|
Originally published In Press as doi:10.1074/jbc.M301328200 on March 5, 2003
J. Biol. Chem., Vol. 278, Issue 20, 17752-17759, May 16, 2003
Structural Analysis of the DNA-binding Domain of the
Erwinia amylovora RcsB Protein and Its Interaction with the
RcsAB Box*
Primo
Pristov ek §,
Kaushik
Sengupta¶,
Frank
Löhr¶,
Birgit
Schäfer¶,
Markus Wehland
von
Trebra ,
Heinz
Rüterjans¶, and
Frank
Bernhard¶ **
From the Kemijski Institute, National Institute of
Chemistry, Hajdrihova 19, P. O. Box 660, SI-1001 Ljubljana, Slovenia,
the ¶ Universität Frankfurt/Main, Institut
für Biophysikalische Chemie, Marie Curie Str. 9, D-60439
Frankfurt, Germany, and the Freie Universität Berlin,
Institut für Kristallographie, Takustr.6,
D-14195 Berlin, Germany
Received for publication, February 6, 2003
 |
ABSTRACT |
The transcriptional regulator RcsB interacts with
other coactivators to control the expression of biosynthetic operons in enterobacteria. While in a heterodimer complex with the regulator RcsA
the RcsAB box consensus is recognized, DNA binding sites for RcsB
without RcsA have also been identified. The conformation of RcsB might
therefore be modulated upon interaction with various coactivators,
resulting in the recognition of different DNA targets. We report the
solution structure of the C-terminal DNA-binding domain of the RcsB
protein from Erwinia amylovora spanning amino acid residues
129-215 solved by heteronuclear magnetic resonance (NMR) spectroscopy.
The C-terminal domain is composed of four -helices where two central
helices form a helix-turn-helix motif similar to the structures of the
regulatory proteins GerE, NarL, and TraR. Amino acid residues involved
in the RcsA independent DNA binding of RcsB were identified by
titration studies with a RcsAB box consensus fragment. Data obtained
from NMR spectroscopy together with surface plasmon resonance
measurements demonstrate that the RcsAB box is specifically recognized
by the RcsAB heterodimer as well as by RcsB alone. However, the binding
constant of RcsB alone at target promoters from Escherichia coli,
E. amylovora, and Pantoea stewartii was approximately
1 order of magnitude higher compared with that of the RcsAB
heterodimer. We present evidence that the obvious role of RcsA is not
to alter the DNA binding specificity of RcsB but to stabilize RcsB-DNA complexes.
 |
INTRODUCTION |
The RcsB protein is a key regulator in enteric and plant
pathogenic bacteria and represents the transcriptional effector of a
modified two-component system. RcsB is essential for the induction of
exopolysaccharide (EPS)1
biosynthesis (1), an important factor for the virulence of bacterial
pathogens. It is further involved in rcsA autoregulation (2,
3), in the regulation of cell division (4, 5), in the expression of the
osmoregulated gene osmC (6) and probably in regulation of
motility and chemotaxis (7-9). The Rcs regulation system is different
from homologous systems as the phosphorylation of RcsB involves two
other proteins, the membrane sensor RcsC (1) and the
histidine-containing phosphotransmitter RcsD (YojN) (8). A third
protein, RcsF, might be additionally involved in the activation of RcsB
(10). Whereas specific signals recognized by the sensor protein RcsC
still remain unknown, the RcsB regulation pathway can be activated by
osmotic shock (11) and desiccation, by mutations affecting the
integrity and composition of the cell envelope (12, 13), by treatment
with the cationic amphipathic substance chlorpromazine (9), and by
overproduction of the chaperone-like transmembrane protein DjlA (14,
15).
A further modification of the RcsB regulation mechanism if compared
with conventional two-component systems might be the ability of RcsB to
recognize different nucleic acid structures in combination with other
proteins. RcsB does interact with various coinducers like RcsA (12) and
probably TviA (16), and the formation of alternative protein complexes
might direct the regulator to different targets. It has been shown that
the EPS production is induced by the binding of a heterodimer of RcsB
and RcsA at the RcsAB box (17, 18). This 14-bp consensus sequence is
present in the promoters of all analyzed Rcs-regulated operons for
capsule synthesis, as well as in rcsA promoters. However,
several other genes in Escherichia coli, like the
osmoregulated gene osmC (6) as well as cell division genes
controlled by the fts promoter (5), and the genes
responsible for Vi antigen synthesis in Salmonella typhi
(16) were reported to be controlled by RcsB in a completely RcsA
independent mechanism. Still it remains unclear whether the RcsA
independent regulation mechanisms are mediated by RcsB alone or by the
interaction of RcsB with further, yet unidentified coinducers. The
requirement for RcsA in EPS regulation can be bypassed by increasing
the copy number of RcsB (19), indicating that RcsA modulates the
RcsB-mediated transcriptional activation, but that it seems not to be
essential for the general regulation mechanism. RcsA might help to keep
RcsB in an active conformation by stabilizing its phosphorylation. This
assumption might be supported by the observation that a mutant in the
putative RcsB phosphorylation motif results in the RcsA independent
overproduction of EPS in E. coli (6). In any case,
regulation of different operons by RcsB alone or in combinations with
certain coactivators would imply different modes of DNA binding.
DNA binding activity of RcsB alone could not be clearly demonstrated so
far. An interaction with specific DNA-binding sites by electrophoretic
mobility shift assays could be shown only in combination with RcsA (17)
or RNA polymerase (6). Two well conserved sequence motifs can be found
in RcsB, a N-terminal phosphorylation motif involving three aspartic
acid residues at positions 10, 11, and 56, and a C-terminal
helix-turn-helix (HTH) DNA binding motif spanning amino acid positions
151-194 and sharing sequence homology with the autoinducer homoserine
lactone-dependent LuxR-type regulators (20) and the
phosphorylation controlled FixJ/UhpA family of activators (21). The
24-kDa protein RcsB can therefore be divided into a N-terminal
"receiver" and probably protein interacting domain, and into a
C-terminal "effector" domain interacting with DNA. To analyze the
DNA binding properties of RcsB, we have solved the solution structure
of the RcsB effector domain by high resolution 1H,
15N, and 13C NMR spectroscopy and we have
further analyzed the interaction of RcsB with one of its DNA targets.
Specific amino acid residues of RcsB interacting with the RcsAB box
have been identified and we could show that RcsA considerably
stabilizes the RcsAB-DNA complex. However, we also could demonstrate
that RcsA is not essential for the specific recognition of the RcsAB
box by RcsB.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Plasmids, Oligonucleotides, and DNA
Techniques--
Strains and plasmids used for DNA cloning and
expression studies are listed in Table I.
Standard DNA techniques were used as described elsewhere (24). The
coding sequence for the Erwinia amylovora C-RcsB protein
spanning residues 129 to 215 was amplified by standard PCR with Vent
polymerase using the plasmid pQ-RcsBEA as a template and
primers RcsBEaC-up
(GCGGATCCTATACCCCGGAAAGCGTGGC) and RcsBEA-low
(ACCTGCAGTTATTTATCTACCGGCGTC). The DNA was cloned with enzymes
BamHI and PstI into the vector pQE30
resulting in plasmid pQ-CRcsBEA encoding for a fusion
protein containing the C-terminal 87 amino acid residues of the RcsB
protein with the additional 12 amino acid residues
MRGS(H)6GS at its N-terminal end.
The 14-bp fragment PamsG14 was reconstituted by hybridizing the
oligonucleotides amsG14-up (TGAGAATAATCTTA) and amsG14-low (TAAGATTATTCTCA) in a 1:1 ratio in 10 mM sodium phosphate
buffer with 50 mM NaCl in a total volume of 100 µl. The
sample was heated to 95 °C for 5 min and then slowly cooled down to
room temperature. The hybridized DNA fragment was concentrated to 4 mM in a SpeedVac centrifuge at 45 °C. For surface
plasmon resonance experiments, biotin-labeled oligonucleotides were
used for the PCR amplification of DNA fragments of approximately 110 bp
containing a centered RcsAB box.
Expression and Purification of Proteins--
The RcsA protein
was produced with the plasmid pM-RcsAEA (17) in
strain BL21 as C-terminal fusion to the maltose-binding protein. The
RcsB protein was produced with plasmid pQ-RcsBEA (17) with
an N-terminal poly(His)6 tag in strain JB3034. The proteins
were purified as described (17, 18). The C-RcsB protein was labeled
with stable isotopes by growing strain Xl1 x
pQ-CRcsBEA in M9 minimal medium supplemented per liter with
1 g of [15N]NH4Cl, 0.25 g of
[U-13C]glycerol, and 0.1 g of
[U-13C]glucose as appropriate. After 4 h of
induction with 1 mM
isopropyl-1-thio- -D-galactopyranoside, the cells
were harvested by centrifugation and disrupted in a French press. The
C-RcsB protein was purified by nickel-chelate chromatography in 50 mM phosphate buffer, pH 8.0, 50 mM NaCl at a
flow rate of 2 ml/min. The C-RcsB protein was eluted with a gradient up
to 1 M imidazole in 60 min and it started to elute at
approximately 200 mM imidazole. The pooled fractions were
applied to a heparin column equilibrated with 50 mM
phosphate buffer, pH 6.4, and the bound protein was eluted with a NaCl
gradient up to 1 M in 60 min at a flow rate of 2 ml/min.
The C-RcsB protein eluted at approximately 500 mM NaCl and
the combined fractions were concentrated by ultrafiltration up to a
final concentration of 1 mM in 50 mM phosphate
buffer, pH 6.4.
Surface Plasmon Resonance (SPR) Technique--
SPR measurements
were performed with a BIAcore X instrument (BIAcore, Uppsala, Sweden).
Biotinylated DNA (about 60 resonance units) were coupled to the
streptavidin-coated sensor chip SA as recommended by the manufacturer.
The experiments were carried out at a flow rate of 50 µl/min. The DNA
fragments and proteins were diluted in running buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM dithiothreitol, 0.1 mM EDTA). Bovine serum
albumin and -DNA were added to the protein solutions to a final
concentration of 200 and 8 ng/µl, respectively. RcsA/RcsB mixtures of
various concentrations ranging from approximately 47 nM to
7.5 µM were injected allowing an association time of
120 s and a dissociation time of 300 s. A reference flow cell
loaded with a random DNA target of the same size as the probe DNA
target was used to subtract unspecific DNA/protein interactions.
Regeneration of the chip surface was achieved by removing all bound
proteins with a pulse of 5 µl of 0.05% SDS in running buffer.
Kinetic analyses were done using the BIAevaluation 3.0 program. To
determine the binding properties of the proteins, 1:1 Langmuir kinetics
provided by the software were used.
Biochemical Assays--
The enzymatic activity of the
-galactosidase was determined with the
o-nitrophenyl- -D-galactopyranoside assay
after Miller (25). Electrophoretical mobility shift assays were done as
described (17). The band intensities were visualized using a
phosphoimaging plate. Intensities of the bands were quantified with
ImageQuant version 4.1 from Amersham Biosciences.
NMR Data Collection and Processing--
NMR data collection was
carried out at 289 K on Bruker DMX and DRX spectrometers operating at
1H-resonance frequencies of 499, 600, and 800 MHz using
5-mm triple-resonance (1H/13C/15N)
probes with Z- or XYZ-gradient capability. The reduced temperature was
chosen because of instability of the protein at room temperature and
millimolar concentrations needed for NMR measurements. All three-dimensional experiments made use of pulsed field gradients for
coherence selection and artifact suppression, and utilized gradient
sensitivity enhancement schemes wherever appropriate (26, 27).
Homonuclear as well as 13C- and/or 15N-edited
TOCSY and NOESY experiments (28, 29) were acquired and processed as
reported elsewhere (30, 31). DNA titration experiments were
performed at 600 MHz with an initial C-RcsB concentration of 0.4 mM at 15 °C with a reconstituted 14-bp RcsAB box of the sequence TGAGAATAATCTTA.
Restraints Generation and Structure Calculation--
The
NOE-derived distance restraints were determined from two-dimensional
homonuclear NOESY and three-dimensional 13C- or
15N-edited NOESY-HSQC spectra, including a constant-time
13C-edited NOESY-HSQC for the aliphatic side chain region
providing positive peaks for protons bound to a carbon atom with 1 or 3 aliphatic carbon atom neighbors, and negative peaks for protons bound
to a carbon atom with 2 carbon atom neighbors (32). The sequential
assignment was confirmed using the self-written program st2nmr (33). Semi-automated assignments of the NOE
cross-peaks based on chemical shifts and a preliminary structure
derived from manual homology building with NarL (Protein Data Bank code
1NRL) were obtained with the self-written program nmr2st
(34). Stereospecific assignments of the prochiral methylene and
isopropyl methyl groups were obtained using the program GLOMSA (35).
Pseudo-atom correction for unassigned stereo partners and magnetically
equivalent protons was applied as proposed (36).
All structure calculations were performed as described previously (34,
37). A total of 100 conformers were calculated in 8000 annealing steps
each using the DYANA 1.5 program package (38).
 |
RESULTS |
Specific Recognition of the RcsAB Box by the RcsB Protein--
The
RcsA independent activation of EPS biosynthesis in E. coli
caused by multicopy rcsB strongly indicates a specific
interaction of RcsB alone with Rcs-regulated promoters. We therefore
analyzed the interaction of the E. amylovora RcsB protein in
the absence of the coinducer RcsA with the promoters of EPS
biosynthetic operons from three different species by the highly
sensitive SPR technology. The selected promoters were Pwza from the
E. coli operon for colanic acid biosynthesis, PamsG from the
E. amylovora operon for amylovoran biosynthesis, and PcpsA
from the P. stewartii operon for stewartan biosynthesis. PCR
generated DNA fragments of the three promoters with approximately 110 bp in length and containing the previously described RcsAB boxes were
analyzed by incubating with a 750 nM solution of purified
RcsB. We could clearly demonstrate a specific interaction of RcsB alone
with all three DNA fragments (Fig.
1A). In steady state kinetics
using RcsB concentrations from 0.4 nM to 3 µM, the KD values of the RcsB/DNA
interaction were calculated to 4.6 ± 3 × 10 6
with Pwza, 2.2 × 10 6 with PamsG, and 5.4 × 10 6 with PcpsA. Characteristic for these interactions was
a high instability and an immediate dissociation of the protein-DNA
complexes. The half-lives of all three complexes was less than a second
and too short to become estimated with our technique. This rapid
dissociation of RcsB from its DNA target might contribute to the
failure to receive a clear retarded band by analyzing the RcsB/DNA
interaction by other techniques like the electrophoretic mobility shift
assay.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Interaction of the RcsB protein with DNA
fragments containing the RcsAB boxes of the promoters of
amsG, wza, and
cpsA. The protein/DNA interaction was analyzed by
SPR technology using DNA fragments of approximately 110 bp. The
concentration of each protein was 750 nM. Solid
line, PamsG; dotted line, PcpsA; broken
line, Pwza. A, DNA binding of RcsB alone. B,
DNA binding of RcsB with RcsA. C, interaction of RcsB alone
with Pwza after deletion of the 14-bp RcsAB box. The protein
concentration was 1.5 µM.
|
|
A 14-bp consensus sequence called the RcsAB box was previously
described as the RcsAB-binding region in the wza,
amsG, and cpsA promoters (3). We next determined
whether the RcsAB box is also important for the DNA binding of RcsB
alone at these promoters. For this purpose, the 14-bp RcsAB box in
fragment Pwza was deleted and the binding of RcsB to the modified
110-bp fragment was analyzed by SPR (Fig. 1C). We could not
detect any binding, indicating that the RcsAB box is also essential for
an interaction of RcsB alone with DNA.
RcsA Stabilizes the DNA Interaction of RcsB--
As heterodimer
formation with RcsA is obviously not a prerequisite for RcsB to
recognize the RcsAB box, we now analyzed the influence of RcsA on the
DNA binding characteristics of RcsB. Addition of RcsA protein equimolar
to RcsB considerably decreased the dissociation of the proteins from
the three DNA fragments and stabilized the protein-DNA complexes (Fig.
1B). We obtained KD values of 3.8 ± 0.1 × 10 7 with Pwza, 2.8 ± 0.8 × 10 8 with PamsG, and 1.5 ± 0.3 × 10 7 with PcpsA. The half-lives of all three RcsAB-DNA
complexes were extended to several minutes and the most stable complex
was formed with PamsG, followed by Pwza and PcpsA. The
Kd of the RcsAB-Pwza complex using protein
concentrations of 94 nM to 1.5 µM was
calculated as 3.1 ± 1.7 × 10 3. These results
indicate that a major role of RcsA in the activation of EPS
biosynthesis is the stabilization of the RcsB-DNA complex.
Characterization of the C-terminal DNA-binding Domain of
RcsB--
A further detailed characterization of the different binding
modes of RcsB requires its structural analysis by solution NMR spectroscopy. Unfortunately, the full-length RcsB protein is sparingly stable in the concentrations required for NMR spectroscopy. In addition, only a few signals were obtained from the N-terminal domain
indicating an open solvent accessible structure. These findings
presently preclude the study of the full-length RcsB protein by NMR
spectroscopy. In contrast, the C-terminal part spanning amino acids
129-215 (C-RcsB, Fig. 2) and including
the complete effector domain was reasonably stable. The C-RcsB protein was overproduced from the expression plasmid pQ-CrcsBEA in
E. coli, generating a modified protein with an addition of
12 amino acid residues at the N-terminal end including a
poly(His)6 tag. The protein stayed soluble and could be
purified in two steps using Ni2+-chelate and heparin
chromatography. To analyze whether the truncated RcsB protein is
produced with a functional conformation, we transformed the plasmid in
strain JB3034 x pEA101, containing a chromosomal cpsB::lacZ insertion as a reporter
gene, and the E. amylovora rcsA gene on the compatible
multicopy plasmid pEA101. The lacZ expression in this strain
is activated, as the cps operon is strongly induced by
binding of a RcsAB dimer and because of the increased copy number of
RcsA. After induction of C-RcsB overproduction with
isopropyl-1-thio- -D-galactopyranoside, the protein shows a negative effect on the expression of the cps operon in E. coli with a decrease of approximately 30%. Accordingly, the
highly mucoid phenotype of E. coli strain Xl1 x pEA101,
which is because of the increased copy number of RcsA, was rendered to
an only slightly mucoid phenotype upon transformation with the plasmid pQ-CrcsBEA and after induction of C-RcsB production with
isopropyl-1-thio- -D-galactopyranoside. These results
gave evidence that at increased copy numbers the C-terminal RcsB domain
could prevent RcsAB dimers from binding at the Pwza promoter in
vivo by blocking the RcsAB box.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 2.
Primary structure of the E. amylovora RcsB protein. The analyzed C-terminal domain
encompasses residues 129 to 215. The identified helices are indicated
in bold. Residues showing a chemical shift larger than 0.05 ppm upon addition of the PamsG14 fragment are underlined.
The HTH consensus sequence derived from an alignment of homologous
transcriptional regulators is given below the sequence.
Uppercase, highly conserved; lowercase, medium
conserved; dash, non-conserved; #, hydrophobic
residue.
|
|
A reduction in EPS biosynthesis might also be caused by metabolic
reasons after overproduction of a protein. We therefore supported the
results obtained in vivo by an in vitro
competition of a RcsAB-DNA complex formation at the E. amylovora PamsG promoter by the C-RcsB protein (Fig.
3). A 183-bp PamsG fragment spanning nucleotides 684 to 501 relative to the start codon of
amsG and including the RcsAB box (17) was shifted in an
electrophoretic mobility shift assay through binding of the RcsAB
heterodimer. Increasing amounts of C-RcsB continuously reduced the
amount of shifted DNA and the formation of the RcsAB-DNA complex was
diminished to 50% at a RcsB:C-RcsB ratio of 1:3. Taken together, the
results indicate that the C-terminal domain of RcsB is correctly folded in solution and that it retains its DNA binding activities.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibition of RcsAB-DNA complex formation by
the C-RcsB protein. The DNA binding was analyzed in an
electrophoretic mobility shift assay with a labeled 183-bp fragment
from the E. amylovora amsG promoter containing the RcsAB
box. The RcsB and RcsA proteins were added in concentrations of 2 and
15 µM, respectively. The formation of protein-DNA
complexes was analyzed by electrophoresis in a 5% acrylamide gel and
the separated bands were quantified with PhosphorImager.
|
|
Structure Description of C-RcsB--
The solution
structure of C-RcsB was solved by heteronuclear NMR spectroscopy. The
resonance assignment of C-RcsB is available at the BioMagResBank
(www.bmrb.wisc.edu) under accession number BMRB-5615. The residues of
the first 12 residues including the poly(His)6 tag could
only be partially assigned because of heavy overlap in the poly-His
portion, and high mobility leading to weak signals in most spectra. Of
the main chain, few resonances of Thr-131, Val-136, Ile-141, Leu-151,
Asn-197, and Asp-198 remain unassigned because of overlap and/or weak
signals in the spectra. The 15N-HSQC showed rather modest
spectral dispersion and overlap in the amide region; consequently,
triple-resonance experiments on a double-enriched sample were employed
to obtain the sequential resonance assignment.
Short- and medium-range NOE patterns were observed for the backbone
protons in the NOESY spectra (Fig. 4).
Five helical regions involving residues 133-142, 153-164, 168-175,
179-193, and 198-210 are indicated by the strong sequential
HN-HN and medium-range
H -HN(i,i+3),
H -H (i,i+3), and
H -HN(i,i+4) NOE
connectivities, as well as consensus chemical shift index data
calculated from 1H , 13C ,
13C , and 13CO chemical shift values (Ref.
39; data not shown). The three prolines in positions 131, 153, and 212 are all present in the trans configuration, as indicated by
the observation of strong NOE connectivities between their
H protons and the H of the corresponding
preceding residues.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4.
Schematic representation of the sequential
connectivities involving HN,
H , and
H protons in C-RcsB. For
sequential connectivities, the thickness of the
bars indicates the NOE intensities. The medium range
NOEs are identified by lines connecting the two coupled
residues.
|
|
The experimental NOESY peaks from two- and three-dimensional spectra
were assigned, integrated, and transformed into upper distance
restraints. A total of 1618 were found to be meaningful and therefore
taken into account by the program DYANA (38) in the structure
calculations. 22 stereospecific assignments of diastereotopic groups
were obtained with the program GLOMSA (35). Diastereotopic methyl
groups with non-degenerate proton resonances could be
stereospecifically assigned for 5 of 6 valine and 4 of 9 leucine
residues. One-hundred structures were finally calculated. An ensemble
of 20 final energy-minimized structures was selected to represent the
solution structure of C-RcsB in the native state (Fig.
5). The statistical information for this
family of structures is summarized in Table
II. This analysis does not include
residues 129-130, 144-151, and 213-215 that display trivial NOE
connectivities only and are most probably located in highly mobile
regions of the protein. The residues 144-152 represent the loop region
connecting the first and the second helical region, displaying local
r.m.s.d. values of 1.26-3.57 Å. The vast majority of the residues in
the NMR ensemble are located in the core (allowed) region of the
Ramachandran plot (Table II). Only 0.1% of the total number of
residues fall into disallowed regions.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
Stereoplot showing the ensemble of the 20 final energy-minimized structures of C-RcsB. Displayed are the
-carbon traces superposed for residues 131-143 and 152-212. The N-
and C-terminal ends of the protein are indicated.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Structural statistics of the 20 selected energy-minimized C-RcsB
structures
The quality of the structures was evaluated using PROCHECK-NMR (40).
|
|
The solution structure of C-RcsB contains five helices (Fig.
6), designated 6 to 10 according to
the corresponding helices in the homologous proteins NarL (43) and GerE
(44) (Fig. 2). The central DNA binding HTH motif is formed by helices
8 and 9 and is supported by 7. Helix 10 completes a
hydrophobic core of the domain. The N-terminal helix 6 has modest
hydrophobic interactions with the C-terminal helix 10. The three
helices 7 to 9 are fixed to their proper positions by a
hydrophobic cluster formed by the side chains of Val-158, Ile-171, and
Ile-182. Leu-175 anchors the loop between 8 and 9 to the cluster.
A conserved glycine residue is located at position 165 with
( , ) (145°, 45°) to assure a proper angle between
helices 7 and 8. Other highly conserved residues contributing to
the stability of the fold are Glu-155 at the amino end of 7 and
Lys-192 at the carboxyl end of 9.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 6.
Schematic representation of the refined
solution structure of C-RcsB. The helices are labeled with the
corresponding number (produced with MOLSCRIPT (41) and Raster3D
(42)).
|
|
The overall molecular structure of the protein is homologous to the
C-terminal DNA-binding domains of the transcriptional regulators NarL
(Ref. 43, Protein Data Bank code 1RNL) and TraR (45, 46). Helices 6
and 7 are connected by a flexible tether that is not visible in the
x-ray structure analysis of NarL, and it is presumably disordered. This
region corresponds to the region 143-149 of C-RcsB that is highly
mobile in the solution structure and was excluded from the structure
statistics (see above). The proper angle between 7 and 8 is
assured by Gly-170 that adopts a conformation with ( , ) (85°,15°). A further related structure is reported from the small
transcriptional regulator GerE (Ref. 43, Protein Data Bank code 1FSE);
here a helix corresponding to helix 6 of C-RcsB is missing while the
four C-terminal helices including the HTH motif are well conserved. The
residue corresponding to Gly-165 of C-RcsB and Gly-170 of NarL is
Asp-26; it adopts ( , ) values of (70°,37°). Both x-ray structures therefore place the corresponding residue in the
L region of the Ramachandran plot. It remains unclear
whether the discrepancy with the NMR solution structure is based on a
true structural difference or is a result of the paucity of NOEs in the
loop between helices 7 and 8, combined with the effect of the
force field used during energy minimization (see "Experimental Procedures"). The discrepancy, however, has no impact on the overall structures of the protein. An r.m.s.d. superposition of C-RcsB with
GerE and the C-terminal domain of NarL (Fig.
7) shows that the spatial orientation of
the helical domains is very well preserved despite the modest primary
sequence identities of less than 20%.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 7.
Backbone atom superposition of the solution
structure of C-RcsB (dark gray ribbon) with the
C-terminal domain of NarL (light gray ribbon, Protein
Data Bank code 1RNL) and GerE (medium gray ribbon,
Protein Data Bank code 1FSE). The orientation of C-RcsB is chosen
similarly to that in Fig. 6. Residues used for superposition: 129-142
and 152-210 in C-RcsB, 129-142 and 157-215 in NarL (r.m.s.d. 1.55 Å); 152-210 in C-RcsB, 13-71 in GerE (r.m.s.d. 1.32 Å).
|
|
Identification of DNA Interacting Residues in the C-terminal Domain
of RcsB--
NMR chemical shift perturbation mapping was performed to
study interactions of C-RcsB with the RcsAB box. A 0.4 mM
solution of the 15N-labeled C-RcsB protein was titrated
with a 4 mM solution of the reconstituted PamsG14 fragment
representing the 14-bp RcsAB box from the E. amylovora PamsG
promoter. The protein:DNA ratios used for the titration were 8:1,
2.7:1, 1.5:1, and 1:1. Several residues showing significant chemical
shift differences upon addition of the DNA could be identified (Fig.
8), giving evidence for a specific
interaction of C-RcsB with the RcsAB box. The most prominent differences were detected from residues Lys-153, Val-158, Leu-168, Thr-170, Arg-177, Ser-178, Ile-179, Thr-181, and Ile-182. The majority
of these residues are located in the HTH motif or in the supporting
7 helix. Five of the identified residues are located in the proposed
DNA recognition helix 9 or in the linker region between helices 8
and 9. The overall structure of C-RcsB did not show any changes upon
interaction with the RcsAB box. The detection of only a few specific
chemical shift differences after an interaction of C-RcsB with the
RcsAB box by NMR spectroscopy is in accordance with our results from
SPR experiments, showing specific but weak interactions of RcsB alone
with DNA fragments containing the RcsAB box.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 8.
Chemical shift comparison of C-RcsB and a
C-RcsB-DNA complex. A, 1H-15N
HSQC spectrum of the 15N-labeled C-RcsB alone
(black) and complexed in a 1:1 ratio with the 14-bp RcsAB
box (gray) recorded at 600 MHz at 15 °C. Assignments of
residues showing significant differences in their chemical shifts are
indicated by residue type and number.
15N -1H correlations of arginine
side chains are shown in the inset. B, summary of
chemical shift differences of all C-RcsB residues complexed with the
RcsAB box.
|
|
 |
DISCUSSION |
Proteins with structures homologous to RcsB are the regulator for
nitrate uptake NarL (43) of E. coli, belonging to the FixJ
family of response regulators, the sporulation regulator GerE (44) of
Bacillus subtilis, representing an autonomous effector domain, and the autoinducer dependent regulator TraR of
Agrobacterium tumefaciens (45, 46), a member of the LuxR
family of regulators. C-RcsB could best be aligned with NarL and GerE,
showing that the effector domain starts with helix 7 and that the
HTH motif is composed of helices 8, the scaffold helix, and 9,
the recognition helix. The complete structural unit is composed of a
four-helix bundle including helices 7 and 10. Amino acid residues
143 to 152 represent a flexible tether between the RcsB receiver and effector domain, and helix 6 might function as a linker helix between the two domains as suggested for the homologous helices 6 of
NarL and TraR. The analyzed C-RcsB protein therefore comprises the
complete effector domain including the interdomain region. The C-RcsB
protein was found to be correctly folded as indicated by competition
experiments in DNA interaction assays. The inhibition of RcsAB-DNA
complex formation by C-RcsB is most likely because of an interaction of
its HTH motif with the DNA target, but an additional interaction with
either the RcsA or RcsB protein cannot be excluded. For GerE as well as
for TraR, an involvement of helix 10 in protein dimerization was
reported (44, 45). Inactive protein complexes might therefore be formed
by oligomerization of C-RcsB with RcsA or RcsB. However, it is not
known whether RcsB forms dimers or oligomers in solution or upon
binding to DNA.
The DNA binding surface of C-RcsB at the 14-bp RcsAB box was analyzed
by heteronuclear NMR spectroscopy in DNA titration experiments. In
general, the amide protons in the majority of residues exhibit none or
only very small chemical shift changes indicating that the overall fold
of the protein is not altered upon binding to DNA. The data gave no
evidence for a very strong interaction, which is in agreement with our
results obtained by SPR measurements of the RcsB/RcsAB box
interactions, where the DNA binding affinity and the half-time of the
RcsB-DNA complex was considerably decreased in the absence of RcsA.
However, a specific recognition of the RcsAB box by RcsB alone was
evident. The highest accumulation of chemical shift changes of C-RcsB
was found in the recognition helix of the HTH motif and in the linker
between scaffold and recognition helix, the turn of the HTH motif. The
sequence RSIKTIS of the C-RcsB HTH motif is most likely responsible for
DNA recognition and we could identify five of these residues being
involved in the interaction with the RcsAB box. Accordingly, the
N-terminal ends of recognition helices in homologous HTH containing
proteins are supposed to contact specific bases in the major groove of the DNA binding motifs (43, 45). Chemical shift variations of C-RcsB
were detected at positions of the highly conserved residues Val-157 and
Ile-182 that participate in a hydrophobic cluster fixing helices 7
to 9 in their proper position. In addition, residue Glu-154 showing
also a considerable chemical shift change upon complexation is involved
in a salt bridge stabilizing the HTH motif. A less clear explanation
can be given for the chemical shift perturbation in Ser-206 and
Val-208. Both residues are located at the C terminus of helix 10 and
are not in the proximity of the DNA-binding site. A possible
explanation would be the formation of a dimer upon DNA binding. In a
model of C-RcsB bound to DNA obtained by backbone superposition of two
identical C-RcsB structures (residues 153-215) on subunits A and C
(residues 176-228; r.m.s.d. 1.2 and 1.1 Å) of TraR bound to DNA
(Protein Data Bank code 1L3L (46)), the residues Ser-206 and Val-208
are located in the 10 helix that determines the contact between the
two monomers. However, the NMR chemical shift perturbation data do not
indicate a significant change in the chemical environment of other
residues in 10 that should come in close contact upon dimerization.
Additionally, to obtain the dimer of C-RcsB in a position suitable for
DNA binding the linker helix 6 had to be deleted because of overlap
with 10 of the other dimer unit. We may conclude that binding to DNA as dimer in a fashion equivalent to TraR would require a significant change in the position of the linker helix 6. Interestingly, a
similar observation that a change in position of 6 is necessary to
allow the entry of 9 into the major groove was made in the case of
NarL (43).
The RcsAB box has been identified as the binding site for the RcsAB
heterodimer and might represent only a suboptimal binding site for RcsB
alone. This assumption is supported by our observation that the
affinity of RcsB to the RcsAB box is 1 order of magnitude lower in the
absence of RcsA. The weaker binding specificity of the RcsB HTH
recognition helix might be compensated in combination with
corresponding helices from coactivators like RcsA. Interaction with a
coinducer could, furthermore, allosterically affect the binding
specificity of the HTH motif. Unfortunately, the effect of RcsA on the
structural conformation and on the DNA interaction of RcsB could not be
analyzed by NMR spectroscopy so far. The RcsA protein can only be
produced in an active conformation when fused to the large
maltose-binding protein (17) and tends to aggregate at higher concentrations.
Potential DNA targets recognized by RcsB alone or at least
independently from RcsA have been proposed for the ftsA1p
promoter regulating ftsAZ and for omsC expression
(5, 6). The proposed 18-bp RcsB box differs from the RcsAB box mostly
in nucleotide positions located at the 3' end of the consensus (6), and
therefore positioning of RcsB at the left site of the RcsAB box in the
RcsAB-DNA complex was suggested. However, it was not possible to
demonstrate the interaction of RcsB alone with the RcsB box by
electrophoretical mobility shift assays, indicating also a somehow
instable complex. An -helix of a HTH motif can access only one side
of the DNA and it is therefore able to bind no more than 5 base pairs
because of the curvature of the DNA major groove. The length of the
suggested RcsB box gives therefore evidence for the interaction of more than one RcsB monomer with the DNA, or for the involvement of other yet
unidentified coactivators. If the formation of RcsB homodimers or
homo-oligomers enables or supports DNA binding, then the protein
interface should involve at least parts of the C-terminal domain as the
C-RcsB protein was still able to interact with DNA.
Our results show that heterodimerization with RcsA is not required for
a RcsB/DNA interaction but that it considerably enhances its
efficiency. The formation of relatively unstable complexes of RcsB
alone with promoters containing RcsAB or RcsB boxes might therefore be
important to maintain an essential basal level of expression of the
corresponding genes. Modulation of the DNA recognition specificity or
the stabilization of RcsB-DNA complexes by heterodimerization with
specific coinducers as a response to distinct external signals might
represent an additional option to rapidly increase the expression of
selected genes or operons. The results presented in this report indicate that in the case of the RcsA/RcsB heterodimer formation, the
stabilization of the protein-DNA complex is the predominant function.
 |
ACKNOWLEDGEMENTS |
The European Large Scale Facility for
Biomolecular NMR at the University of Frankfurt is kindly acknowledged
for the use of its equipment. We are grateful to Thomas D. Link and
Claudia Buechel for providing the CD spectroscopy facilities.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The atomic coordinates and the structure factors (code 1NRL) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ (http://www.rcsb.org/).
§
Supported by the Ministry of Education, Science and Sport of Slovenia.
**
To whom correspondence should be addressed. Tel.: 49-69-798-29626;
Fax: 49-69-798-29632; E-mail: fbern@bpc.uni-frankfurt.de.
Published, JBC Papers in Press, March 5, 2003, DOI 10.1074/jbc.M301328200
 |
ABBREVIATIONS |
The abbreviations used are:
EPS, exopolysaccharide;
TOCSY, total correlation spectroscopy;
NOESY, nuclear Overhauser enhancement and exchange spectroscopy;
HSQC, heteronuclear single-quantum coherence;
NOE, nuclear Overhauser effect;
r.m.s.d., root mean square deviation;
HTH, helix turn helix, SPR,
surface plasmon resonance.
 |
REFERENCES |
| 1.
|
Stout, V.,
and Gottesman, S.
(1990)
J. Bacteriol.
172,
659-669[Abstract/Free Full Text]
|
| 2.
|
Ebel, W.,
and Trempy, J. E.
(1999)
J. Bacteriol.
181,
577-584[Abstract/Free Full Text]
|
| 3.
|
Wehland, M.,
and Bernhard, F.
(2000)
J. Biol. Chem.
275,
7013-7020[Abstract/Free Full Text]
|
| 4.
|
Gervais, F. G.,
Phoenix, P.,
and Drapeau, G. R.
(1992)
J. Bacteriol.
174,
3964-3971[Abstract/Free Full Text]
|
| 5.
|
Carballes, F.,
Bertrand, C.,
Bouche, J. P.,
and Cam, K.
(1999)
Mol. Microbiol.
25,
442-450
|
| 6.
|
Davalos-Garcia, M.,
Conter, A.,
Toesca, I.,
Gutierrez, C.,
and Cam, K.
(2001)
J. Bacteriol.
183,
5870-5876[Abstract/Free Full Text]
|
| 7.
|
Arricau, N.,
Hermant, D.,
Waxin, H.,
Ecobichon, C.,
Duffey, P. S.,
and Popoff, M. Y.
(1998)
Mol. Microbiol.
29,
835-850[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Takeda, S. I.,
Fujisawa, Y.,
Matsubara, M.,
Aiba, H.,
and Mizuno, T.
(2001)
Mol. Microbiol.
40,
440-450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Conter, A.,
Sturny, R.,
Gutierrez, C.,
and Cam, K.
(2002)
J. Bacteriol.
184,
2850-2853[Abstract/Free Full Text]
|
| 10.
|
Gervais, F. G.,
and Drapeau, G. R.
(1992)
J. Bacteriol.
174,
8016-8022[Abstract/Free Full Text]
|
| 11.
|
Sledjeski, D. D.,
and Gottesman, S.
(1996)
J. Bacteriol.
178,
1204-1206[Abstract/Free Full Text]
|
| 12.
|
Gottesman, S.
(1995)
in
Two-component Signal Transduction
(Hoch, J. A.
, and Silhavy, T. J., eds)
, pp. 253-262, ASM Press, Washington, D. C.
|
| 13.
|
Clavel, T.,
Lazzaroni, J. C.,
Vianney, A.,
and Portalier, R.
(1996)
Mol. Microbiol.
19,
19-25[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Clarke, D. J.,
Holland, I. B.,
and Jacq, A.
(1997)
Mol. Microbiol.
25,
933-944[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Kelley, W. L.,
and Georgopoulos, C.
(1997)
Mol. Microbiol.
25,
913-931[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Virlogeux, I.,
Waxin, H.,
Ecobichon, C.,
Lee, J. O.,
and Popoff, M. Y.
(1996)
J. Bacteriol.
178,
1691-1698[Abstract/Free Full Text]
|
| 17.
|
Kelm, O.,
Kiecker, C.,
Geider, K.,
and Bernhard, F.
(1997)
Mol. Gen. Genet.
256,
72-83[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Wehland, M.,
Kiecker, C.,
Coplin, D. L.,
Kelm, O.,
Saenger, W.,
and Bernhard, F.
(1999)
J. Biol. Chem.
274,
3300-3307[Abstract/Free Full Text]
|
| 19.
|
Brill, J. A.,
Quinlan-Walshe, C.,
and Gottesman, S.
(1988)
J. Bacteriol.
170,
2599-2611[Abstract/Free Full Text]
|
| 20.
|
Henikoff, S.,
Wallace, J. C.,
and Brown, J. P.
(1990)
Methods Enzymol.
183,
111-132[Medline]
[Order article via Infotrieve]
|
| 21.
|
Kahn, D.,
and Ditta, G.
(1991)
Mol. Microbiol.
5,
987-997[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Bullock, W. O.,
Fernandez, J. M.,
and Stuart, J. M.
(1987)
BioTechniques
5,
376-379
|
| 23.
|
Bernhard, F.,
Poetter, K.,
Geider, K.,
and Coplin, D. L.
(1990)
Mol. Plant-Microbe Interact.
3,
429-437[Medline]
[Order article via Infotrieve]
|
| 24.
|
Sambrock, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
in
Molecular Cloning: A Laboratory Manual
(Ford, N.
, Nolan, C.
, and Ferguson, M., eds), 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 25.
|
Miller, J. H.
(1972)
Experiments in Molecular Genetics
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 26.
|
Kay, L. E.,
Keifer, P.,
and Saarinen, T.
(1992)
J. Am. Chem. Soc.
114,
10663-10665[CrossRef]
|
| 27.
|
Schleucher, J.,
Sattler, M.,
and Griesinger, C.
(1993)
Angew. Chem. Int. Ed. Eng.
32,
1489-1491[CrossRef]
|
| 28.
|
Kay, L. E.,
Marion, D.,
and Bax, A.
(1989)
J. Magn. Reson.
84,
72-84
|
| 29.
|
Zuiderweg, E. R. P.,
and Fesik, S. W.
(1989)
Biochemistry
28,
2387-2391[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Pristov ek, P.,
Lücke, C.,
Reincke, B.,
Löhr, F.,
Ludwig, B.,
and Rüterjans, H.
(2000)
J. Biomol. NMR
16,
353-354[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Lücke, C.,
Reincke, B.,
Löhr, F.,
Pristov ek, P.,
Ludwig, B.,
and Rüterjans, H.
(2000)
J. Biomol. NMR
18,
365-366[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Vuister, G. W.,
and Bax, A.
(1992)
J. Magn. Reson.
98,
428-435
|
| 33.
|
Pristov ek, P.,
Rüterjans, H.,
and Jerala, R.
(2002)
J. Comput. Chem.
23,
335-340[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Pristov ek, P.,
Lücke, C.,
Reincke, B.,
Ludwig, B.,
and Rüterjans, H.
(2000)
Eur. J. Biochem.
267,
4205-4212[Medline]
[Order article via Infotrieve]
|
| 35.
|
Güntert, P.,
Braun, W.,
and Wüthrich, K.
(1991)
J. Mol. Biol.
217,
517-530[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Wüthrich, K.
(1986)
NMR of Proteins and Nucleic Acids
, Wiley, New York
|
| 37.
|
Reincke, B.,
Pérez, C.,
Pristov ek, P.,
Lücke, C.,
Ludwig, C.,
Löhr, F.,
Rogov, V.,
Ludwig, B.,
and Rüterjans, H.
(2001)
Biochemistry
40,
12312-12320[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Güntert, P.,
Mumenthaler, C.,
and Wüthrich, K.
(1997)
J. Mol. Biol.
273,
283-298[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Wishart, D. S.,
and Sykes, B. D.
(1994)
J. Biomol. NMR
4,
171-181[Medline]
[Order article via Infotrieve]
|
| 40.
|
Laskowski, R. A.,
MacArthur, M. W.,
Moss, D. S.,
and Thornton, J. M.
(1993)
J. Appl. Crystallogr.
26,
283-291[CrossRef]
|
| 41.
|
Kraulis, P. J.
(1991)
J. Appl. Crystallogr.
24,
946-950[CrossRef]
|
| 42.
|
Merritt, E. A.,
and Bacon, D. J.
(1997)
Methods Enzymol.
277,
505-524[Medline]
[Order article via Infotrieve]
|
| 43.
|
Baikalov, I.,
Schröder, I.,
Kaczor-Grzeskowiak, M.,
Grzeskowiak, K.,
Gunsalus, R. P.,
and Dickerson, R. E.
(1996)
Biochemistry
35,
11053-11061[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Ducros, V. M. A.,
Lewis, R. J.,
Verma, C. S.,
Dodson, E. J.,
Leonard, G.,
Turkenburg, J. P.,
Murshudov, G. N.,
Wilkinson, A. J.,
and Brannigan, J. A.
(2001)
J. Mol. Biol.
306,
759-771[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Vannini, A.,
Volpari, C.,
Gargioli, C.,
Muragila, E.,
Cortese, R.,
De Francesco, R.,
Neddermann, P.,
and Di Marco, S.
(2002)
EMBO J.
21,
4393-4401[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Zhang, R. G.,
Pappas, T.,
Brace, J. L.,
Miller, P. C.,
Oulmassov, T.,
Molyneaux, J. M.,
Anderson, J. C.,
Bashkin, J. K.,
Winans, S.,
and Joachimiak, A.
(2002)
Nature
417,
971-974[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
I. de Bruijn and J. M. Raaijmakers
Diversity and Functional Analysis of LuxR-Type Transcriptional Regulators of Cyclic Lipopeptide Biosynthesis in Pseudomonas fluorescens
Appl. Envir. Microbiol.,
July 15, 2009;
75(14):
4753 - 4761.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Carroll, X. Liao, L. K. Morgan, E. M. Cicirelli, Y. Li, W. Sheng, X. Feng, and L. J. Kenney
Structural and Functional Analysis of the C-terminal DNA Binding Domain of the Salmonella typhimurium SPI-2 Response Regulator SsrB
J. Biol. Chem.,
May 1, 2009;
284(18):
12008 - 12019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mittal and L. Kroos
A combination of unusual transcription factors binds cooperatively to control Myxococcus xanthus developmental gene expression
PNAS,
February 10, 2009;
106(6):
1965 - 1970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. M. Pruss, C. Besemann, A. Denton, and A. J. Wolfe
A Complex Transcription Network Controls the Early Stages of Biofilm Development by Escherichia coli
J. Bacteriol.,
June 1, 2006;
188(11):
3731 - 3739.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Mouslim, T. Latifi, and E. A. Groisman
Signal-dependent Requirement for the Co-activator Protein RcsA in Transcription of the RcsB-regulated ugd Gene
J. Biol. Chem.,
December 12, 2003;
278(50):
50588 - 50595.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|