Originally published In Press as doi:10.1074/jbc.M212467200 on March 7, 2003
J. Biol. Chem., Vol. 278, Issue 20, 17636-17645, May 16, 2003
Macroautophagy Is Required for Multicellular Development of the
Social Amoeba Dictyostelium discoideum*
Grant P.
Otto
,
Mary Y.
Wu
,
Nevzat
Kazgan
,
O. Roger
Anderson§, and
Richard H.
Kessin
¶
From the
Department of Anatomy and Cell Biology,
Columbia University, New York, New York 10032 and
§ Department of Biology, Lamont-Doherty Earth Observatory,
Columbia University, Palisades, New York 10964
Received for publication, December 6, 2002, and in revised form, January 22, 2003
 |
ABSTRACT |
Macroautophagy is a mechanism employed by
eukaryotic cells to recycle non-essential cellular components during
starvation, differentiation, and development. Two conjugation reactions
related to ubiquitination are essential for autophagy: Apg12p
conjugation to Apg5p, and Apg8p conjugation to the lipid
phosphatidylethanolamine. These reactions require the action of the
E1-like enzyme, Apg7p, and the E2-like enzymes, Apg3p and Apg10p. In
Dictyostelium, development is induced by starvation,
conditions under which autophagy is required for survival in yeast and
plants. We have identified Dictyostelium homologues of 10 budding yeast autophagy genes. We have generated mutations in
apg5 and apg7 that produce defects typically
associated with an abrogation of autophagy. Mutants are not grossly
affected in growth, but survival during nitrogen starvation is severely
reduced. Starved mutant cells show little turnover of cellular
constituents by electron microscopy, whereas wild-type cells show
significant cytoplasmic degradation and reduced organelle number. Bulk
protein degradation during starvation-induced development is reduced in
the autophagy mutants. Development is aberrant; the autophagy mutants
do not aggregate in plaques on bacterial lawns, but they do proceed
further in development on nitrocellulose filters, forming defective
fruiting bodies. The autophagy mutations are cell autonomous, because
wild-type cells in a chimaera do not rescue development of the
autophagy mutants. We have complemented the mutant phenotypes by
expression of the cognate gene fused to green fluorescent protein. A
green fluorescent protein fusion of the autophagosome marker
Apg8 mislocalizes in the two autophagy mutants. We show that the
Apg5-Apg12 conjugation system is conserved in
Dictyostelium.
 |
INTRODUCTION |
Protein turnover in eukaryotes is accomplished by two major
mechanisms, autophagy or proteasomal degradation. Three modes of
autophagy have been identified: chaperone-mediated autophagy, microautophagy, and macroautophagy. In chaperone-mediated autophagy, specific proteins containing targeting sequences are bound by chaperones that mediate direct transport across the lysosomal membrane
(1). A lysosomal receptor, lysosomal-associated membrane protein type
2a, interacts with the substrate to facilitate transport into the
lysosome (2, 3). Microautophagy is required for basal protein
degradation in rat liver (4) or glucose-induced peroxisome degradation
in the methylotropic yeast Pichia pastoris (5) and involves
vacuolar membrane invagination to capture cargo directly.
Macroautophagy is a non-selective mechanism used to deliver
cytoplasmic components, including entire organelles, to the lysosome or
vacuole during starvation (reviewed in Ref. 6). Initially, a membrane
distinct from the vacuole/lysosome encloses a portion of cytoplasm to
form a double-membraned vesicle called an autophagosome or autophagic
vacuole. The autophagosome docks at and fuses with the
vacuole/lysosome, releasing a single-membraned vesicle called an
autophagic body, which is degraded by resident hydrolases. Molecular
genetic analysis in the budding yeast, Saccharomyces cerevisiae, has identified many of the genes that are required for
autophagy (7-9). These genes are required for phosphorylation reactions (10), a phosphatidylinositol 3-kinase complex (11, 12),
and two novel ubiquitin-like conjugation reactions (13, 14). Starvation
releases the repression of autophagy by the target of rapamycin
(Tor)1 protein kinase,
leading to the activation of another serine/threonine kinase, Apg1p,
which activates autophagy through unknown downstream targets (15).
Apg1p kinase activity is regulated by the phosphorylation status of a
binding partner, Apg13; hyperphosphorylated Apg13p associates weakly
with Apg1p. Upon Tor inactivation, Apg13p is dephosphorylated and binds
more tightly to and activates Apg1p.
Autophagosome formation also requires the activity of two protein
conjugation systems mechanistically related to ubiquitination. In the
first, the carboxyl-terminal glycine of Apg12p is
conjugated to an internal lysine of Apg5p, through the action of
E1-like and E2-like enzymes, Apg7p and Apg10p, respectively (16-18).
Apg16p binds to Apg5p and then oligomerizes to produce
Apg12p-Apg5p·Apg16p oligomers (19, 20). A second conjugation system
involves the conjugation of Apg8p/Aut7p to the membrane lipid
phosphatidylethanolamine (14, 21), through the action of the
E1-like and E2-like enzymes, Apg7p and Apg3p/Aut1p, respectively (22).
Apg8p/Aut7p is the only component of the autophagy machinery in yeast
that is transcriptionally up-regulated upon starvation (23).
Dictyostelium discoideum is a soil amoeba that feeds on
bacteria but upon starvation completes a complex developmental cycle to
produce a multicellular organism (reviewed in Ref. 24). Starving amoebae aggregate using a cyclic AMP signaling relay to form mounds of
about 100,000 cells. The mound undergoes morphogenesis to produce a
mature fruiting body composed of a sphere of spores held aloft a
cellular stalk. To complete development and construct a fruiting body,
Dictyostelium needs to mobilize resources allotted
previously to growth. We reasoned therefore that autophagy would be
important for Dictyostelium development. Additionally, given
its genetic tractability, we believe that Dictyostelium is a
good organism to extend the observations on autophagy made in budding
yeast, plants, and mammalian cells and to ask questions about the
control of autophagy during development. We find that apg5
and apg7 are essential for Dictyostelium
development. Mutants disrupted in these genes do not aggregate on agar
plates cleared of Klebsiella pneumoniae, as the wild-type
parents do, but will aggregate if starved on nitrocellulose
filters or non-nutrient agar. The autophagy mutants have no evident
growth defects but die rapidly when starved of amino acids. Protein
turnover, which is normally induced by starvation, is reduced in
apg5
and apg7
. GFP
fusions of Apg5 and Apg12 are present in two forms in growing and
starving cells, corresponding to free and conjugated forms, implying
similar conjugation reactions to those discovered in budding yeast. We
also examine the subcellular localization of a GFP fusion of Apg8 in
Dictyostelium and show the effects of autophagy on the
ultrastructural organization of cells during starvation.
 |
EXPERIMENTAL PROCEDURES |
Strains--
All mutations were created in the strain DH1, which
is a uracil auxotroph. All strains were grown in HL5 medium or on lawns of K. pneumoniae (25).
Development--
For multicellular development, axenically grown
cells in mid-log phase (2-4 × 106 cells/ml) were
washed twice in cold Sorensen C (SorC) buffer (16.7 mM
Na2H/KH2PO4, 50 µM
CaCl2, pH 6.0). The cells were resuspended in SorC buffer
and plated on 25-mm, 0.45 µM nitrocellulose filters (Millipore Corp.), which rested on SorC-soaked Whatman grade 17 filter
pads, at a density of 3.3 × 106 cells/cm2
or 1.6 × 107 cells/filter (25). For development on
non-nutrient agar, cells were resuspended at 107 cells/ml,
and 100 µl of these cells were plated on 35-mm SorC-1% Phytagel
(Sigma) agar plates and allowed to dry.
Identification of D. discoideum Autophagy
Genes--
Dictyostelium orthologues of budding yeast
autophagy genes were identified by searching the partial
Dictyostelium genome sequence at dicty.sdsc.edu/ with
the S. cerevisiae amino acid sequence. This super computer
at the University of San Diego, La Jolla, CA contains sequence data
from all the members of the Dictyostelium Genome sequencing
consortium. These include the Institute of Biochemistry I,
Cologne, Germany, the Genome Sequencing Centre, Jena, Germany, the Baylor College of Medicine Dictyostelium Genome Center,
and the Sanger Centre Dictyostelium Project. Sequence data
obtained from the Genome Sequencing Centre, Jena are available at
genome.imb-jena.de/dictyostelium. The sequence data produced by the
D. discoideum Genome Project at the Sanger Centre can be
obtained from ftp.sanger.ac.uk/pub/databases/D.discoideum_sequences/. Where contigs were not available, we assembled individual reads into
contiguous sequences. The locations of intron/exon boundaries were
inferred from sequence homology to the consensus splice donor and
acceptor sites in Dictyostelium (26), by the AT richness of
introns in D. discoideum, and by identifying fusions that
maintained a single open reading frame.
Gene Disruption--
The complete apg5 gene was
obtained by PCR reactions with primers 5-1A (ATGTCATCATTTGACGAAGAT)
and 5-1B (ATCGATGGGTATGATTGGAAATGAACA) to generate the 5' region, and
5-2A (ATCGATTGATAGAATACTATTATGTTG) and 5-2B (CCTTAGTAGTTATTGCTATTA)
to generate the 3' region. A ClaI site was generated in the
PCR product by inclusion of appropriate sequence in the primers. The
PCR products were ligated into pCR2.1-TOPO (Invitrogen). The
blasticidin resistance cassette was removed from pBSR519 with
ClaI and cloned into the generated ClaI site of
the apg5 PCR product. The complete apg7 gene was
obtained by PCR reactions with primers 7-1A (ATGACAAATACACTTCAGTTT)
and 7-1B (GTCGACTGGTAATGAACATGGATCAC) to generate the 5' region, and
7-2A (GTCGACTTAAATCCAGGTTGGCCTTT) and 7-2B (AACGATAATTGTAAAAATAGAGA) to generate the 3' region. The PCR products were ligated into pGEM-T
Easy (Promega). The blasticidin resistance cassette was removed from
pBSR519 with BamHI and cloned into the BamHI site of the apg7 gene. These two plasmids, composed of the entire
apg5 or apg7 gene interrupted by insertion of the
selectable blasticidin resistance cassette, constitute the knockout
constructs. The knockout constructs were linearized with
ApaI prior to electroporation into DH1 cells by the method
of Kuspa and Loomis (27). Transformants were selected with the drug
blasticidin (5 µg/ml) in HL5 medium for 1 week. Transformants were
harvested from Petri dishes and plated onto SM plates, and clones of
mutant or wild-type phenotype were selected for further analysis.
Homologous recombination of the knockout construct with the endogenous
locus was confirmed by PCR or by Southern blot.
Expression Analysis--
Northern blot analysis was conducted as
described previously (28), except that Nytran membrane (Schleicher & Schuell) was used to immobilize RNA. Cells were deposited on
nitrocellulose filters for development, and a filter was harvested
every 4 h for RNA extraction. 5-µg total RNA of wild-type or
mutant cells was glyoxylated, size-fractionated on 1% agarose gels,
transferred to nitrocellulose, and hybridized with random
primer-labeled DNA probes. Probes were obtained by isolation of
appropriate restriction fragments following separation on low melting
temperature agarose gels.
GFP Fusion Constructs--
GFP fusions were produced by cloning
the full-length genomic sequence of each gene (generated by PCR) into
the pTX-GFP vector (29), a plasmid in which the expression of the gene
of interest is under the control of the constitutive actin15
promoter. Isolation of the apg7 sequence was described
earlier (see "Gene Disruption"). The apg5 gene was
obtained by PCR with the primers 5-5GFP (GGTACCATGTCATCATTTGACGAAGA) and 5-3GFP (GGTACCGTAGTTATTGCTATTATTAT). The apg8 gene was
obtained with the primers 8-5GFP (GAGCTCATGGTTCATGTATCAAGCTT) and 8-2
(GGCAAACTATTATTGTTTGGA). The apg12 gene was obtained with
the primers 12-1 (TTAACC CCACGCCATTTGAA) and 12-3
(ATGGAGGAAGAAGAAAAAAA). PCR products were cloned into pGEM-T Easy
(Promega). The apg5 sequence was cut from pGEM-T Easy with
KpnI and ligated into KpnI-digested,
dephosphorylated pTX-GFP. The apg8 sequence was cut from
pGEM-T Easy with SacI and ligated into
SacI-digested, dephosphorylated pTX-GFP. The apg7
and apg12 sequences were cut from pGEM-T Easy with
NcoI and SacI and ligated into
XbaI/SacI-digested pTX-GFP, along with a linker
composed of the following two oligonucleotides: CATGGTGCATTGACGTAGCT
and CTAGAGCTACGTCAATGCAC. This linker provides compatible cohesive ends
for XbaI and NcoI sites. The linker
oligonucleotides were annealed, and the ends were phosphorylated with
T4 polynucleotide kinase and then purified with a Sephadex G50 column
(Amersham Biosciences). The correct orientation of the inserts
was confirmed by sequencing of the junctions with the primers pTX-Sac5'
(GAGTTTGTAACAGCTGCTGG), pTX-Kpn5' (ATCAGATCCAAGCTTAAAAA), and
pTX-Kpn3' (TTCACCCTCTCCACTGACAG) where appropriate. GFP
fusion constructs were electroporated into DH1 cells and autophagy
mutants, and transformants were selected with the drug G418 (5 µg/ml)
in HL5 medium for 1 week. Transformants were harvested from Petri
dishes and plated onto SM+G418 (40 µg/ml) plates with G418-resistant
K. pneumoniae to obtain clones. GFP expression in
transformants was confirmed by Western blotting with rabbit polyclonal
serum against GFP (Molecular Probes).
Protein Turnover Assays--
Protein turnover assays were based
on those of White and Sussman (30). Developing cells were recovered
from Millipore filters in SorC buffer, pelleted by centrifugation, and
resuspended in 50 mM Tris containing protease inhibitors
(Complete, Mini; Roche Molecular Biochemicals). Cells were lysed by
freeze-thaw before determining protein levels using the Pierce
Coomassie® Plus protein assay reagent, following the manufacturer's
instructions. Protein turnover assays were also conducted in axenic
medium. Cells were shaken in FM medium (31) lacking amino acids at a
density of 5 × 106 cells/ml. Three 1-ml aliquots of
cells were harvested every 8 h and prepared as described for filters.
Electron Microscopy--
Electron microscopy procedures were as
described (32). Briefly, cells were fixed with 2% phosphate-buffered
glutaraldehyde, pH 7.2, followed by 2% osmium tetroxide fixation in
the same buffer, sedimented by centrifugation and enrobed in agar,
dehydrated with an aqueous/acetone series, and embedded in TAAB epon
resin (Energy Beam Sciences, Agawam, MA).
Fluorescence Microscopy--
To examine the localization of GFP
fusion proteins, axenic cells were incubated overnight in FM medium on
35-mm glass bottom microwell dishes (MatTEK Corporation), and the
following day the medium was replaced with SorC 4-6 h prior to
visualization (representing starving cells) or visualized directly
(representing growing cells). Samples were viewed under a Nikon Eclipse
TE300 microscope, and images were captured with a cooled CCD camera and
processed using Metamorph 5 imaging software (Universal Imaging
Corporation).
For chimeric development, cells were resuspended at 108
cells/ml, and 100 µl of these cells were plated on 35-mm SorC-1%
Phytagel (Sigma) agar plates and allowed to dry. Structures were viewed after 32 h under a Zeiss Axioplan 2 microscope, and images were captured with a cooled CCD camera and processed using Openlab 3 imaging
software (Improvision). We tapped the Petri dishes lightly against a
hard surface to make the fruiting structures collapse onto the
Phytagel. This treatment caused the sorus to burst in most cases,
releasing the contained spores. This procedure made photography of
these structures easier, because the number of Z-sections required to
capture the full depth of the fruiting body was minimized.
 |
RESULTS |
Identification of Autophagy Genes in D. discoideum--
To
identify autophagy genes in Dictyostelium, we searched the
near complete D. discoideum genome sequence data base with
budding yeast protein sequences using the BLAST algorithm. We
identified putative Dictyostelium orthologues for Tor
(AY204354), Apg1 (AY191011), Apg2 (AAM45260), Apg3 (AAL93575), Apg4
(AY191018), Apg5 (AY191012), Apg6 (AY191013), Apg7 (AY191014), Apg8
(AY191015), Apg9 (AY191016), and Apg12 (AY191017) (Fig.
1, and data not shown). Orthologues for
Apg10, Apg13, Apg14, Apg16, and Apg17 were not identified. Similar
searches of the Arabidopsis thaliana genome by others (33,
34) identified orthologues for Apg1-Apg13. Apg14, Apg16, and Apg17
orthologues were not found, consistent with our search of the
Dictyostelium genome. Whereas multiple isoforms of Apg1,
Apg4, Apg8, Apg12, and Apg13 are present in Arabidopsis, we
identified only a single homologue for each autophagy protein in
Dictyostelium, with the exception of Apg4. We identified two
possible orthologues of Apg4, although incomplete sequence is available
for one (data not shown).

View larger version (111K):
[in this window]
[in a new window]
|
Fig. 1.
Amino acid alignment of D. discoideum (Dd) Apg5 and Apg7 with
orthologues from A. thaliana (At),
H. sapiens (Hs) and S. cerevisiae (Sc). A,
alignment of Apg5. The asterisk indicates the conserved
lysine residue that forms an isopeptide bond with the carboxyl-terminal
glycine of Apg12p. The accession numbers are as follows:
A. thaliana, NP_197231 (RefSeq); H. sapiens,
Q9H1Y0 (Swiss Prot); S. cerevisiae, S65160 (PIR).
B, alignment of Apg7. The active site cysteine is indicated
with an asterisk. The ATP binding motif is indicated by a
dashed line. The accession numbers are as follows: A. thaliana, BAB88385 (GenBankTM); H. sapiens, NP_006386
(RefSeq); S. cerevisiae, NP_012041 (RefSeq). Alignments were
performed using the BCM Search Launcher at
searchlauncher.bcm.tmc.edu/multi-align/multi-align.html. The ClustalW
1.8 algorithm was used for multiple sequence alignments, and the
resulting alignment was shaded using the Boxshade server at
www.ch.embnet.org/software/BOX_form.html. Identical residues are
shaded black, and similar residues are shaded
gray.
|
|
In this study, we focus on apg5 and apg7. The
homology of the Dictyostelium genes to orthologues in
S. cerevisiae, A. thaliana, and Homo
sapiens is shown in Fig. 1. Apg5 has a 54-amino acid asparagine-rich stretch in the amino terminus of the protein that is
absent from the orthologues of the other species. Although asparagine-rich stretches are common in Dictyostelium
proteins, their function is unknown. The lysine residue that is the
site of isopeptide bond formation with Apg12 is conserved in all four species and corresponds to Lys-128 of A. thaliana, Lys-130
of H. sapiens, Lys-149 of S. cerevisiae, and
Lys-186 of D. discoideum. Apg5 shares highest homology with
the Arabidopsis gene, 24% identity over 393 residues. The
homology to the human gene is also high, 29% identity over 277 residues. The degree of sequence conservation between species is even
higher for Apg7. The Dictyostelium protein shares highest
homology with the human protein: 39% identity over 719 residues. The
ATP binding motif, Gly-X-Gly-X-X-Gly
(amino acids 368-373), and the active site cysteine (Cys-563), are
conserved in the Dictyostelium Apg7 protein.
Regulation of Autophagy Genes--
We examined the expression of
autophagy genes during growth and throughout development of
Dictyostelium. Transcription of apg1,
apg8, and apg9 appears to be induced by
starvation (Fig. 2). The expression
levels of apg5, apg7, and apg12 were
very low, which made it difficult to conclude whether starvation
induces expression. We were unable to detect an apg6
transcript by Northern blotting. In budding yeast, only apg8
expression appears to be up-regulated by starvation (23).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 2.
Analysis of autophagy gene expression in
Dictyostelium. 5-µg total RNA of wild-type or mutant cells
were harvested at the indicated time points, size-fractionated on 1%
agarose gels, transferred to nitrocellulose, and hybridized with the
random primer-labeled DNA probes indicated. The approximate sizes of
the transcripts are indicated. apg1, apg8, and
apg9 expression is induced by starvation. apg1
and apg8 expression was induced as early as 4 h of
development, whereas apg9 expression rises at 8 h of
development. The remaining genes are expressed at similar levels during
growth and development. An apg5 transcript is absent in
apg5 , indicating a null mutation. A truncated
~1-kb apg7 transcript is produced in
apg7 , corresponding to the insertion site of
the blasticidin resistance cassette in the apg7 gene. The
complemented strains express transcripts of the expected sizes composed
of the cognate genes fused to the 821-bp GFP open reading frame (~2.4
kb for apg5 and ~3.5 kb for
apg7 ).
|
|
We generated two autophagy mutants by insertional mutagenesis:
apg5
and apg7
. The
apg5
mutant does not produce a transcript, and
therefore we consider the insertional mutation a null. The
apg7
strain expresses a truncated transcript
of a size expected from the site of insertion of the resistance
cassette and at similar levels to the uninterrupted transcript in
parental DH1 cells. We believe that the apg7
strain is a null mutant, because the insertion precedes the ATP binding
motif and the active site cysteine. The complemented strains, apg5
(act15/apg5-gfp)
and apg7
(act15/gfp-apg7), express a transcript of the
appropriate size composed of the structural gene and the GFP open
reading frame (Fig. 2, right panel). The transcript levels
are high throughout growth and development, because expression is from
the constitutive actin15 promoter.
Autophagy Is Required for Development--
We tested the growth of
autophagy mutants and parental strain in both shaking axenic culture
(by hemocytometer counts) and on bacterial lawns (by plaque size). The
two autophagy mutants grow as well as the parent under both conditions
(data not shown). Both mutants show defective development when
developing within plaques on bacterial lawns and when developed on
nitrocellulose filters (see Fig. 3) or
non-nutrient agar (data not shown). However, the defect observed under
the two sets of conditions is strikingly different. When developed on
nitrocellulose filters, mutant cells produce larger aggregates than
wild-type, from which multiple tips arise. These tips give rise to
slugs that rarely migrate from the enlarged mounds. The slugs culminate
to form small, abnormal fruiting bodies with thickened stalks and empty
sori (Fig. 3, C and E). In marked contrast, the
mutants do not aggregate when they develop within plaques on bacterial
lawns (Fig. 3B). We have tested development of cells grown
on bacterial lawns and then starved for development on nitrocellulose
filters. Under these conditions, both autophagy mutants aggregate, but
they arrest development at an earlier stage than axenically grown cells
developing on filters. The apg7
mutant arrests
at the tight aggregate stage, whereas apg5
arrests at the loose mound stage (data not shown). Axenically grown
mutant cells will develop on SM or SM/5 plates without bacteria as they
do on nitrocellulose filters. These results indicate that a bacterial
load in cells or a bacterial metabolite may inhibit development of the
autophagy mutants.

View larger version (146K):
[in this window]
[in a new window]
|
Fig. 3.
Phenotypes of autophagy mutants.
A, the parental strain, DH1, produces large sori
containing spores, held aloft by a stalk. B,
apg5 (shown) and apg7
(not shown) both do not aggregate when developed in situ on
bacterial lawns. C, apg5 forms
multi-tipped aggregates when developed on nitrocellulose filters. The
multiple tips develop into aborted fruiting bodies. D,
apg5 (act15/apg5gfp)
forms normal fruiting bodies. E,
apg7 has a similar phenotype to
apg5 , producing aborted fruiting bodies with
empty sori. F, apg7
(act15/gfpapg7) forms normal fruiting bodies that
are similar to the parent.
|
|
Consistent with the severity of the developmental phenotype on
nitrocellulose filters, apg5
and
apg7
produce no viable, detergent-resistant
spores (data not shown). The complemented strains,
apg5
(act15/apg5-gfp)
and apg7
(act15/gfp-apg7), rescue development (Fig. 3,
D and F) and spore production to wild-type levels
(data not shown). When mutant cells are developed on non-nutrient agar,
development progresses further so that small, seemingly normal fruiting
bodies form. However, when the contents of these sori are closely
examined, the cells do not have the normal elliptical shape of
wild-type spores but instead are round and less refractive and are
therefore most likely amoebae.
Autophagy Mutations Are Cell Autonomous--
To determine whether
the developmental defect of autophagy mutant cells could be rescued by
development in the presence of their wild-type counterparts, we
performed mosaic development experiments. We thought that perhaps
nutritionally stressed cells would be cross-fed by wild-type neighbors.
Mutant and wild-type cells were mixed at a 1:3 ratio. We examined
spores produced by chimeric fruiting bodies for the presence of
autophagy mutant cells (autophagy mutants do not produce spores on
their own). Terminal developmental structures were treated with Triton
X-100, which kills amoebae but not mature spores, and surviving cells were plated on K. pneumoniae lawns on SM plates. Wild-type
spores produce plaques that contain developmental structures, whereas apg5
or apg7
spores
produce clear plaques, because mutant amoebae do not aggregate within
plaques on bacterial lawns. We examined 273 spores from 1:3 mixtures of
apg5
and DH1, and 243 spores from 1:3 mixtures
of apg7
and DH1. We never recovered any
non-aggregating plaques on SM plates (we expect 25% of recovered
spores to be mutant). Thus, the autophagy mutations we have created are
cell autonomous, because spore production cannot be rescued by mixing
with wild-type cells.
To follow the fate of specific cells, we used marked strains expressing
GFP from a constitutive actin15 promoter. We examined the
developmental phenotype of 25% marked:75% unmarked cell mixtures on
1% Phytagel-SorC. We determined the localization of GFP-expressing cells in the mosaic fruiting structures by taking Z-sections under a
fluorescence microscope. Marked wild-type cells distribute to all
structures of the fruiting body (Fig.
4B). The autophagy mutant cells appear to aggregate normally in mixtures with wild-type cells,
although they accumulate predominantly at the periphery of mounds (data
not shown). However, when slugs are formed, autophagy mutant cells
accumulate at the rear of the slug and remain in the slime sheath after
culmination commences, resulting in exclusion from the sorus (Fig. 4,
D and F).

View larger version (98K):
[in this window]
[in a new window]
|
Fig. 4.
Autophagy mutations are cell autonomous.
Cells expressing GFP from an actin15 promoter were mixed 1:3
with unlabelled wild-type cells and developed on nitrocellulose
filters. Fluorescent images are two-dimensional projections of a
15-step 10-µm Z-series. Whereas labeled DH1 cells are found in all
compartments of the fruiting structures (A and
B), labeled apg5 (C and
D) and apg7 (E and
F) cells are found only in the slime sheath discarded by the
migrating slug when culmination begins, in the basal disc, and
sometimes the lower stalk. The sorus in C and D
has not burst, as it has in A, B, E,
and F. The sorus in each image is at the top, and
the basal disc, where visible, is at the bottom of the
image. Scale bar, 0.1 mm.
|
|
Autophagy Mutants Are Hypersensitive to Amino Acid
Starvation--
We tested the ability of the autophagy mutants and
wild-type cells to survive when starved of amino acids. This treatment is commonly used in budding yeast to stimulate autophagy, and yeast
autophagy mutants die more rapidly than wild-type yeast when starved in
this way (16, 35-39). We determined viability by the ability to form
plaques on bacterial lawns. Amino acid-free FM medium was inoculated
with 5 × 105 cells/ml, the cells were incubated on a
shaker at 22 °C, and aliquots were plated with K. pneumoniae on SM/5 plates every 2 days. The parental strain, DH1,
survives well, and viability only starts dropping slightly after 8 days
(Fig. 5). The autophagy mutants are
highly susceptible to amino acid starvation; the number of viable cells
drops rapidly after 4 days to ~10% of parental levels. The
complemented strain, apg5
(act15/apg5-gfp), behaves like the parental
strain, whereas survival of the apg7
(act15/gfp-apg7) strain is not rescued as
efficiently (Fig. 5).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
Survival during nitrogen starvation.
Growing cells were harvested and resuspended in FM medium lacking amino
acids at 5 × 105/ml. Aliquots were taken at the
indicated time points to determine viability by plaque formation on
bacterial lawns. Wild-type cells survive for longer than a week under
these conditions. The apg5 and
apg7 strains rapidly lose viability after 2 days and display 50-fold fewer viable cells than the parental strain
after 6 days. The apg5
(act15/apg5gfp) strain rescues viability
completely, whereas the apg7
(act15/gfpapg7) strain shows an intermediate
phenotype.
|
|
Bulk Protein Turnover Is Reduced in Autophagy
Mutants--
Autophagy may have an important function in protein
turnover when Dictyostelium cells starve. We determined
total protein levels of cells starving on nitrocellulose filters. We
find that parental cells lose 33% of total protein over 24 h,
whereas apg5
(and
apg7
; data not shown) loses less than 15% of
total protein over the same time period (Fig.
6). The complemented strain,
apg5
(act15/apg5-gfp),
displays protein degradation comparable with the parental strain
(similar results are seen for the apg7
(act15/gfp-apg7) strain; data not shown). A
Dictyostelium mutant that does not aggregate,
yakA
(40), was also tested to control for the
effects of multicellular development on protein turnover; protein
levels drop by 26% during 24 h of starvation (Fig. 6), meaning
that protein degradation occurs despite the early block to development.
This experiment has been repeated four times with similar results. All
strains behave similarly when starved axenically in FM medium without amino acids, although the reduction in protein levels is not as marked
(data not shown).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
Protein turnover during starvation and
development is reduced in autophagy mutants. Cells were placed on
nitrocellulose filters for development and harvested at the indicated
times. Total cellular protein was measured using the Bradford assay.
Protein levels in the parental DH1 strain typically drop 30-40% after
24 h of development. The apg5 mutant does
not show an appreciable drop in protein levels. The
apg5 (act15/apg5gfp)
strain shows wild-type levels of protein degradation.
|
|
The GFP-Apg8 Fusion Protein Localizes to Punctate Structures in the
Cytoplasm--
To determine the localization of autophagy proteins
in Dictyostelium cells and to ask whether this occurs
normally in the apg5
and
apg7
mutants, we created fusions of the
autophagy proteins with GFP. We fused GFP to the amino termini
of Apg7, Apg8, and Apg12 and to the carboxyl terminus of Apg5. We
examined the distribution of GFP fusion proteins by fluorescence
microscopy. Free GFP and GFP-Apg7 show diffuse cytoplasmic localization
during both growth and starvation (data not shown). Diffuse cytoplasmic
localization and, rarely, a single punctate spot are observed for
Apg5-GFP and GFP Apg12 in both wild-type and
apg5
genetic backgrounds, irrespective of
nutritional status (data not shown). Very little signal is detected for
Apg5-GFP in the apg7
background, and the
frequency of cells with detectable expression is low. This localization
data for Apg5-GFP and GFP-Apg12 is consistent with that observed in
yeast, where most autophagy proteins (Apg5, Apg12, Apg1 etc.) localize
to one or a few punctate spots adjacent to the vacuole, in the
perivacuolar preautophagosomal structure (41).
In addition to diffuse cytoplasmic localization, GFP-Apg8 labels
multiple punctate structures in wild-type cells in FM growth medium or
SorC starvation medium (Fig. 7,
B and D). These punctate structures are larger
than those labeled by Apg5-GFP and GFP-Apg12 and are visualized more
easily. We have observed that fewer punctate structures are observed in
cells grown in the very rich, undefined medium HL5 (data
not shown). In both autophagy mutants, we see an absence of the many
small dots in the cytoplasm observed in DH1; instead, a single larger
punctate structure is labeled regardless of the nutritional conditions
(Fig. 7, F, H, J, and L).
In budding yeast, Apg8p localizes to the preautophagosomal structure
and labels the membranes of forming autophagosomes, and a portion of
Apg8p remains inside the autophagosome after completion (23).

View larger version (118K):
[in this window]
[in a new window]
|
Fig. 7.
Localization of GFP-Apg8 in live cells.
GFP-Apg8 shows cytoplasmic localization and labels punctate structures
in wild-type cells growing in FM medium (A, phase image;
B, GFP fluorescence). In wild-type cells starving in SorC
(C, phase image; D, GFP fluorescence), a similar
distribution of GFP-Apg8 fluorescence is seen. In the autophagy
mutants, GFP-Apg8 again shows cytoplasmic localization, but in
addition, a single large punctate structure is labeled, irrespective of
nutrient conditions. E and F,
apg5 in FM medium; G and
H, apg5 in SorC; I and
J, apg7 in FM medium; K
and L, apg7 in SorC.
|
|
The Apg5-Apg12 Conjugation System Is Conserved in
Dictyostelium--
We wanted to test whether the Apg5-Apg12
conjugation system described in S. cerevisiae is conserved
in D. discoideum. For this experiment, we used the GFP
fusions that we created to determine subcellular localization of the
autophagy proteins. We were able to detect these fusions by Western
blotting with a rabbit polyclonal antiserum against GFP (Molecular
Probes). Both Apg5 and Apg12 GFP fusions are present in two forms in
the parental strain DH1, corresponding to free and conjugated forms of
the proteins (Fig. 8). Apg5-GFP displays
two bands; one migrates at ~80 kDa, and the second migrates at ~100
kDa. GFP-Apg12 migrates at the expected mass of ~50 kDa, but the
conjugated form (~130 kDa) is larger than the reciprocal conjugate of
Apg5-GFP-Apg12. We are investigating this discrepancy. The
interpretation of the nature of these two bands is confirmed by the
absence of the higher molecular mass form of GFP-Apg5p in the
apg7
mutant, because Apg7 is the E1 that
activates Apg12 prior to conjugation with Apg5. The higher molecular
mass form of GFP-Apg12 is absent in the apg5
and apg7
mutants, where the target of
conjugation and the E1 activating enzyme, respectively, are absent.
This is the predicted result if the Dictyostelium system
functions like that of budding yeast.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 8.
Apg5-GFP and GFP-Apg12 fusion proteins are
present in two forms. GFP was fused to the carboxyl terminus of
Apg5 and the amino terminus of Apg12 and overexpressed from a
constitutive actin15 promoter in the parental strain, DH1,
and the two autophagy mutants, apg5 and
apg7 . Cells were grown in HL5 medium
(G) or starved in SorC (S) for 6 h and
immunoblotted with anti-GFP antibody. The non-conjugated Apg5-GFP and
GFP-Apg12 are present in all strains regardless of growth conditions.
However, the Apg5-GFP-Apg12 conjugate is only present in DH1 and
apg5 but is absent in the strain lacking
E1-like activity, apg7 . The band
above free Apg5-GFP is a nonspecific band. The
GFP-Apg12-Apg5 conjugate is present only in the wild-type strain and is
absent in the strain lacking a target for conjugation
(apg5 ) or the E1-like activating enzyme
(apg7 ).
|
|
Wild-type Cells Show Extensive Cytoplasmic Degradation When Starved
of Amino Acids--
To study the defect in autophagy mutant cells, we
examined ultrastructure by transmission electron microscopy. We looked
at both growing cells and cells starved of amino acids for 36 h to stimulate autophagy. Growing mutant amoebae are indistinguishable from
their growing wild-type counterparts (Fig.
9, A, C, and
E). Many small vesicles concentrated at the cell periphery
are observed (Fig. 9A); these are macropinosomes resulting
from feeding on the FM medium. When cells are starved, we observe
dramatic differences between wild-type and autophagy mutant strains. In
the parent DH1, large vesicles containing predominantly membrane, but
also a little granular material, are observed. Most organelles have been degraded, leaving an almost empty cytoplasm (Fig. 9B).
However, in starved autophagy mutants, vesicles are observed that
contain organelles and cytoplasmic components, but the contents have
undergone little or no degradation. The cytoplasm of mutant amoebae
contains many organelles and is densely packed with glycogen (Fig. 9,
D and F). It appears that amoebae of the
wild-type parental strain recycle cellular components to aid in
survival during nitrogen starvation, whereas mutant amoebae do not.
These studies reveal the presence of what appear to be autophagosomal
structures in the autophagy mutants (see arrows in Fig.
9, D and F), although additional evidence besides
morphology is required to substantiate this conclusion.

View larger version (144K):
[in this window]
[in a new window]
|
Fig. 9.
Ultrastructural features of growing and
starving amoebae. Parental cells (A and B),
apg5 cells (C and D),
and apg7 cells (E and F)
were grown in FM medium (A, C, and E) or in FM
medium lacking amino acids (B, D, and
F) for 36 h. A, wild-type cells in FM medium
exhibit scattered mitochondria (M) and few vacuoles
containing enclosed cytoplasm or membranous inclusions. B,
cells in FM medium lacking amino acids exhibit less granular cytoplasm,
fewer mitochondria (M), and large vacuoles enclosing
membranous and lightly granular masses of cytoplasm (arrows)
suggesting autolysis. C and E, mutant cells grown
in FM medium are similar to growing wild-type cells. D and
F, mutant cells grown in FM medium lacking amino acids
exhibit scattered vacuoles containing membranous whorls and granular
masses of cytoplasm (arrows), suggesting possible
autophagosome formation, but less evidence of autolysis. D
(inset) shows enclosure of a mitochondrion within a
cup-shaped membrane that appears to be a forming autophagosome.
F (inset) is a higher magnification view of a
membranous whorl within the peripheral cytoplasm (arrow) of
an apg7 cell grown in FM medium lacking amino
acids. Scale bars = 1 µm (insets = 0.2 µm).
|
|
 |
DISCUSSION |
In this study, we show that the autophagy pathway characterized in
yeast, plants, and mammalian cells is conserved in D. discoideum. We identified putative Dictyostelium
orthologues of S. cerevisiae proteins for Apg1-9, Apg12,
and Tor. We were unable to locate orthologues of Apg10, Apg13, Apg16,
or Apg17, either because they do not exist in social amoebae, are
poorly conserved in evolution, or because we searched an incompletely
sequenced genome. Unlike A. thaliana, we find only a single
isoform of each protein with the exception of Apg4. We examined the
expression of some of the identified autophagy genes in
Dictyostelium and observe up-regulated transcription of
apg1, apg8, and apg9 when cells are
starved (Fig. 2). In yeast, the expression of only one autophagy gene,
APG8, is significantly induced by starvation (23).
To analyze the functional conservation of macroautophagy, we generated
and characterized the first autophagy mutants described in D. discoideum, in the apg5 and apg7 genes. Apg5
is the target of Apg12 conjugation, requiring the activity of the
E1-like enzyme, Apg7. This conjugation reaction is chemically similar
to ubiquitination and is required for the formation of autophagosomes
(13, 42). Both Dictyostelium genes show significant homology
with their budding yeast, plant, and mammalian counterparts (Fig. 1),
with all residues known to be essential for function conserved. In addition, the Apg12-Apg5 conjugation system appears to be present in
Dictyostelium (Fig. 7). Two forms of the GFP fusion proteins are detected in wild-type cells, but the higher molecular mass form of
Apg5-GFP is absent in apg7
, and the conjugated
form of GFP-Apg12 is absent in both apg5
and
apg7
. This conjugation pattern is consistent
with the functions assigned to Apg5, Apg7, and Apg12 from studies in
budding yeast and mammalian cells. Apg5-GFP and GFP-Apg12 show diffuse
cytoplasmic localization and rarely a single dot in growing and
starving cells (data not shown). The GFP-Apg8 fusion shows a change in
localization pattern dependent on the nutritional status and genetic
background of the cell. In the wild-type strain, GFP-Apg8 localizes to
many punctate spots in the cytoplasm (Fig. 7, B and
D), in addition to diffuse cytoplasmic localization.
Interestingly, the frequency of the dots is lowest in rich growth
medium, HL5 (data not shown), and is higher in the defined medium, FM,
and in phosphate buffer (SorC). These punctate structures may represent
preautophagosomal complex(es) and/or forming/complete autophagosomes.
In the apg5
and apg7
mutants, GFP-Apg8 labels only a single punctate structure that is much
larger than the dots observed in the wild-type strain (Fig. 7,
F, H, J, and L), and the
localization/frequency of these structures does not change when cells
are starved. It is unclear what these large structures represent, but
immunoelectron microscopy with anti-GFP antibodies in
GFP-Apg8-expressing strains may be informative.
We find that apg5 and apg7 are dispensable for
growth in Dictyostelium but are required for normal
development. When apg5
and
apg7
mutants develop, they form large
multi-tipped aggregates that fail to complete normal morphogenesis.
Instead, aberrant fruiting bodies composed of thickened stalks and
empty sori are formed (Fig. 3). These structures produce no viable,
mature spores. Additionally, development and spore production cannot be
rescued by co-developing autophagy mutant cells with wild-type cells in
a chimeric organism (Fig. 4). Thus, these autophagy mutations are cell
autonomous. It is not clear how these mutations prohibit proper
development, but it may include interference with chemotaxis, motility,
adhesion, intercellular signaling, or differentiation.
The apg5
and apg7
mutants exhibit additional attributes of autophagy mutants. Survival in
medium lacking amino acids is severely reduced (Fig. 5), similar to
that described for yeast and plants. Yeast autophagy mutants die
rapidly when starved of amino acids, and plants carrying autophagy
mutations are susceptible to nutrient limitation. Autophagy is the
major mechanism of bulk protein turnover when yeast cells are starved
for nitrogen, accounting for 80% of protein turnover (22). We find
that starved Dictyostelium autophagy mutants degrade very
little protein (10-15%), whereas starved wild-type cells and
complemented autophagy mutants degrade 30-40% of the protein they
contained at the end of growth (Fig. 6). A mutation in yakA,
a gene that is required for the growth to development transition in
Dictyostelium (40), does not affect the reduction in protein
levels typical of starved cells, indicating that the earliest events in
development are not required for the induction of
autophagy-dependent proteolysis. We see a similar result
when starvation-induced protein turnover is assayed in an adenylyl
cyclase mutant (aca
) (data not shown). The
aca
mutant also survives as well as wild-type
when starved for amino acids (data not shown), confirming that
autophagy can be induced even in the absence of early developmental
events that are usually triggered by starvation.
Consistent with the protein turnover defect in
apg5
and apg7
, we
observe by transmission electron microscopy that turnover of organelles
and cytoplasmic constituents in cells starved for amino acids for
36 h is impaired (Fig. 9). Wild-type cells show significant
degradation of the cytoplasm, to such an extent that portions of the
cytoplasm are electron-lucent. Additionally, large vesicles are
observed that contain a small amount of membrane and granular material
that appears highly degraded. Conversely, in the starved mutant cells,
vesicles containing membrane whorls and cytoplasm with little evidence
of degradation are observed. These enclosed membrane whorls are
reminiscent of autophagosomes or autophagic vacuoles in mammalian cells
(43, 44). The morphology of the autophagic system in
Dictyostelium appears more similar to mammalian cells than
to budding yeast and may reflect the more complex intracellular
membrane structure and dynamics of Dictyostelium compared
with yeast. In the latter, the autophagosome fuses with the vacuole,
releasing the autophagic body into the vacuolar lumen for degradation
by resident hydrolases. In contrast, in mammalian cells, primary
autophagosomes appear to mature to autophagic vacuoles through
incorporation of lysosomal membrane proteins, vacuole acidification,
and acquisition of lysosomal hydrolases (45). Additional
transmission electron microscopy studies are under way to
better characterize the morphology of autophagy in
Dictyostelium and the specific defect we observe in the
autophagy mutants.
The underlying machinery used to generate autophagosomes is conserved
among yeast, plants, humans, and now Dictyostelium. Genetic
and cell biology studies in yeast have delineated the molecular
framework required for autophagy. The challenge for the future is to
elucidate the signaling pathways required to initiate autophagy, the
mechanistic details of autophagosome formation, and the interaction of
autophagy and endolysosomal pathways. Dictyostelium provides
a useful system for these studies; it is genetically tractable, the
endolysosomal system is similar to mammalian cells, and, most
importantly, the effects of autophagy on multicellular development can
be examined fruitfully.
 |
ACKNOWLEDGEMENTS |
We thank all members of the Kessin laboratory
and Howard Shuman and Hubert Hilbi for helpful discussions. We thank
Thomas Huckaba, Edgar Gomes, and Chiann-Mun Chen for help with
microscopy. We are grateful to the Dictyostelium Genome
Sequencing Consortium for their efforts.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant GM33136 (to R. H. K.). This is Lamont-Doherty Earth Observatory Contribution Number 6408.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept. of Anatomy
and Cell Biology, Rm. 12-517, Columbia University, 630 W. 168th St.,
New York, NY 10032. Tel.: 212-305-5653; Fax: 212-305-3970; E-mail:
rhk2@columbia.edu.
Published, JBC Papers in Press, March 7, 2003, DOI 10.1074/jbc.M212467200
 |
ABBREVIATIONS |
The abbreviations used are:
Tor, target of
rapamycin;
GFP, green fluorescent protein;
SorC, Sorensen C.
 |
REFERENCES |
| 1.
|
Dice, J. F.,
Terlecky, S. R.,
Chiang, H. L.,
Olson, T. S.,
Isenman, L. D.,
Short-Russell, S. R.,
Freundlieb, S.,
and Terlecky, L. J.
(1990)
Semin. Cell Biol.
1,
449-455[Medline]
[Order article via Infotrieve]
|
| 2.
|
Cuervo, A. M.,
and Dice, J. F.
(2000)
Traffic
1,
570-583[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Cuervo, A. M.,
and Dice, J. F.
(2000)
J. Cell Sci.
113,
4441-4450[Abstract]
|
| 4.
|
Mortimore, G. E.,
Lardeux, B. R.,
and Adams, C. E.
(1988)
J. Biol. Chem.
263,
2506-2512[Abstract/Free Full Text]
|
| 5.
|
Tuttle, D. L.,
and Dunn, W. A., Jr.
(1995)
J. Cell Sci.
108,
25-35[Abstract]
|
| 6.
|
Reggiori, F.,
and Klionsky, D. J.
(2002)
Eukaryot. Cell
1,
11-21[Free Full Text]
|
| 7.
|
Tsukada, M.,
and Ohsumi, Y.
(1993)
FEBS Lett.
333,
169-174[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Thumm, M.,
Egner, R.,
Koch, B.,
Schlumpberger, M.,
Straub, M.,
Veenhuis, M.,
and Wolf, D. H.
(1994)
FEBS Lett.
349,
275-280[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Noda, T.,
Matsuura, A.,
Wada, Y.,
and Ohsumi, Y.
(1995)
Biochem. Biophys. Res. Commun.
210,
126-132[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Noda, T.,
and Ohsumi, Y.
(1998)
J. Biol. Chem.
273,
3963-3966[Abstract/Free Full Text]
|
| 11.
|
Kametaka, S.,
Okano, T.,
Ohsumi, M.,
and Ohsumi, Y.
(1998)
J. Biol. Chem.
273,
22284-22291[Abstract/Free Full Text]
|
| 12.
|
Kihara, A.,
Noda, T.,
Ishihara, N.,
and Ohsumi, Y.
(2001)
J. Cell Biol.
152,
519-530[Abstract/Free Full Text]
|
| 13.
|
Mizushima, N.,
Noda, T.,
Yoshimori, T.,
Tanaka, Y.,
Ishii, T.,
George, M. D.,
Klionsky, D. J.,
Ohsumi, M.,
and Ohsumi, Y.
(1998)
Nature
395,
395-398[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Ichimura, Y.,
Kirisako, T.,
Takao, T.,
Satomi, Y.,
Shimonishi, Y.,
Ishihara, N.,
Mizushima, N.,
Tanida, I.,
Kominami, E.,
Ohsumi, M.,
Noda, T.,
and Ohsumi, Y.
(2000)
Nature
408,
488-492[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Kamada, Y.,
Funakoshi, T.,
Shintani, T.,
Nagano, K.,
Ohsumi, M.,
and Ohsumi, Y.
(2000)
J. Cell Biol.
150,
1507-1513[Abstract/Free Full Text]
|
| 16.
|
Shintani, T.,
Mizushima, N.,
Ogawa, Y.,
Matsuura, A.,
Noda, T.,
and Ohsumi, Y.
(1999)
EMBO J.
18,
5234-5241[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Tanida, I.,
Mizushima, N.,
Kiyooka, M.,
Ohsumi, M.,
Ueno, T.,
Ohsumi, Y.,
and Kominami, E.
(1999)
Mol. Biol. Cell
10,
1367-1379[Abstract/Free Full Text]
|
| 18.
|
Yuan, W.,
Stromhaug, P. E.,
and Dunn, W. A., Jr.
(1999)
Mol. Biol. Cell
10,
1353-1366[Abstract/Free Full Text]
|
| 19.
|
Kuma, A.,
Mizushima, N.,
Ishihara, N.,
and Ohsumi, Y.
(2002)
J. Biol. Chem.
277,
18619-18625[Abstract/Free Full Text]
|
| 20.
|
Mizushima, N.,
Noda, T.,
and Ohsumi, Y.
(1999)
EMBO J.
18,
3888-3896[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Kirisako, T.,
Ichimura, Y.,
Okada, H.,
Kabeya, Y.,
Mizushima, N.,
Yoshimori, T.,
Ohsumi, M.,
Takao, T.,
Noda, T.,
and Ohsumi, Y.
(2000)
J. Cell Biol.
151,
263-276[Abstract/Free Full Text]
|
| 22.
|
Schlumpberger, M.,
Schaeffeler, E.,
Straub, M.,
Bredschneider, M.,
Wolf, D. H.,
and Thumm, M.
(1997)
J. Bacteriol.
179,
1068-1076[Abstract/Free Full Text]
|
| 23.
|
Kirisako, T.,
Baba, M.,
Ishihara, N.,
Miyazawa, K.,
Ohsumi, M.,
Yoshimori, T.,
Noda, T.,
and Ohsumi, Y.
(1999)
J. Cell Biol.
147,
435-446[Abstract/Free Full Text]
|
| 24.
|
Kessin, R. H.
(2001)
Dictyostelium-Evolution, Cell Biology, and the Development of Multicellularity
, Cambridge University Press, Cambridge, United Kingdom
|
| 25.
|
Sussman, M.
(1987)
in
Methods in Cell Biology
(Spudich, J. A., ed), Vol. 28
, pp. 9-29, Academic Press, Orlando, FL
|
| 26.
|
Wu, L.,
and Franke, J.
(1990)
Gene
91,
51-56[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Kuspa, A.,
and Loomis, W. F.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
8803-8807[Abstract/Free Full Text]
|
| 28.
|
Podgorski, G. J.,
Franke, J.,
Faure, M.,
and Kessin, R. H.
(1989)
Mol. Cell. Biol.
9,
3938-3950[Abstract/Free Full Text]
|
| 29.
|
Levi, S.,
Polyakov, M.,
and Egelhoff, T. T.
(2000)
Plasmid
44,
231-238[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
White, G. J.,
and Sussman, M.
(1961)
Biochim. Biophys. Acta
53,
285-293[Medline]
[Order article via Infotrieve]
|
| 31.
|
Franke, J.,
and Kessin, R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
2157-2161[Abstract/Free Full Text]
|
| 32.
|
Anderson, O. R.
(1994)
J. Eukaryot. Microbiol.
41,
124-128
|
| 33.
|
Doelling, J. H.,
Walker, J. M.,
Friedman, E. M.,
Thompson, A. R.,
and Vierstra, R. D.
(2002)
J. Biol. Chem.
277,
33105-33114[Abstract/Free Full Text]
|
| 34.
|
Hanaoka, H.,
Noda, T.,
Shirano, Y.,
Kato, T.,
Hayashi, H.,
Shibata, D.,
Tabata, S.,
and Ohsumi, Y.
(2002)
Plant Physiol.
129,
1181-1193[Abstract/Free Full Text]
|
| 35.
|
George, M. D.,
Baba, M.,
Scott, S. V.,
Mizushima, N.,
Garrison, B. S.,
Ohsumi, Y.,
and Klionsky, D. J.
(2000)
Mol. Biol. Cell
11,
969-982[Abstract/Free Full Text]
|
| 36.
|
Noda, T.,
Kim, J.,
Huang, W. P.,
Baba, M.,
Tokunaga, C.,
Ohsumi, Y.,
and Klionsky, D. J.
(2000)
J. Cell Biol.
148,
465-480[Abstract/Free Full Text]
|
| 37.
|
Lang, T.,
Reiche, S.,
Straub, M.,
Bredschneider, M.,
and Thumm, M.
(2000)
J. Bacteriol.
182,
2125-2133[Abstract/Free Full Text]
|
| 38.
|
Wang, C. W.,
Kim, J.,
Huang, W. P.,
Abeliovich, H.,
Stromhaug, P. E.,
Dunn, W. A., Jr.,
and Klionsky, D. J.
(2001)
J. Biol. Chem.
276,
30442-30451[Abstract/Free Full Text]
|
| 39.
|
Shintani, T.,
Suzuki, K.,
Kamada, Y.,
Noda, T.,
and Ohsumi, Y.
(2001)
J. Biol. Chem.
276,
30452-30460[Abstract/Free Full Text]
|
| 40.
|
Souza, G. M.,
Lu, S.,
and Kuspa, A.
(1998)
Development
125,
2291-2302[Abstract]
|
| 41.
|
Suzuki, K.,
Kirisako, T.,
Kamada, Y.,
Mizushima, N.,
Noda, T.,
and Ohsumi, Y.
(2001)
EMBO J.
20,
5971-5981[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Mizushima, N.,
Sugita, H.,
Yoshimori, T.,
and Ohsumi, Y.
(1998)
J. Biol. Chem.
273,
33889-33892[Abstract/Free Full Text]
|
| 43.
|
Papadopoulos, T.,
and Pfeifer, U.
(1987)
Exp. Cell Res.
171,
110-121[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Niemann, A.,
Takatsuki, A.,
and Elsasser, H. P.
(2000)
J. Histochem. Cytochem.
48,
251-258[Abstract/Free Full Text]
|
| 45.
|
Dunn, W. A., Jr.
(1990)
J. Cell Biol.
110,
1935-1945[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea