurs in M phase resulting in
binucleated cells, which enter the G1 phase of the cell
cycle. However, cell division is not normally completed until S phase
as DNA replication takes place. Thus, most cells contain 2C DNA
content, except during S phase when the DNA content varies between 1C
(cells that divide before DNA replication) and 4C (cells that remain
undivided after DNA replication) (48, 49). Interestingly, we found that
a large population of cells with greater than 2C DNA content
accumulated upon nak1 repression (Fig. 2C),
suggesting a delay in cell division or cell separation until late S
phase. This conclusion is further supported by our observation that
there is a concomitant increase in the proportion of binucleated cells
upon nak1 repression (Table II). Previous reports indicate that
~10% of wild-type cells are septated/binucleated in a growing
culture (50, 51). We observed a similar level of
nmt1-nak1 binucleated cells in the absence of
thiamine, but this level increased significantly 12-18 h after the
addition of thiamine to repress nak1 expression. A
significant proportion of these binucleated cells were septated,
implying a delay in cell separation following septa formation.
Together, these results indicate that Nak1 is essential for bipolar
cell morphology, cell proliferation, and normal cell cycle
progression.

View larger version (77K):
[in this window]
[in a new window]
|
Fig. 2.
Repression of nak1 results
in aberrant cell polarity and growth phenotypes. A,
TYH1 (nmt1-nak1) cells expressing GFP-Atb2 ( -tubulin)
were grown at 30 °C in PMA minimal medium in the presence or
absence of 100 µg/ml thiamine to repress nak1 expression
for 12 or 18 h. Cells were either fixed and stained with
TRITC-phalloidin to visualize actin localization or visualized for
GFP- -tubulin to observe microtubule localization by fluorescence
microscopy. Cells were also examined by DIC microscopy. B,
TYH1 (nmt1-nak1) and SPU (wild type) strains were grown on
PMA minimal medium plates in the presence or absence of 100 µg/ml thiamine (+B1) and 1.2 M KCl
(+KCl) at the indicated temperature (30 °C or 35 °C)
for 3-5 days. C, TYH (nmt-nak1) cells were grown
in the presence (+B1) or absence ( B1) of 100 µg/ml thiamine for 20 h at 30 °C and analyzed by flow
cytometry.
|
|
Overexpression of a Mutant Kinase-inactive Nak1 or the
Non-catalytic Domain Results in Dominant-negative Phenotypes--
To
further examine the function and regulation of Nak1, we generated
expression constructs containing a series of deletions and specific
mutations within the Nak1 coding sequence (Fig.
3), including mutation of the critical
ATP-binding region (HA-Nak1K39R) predicted to produce an
inactive kinase. We also generated a construct predicted to encode a
partially inactive kinase (HA-Nak1T171A) by site-directed
mutation of a critical autophosphorylation/activation Thr residue (19).
These mutant proteins were detectable in yeast extracts by Western blot
analysis using anti-HA antibody, indicating that they were stably
expressed (data not shown). We found that overexpression of HA-Nak1 in
a normal haploid S. pombe background did not have a
significant effect on growth or morphology (data not shown). However,
overexpression of either the kinase-inactive mutant
(HA-Nak1K39R) or the non-catalytic domain of Nak1
(HA-Nak1262-652) produced a round morphology similar to
that resulting from nak1 repression (Fig.
4A), suggesting that these
mutant proteins act in a dominant-negative manner to block endogenous
Nak1 function. Furthermore, overexpression of the partially inactive
mutant HA-Nak1T171A produced a similar dominant-negative
morphological effect (data not shown). These morphological aberrations
are also associated with slow growth at high temperature and high salt
concentration (35 °C, 1.2 M KCl) (Fig.
4B).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3.
Schematic diagram of mutant Nak1 expression
constructs. The Nak1 NH2-terminal kinase domain
(residues 1-262), COOH-terminal non-catalytic domain (residues
262-652), and the CTR region (562-652) are indicated (above). The
numbers at the left and the bars at the
right indicate the regions of Nak1 encoded by the various
deletion constructs.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 4.
Overexpression of the Nak1 CTR results in
dominant-negative growth and morphological phenotypes.
A, wild-type (RL143) cells expressing the indicated mutant
Nak1 proteins under the control of the thiamine-repressible
nmt1 promoter were grown on thiamine-free medium for 3 days
at 30 °C and examined by DIC microscopy. B, RL143 cells
expressing the indicated mutant Nak1 proteins were also grown on
thiamine-free medium at 35 °C for 7 days in the presence of 1.2 M KCl. Expression plasmids used for A and
B were pREP3XHA (control), pREP3XHA-Nak1K39R,
pREP3XHA-Nak11-562, K39R,
pREP3XGFPHA-Nak1262-652,
pREP3XGFPHA-Nak1262-562, and
pREP3XGFPHA-Nak1554-652.
|
|
The causative region of Nak1 producing these dominant-negative
morphological and proliferative phenotypes was mapped to the COOH-terminal end (residues 554-652), which we refer to as the CTR
(COOH-terminal region). Expression of the CTR
(HA-Nak1554-652) alone was sufficient to produce a
dominant-negative morphological phenotype, while cells expressing the
Nak1 non-catalytic domain lacking the CTR (HA-Nak262-562)
appeared normal (Fig. 4A). Moreover, expression of
kinase-inactive Nak1 (HA-Nak1K39R), the non-catalytic
domain (HA-Nak1262-652), or the CTR
(HA-Nak1481-652) resulted in severe growth inhibition at
high temperature and high salt concentration (35 °C, 1.2 M KCl), but cells expressing the kinase-inactive mutant
lacking the CTR (HA-Nak11-562, K39R) or the non-catalytic
domain lacking the CTR (HA-Nak1262-562) were able to grow
under these conditions (Fig. 4B). In summary, these results
suggest that overexpression of the CTR abrogates endogenous Nak1
activity resulting in dominant-negative phenotypes.
The CTR Is Required for Proper Nak1 Function--
Expression of
HA-Nak1 results in full reversion of morphological and slow growth
phenotypes associated with nak1 repression in
nmt1-nak1 strains (Fig.
5, A and B).
However, expression of the partially inactive mutant
(HA-Nak1T171A) or Nak1 lacking the CTR
(HA-Nak11-562) only partially rescued the morphological
and slow growth phenotypes. These results suggest that both kinase
activity and the CTR are important for Nak1 function.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
The CTR is important for Nak1 function.
A, TYH1 (nmt1-nak1) cells expressing HA-Nak1,
HA-Nak11-562 (lacking the CTR), or mutant
HA-Nak1T171A from ADH1 promoter constructs were
grown in the presence or of 100 µg/ml thiamine at 30 °C for 3 days
and examined by DIC microscopy. B, cells were grown at
35 °C in the presence of 1.2 M KCl for 5 days.
Expression plasmids used for A and B were pAALNHA
(control), pAALNHA-Nak1, pAALNHA-Nak11-562, and
pAALNHA-Nak1T171A. C, precleared extracts from
wild-type SPU strains expressing HA-Nak1 or HA-Nak11-562
were immunoprecipitated with anti-HA (12CA5) antibody. Half of the
immunoprecipitates were immunoblotted with 12CA5 (anti-HA) antibody
(top panel), while the other half were assayed for
autokinase activity (middle panel) and phosphorylation of
myelin basic protein (MBP) (bottom panel).
Expression constructs used were pREP3xC-HA (control,
first lane), pREP3xC-HA Nak1 (second lane), and
pREP3xC-HA Nak11-562 (third lane).
|
|
To further examine the role of the CTR, we expressed HA-Nak1 and
HA-Nak11-562 in a wild-type S. pombe strain,
immunoprecipitated the HA-tagged proteins from cell extracts, and
performed in vitro kinase assays. We found that
immunoprecipitated HA-Nak1 exhibited a detectable level of
autophosphorylation and phosphorylation of myelin basic protein,
whereas deletion of the CTR resulted in a significant decrease in
kinase activity, indicating that the CTR is critical for Nak1 kinase
activity in vitro (Fig. 5C). Together, our
evidence implicates the CTR as an important regulatory sequence and
suggests that Nak1 may be regulated by the association of key factors
with the CTR.
Nak1 Localizes Uniformly in the Cytoplasm--
To examine the
localization of Nak1 we constructed vectors to express GFP-tagged Nak1
from the adh1 promoter. Expression of GFP-Nak1 rescued
growth and morphological defects in nak1-repressed strains,
indicating that it is functional (data not shown). Visualization of
various GFP-Nak1 mutants expressed in wild-type cells revealed that
GFP-Nak1, GFP-Nak11-562 (lacking the CTR),
GFP-Nak1481-652 (the CTR alone), and the GFP control
localized throughout the cytoplasm (Fig.
6). Although other kinases, which
regulate cell polarity in fission yeast, localize to cell ends in the
presence of high salt (52), GFP-Nak1 localization was observed to be unaffected in the presence of 1.2 M KCl (data not shown).
Interestingly, we found that GFP-Nak1 and GFP-Nak11-562
were excluded from the nucleus, whereas the GFP control and
GFP-Nak1481-652 constructs localized throughout the cell
including the nucleus. However, GFP-Nak1481-652 was
consistently more concentrated around the nucleus. Although the
significance of this observation is unclear, it may reflect active
cellular mechanisms that exclude Nak1 from the nucleus and localize the
Nak1 CTR to regions around the nucleus.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 6.
Nak1 localizes to the cytoplasm.
Wild-type (SPU) strains were transformed with constructs expressing GFP
alone, GFP-Nak1, GFP-Nak11-562 (lacking the CTR), and
GFP-Nak1481-652 (the CTR alone). Transformants were grown
in liquid medium to mid-log phase at 30 °C and
visualized by fluorescence microscopy for GFP. Expression
constructs used include pAALNeGFP, pAALNGFPHANak1,
pAALNGFPHANak11-562, and
pAALNGFPHANak1481-652.
|
|
 |
DISCUSSION |
Nak1 Is a GC Kinase That Mediates Cell Growth and Morphology in S. pombe--
In this study, we report the identification and
characterization of the Nak1, a protein kinase in S. pombe.
The lack of proline-rich SH3-binding motifs within the COOH-terminal
non-catalytic domain of Nak1 indicates that Nak1 belongs to the group
II subclass of GCKs. In addition to Nak1, the fission yeast genome
encodes two related GCK family kinases, which include Sid1 and an
uncharacterized protein kinase (accession number CAB16374) lacking a
non-catalytic domain. Although the three GCK family members in S. pombe reveal extensive homology within their catalytic regions, it
was unknown whether these kinases are functionally related. Sid1 has
been previously shown to be involved in the regulation of septation and
cytokinesis during the later stages of anaphase. In contrast, our
results indicate that Nak1 is required for cell polarity and growth,
suggesting that Nak1 and Sid1 have distinct functions. In support of
this conclusion, we found that overexpression of Sid1, or the related
budding yeast GC kinases Nrk1 or Sps1, failed to rescue morphology and
growth defects in nak1-repressed cells, indicating that Nak1
function is not conserved between related family members (data not
shown). However, our results also suggest that nak1
repression results in a delay in cell division and cell separation,
which indicate that proper cell division requires both Nak1 and Sid1.
Although the round morphology due to nak1 repression is
somewhat similar to cells defective for the Wee1 kinase,
nak1-repressed cells are more spherical and larger than
wee1 mutant cells. Also, we found that
nak1-repressed cells lose specific localization of actin to
the cell ends, whereas Wee1-deficient cells retain bipolar actin
localization (10). Furthermore, Wee1 deficiency results in a greater
proportion of cells with 1C DNA content due to a longer G1
phase, which allows cells to divide prior to S phase (48, 49). We did
not observe a similar increase in the proportion of cells with 1C DNA
content upon nak1 repression. Thus the abnormal round
morphology of nak1-repressed cells appears to be due to
dysregulation of cell polarity rather than a wee1-like defect. Interestingly, the round morphological phenotype associated with nak1 repression bears strong resemblance to the
morphology of cells deficient for Pak1 (29), suggesting that Nak1 and
Pak1 may have related functions in the regulation of bipolar cell
morphology. However, we found that overexpression of Pak1/Shk1, Orb6,
or Wee1 did not suppress growth and morphology defects associated with nak1 repression (data not shown).
Several proteins have been identified that appear to be involved in
regulating polarized cell growth in fission yeast. Many of these
proteins, such as Tea1, Bud6, SspI, and Pom1, localize to
the growing cell ends (8, 11, 52-55). Although our genetic studies
suggest that Nak1 is required for polarized cell morphology, we found
that GFP-Nak1 did not exhibit specific localization to the cell ends.
However, GFP-Nak1 overexpression could mask low levels specifically
localized to the cell ends. Nevertheless, it is possible that Nak1
influences the localization of other cell polarity components to
specific sites, such as sites of growth and division. Also, since Nak1
localization overlaps with sites of cell growth and division, it may
regulate the activities of cell polarity components already present at
these sites. Therefore, Nak1 may regulate cell polarity and growth by
influencing the localization and activities of other proteins involved
in these processes.
The Nak1 CTR Is an Important Regulatory
Sequence--
Although the COOH-terminal non-catalytic domains of GCKs
have been implicated to both inhibit and mediate GCK function, the mechanism by which these domains regulate kinase activity remains unclear (34-36). Our results demonstrate that a region (the CTR) within the non-kinase domain of Nak1 is important for Nak1 function as
measured by in vitro kinase assays and functional
complementation of nak1-repressed growth and morphological
defects. Furthermore, overexpression of the CTR produced
dominant-negative morphological and growth inhibitory phenotypes. This
dominant-negative effect may result from the ineffectual binding of
positive regulators of Nak1 to the CTR.
Together, our results indicate that Nak1 is essential for cell growth,
polarity, and normal cell division, and the CTR is important for Nak1
function. Further studies of the interactions between Nak1 and
associated proteins may provide insight into the regulation of
Nak1-dependent morphogenic mechanisms.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Steve Robbins for helpful
discussions regarding this manuscript and Laurie Robertson for
undertaking flow cytometric analyses included in this study.
 |
FOOTNOTES |
*
This work was supported by a grant (to D. Y.) from the
Canadian Institutes of Health Research.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF091345.
Supported by the National Sciences and Engineering Research
Council of Canada and the Alberta Heritage Foundation for Medical Research.
§
Supported by the Alberta Cancer Board.
¶
Supported by the Alberta Heritage Foundation for Medical
Research. To whom correspondence should be addressed: Dept. of
Biochemistry & Molecular Biology, University of Calgary, 3330 Hospital
Dr. NW, Calgary, Alberta T2N 4N1, Canada. Tel.: 403-220-3030; Fax: 403-283-8727; E-mail: young@ucalgary.ca.
Published, JBC Papers in Press, November 8, 2002, DOI 10.1074/jbc.M208993200
 |
ABBREVIATIONS |
The abbreviations used are:
PAK, p21-activated kinase;
CRIB, Cdc42/Rac interactive binding;
GCK, germinal center kinase;
HA, hemagglutinin;
DIC, differential
interference contrast;
CTR, COOH-terminal region;
GFP, green
fluorescent protein;
SH, Src homology domain;
TRITC, tetramethylrhodamine isothiocyanate.
 |
REFERENCES |
| 1.
|
Strome, S.
(1993)
Cell
72,
3-6[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Lehmann, R.
(1995)
Cell
83,
353-356[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Drubin, D. G.,
and Nelson, W. J.
(1996)
Cell
84,
335-344[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Madden, K.,
and Snyder, M.
(1998)
Annu. Rev. Microbiol.
52,
687-744[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Miller, P. J.,
and Johnson, D. I.
(1994)
Mol. Cell. Biol.
14,
1075-1083[Abstract/Free Full Text]
|
| 6.
|
Chang, E. C.,
Barr, M.,
Wang, Y.,
Jung, V., Xu, H. P.,
and Wigler, M. H.
(1994)
Cell
79,
131-141[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Snell, V.,
and Nurse, P.
(1994)
EMBO J.
13,
2066-2074[Medline]
[Order article via Infotrieve]
|
| 8.
|
Mata, J.,
and Nurse, P.
(1997)
Cell
89,
939-949[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Verde, F.,
Mata, J.,
and Nurse, P.
(1995)
J. Cell Biol.
131,
1529-1538[Abstract/Free Full Text]
|
| 10.
|
Verde, F.,
Wiley, D. J.,
and Nurse, P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
7526-7531[Abstract/Free Full Text]
|
| 11.
|
Bahler, J.,
and Pringle, J. R.
(1998)
Genes Dev.
12,
1356-1370[Abstract/Free Full Text]
|
| 12.
|
Shulman, J. M.,
and St. Johnston, D.
(1999)
Trends Cell Biol.
9,
M60-M64[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Daniels, R. H.,
and Bokoch, G. M.
(1999)
Trends Biochem. Sci.
24,
350-355[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Brown, J. L.,
Stowers, L.,
Baer, M.,
Trejo, J.,
Coughlin, S.,
and Chant, J.
(1996)
Curr. Biol.
6,
598-605[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Zhang, S.,
Han, J.,
Sells, M. A.,
Chernoff, J.,
Knaus, U. G.,
Ulevitch, R. J.,
and Bokoch, G. M.
(1995)
J. Biol. Chem.
270,
23934-23936[Abstract/Free Full Text]
|
| 16.
|
Ottilie, S.,
Miller, P. J.,
Johnson, D. I.,
Creasy, C. L.,
Sells, M. A.,
Bagrodia, S.,
Forsburg, S. L.,
and Chernoff, J.
(1995)
EMBO J.
14,
5908-5919[Medline]
[Order article via Infotrieve]
|
| 17.
|
Polverino, A.,
Frost, J.,
Yang, P.,
Hutchison, M.,
Neiman, A. M.,
Cobb, M. H.,
and Marcus, S.
(1995)
J. Biol. Chem.
270,
26067-26070[Abstract/Free Full Text]
|
| 18.
|
Leberer, E.,
Dignard, D.,
Harcus, D.,
Thomas, D. Y.,
and Whiteway, M.
(1992)
EMBO J.
11,
4815-4824[Medline]
[Order article via Infotrieve]
|
| 19.
|
Wu, C.,
Whiteway, M.,
Thomas, D. Y.,
and Leberer, E.
(1995)
J. Biol. Chem.
270,
15984-15992[Abstract/Free Full Text]
|
| 20.
|
Rudel, T.,
and Bokoch, G. M.
(1997)
Science
276,
1571-1574[Abstract/Free Full Text]
|
| 21.
|
Faure, S.,
Vigneron, S.,
Doree, M.,
and Morin, N.
(1997)
EMBO J.
16,
5550-5561[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Kyriakis, J. M.
(1999)
J. Biol. Chem.
274,
5259-5262[Free Full Text]
|
| 23.
|
Dan, I.,
Watanabe, N. M.,
and Kusumi, A.
(2001)
Trends Cell Biol.
11,
220-230[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Burbelo, P. D.,
Drechsel, D.,
and Hall, A.
(1995)
J. Biol. Chem.
270,
29071-29074[Abstract/Free Full Text]
|
| 25.
|
Manser, E.,
Leung, T.,
Salihuddin, H.,
Zhao, Z. S.,
and Lim, L.
(1994)
Nature
367,
40-46[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Marcus, S.,
Polverino, A.,
Chang, E.,
Robbins, D.,
Cobb, M. H.,
and Wigler, M. H.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
6180-6184[Abstract/Free Full Text]
|
| 27.
|
Gilbreth, M.,
Yang, P.,
Wang, D.,
Frost, J.,
Polverino, A.,
Cobb, M. H.,
and Marcus, S.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
13802-13807[Abstract/Free Full Text]
|
| 28.
|
Gilbreth, M.,
Yang, P.,
Bartholomeusz, G.,
Pimental, R. A.,
Kansra, S.,
Gadiraju, R.,
and Marcus, S.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
14781-14786[Abstract/Free Full Text]
|
| 29.
|
Yang, P.,
Kansra, S.,
Pimental, R. A.,
Gilbreth, M.,
and Marcus, S.
(1998)
J. Biol. Chem.
273,
18481-18489[Abstract/Free Full Text]
|
| 30.
|
Sells, M. A.,
Barratt, J. T.,
Caviston, J.,
Ottilie, S.,
Leberer, E.,
and Chernoff, J.
(1998)
J. Biol. Chem.
273,
18490-18498[Abstract/Free Full Text]
|
| 31.
|
Fu, C. A.,
Shen, M.,
Huang, B. C.,
Lasaga, J.,
Payan, D. G.,
and Luo, Y.
(1999)
J. Biol. Chem.
274,
30729-30737[Abstract/Free Full Text]
|
| 32.
|
Guertin, D. A.,
Chang, L.,
Irshad, F.,
Gould, K. L.,
and McCollum, D.
(2000)
EMBO J.
19,
1803-1815[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Balasubramanian, M. K.,
McCollum, D.,
Chang, L.,
Wong, K. C.,
Naqvi, N. I., He, X.,
Sazer, S.,
and Gould, K. L.
(1998)
Genetics
149,
1265-1275[Abstract/Free Full Text]
|
| 34.
|
Guertin, D. A.,
and McCollum, D.
(2001)
J. Biol. Chem.
276,
28185-28189[Abstract/Free Full Text]
|
| 35.
|
Creasy, C. L.,
Ambrose, D. M.,
and Chernoff, J.
(1996)
J. Biol. Chem.
271,
21049-21053[Abstract/Free Full Text]
|
| 36.
|
Pombo, C. M.,
Bonventre, J. V.,
Molnar, A.,
Kyriakis, J.,
and Force, T.
(1996)
EMBO J.
15,
4537-4546[Medline]
[Order article via Infotrieve]
|
| 37.
|
Moreno, S.,
Klar, A.,
and Nurse, P.
(1991)
Methods Enzymol.
194,
795-823[Medline]
[Order article via Infotrieve]
|
| 38.
|
Sengar, A. S.,
Markley, N. A.,
Marini, N. J.,
and Young, D.
(1997)
Mol. Cell. Biol.
17,
3508-3519[Abstract]
|
| 39.
|
Sambrook, J.,
Maniatis, T.,
and Fritsch, E. F.
(1989)
Molecular Cloning a Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 40.
|
Loewith, R.,
Hubberstey, A.,
and Young, D.
(2000)
J. Cell Sci.
113,
153-160[Abstract]
|
| 41.
|
Xu, H. P.,
Wang, Y.,
Riggs, M.,
Rodgers, L.,
and Wigler, M.
(1990)
Cell Regul.
1,
763-769[Medline]
[Order article via Infotrieve]
|
| 42.
|
Meijer, M.,
Karimi-Busheri, F.,
Huang, T. Y.,
Weinfeld, M.,
and Young, D.
(2002)
J. Biol. Chem.
277,
4050-4055[Abstract/Free Full Text]
|
| 43.
|
Rothstein, R. J.
(1983)
Methods Enzymol.
101,
202-211[Medline]
[Order article via Infotrieve]
|
| 44.
|
Russell, P.,
and Nurse, P.
(1986)
Cell
45,
145-153[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Alfa, C.,
Fantes, P.,
Hyams, J.,
McLeod, M.,
and Warbrick, E.
(1993)
Experiments with Fission Yeast, A Laboratory Course Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 46.
|
Feierbach, B.,
and Chang, F.
(2001)
Curr. Biol.
11,
1656-1665[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Ding, D. Q.,
Chikashige, Y.,
Haraguchi, T.,
and Hiraoka, Y.
(1998)
J. Cell Sci.
111,
701-712[Abstract]
|
| 48.
|
Nurse, P.,
and Thuriaux, P.
(1977)
Exp. Cell Res.
107,
365-375[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Novak, B.,
and Mitchison, J. M.
(1989)
J. Cell Sci.
94,
657-662[Abstract/Free Full Text]
|
| 50.
|
Morrell, J. L.,
Morphew, M.,
and Gould, K. L.
(1999)
Mol. Biol. Cell
10,
4201-4215[Abstract/Free Full Text]
|
| 51.
|
Colussi, P. A.,
and Orlean, P.
(1997)
Yeast
13,
139-150[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Rupes, I.,
Jia, Z.,
and Young, P. G.
(1999)
Mol. Biol. Cell
10,
1495-1510[Abstract/Free Full Text]
|
| 53.
|
Bahler, J.,
and Nurse, P.
(2001)
EMBO J.
20,
1064-1073[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Verde, F.
(2001)
Curr. Biol.
11,
R600-R602[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Glynn, J. M.,
Lustig, R. J.,
Berlin, A.,
and Chang, F.
(2001)
Curr. Biol.
11,
836-845[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Kurischko, G. Weiss, M. Ottey, and F. C. Luca
A Role for the Saccharomyces cerevisiae Regulation of Ace2 and Polarized Morphogenesis Signaling Network in Cell Integrity
Genetics,
October 1, 2005;
171(2):
443 - 455.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bimbo, Y. Jia, S. L. Poh, R. K. M. Karuturi, N. den Elzen, X. Peng, L. Zheng, M. O'Connell, E. T. Liu, M. K. Balasubramanian, et al.
Systematic Deletion Analysis of Fission Yeast Protein Kinases
Eukaryot. Cell,
April 1, 2005;
4(4):
799 - 813.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Y. Huang, M. Renaud-Young, and D. Young
Nak1 interacts with Hob1 and Wsp1 to regulate cell growth and polarity in Schizosaccharomyces pombe
J. Cell Sci.,
January 1, 2005;
118(1):
199 - 210.
[Abstract]
[Full Text]
[PDF]
|
 |
|