|
Originally published In Press as doi:10.1074/jbc.M300508200 on March 6, 2003
J. Biol. Chem., Vol. 278, Issue 20, 17792-17799, May 16, 2003
Distinct Functional Interactions of Human Skn-1 Isoforms with
Ese-1 during Keratinocyte Terminal Differentiation*
Adriana
Cabral ,
David F.
Fischer §,
Wilbert P.
Vermeij, and
Claude
Backendorf¶
From the Laboratory of Molecular Genetics, Leiden Institute of
Chemistry, Leiden University, P. O. Box 9502, 2300 RA Leiden, The Netherlands
Received for publication, January 16, 2003
 |
ABSTRACT |
Among the three major POU proteins expressed in
human skin, Oct-1, Tst-1/Oct-6, and Skn-1/Oct-11, only the latter
induced SPRR2A, a marker of keratinocyte terminal
differentiation. In this study, we have identified three Skn-1
isoforms, which encode proteins with various N termini, generated by
alternative promoter usage. These isotypes showed distinct expression
patterns in various skin samples, internal squamous epithelia, and
cultured human keratinocytes. Skn-1a and Skn-1d1 bound the
SPRR2A octamer site with comparable affinity and functioned
as transcriptional activators. Skn-1d2 did not affect
SPRR2A expression. Skn-1a, the largest protein,
functionally cooperated with Ese-1/Elf-3, an epithelial-specific transcription factor, previously implicated in SPRR2A
induction. This cooperativity, which depended on an N-terminal
pointed-like domain in Skn-1a, was not found for Skn-1d1. Actually,
Skn-1d1 counteracted the cooperativity between Skn-1a and Ese-1.
Apparently, the human Skn-1 locus encodes multifunctional
protein isotypes, subjected to biochemical cross-talk, which are likely
to play a major role in the fine-tuning of keratinocyte terminal differentiation.
 |
INTRODUCTION |
The epidermis constitutes the interface between the
organism and the environment and provides protection against physical, chemical, and microbial damage. The major epidermal cell type, the
keratinocyte, engages in a tightly regulated process of terminal differentiation, which is essential for the protective barrier of the
skin and is reflected in vivo by the multilayered structure of the epidermis. The innermost layer (stratum basale), connected to
the dermis, comprises undifferentiated keratinocytes with a high
proliferative potential. The cells committed to terminal differentiation migrate outwards into the non-dividing suprabasal layers and undergo distinct morphological and structural changes (for
review, see Ref. 1). The transition from proliferating basal
keratinocytes to terminally differentiated cells is accompanied by a
significant alteration in the gene expression program. The repression
of genes required for cellular growth contrasts with the induction of
genes related to cell death and cornification. Aberrations in this
tightly choreographed process will affect the expression of epidermal
structural proteins, such as those involved in the formation of
cytoskeleton, desmosomes, and cornified cell envelopes. As a matter of
fact many genetic and acquired human dermatoses have been linked to
mutations or aberrant expression of these proteins (2, 3).
Whereas the importance of structural proteins in safeguarding the
integrity of epidermis and internal squamous epithelia is becoming well
understood, little is yet known about the regulatory processes that are
involved. Although ubiquitous transcription factors contribute to
keratinocyte-specific gene expression (4-7), the complex balance
between proliferation, stratification, and cornification is likely to
be coordinated by cell type-specific proteins. Good candidates for such
a function are the POU domain transcription factors, a family of more
than 40 homeodomain-containing proteins involved in cell
differentiation and tissue specification (8, 9). The characteristic POU
domain consists of two conserved regions, a POU-specific domain and a
POU homeodomain, connected by a hypervariable linker region. The entire
POU domain is required for DNA binding. The octamer 5'-ATGCAAAT-3' is
the most frequent target for POU domain proteins (10).
Major POU domain factors in skin are Oct-1, Tst-1/Oct-6, and
Skn-1/Oct-11 (11). The ubiquitous Oct-1 is expressed in both proliferating and differentiating epidermal keratinocytes, whereas Oct-6 and Skn-1 are primarily expressed in suprabasal layers. Skn-1 is
selectively expressed in the epidermis (12-15). In vivo ablation of murine Skn-1 did not reveal a specific function
for this gene, mainly due to redundancy with Oct-6 (12). Recently however, the use of in vitro raft cultures disclosed a
regulatory role of Skn-1 in keratinocyte proliferation and
differentiation (16).
A further degree of regulatory complexity is due to the fact that at
least several POU genes give rise to various isoforms, with specific
functional properties and expression patterns (e.g. Oct-1, Oct-2, Brn-3, and
Pit-1) (8). Also, the rat Skn-1 gene was shown to
generate two functionally distinct transcripts, Skn-1a and
Skn-1i (13). Here we show that the human homologue expresses three isoforms that differentially affected the expression of the
SPRR2A cornified envelope precursor gene, a marker of
keratinocyte terminal differentiation, whose regulation has been
extensively studied (5, 17). This isotype-specific selectivity in
SPRR2A regulation, which varied from activation to
repression, depended on the differential interaction of the Skn-1
isoforms with the epithelium-specific Ets factor Ese-1 (18).
 |
EXPERIMENTAL PROCEDURES |
Screening of a Keratinocyte cDNA Library--
A human
keratinocyte cDNA library constructed in Lambda ZAP II
(Stratagene) (19) was screened with probes from the POU domains of
Oct-1 and Oct-2 (20, 21) at a stringent hybridization temperature. This
yielded among others two independent Skn-1 clones. Plasmid DNA was
isolated by in vivo excision with Exassist M13 helper phage (Stratagene).
5'-Rapid Amplification of cDNA Ends
(RACE)1--
5'-RACE was
performed on poly(A) RNA isolated from cultured normal human
keratinocytes essentially according to a previously described method
(22). Briefly, cDNA synthesized from 1 µg of poly(A) RNA, primed
with a 5'-biotinylated antisense oligonucleotide specific for Skn-1
(5'-biotinGAAACCTCTTCTCCAGAGTCAGGCGG), was purified on
Dynabeads coated with streptavidin (Dynal) and ligated to a
5'-phosphorylated and 3' 3-amino-2-propanol-ether-blocked RACE-anchor
(5'-phosphate-GCGGCCGCGTCGTGACTGGGAAAACCCOCH2CHOHCH2NH2). PCR primed with various reverse Skn-1 primers (1, ACCAAATACTTCACTGAGGCTGGGGTAGGAG; 2, AACCGCCGCAGCCCCACATCTCCCT GT; 3, GAGGAGACCGCTTTGTTGCTGTGGA; positions in GenBankTM
accession number AF133895 are 814, 631, and 394, respectively) and a RACE primer complementary to the anchor
(GGGTTTTCCCAGTCACGACGCGGC) was performed with a 2.5:1 mixture of
Pwo polymerase (Roche Applied Science) and
Taq polymerase (HT Biotechnology Ltd.) for 40 cycles (20 min
at 94 °C, 30 min at 50-60 °C, 2 min at 72 °C). Fragments were
cloned in pBluescript II SK( ) (Stratagene).
Inverse PCR--
Genomic DNA was isolated from either simian
COS-1 cells or mouse 3T3 fibroblasts by proteinase K digestion and
phenol extraction. One µg of DNA was digested with either
BstYI or Sau3AI and ligated with T4 DNA ligase
(Amersham Biosciences). Ligated DNA was used in a PCR reaction with
primers designed to contain restriction sites at the 5' end to
facilitate subsequent cloning (simian sense primer, CGAATTCCCACAGACTGG
GCCGGGACT; mouse sense primer, AGAATTCCCACAGACAGGGCCTGGCCT, derived
from the mouse cDNA sequence (GenBankTM accession
number Z18537); common antisense primer, AGAAAGCTTTGTTGCTGTGGAAAGG).
Semiquantitative RT-PCR and RNA Blotting--
Trizol reagent
(Invitrogen) was used to isolate total epidermal RNA from tissue
obtained either after breast reduction or circumcision. Total RNA (200 ng) was reverse-transcribed with Super-RT (SphaeroQ) and random
hexamers (Amersham Biosciences). Semiquantitative PCR was performed
according to a previously published procedure (23) but using AmpliTaq
Gold (Roche Applied Science). The following isotype-specific Skn-1
primers were used: Skn-1a: sense, CACAGATATCAAGATGAGTG,
antisense, TCTGAGATAGCAGGAACTG; Skn-1d1: sense, GTTGTAGCACATGTGTTTCA,
antisense, GAAACCTCTTCTCCAGAGTCAG; Skn-1d2: sense, TCACCTTAGAGGGAGGAGA,
antisense, CAGCCGGGAGTTGTAGAC. This analysis resulted in products
of 330, 581, and 590 base pairs for Skn-1a, Skn-1d1, and Skn-1d2,
respectively. Other primers were: SPRR2A: sense,
TGGTACCTGAGCATCGATCTGCC, antisense, CCAAATATCCTTATCCTTTCTTGG (23); Ese-1: sense, CTGAGCAAAGAGTACTGGGACTGTC, antisense,
CCATAGTTGGGCCACAGCCTCGGAGC. RT-PCR conditions for GAPDH were
described previously (24). All primers bridged introns, thus allowing a
control for DNA contamination. PCR products for the various Skn-1
isoforms were analyzed on a blot with a probe covering most of the
cDNA (generated with the Skn-1a sense and the Skn-1d2 antisense
primers). Sequence analysis was used to verify the identity of the
various PCR products obtained. SPRR2A RT-PCR products were identified
with an SPRR2 cDNA probe (25). Ese-1 and GAPDH products were
detected by ethidium bromide staining. RNA dot-blots were probed with a
511-bp KpnI/EcoRV fragment (3'-UTR) of Skn-1
(GenBankTM accession number AF133895).
In Situ Hybridization--
Experiments were carried out as
described previously (24). Digoxigenin-labeled (Roche Applied Science)
sense and antisense RNA probes were generated using the 511-bp
KpnI/EcoRV fragment (3'-UTR) of Skn-1 described
above, a 680-bp fragment of SPRR2 (26), and a 475-bp
XhoI/BglII fragment (3'-UTR) of Ese-1
(GenBankTM accession number U73844).
Expression Plasmids--
Protein expression plasmids were
constructed by introducing the Skn-1 coding sequences in the
HindIII and EcoRI sites of the T7 expression
plasmid pT7-2. Plasmids encoding the whole open reading frame were
generated for Skn-1a (pPOU117, from exon 1-13), Skn-1d1 (pPOU123, from codon A in intron 5 to exon 13), and
Skn-1d2 (pPOU121, exon 8-13). For Skn-1d1, 3 mutants were constructed either by site-directed mutagenesis (point
mutations in pPOU124 and pPOU118) or by PCR (pPOU137). Proteins encoded
by these plasmids were synthesized in a coupled in vitro
transcription-translation system (TNT reticulocyte lysate,
Promega) in the presence of [35S]methionine (Amersham
Biosciences). Full-length Ets-2, Ese-1, and
Oct-2 cDNAs were isolated by screening the
above-mentioned human keratinocyte cDNA library either with
Ets-specific (27) or Oct-1/2 POU domain probes. For transfection the
different cDNAs were cloned into the RSV-H20 expression plasmid
(28). Expression plasmids for Oct-1 and Oct-6 were gifts of Dr. W. Herr
(Cold Spring Harbor) and Dr. D. Meijer (Erasmus University
Rotterdam), respectively.
Electrophoretic Mobility Shift Assay--
Electrophoretic
mobility shift assays were performed as described in Fischer et
al. (5). The SPRR2A octamer oligonucleotide (GGATAAATTTGCATCTGGCT) was labeled with T4 polynucleotide kinase, purified by denaturing gel electrophoresis and reverse-phase
chromatography, and subsequently annealed to the unlabeled
complementary strand. In each reaction 2 µl of programmed
reticulocyte lysate and 20 fmol of labeled oligonucleotide duplex were used.
Cell Culture, Transient Transfections, CAT and Luciferase
Assays--
HaCaT cells were grown in DMEM with 10% bovine calf serum
(Hyclone). Confluent cultures were transfected by incubating 5 cm culture dishes for 2 h with 5 µg of reporter plasmid (CAT or
luciferase), 2.0 µg of Rous sarcoma virus expression plasmids
(including compensating amounts of empty Rous sarcoma virus vector),
and 40 µg of
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium salts transfection reagent. Monolayers were washed with
phosphate-buffered saline and incubated for 24 h in culture
medium. CAT assays were performed as described (5). Luciferase activity
was measured with the luciferase assay system (Promega) essentially as
previously described (28). All transfections were performed at least in triplicate.
The SPRR2A minimal promoter-driven CAT plasmid pSG55 has
been previously described (5). Luciferase plasmids were constructed in
pGL3 (Promega) and contained the following SPRR2A promoter inserts, all derived from previously described plasmids (5): pSG350-wt
(minimal promoter), pSG55; pSG390-Ets mutant, pSG212; pSG527-octamer
mutant, pSG185.
 |
RESULTS |
Structural Characterization and Organization of Skn-1
Isoforms--
Searching the human genome data base at NCBI with the
previously described human Skn-1a cDNA
(GenBankTM accession number AF133895) disclosed one
sequence (GenBankTM accession number AP 001150),
encompassing the complete human gene. The 2868-bp cDNA sequence
comprises 13 exons and extends over a 70-kilobase genomic region (Fig.
1A). The characteristic POU
domain is encoded by exons 7-10.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
A, genomic organization of the
human Skn-1 gene. The transcription start sites for Skn-1a, Skn-1d1,
and Skn-1d2 are indicated by arrows. The POU-specific domain
(POU-S) and the POU-homeodomain (POU-HD) of
Skn-1a are represented. Exons are boxed, and introns are
numbered. kb, kilobases. B, part of
human intron 5 is compared with the corresponding sequence from simian,
rat (GenBankTM accession number L23863), and mouse. Simian
and murine sequences were obtained from inverse PCR on Cos-1 and 3T3
cells, respectively ("Experimental Procedures"). An
asterisk indicates the start of the longest 5'-RACE clone
for Skn-1d1. Bases shown in lowercase correspond to intronic
sequences; various initiation and termination codons that are discussed
in "Results," and the 3' splice-site of intron 5 is
highlighted. C, sequence of the longest 5'-RACE
clone for Skn-1d2. Potential initiation and termination codons are
indicated. Intron sequences are shown in lowercase. The
sequence of exon 8 is underlined. The 3' splice site is
represented in bold.
|
|
The screening of a human keratinocyte cDNA library with a POU
domain probe and 5' RACE (see "Experimental Procedures") identified three Skn-1 isoforms, namely the previously described Skn-1a (29) and
two novel variants, Skn-1d1 and Skn-1d2. Comparison with the genomic
sequence revealed that the 5' end of Skn-1d1 and
Skn-1d2 corresponded to sequences in introns 5 and 7, respectively (Fig. 1A). The absence of other introns in
these transcripts confirmed the mRNA origin of both clones.
The human Skn-1d1 transcript is homologous to the
Skn-1i variant of rat (13) and is compared in Fig.
1B with the corresponding simian and rodent sequences. The
translation initiation codon previously identified in the rat (codon 1)
is not present in the human sequence. Both primate genes contain an AUG
codon (codon A), which is in-frame with the Skn-1a coding
sequence. However, this start codon is not likely to be functional
since it is followed by a termination codon UAG (codon B) that is not
present in rodents. A putative low affinity initiation codon CUG for
Skn-1d1 is found at position 85 in the beginning of exon 6 (codon C) (Fig. 1B).
The sequence of the Skn-1d2 transcript, which initiates in
intron 7, revealed 3 intron-encoded AUG codons in-frame with the POU
domain sequence but followed by a termination codon at position 154 (Fig. 1C). Potential start codons for open reading frames are found in exon 8 (codon D and/or codon E).
DNA Binding Activity of the hSkn-1 Variants--
The integrity of
the Skn-1 expression plasmids and their coding potential were verified
by producing proteins in vitro with the TNT reticulocyte
lysate system (Promega) (Fig.
2B). Skn-1a (pPOU-117)
migrated at the predicted molecular mass (47.5 kDa) and bound to the
SPRR2A octamer site (Fig. 2C). The Skn-1d2
isoform (pPOU-121) generated two different products (Fig.
2B). The slow migrating product has an apparent molecular
mass of 25 kDa, which is in accordance with a protein initiating at
codon D in the POU-specific domain (Fig. 1C). The 21.5-kDa
product corresponds to a protein starting at initiation codon E. None
of these Skn-1d2 isoforms is capable of binding to the
SPRR2A octamer site (Fig. 2C), which is likely
due to the partial deletion of the POU-specific domain (Fig.
1A).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 2.
DNA binding activity of in vitro
synthesized Skn-1 isotypes. A, plasmids used for
in vitro transcription-translation. The various mutations in
Skn-1d1 are indicated. Nomenclature of codons A, B, and C is
according to Fig. 1B. B, SDS-PAGE analysis of
in vitro synthesized Skn-1 proteins. Reticulocyte lysates
were programmed with the indicated Skn-1 plasmid or with a
control plasmid (pT7-2, lane 1). Molecular mass markers
(Amersham Biosciences) are indicated in the margin (in kDa). Skn-1d1-
and Skn-1d2-specific products are marked with asterisks.
C, electrophoretic mobility shift assay of Skn-1-programmed
lysates (lanes 1-6) or un-programmed lysate (lane
7) with the SPRR2A octamer site. D, affinity
of Skn-1a or Skn-1d1 for octamer binding; reticulocyte lysate
containing identical amounts of either Skn-1a or Skn-1d1 protein were
incubated with 20 fmol of the 32P-labeled SPRR2A
octamer site and competed with the indicated molar excess of unlabeled
binding site.
|
|
The wild type Skn-1d1 transcript (plasmid pPOU-123) codes
for a major polypeptide of 35 kDa and two minor products of 33 and 31 kDa (Fig. 2B). To investigate translational initiation of
Skn-1d1 proteins more precisely, constructs with mutations in codons A, B, or C (Fig. 1B and 2A) were generated. Fig.
2B shows that translation of the major Skn-1d1 polypeptide
most likely initiates at codon C (a weak CUG initiation codon). Indeed,
pPOU-137, in which this codon was changed into an efficient AUG
initiator, yielded high levels of a product of 35 kDa, identical to the
largest polypeptide from the wild type transcript. This cDNA was
used in transfection experiments. The minor 33- and 31-kDa proteins
were not investigated further.
Electrophoretic mobility shift assays were performed to compare the
binding affinity of Skn-1a (pPOU-117) and Skn-1d1 (pPOU-137) to the
SPRR2A octamer site. Labeled double-stranded
SPRR2A octamer oligonucleotide was incubated with
reticulocyte lysate programmed with either Skn-1a or Skn-1d1. As shown
in Fig. 2D, competition with increasing amounts of unlabeled
binding site revealed that both Skn-1 variants bound the
SPRR2A octamer site with similar affinities.
Transactivation Potential of Skn-1 Isoforms--
In Fig.
3A, the SPRR2A
proximal promoter, fused to the CAT reporter and encompassing all
cis-elements necessary for expression during keratinocyte terminal
differentiation (5), was transiently transfected into HaCaT cells,
which contain low levels of endogenous POU proteins (16). We first
evaluated the transactivation potential of Oct-1, Oct-6/Tst-1, and
Skn-1a, the major POU domain proteins expressed in skin (11), and of
Oct-2, a lymphoid-specific transcription factor (21), also expressed in
cultured human keratinocytes (12).2 Oct-1 and Oct-2 did
not affect base-line expression of SPRR2A, Oct-6 repressed
promoter activity by ~70%, and Skn-1a was the only POU domain
protein tested that mediated gene activation (3-4-fold induction, Fig.
3A).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of various POU proteins on SPRR2A
promoter activity. A, the SPRR2A-CAT reporter construct
(pSG55) was either transfected alone or together with expression
plasmids for Oct-1, Oct-2, Oct-6, and Skn-1a into HaCaT keratinocytes
as described under "Experimental Procedures." CAT activity was
determined 24 h after transfection as previously described (5) and
was related to the basal activity of pSG55. B, increasing
amounts of Skn-1a, Skn-1d1, and Skn-1d2 expression plasmids were
co-transfected with the SPRR2A-luciferase reporter construct (pSG350),
and luciferase activity was determined 24 h later essentially as
previously described (28).
|
|
To investigate the relative contribution of the individual Skn-1
isoforms in the regulation of the SPRR2A gene, the
transactivation potential of the three variants was determined by
transfecting increasing amounts of isotype-specific expression plasmids
into HaCaT cells, programmed with an SPRR2A-luciferase
construct. Both Skn-1a and Skn-1d1 up-regulated the SPRR2A
promoter by 3-4-fold. The saturation kinetics were, however, different
because lower amounts of Skn-1a were needed to reach a plateau,
indicating that Skn-1a can transactivate the SPRR2A promoter
more efficiently than Skn-1d1 (Fig. 3B). Skn-1d2 had no
effect on SPRR2A promoter activity, even at higher doses.
Collectively, these results indicate that among several POU domain
proteins only Skn-1a and Skn-1d1 are able to activate the
SPRR2A promoter in an in vitro transient transfection experiment. Hence, it was important to investigate whether
a similar direct relation existed also in vivo between Skn-1a/d1 and SPRR2A expression.
Correlation between SPRR2A and Skn-1a Expression in
Vivo--
Initially, a panel of 50 different RNA samples from various
human tissues was analyzed with a Skn-1-specific probe
(3'-UTR), which detects all isoforms. Skn-1 expression was
restricted to a few stratified squamous epithelia including epidermis,
cervix, and foreskin (results not shown). To compare the expression
pattern of the three human Skn-1 variants with
SPRR2A expression, semiquantitative RT-PCR with
isotype-specific primer sets was performed on RNA isolated from either
total skin, epidermis, foreskin, cervix, or cultured primary
keratinocytes. RNA from uterus, which does not contain
SPRR2A transcripts (23), was used as a negative control. The
results in Fig. 4A show that
Skn-1a was expressed in all squamous epithelia (lanes
1-6 and 8) and in cultured keratinocytes (lane
7), although at different levels. Expression of Skn-1d1 was more heterogeneous, as it was not detected in the skin and cervix
samples from lanes 1 and 8, respectively.
Relatively high expression levels of Skn-1d1 (already
visible after 25 cycles) were found in the epidermal RNAs from
lanes 2, 3, and 5. Skn-1d2 expression was, in general, similar to the one of Skn-1a.
The absence of Skn-1 transcripts in uterus correlated well
with the absence of SPRR2A expression. However, no clear
correlation was found in the other samples between the expression level
of one of the Skn-1 isotypes and SPRR2A
expression, indicating the involvement of other transcription factors.
Indeed, previous work from our laboratory has shown that expression of
SPRR2A relied on interdependent regulatory promoter
elements, recognized by various classes of transcription factors (5).
Consequently, we have also monitored the expression of the
epithelial-specific Ets factor Ese-1, previously implicated in
SPRR regulation (18, 27). Expression of this gene was found
in all samples, including uterus (although at low levels). The highest
levels were found in the epidermal sample of lane 2, in
cultured keratinocytes (lane 7), and in cervix (lane 8). Again, no strict correlation was found between the levels of
Ese-1 and SPRR2A expression (Fig.
4A).

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 4.
A, semiquantitative RT-PCR analysis of
Skn-1, Ese-1, SPRR2A, and GAPDH expression in various human tissues and
cells. RNA isolated from total skin (lane 1), isolated
epidermis (lanes 2-5), foreskin (lane 6),
cultured primary keratinocytes (lane 7), cervix (lane
8), and uterus (lane 9) were analyzed with
SPRR2A, Ese-1, GAPDH, and
isoform-specific Skn-1 primers. PCR was performed with 25, 30, and 35 cycles, and products were either detected with gene-specific
probes (Skn-1 isoforms and SPRR2A) or by direct
ethidium bromide staining (Ese-1 and GAPDH). For
GAPDH only the 30-cycle product is shown. B,
in situ hybridization performed with digoxigenin-labeled
Skn-1-, SPRR2-, and Ese-1-specific RNA
probes. A foreskin section was analyzed with sense (a,
c, e) and antisense (b, d,
f) probes. Bar, 100 µm.
|
|
To investigate whether Skn-1 and Ese-1 co-localize in vivo,
we monitored the stratum-specific expression of Skn-1,
Ese-1, and SPRR2A in sections of foreskin (Fig.
4B). Whereas Skn-1 (the 3'-UTR probe used detects
all isoforms) was present in most suprabasal layers, Ese-1
expression was confined to the more differentiated layers. Most
importantly, the distribution of both factors overlapped with the
expression of SPRR2A. Because both octamer and Ets binding sites in the promoter are essential for SPRR2A expression
(5), we questioned whether Skn-1 isoforms and Ese-1 had the potential to cooperate in SPRR2A transactivation.
Ese-1 Selectively Cooperates with Skn-1a in the Transactivation of
the SPRR2A Promoter--
HaCat cells were transfected with the
SPRR2A-luciferase reporter construct (PSG350) together with
increasing amounts of the different transcription factors either alone
or in various combinations (Fig. 5). The
total amount of transfected expression plasmid was kept constant by
compensating with the empty vector. Skn-1a, Skn-1d1, and Ese-1 alone
induced the SPRR2A promoter 3-4-fold at saturation. However, cotransfections of Skn-1a and Ese-1 activated the same promoter in a dose-dependent manner up to 8-fold,
suggesting functional cooperativity between these two transcription
factors (Fig. 5A). Such synergy was not found in
combinations of Skn-1d1 with Ese-1 (Fig. 5B) nor with Skn-1a
and Ets-2 (Fig. 5C), another Ets transcription factor
previously implicated in keratinocyte terminal differentiation (30).
Apparently, only Skn-1a can specifically cooperate with Ese-1 in the
activation of the SPRR2A gene.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
Transcription factor cooperativity and
antagonism during SPRR2A gene regulation; cotransfection of
the SPRR2A-luciferase reporter construct (5 µg) with the indicated
total amounts (µg) of expression plasmids for Skn-1a and/or Ese-1
(A), Skn-1d1 and/or Ese-1 (B), and Skn-1a and/or
Ets-2 (C). When more than one transcription factor was
transfected in the same mixture, the plasmids were always added in
equal amounts. The total amount of transfected expression plasmid was
kept constant at 2 µg by compensating with empty vector.
D, cotransfection of the wild type (pSG350) or mutant
(octamer site, pSG527; Ets site, pSG390) SPRR2A promoter
constructs with Skn-1a/Ese-1 and the indicated transcription factor
expression plasmids. Transfection and luciferase measurements were as
described previously (28).
|
|
Fig. 5D shows the effect of Skn-1d1, Skn-1d2, or Ets-2 on
the cooperative activation of the SPRR2A promoter by Skn-1a
and Ese-1. Although neither Skn-1d2 nor Ets-2 was able to affect the cooperativity between Skn-1a and Ese-1, a clear drop in promoter activity was observed when Skn-1d1 was included. Apparently Skn-1d1 is
able to compete with Skn-1a for promoter binding even in the presence
of Ese-1, resulting in a complete abrogation of the synergistic effect.
In the case of Ets-2 the situation is different; Ets-2 can at least
partially down-modulate the activity of Skn-1a in the absence of Ese-1
(Fig. 5C) but not in its presence (Fig. 5D). Furthermore, it is shown that mutations in either Ets (PSG390) or the
octamer binding site (PSG527) resulted in a complete inhibition of
SPRR2A promoter activity, in agreement with our previously published results (5).
Taken together, our results show that although both Skn-1a and Skn-1d1
could transactivate the SPRR2A promoter, only Skn-1a was
able to functionally cooperate with Ese-1, resulting in enhanced transactivation. Skn-1d1 was able to counteract this functional cooperativity.
 |
DISCUSSION |
In this study, we have identified and characterized three isoforms
of the human Skn-1/Oct-11 gene and assessed their
ability to regulate the human SPRR2A gene. The promoter of
this gene has been well characterized in the past, and its activation
during keratinocyte differentiation has been well documented. It
encompasses an octamer binding site, that is recognized by Skn-1 and is
essential for promoter activity together with three other
transcriptional control elements bound by, respectively, the Ets, Irf,
and Klf transcription factor families (5). Among these, only the Ets binding activity has previously been identified as the
epithelial-specific Ets factor, Ese-1 (18). Our previous finding, that
destruction of a single binding site results in a complete loss of
promoter activity, has stressed the importance of signal integration
and transcription factor cooperativity in the regulation of this gene (5). Here, we have used this well documented facet of SPRR2A regulation to analyze the regulatory abilities, including possible synergistic/antagonistic activities, of the three different Skn-1 isoforms that we have identified.
The human Skn-1 gene produces three mRNA species,
encoding proteins with various N termini (Fig.
6A). The two shorter mRNA variants are the result of internal promoter usage and initiate within
introns 5 and 7. The observation that the three transcripts are
differentially expressed in various skin samples and in cultured human
keratinocytes (Fig. 4A) indicates that the
corresponding promoters function independently and are subjected to
selective regulation. Although the Skn-1d1 and Skn-1d2 variants
originate within introns, termination codons prevent the addition of
specific N-terminal ("intron"-encoded) sequences to the proteins.
Consequently, Skn-1d1 and Skn-1d2 can be viewed as N-terminal deletions
of Skn-1a.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
A, schematic representation of the
various Skn1 isoforms identified in this study. The POU-specific domain
(POU-S), the POU-homeodomain (POU-HD), and the
pointed-like domain (PLD) are represented. The amino acid
numbering corresponds to the Skn-1a isoform. B, comparison
of the N-terminal region (amino acids 35-121) of Skn-1a with the
sterile motif/pointed domains of Ets-1 and p73- . Identical and
similar amino acid residues are highlighted in
gray, and the predicted -helices in Skn-1a (3D-PSSM) and
those in the resolved structures of Ets-1 (37) and p73 (38) are
boxed. As a reference -helices in Ets-1 are numbered
H1-H5.
|
|
Skn-1a, which encodes the full-length protein, is identical
to the mRNA previously described by others (29) and is highly homologous to its rat and mouse orthologues (13, 14). Skn-1a transcripts are expressed in all human skin samples analyzed (Fig. 4A). The higher level of expression in epidermal samples
(lanes 2-5) as compared with a total skin preparation
(lane 1) correlates with the epidermal expression of this
gene (Fig. 4B). Our analysis clearly shows that
SPRR2A expression is not strictly linked with either
Skn-1A or Ese-1 expression, but it
clearly correlated with the presence of both factors. For instance, low
levels of Ese-1 in uterus do not induce SPRR2A expression due to the
absence of Skn-1a (Fig. 4A, lane 9). However,
weak expression of Skn-1a can be compensated by the presence of Ese-1
and results in efficient SPRR2A expression in cultured
keratinocytes and cervix (lanes 7-8). These in
vivo expression data are in line with our transient transfection
experiments, which have established cooperativity of Skn-1a and Ese-1
in SPRR2A promoter transactivation (Fig. 5) and corroborate
the previously identified necessity for signal integration in the
regulation of SPRR2A (5).
Skn-1d1 did not have the ability to synergize with Ese-1. Because
Skn-1a and Skn-1d1 exhibited comparable DNA binding activities with the
SPRR2A octamer site, the functional cooperativity between Skn-1a and Ese-1 is likely to be mediated by a specific domain in
Skn-1a, which is not present in Skn-1d1. Hence, the 122-amino acid
N-terminal part of Skn-1a, which is absent in Skn-1d1 (Fig. 6A), was screened for possible structural domains by using
3D-PSSM (31), a fold recognition program at Imperial Cancer Research Fund (London) (www.sbg.bio.ic.ac.uk/3dpssm). This search has
revealed between amino acids 35 and 121 a region with significant
similarity to the canonical sterile motif/pointed domain
(Fig. 6B). This fold, which is found in many different
proteins, including for instance the Ets and p53 transcription factor
families, functions essentially as a protein-protein interaction
interface (32, 33). It might seem tempting to speculate that the
pointed-like domain (PLD) in Skn-1a interacts directly with
the Ese-1 pointed domain. However, such an interaction would not
account for the highly specific cooperativity between Skn-1a and Ese-1
that we have observed. Ets-2 also contains a pointed domain; it has the ability to bind to the SPRR2A Ets site, but it does not
synergize with Skn-1a. Consequently, it seems more likely that the
Skn-1a pointed-like domain contacts a protein domain in Ese-1, which is
specific for this factor.
The human Skn-1d1 mRNA is conserved among rodents and
primates; however, its coding potential has clearly changed during
evolution. Although in primates the region encoded by intron 5 is not
translated (due to in-frame termination codons), it encodes in rat and
mouse an N-terminal 32-amino acid domain (Fig. 6A) that is
responsible for the inhibitory activity of the Skn-1i isoform (13).
Skn-1d1 did also inhibit SPRR2A promoter activity in the
presence of Skn-1a and Ese-1 (Fig. 5D), although it had the
ability to activate the same promoter when present on its own (Fig. 3).
Furthermore, in our in vivo analysis, high
Skn-1d1 expression was inversely related to high
SPRR2A expression. For instance in the epidermal samples of
lanes 2, 3, and 5, where high
expression of Ese-1, Skn-1a, and
Skn-1d1 is monitored, expression of SPRR2A is
clearly lower than in foreskin (lane 6), where high
expression of Skn-1a and Ese-1 contrasts with low
expression of Skn-1d1. Similarly, comparison of lanes
7 and 8 (cultured keratinocytes and cervix) reveals
that similar levels of Skn-1a and Ese-1 lead to
lower expression of SPRR2A in the cultured cells (lane
7) due to the presence of Skn-1d1. The mechanisms by which
hSkn-1d1 and mSkn-1i inhibit gene expression differ, however,
fundamentally. Whereas the mSkn-1i inhibitory domain acts in
cis and inhibits DNA binding (13), the human counterpart has
the same DNA binding affinity as Skn-1a. Due to this property it can
compete with Skn-1a for octamer binding and interfere in this way with
the cooperative activation of SPRR2A by Skn-1a and Ese-1.
The differential effect of Skn-1d1 on SPRR2A expression in
the presence or absence of Skn-1a/Ese-1 is also interesting from a
different point of view. It might actually shed light on several
unexplained findings concerning the relative transactivation potential
of Skn1a and various truncated constructs, including an N-terminal
deletion (29, 34). In these experiments the outcome depended greatly on
the specific promoter that was tested. Although the N-terminal deletion
of Skn-1a induced K10 and HPV1a promoter activity, no discernible
effect was observed on HPV-18, and K14 was inhibited. Our results
suggest that such variable outcomes can be expected and that they are
likely to depend mainly on the specific transcription factor occupancy
of the promoter that is analyzed. This is especially true
for promoters subjected to strict combinatorial gene regulation, such
as SPRR2A (5) and most likely also for the various promoters
mentioned above. Consequently, to be able to fully appreciate the
outcome of transcription factor truncation experiments, a reasonable
knowledge of the regulatory configuration of the promoter that is
analyzed is a prerequisite. A similar complexity has also recently been observed for the profilaggrin promoter and is discussed by the authors
(7).
The human Skn-1d2 isoform codes for two proteins lacking the
first 27 or 53 amino acids of the POU-specific domain, whereas the POU
homeodomain is left intact (Fig. 6A). It has previously been
shown that both subdomains are required for DNA binding (35). This
probably explains why Skn-1d2 neither bound to the SPRR2A octamer site nor affected promoter activity. However, Skn-1d2 was
widely expressed, with transcripts detected in all skin samples analyzed. This feature suggests that Skn-1d2 might have a physiological role, which does not depend on DNA binding. Indeed, POU domain proteins
have been shown to regulate transcription also through protein-protein
contacts, in a DNA binding-independent manner. These interactions are
often mediated by the POU-specific, the POU-homeodomain, or both
domains and target other transcription factors, co-regulators, basal
factors, and chromatin components (for a recent review, see Ref. 36).
For instance, down-regulation of keratin 14 is mediated by the POU
domain of either Skn-1a or Oct-6 and does not involve DNA binding to
the K14 promoter (34). In the case of Oct-1, several
protein-protein interactions are mediated solely via the POU
homeodomain (36). Consequently, it is possible that the
Skn-1d2-encoded proteins, which still have intact POU
homeodomains, have the ability to affect gene expression by similar
protein-protein interactions. More experiments will be needed to
unravel a possible regulatory function of the Skn-1d2 isoforms.
Our work describes for the first time a functional interaction between
the Skn-1a and Ese-1 transcription factors. The differential cross-talk
of Skn-1a and Skn-1d1 with Ese-1 highlights the complexity of
combinatorial gene regulation during keratinocyte terminal differentiation. The strict dosage of Skn-1 isoforms is likely to
guarantee both the fine-tuning of the process of epidermal maturation
and its adaptation to external and environmental hazards.
 |
ACKNOWLEDGEMENTS |
We thank Dr. J. Hemelaar and Dr. S. Gibbs for contributions during early stages of this work. Dr. N. Fusenig is acknowledged for providing the HaCaT cell line and Dr. W. Herr and Dr. D. Meijer for providing plasmids.
 |
FOOTNOTES |
*
This work was supported by the J. A. Cohen Institute
(Leiden) and by European Community Grant BMH4-CT96-0319.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this work.
§
Present address: Netherlands Institute for Brain Research,
Meibergdreef 33, 1105 AZ Amsterdam, The Netherlands.
¶
To whom correspondence should be addressed: Laboratory of
Molecular Genetics, Gorlaeus Laboratories, P. O. Box 9502, 2300 RA
Leiden, The Netherlands. Tel.: 31-71-527-4409; Fax: 31-71-527-4537; E-mail: backendo@chem.leidenuniv.nl.
Published, JBC Papers in Press, March 6, 2003, DOI 10.1074/jbc.M300508200
2
A. Cabral, D. F. Fischer, W. P. Vermeij, and C. Backendorf, unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
RACE, rapid
amplification of cDNA ends;
RT, reverse transcription;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
UTR, untranslated
region;
CAT, chloramphenicol acetyltransferase.
 |
REFERENCES |
| 1.
|
Holbrook, K. A.
(1994)
in
The Keratinocyte Handbook
(Leigh, M.
, Lane, E. B.
, and Watt, F. M., eds)
, pp. 3-42, Cambridge University Press, Cambridge, UK
|
| 2.
|
Presland, R. B.,
and Dale, B. A.
(2000)
Crit. Rev. Oral Biol. Med.
11,
383-408[Abstract/Free Full Text]
|
| 3.
|
De Heller-Milev, M.,
Huber, M.,
Panizzon, R.,
and Hohl, D.
(2000)
Br. J. Dermatol.
143,
733-740[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Fuchs, E.
(1990)
J. Cell Biol.
111,
2807-2814[Free Full Text]
|
| 5.
|
Fischer, D. F.,
Gibbs, S.,
van De Putte, P.,
and Backendorf, C.
(1996)
Mol. Cell. Biol.
16,
5365-5374[Abstract]
|
| 6.
|
Eckert, R. L.,
Crish, J. F.,
Banks, E. B.,
and Welter, J. F.
(1997)
J. Invest. Dermatol
109,
501-509[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Jang, S. I.,
Karaman-Jurukovska, N.,
Morasso, M. I.,
Steinert, P. M.,
and Markova, N. G.
(2000)
J. Biol. Chem.
275,
15295-15304[Abstract/Free Full Text]
|
| 8.
|
Ryan, A. K.,
and Rosenfeld, M. G.
(1997)
Genes Dev.
11,
1207-1225[Free Full Text]
|
| 9.
|
Wegner, M.,
Drolet, D. W.,
and Rosenfeld, M. G.
(1993)
Curr. Opin. Cell Biol.
5,
488-498[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Wegner, M.,
Drolet, D. W.,
and Rosenfeld, M. G.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
4743-4747[Abstract/Free Full Text]
|
| 11.
|
Andersen, B.,
Hariri, A.,
Pittelkow, M. R.,
and Rosenfeld, M. G.
(1997)
J. Biol. Chem.
272,
15905-15913[Abstract/Free Full Text]
|
| 12.
|
Andersen, B.,
Weinberg, W. C.,
Rennekampff, O.,
McEvilly, R. J.,
Bermingham, J. R., Jr.,
Hooshmand, F.,
Vasilyev, V.,
Hansbrough, J. F.,
Pittelkow, M. R.,
Yuspa, S. H.,
and Rosenfeld, M. G.
(1997)
Genes Dev.
11,
1873-1884[Abstract/Free Full Text]
|
| 13.
|
Andersen, B.,
Schonemann, M. D.,
Flynn, S. E.,
Pearse, R. V., 2nd,
Singh, H.,
and Rosenfeld, M. G.
(1993)
Science
260,
78-82[Abstract/Free Full Text]
|
| 14.
|
Goldsborough, A. S.,
Healy, L. E.,
Copeland, N. G.,
Gilbert, D. J.,
Jenkins, N. A.,
Willison, K. R.,
and Ashworth, A.
(1993)
Nucleic Acids Res.
21,
127-134[Abstract/Free Full Text]
|
| 15.
|
Yukawa, K.,
Butz, K.,
Yasui, T.,
Kikutani, H.,
and Hoppe-Seyler, F.
(1996)
J. Virol.
70,
10-16[Abstract]
|
| 16.
|
Hildesheim, J.,
Kuhn, U.,
Yee, C. L.,
Foster, R. A.,
Yancey, K. B.,
and Vogel, J. C.
(2001)
J. Cell Sci.
114,
1913-1923[Abstract]
|
| 17.
|
Lohman, F. P.,
Gibbs, S.,
Fischer, D. F.,
Borgstein, A. M.,
van de Putte, P.,
and Backendorf, C.
(1997)
Oncogene
14,
1623-1627[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Oettgen, P.,
Alani, R. M.,
Barcinski, M. A.,
Brown, L.,
Akbarali, Y.,
Boltax, J.,
Kunsch, C.,
Munger, K.,
and Libermann, T. A.
(1997)
Mol. Cell. Biol.
17,
4419-4433[Abstract]
|
| 19.
|
Marenholz, I.,
Zirra, M.,
Fischer, D. F.,
Backendorf, C.,
Ziegler, A.,
and Mischke, D.
(2001)
Genome Res.
11,
341-355[Abstract/Free Full Text]
|
| 20.
|
Sturm, R. A.,
Das, G.,
and Herr, W.
(1988)
Genes Dev.
2,
1582-1599[Abstract/Free Full Text]
|
| 21.
|
Clerc, R. G.,
Corcoran, L. M.,
LeBowitz, J. H.,
Baltimore, D.,
and Sharp, P. A.
(1988)
Genes Dev.
2,
1570-1581[Abstract/Free Full Text]
|
| 22.
|
Edwards, J. B.,
Delort, J.,
and Mallet, J.
(1991)
Nucleic Acids Res.
19,
5227-5232[Abstract/Free Full Text]
|
| 23.
|
Cabral, A.,
Voskamp, P.,
Cleton-Jansen, A. M.,
South, A.,
Nizetic, D.,
and Backendorf, C.
(2001)
J. Biol. Chem.
276,
19231-19237[Abstract/Free Full Text]
|
| 24.
|
Cabral, A.,
Sayin, A.,
de Winter, S.,
Fischer, D. F.,
Pavel, S.,
and Backendorf, C.
(2001)
J. Cell Sci.
114,
3837-3843[Abstract/Free Full Text]
|
| 25.
|
Gibbs, S.,
Fijneman, R.,
Wiegant, J.,
van Kessel, A. G.,
van De Putte, P.,
and Backendorf, C.
(1993)
Genomics
16,
630-637[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Hohl, D.,
de Viragh, P. A.,
Amiguet-Barras, F.,
Gibbs, S.,
Backendorf, C.,
and Huber, M.
(1995)
J. Invest. Dermatol.
104,
902-909[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Sark, M. W.,
Fischer, D. F.,
de Meijer, E.,
van de Putte, P.,
and Backendorf, C.
(1998)
J. Biol. Chem.
273,
24683-24692[Abstract/Free Full Text]
|
| 28.
|
Sark, M. W.,
Borgstein, A. M.,
Medema, J. P.,
van de Putte, P.,
and Backendorf, C.
(1999)
Exp. Cell Res.
250,
475-484[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Hildesheim, J.,
Foster, R. A.,
Chamberlin, M. E.,
and Vogel, J. C.
(1999)
J. Biol. Chem.
274,
26399-26406[Abstract/Free Full Text]
|
| 30.
|
Lee, J. H.,
Jang, S. I.,
Yang, J. M.,
Markova, N. G.,
and Steinert, P. M.
(1996)
J. Biol. Chem.
271,
4561-4568[Abstract/Free Full Text]
|
| 31.
|
Kelley, L. A.,
MacCallum, R. M.,
and Sternberg, M. J.
(2000)
J. Mol. Biol.
299,
499-520[Medline]
[Order article via Infotrieve]
|
| 32.
|
Li, R.,
Pei, H.,
and Watson, D. K.
(2000)
Oncogene
19,
6514-6523[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Arrowsmith, C. H.
(1999)
Cell Death Differ.
6,
1169-1173[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Sugihara, T. M.,
Kudryavtseva, E. I.,
Kumar, V.,
Horridge, J. J.,
and Andersen, B.
(2001)
J. Biol. Chem.
276,
33036-33044[Abstract/Free Full Text]
|
| 35.
|
Klemm, J. D.,
Rould, M. A.,
Aurora, R.,
Herr, W.,
and Pabo, C. O.
(1994)
Cell
77,
21-32[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Andersen, B.,
and Rosenfeld, M. G.
(2001)
Endocr. Rev.
22,
2-35[Abstract/Free Full Text]
|
| 37.
|
Slupsky, C. M.,
Gentile, L. N.,
Donaldson, L. W.,
Mackereth, C. D.,
Seidel, J. J.,
Graves, B. J.,
and McIntosh, L. P.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
12129-12134[Abstract/Free Full Text]
|
| 38.
|
Wang, W. K.,
Bycroft, M.,
Foster, N. W.,
Buckle, A. M.,
Fersht, A. R.,
and Chen, Y. W.
(2001)
Acta Crystallogr. D Biol. Crystallogr.
57,
545-551[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
G. L. Sen, D. E. Webster, D. I. Barragan, H. Y. Chang, and P. A. Khavari
Control of differentiation in a self-renewing mammalian tissue by the histone demethylase JMJD3
Genes & Dev.,
July 15, 2008;
22(14):
1865 - 1870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Davis, D. Davis, B. Norman, and J. Piatigorsky
Gene Expression of the Mouse Corneal Crystallin Aldh3a1: Activation by Pax6, Oct1, and p300
Invest. Ophthalmol. Vis. Sci.,
May 1, 2008;
49(5):
1814 - 1826.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Lei, R. J. Jaramillo, and K. S. Harrod
Transactivation of lung lysozyme expression by Ets family member ESE-1
Am J Physiol Lung Cell Mol Physiol,
November 1, 2007;
293(5):
L1359 - L1368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Manavathi, S. K. Rayala, and R. Kumar
Phosphorylation-dependent Regulation of Stability and Transforming Potential of ETS Transcriptional Factor ESE-1 by p21-activated Kinase 1
J. Biol. Chem.,
July 6, 2007;
282(27):
19820 - 19830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Kopp, P. J. Wilder, M. Desler, L. Kinarsky, and A. Rizzino
Different Domains of the Transcription Factor ELF3 Are Required in a Promoter-specific Manner and Multiple Domains Control Its Binding to DNA
J. Biol. Chem.,
February 2, 2007;
282(5):
3027 - 3041.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Prescott, K. S. N. Koto, M. Singh, and A. Gutierrez-Hartmann
The ETS Transcription Factor ESE-1 Transforms MCF-12A Human Mammary Epithelial Cells via a Novel Cytoplasmic Mechanism
Mol. Cell. Biol.,
June 15, 2004;
24(12):
5548 - 5564.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|