JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M301983200 on March 14, 2003

J. Biol. Chem., Vol. 278, Issue 20, 18117-18123, May 16, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/20/18117    most recent
M301983200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, J.
Right arrow Articles by Woodard, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, J.
Right arrow Articles by Woodard, R. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Escherichia coli YrbI Is 3-Deoxy-D-manno-octulosonate 8-Phosphate Phosphatase*

Jing Wu and Ronald W. WoodardDagger

From the Department of Medicinal Chemistry and Department of Chemistry, University of Michigan, Ann Arbor, Michigan 48109-1065

Received for publication, February 25, 2003, and in revised form, March 14, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

3-Deoxy-D-manno-octulosonate 8-phosphate (KDO 8-P) phosphatase, which catalyzes the hydrolysis of KDO 8-P to KDO and inorganic phosphate, is the last enzyme in the KDO biosynthetic pathway for which the gene has not been identified. Wild-type KDO 8-P phosphatase was purified from Escherichia coli B, and the N-terminal amino acid sequence matched a hypothetical protein encoded by the E. coli open reading frame, yrbI. The yrbI gene, which encodes for a protein of 188 amino acids, was cloned, and the gene product was overexpressed in E. coli. The recombinant enzyme is a tetramer and requires a divalent metal cofactor for activity. Optimal enzymatic activity is observed at pH 5.5. The enzyme is highly specific for KDO 8-P with an apparent Km of 75 µM and a kcat of 175 s-1 in the presence of 1 mM Mg2+. Amino acid sequence analysis indicates that KDO 8-P phosphatase is a member of the haloacid dehalogenase hydrolase superfamily.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

3-Deoxy-D-manno-octulosonate (KDO)1 is an 8-carbon sugar that links the lipid A and polysaccharide moieties of the lipopolysaccharide region in Gram-negative bacteria (1, 2). It has been demonstrated that an interruption in the biosynthesis of KDO leads to the accumulation of lipid A precursors and subsequent arrest in cell growth (3-5). Thus, enzymes involved in KDO biosynthesis and/or its incorporation into lipid A are considered attractive targets for the design of novel antibiotics.

The biosynthesis and utilization of KDO involves five sequential enzymatic reactions that are catalyzed by D-arabinose 5-phosphate isomerase, 3-deoxy-D-manno-octulosonate 8-phosphate (KDO 8-P) synthase, KDO 8-P phosphatase, cytidine 5'-monophosphate-KDO synthetase, and KDO transferase (Fig. 1) (2). During the past two decades, the genes responsible for the expression of KDO 8-P synthase (6-9), cytidine 5'-monophosphate-KDO synthetase (10-12), and KDO transferase (13, 14) have been identified, and their respective enzymes have been studied extensively. More recently, the gene encoding the D-arabinose 5-phosphate isomerase (KpsF) from Neisseria meningitides was identified by Tzeng et al. (15). KDO 8-P phosphatase, therefore, remains the last enzyme in the lipid A-KDO pathway for which a gene has not been assigned.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1.   The biosynthesis of lipid A-KDO. The enzymes that catalyze these reactions are: (1), D-arabinose 5-phosphate isomerase (KpsF); (2), KDO 8-P synthase (KdsA); (3), KDO 8-P phosphatase; (4), cytidine 5'-monophosphate-KDO synthetase (KdsB); and (5), KDO transferase (WaaA).

KDO 8-P phosphatase catalyzes the hydrolysis of KDO 8-P to KDO and inorganic phosphate. Gahlambor and Heath (16) first suggested the existence of a phosphatase for KDO 8-P in 1966. In 1975, Berger and Hammerschmid (17) reported the isolation of a specific phosphatase fraction from a DEAE-cellulose column that would hydrolyze KDO 8-P but not D-arabinose 5-phosphate or p-nitrophenylphosphate. Ray and Benedict (18) first purified and characterized the KDO 8-P phosphatase from Escherichia coli in 1980 but did not identify the encoding gene.

In the present work, for the first time, the gene for KDO 8-P phosphatase is identified and cloned into an overexpression vector. A wild-type phosphatase that specifically hydrolyzes KDO 8-P to KDO and inorganic phosphate was isolated and N-terminally sequenced. A BLAST search of the E. coli K12 genome data base at the National Center for Biotechnology Information web site with this N-terminal sequence revealed a hypothetical protein encoded by the open reading frame (orf) yrbI. The yrbI gene was cloned, and the gene product was overexpressed in E. coli. The recombinant protein was purified to homogeneity, and its characteristics were consistent with those properties reported for the wild-type KDO 8-P phosphatase.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- The E. coli B cells, grown in glucose minimal medium supplemented with inorganic phosphate, were purchased from Grain Processing Inc. (Muscatine, IA) as a frozen cell paste and stored at -80 °C. Genomic E. coli BL21 DNA was a generous gift from Dr. George A. Garcia (University of Michigan). The Promega Wizard DNA purification kit was utilized for plasmid isolation and purification. E. coli XL1-Blue chemically competent cells were obtained from Stratagene Cloning System. E. coli BL21(DE3) chemically competent cells were obtained from Novagen. The pCR®T7 TOPO®TA expression kit was purchased from Invitrogen. Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs. Thermal cycling was performed using a MJ Research PTC-200 Peltier Thermal Cycler. DNA sequencing, N-terminal amino acid sequencing, two-dimensional gel electrophoresis, and DNA primer syntheses were performed by the University of Michigan Biomedical Resources Core Facility. Tris and HEPES were purchased from Research Organics. Glycylglycine, phosphoenolpyruvate mono(cyclohexylammonium) salt, p-nitrophenylphosphate di(cyclohexylammonium) salt, D-ribose 5-phosphate disodium salt, D-arabinose 5-phosphate disodium salt, D-glucose 6-phosphate monosodium salt, D-mannose 6-phosphate monosodium salt, reagent grade CuCl2, CaCl2, ultra pure Trizma base, and Q-Sepharose resin were purchased from Sigma. The puratronic grade MgCl2, CoCl2, MnCl2, CdCl2, ZnSO4, and HCl (99.999%, metal basis) were purchased from Alfa Aesar. EDTA disodium salt and mercuric acetate were obtained from Mallinckrodt. The Mes was obtained from the United States Biochemical Corporation. High grade Spectra/Por® 7 dialysis tubing (10,000 molecular weight cut-off and metal-free) was obtained from VWR Scientific. The Centriprep YM-10 Concentrators were purchased from Millipore. AG-MPI and P2 resin were purchased from Bio-Rad. Mono Q (HR 5/5), phenyl Superose (HR 10/10), and Superose 12 (HR 10/30) chromatography columns were purchased from Amersham Biosciences.

KDO 8-P Phosphatase Activity Assay-- The KDO 8-P phosphatase activity was determined by either a discontinuous colorimetric assay or a continuous spectrophotometric assay. One unit of enzyme activity is defined as the production of 1 µmol of inorganic phosphate/min at 37 °C.

The standard discontinuous colorimetric assay was measured in a 50-µl reaction mixture containing 1 mM KDO 8-P, 1 mM Mg2+, and 100 mM HEPES (pH 7.0) at 37 °C. The reaction was initiated by the addition of enzyme and quenched by the addition of 50 µl of 10% (w/v) ice-cold trichloroacetic acid. The amount of inorganic phosphate produced was quantitated by the malachite green assay (19) using KH2PO4 as the standard.

The continuous spectrophotometric assay was based on the purine nucleoside phosphorylase (PNPase)-coupled phosphate assay first reported by Webb (20) and later modified by Rieger and co-workers (21). The assay was performed in a 70-µl reaction mixture containing 1 mM KDO 8-P, 1 mM Mg2+, 100 mM HEPES (pH 7.0), 200 µM 7-methylinosine, 2 µM recombinant bacterial PNPase, and 2 nM KDO 8-P phosphatase. The reaction mixture, including PNPase but excluding KDO 8-P phosphatase, was incubated at 37 °C for 5 min to allow the PNPase coupling system to remove any inorganic phosphate potentially present as a contaminant in the substrates. The reaction was initiated by the addition of KDO 8-P phosphatase. In the coupled assays, the concentration of KDO 8-P phosphatase and PNPase was adjusted to ensure that the phosphatase activity was rate-limiting.

Enzymatic Synthesis of KDO 8-P-- KDO 8-P was synthesized enzymatically (22) using KDO 8-P synthase purified as previously described (23). The E. coli KDO 8-P synthase (4 mg) was incubated with phosphoenolpyruvate mono(cyclohexylammonium) salt (24 mg) and D-arabinose 5-phosphate disodium salt (26 mg) in 100 mM Tris-HCl (pH 7.5) in a final volume of 4 ml at 37 °C for 2 h. The reaction mixture was quenched by the addition of 0.45 ml 50% (w/v) trichloroacetic acid and centrifuged to remove precipitated protein. The pH of the supernatant was adjusted to 7.0 by 1 N sodium hydroxide. The resulting solution was loaded onto an AG-MPI anion exchange column (chloride form, 2.5 × 30 cm) pre-equilibrated with water. The column was first washed with 100 ml of water at a flow rate of 1 ml/min and then eluted with a linear gradient of 0 to 0.4 M potassium chloride (60 min at 1 ml/min). The fractions containing KDO 8-P were pooled and lyophilized. The lyophilizate was dissolved in 2 ml of water and then desalted on a P2 column (2.0 × 60 cm) using water as the eluent.

Isolation and Purification of Wild-type KDO 8-P Phosphatase from E. coli B-- KDO 8-P phosphatase was isolated and purified from E. coli B using a modification of the protocol originally described by Ray and Benedict (18). The frozen E. coli B cells (46 g) were thawed at 23 °C in 100 mM Tris-HCl (pH 7.4) in a final volume of 60 ml. The cell suspension was subjected to sonication at 4 °C (ice water bath, 45-s pulses with a 2-min rest between pulses, four times), and the unbroken cells and cell debris were removed by centrifugation (40,000 × g, 30 min, 4 °C). The supernatant was saved. The pellet was suspended in 50 ml of 100 mM Tris-HCl (pH 7.4), sonicated, and centrifuged as above. The two supernatants were combined. To remove nucleic acids, a 2.2% (w/v) protamine sulfate solution (pH 7.0) was slowly added at 4 °C with gentle stirring to the supernatant to yield a final concentration of 0.267% (w/v) protamine sulfate. After continuous stirring for 15 min at 4 °C, the precipitated material was removed by centrifugation (40,000 × g, 30 min, 4 °C).

The pH of the above supernatant was adjusted to 5.2 (pH measured at 4 °C) by dropwise addition of cold 1 N acetic acid. After continuously stirring the solution for 10 min at 4 °C, the precipitated protein was removed by centrifugation (29,000 × g, 20 min, 4 °C), and solid (NH4)2SO4 was then slowly added to the supernatant. The protein fraction precipitating between 10 and 34% (w/v) (NH4)2SO4 was collected by centrifugation (29,000 × g, 30 min, 4 °C) and dissolved in buffer A (20 mM Tris-HCl, pH 7.4). The sample was dialyzed against two liters of the same buffer overnight, and the resulting protein solution was applied to a Q-Sepharose column (1.2 × 21 cm) pre-equilibrated with buffer A. The column was eluted at a flow rate of 2.0 ml/min using a linear gradient of 0-0.5 M potassium chloride in buffer A over a 60-min period. The fractions containing KDO 8-P phosphatase activity were pooled.

Solid (NH4)2SO4 was slowly added to the pooled fractions to a final concentration of 20% (w/v). The sample was filtered (0.22 µm) and loaded onto a Phenyl Superose column (HR 10/10) pre-equilibrated with 20% (NH4)2SO4 in buffer A. A reverse gradient from 20 to 0% (NH4)2SO4 in buffer A was applied at a flow rate of 1.0 ml/min over a 60-min period. The fractions containing KDO 8-P phosphatase activity were pooled, dialyzed against 1 liter of buffer A overnight, and applied to a Mono Q (HR 5/5) column pre-equilibrated with buffer A. The column was eluted at a flow rate of 0.5 ml/min using a linear gradient of 0-0.3 M potassium chloride in buffer A over 30 min. The fractions containing KDO 8-P phosphatase activity were pooled and dialyzed against 500 ml of buffer A overnight. The final preparation was concentrated by ultrafiltration to 0.6 mg/ml (Centriprep YM-10 concentrator), and the resulting solution was stored at -80 °C. The purification process of wild-type KDO 8-P phosphatase is summarized in Table I.

Two-dimensional Gel Electrophoresis and N-terminal Amino Acid Sequencing-- The two-dimensional gel electrophoresis and N-terminal amino acid sequencing was performed by the University of Michigan Biomedical Resources Core Facility. The wild-type phosphatase preparation was subjected to electrophoresis in the first dimension on a 7-cm immobilized pH gradient strip (pH 3-10) using the Amersham Biosciences Multiphor II system. In the second dimension, SDS-PAGE was carried out on a NuPAGE Novex 4-12% Bis-Tris ZOOM Gel (Invitrogen) using the Invitrogen Xcell Surelock Mini-Cell system. The gel was electroblotted onto a polyvinylidene difluoride membrane (Applied Biosystems Mini ProBlott membrane) using the Bio-Rad Transblot Semi-Dry blotter system. The blotted protein was visualized by Coomassie Blue R-250. The N-terminal sequencing of the blotted proteins were performed on a Procise Protein Sequencing System.

Sequence Analysis-- Data base searching was performed using the BLAST program (24) at the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov/BLAST). Multiple sequence alignments were performed using the program ClustalW (www.ebi.ac.uk/clustalw) (25).

Cloning, Overexpression, and Purification of KDO 8-P Phosphatase-- The yrbI gene (gi:16131088) was amplified from E. coli BL21 genomic DNA by standard polymerase chain reaction methodologies using Taq DNA polymerase as recommended by the manufacturer. The forward primer was CATATGAGCAAAGCAGGTGCGTCGC, and the reverse primer was GATTCTGAATTCGGATCCTCAATTCACCTTCACCCCC. The amplification product was isolated and ligated directly into the vector pCR®T7/CT-TOPO®. The ligation mixture was used to transform chemically competent E. coli TOP10F' cells. Plasmid DNA isolated from several transformants and identified by restriction analysis to contain the PCR product were subjected to DNA sequencing to confirm the sequence of the desired gene. One plasmid with the correct sequence, pT7CT-yrbI, was digested with the restriction endonucleases NdeI and BamHI (underlined above). The restriction-digested product was ligated into the similarly restriction-digested expression vector, pT7-7, which had been treated with calf intestinal alkaline phosphatase. The ligation mixture was used to transform chemically competent E. coli XL1-Blue cells. The plasmid (pT7-yrbI) isolated from these transformants was first sequenced and then used to transform chemically competent E. coli BL21(DE3) cells.

The E. coli BL21(DE3) cells harboring the pT7-yrbI were grown in 2× YT medium containing ampicillin (100 mg/liter) at 37 °C with shaking (220 rpm). Isopropyl-beta -D-thiogalactoside was added to a final concentration of 0.4 mM when the culture reached an A600 of 1.5. The cells were harvested by centrifugation (29,000 × g, 20 min, 4 °C) 4 h post-induction. The pellet was suspended in buffer A (20 mM Tris-HCl, pH 7.5) and subjected to sonication at 4 °C (ice water bath, 30-s pulses with a 2-min rest between pulses, five times). The crude extract was centrifuged to remove cell debris (40,000 × g, 30 min, 4 °C).

The pH of the above supernatant (90 ml; 1880 mg of total protein from a 1.0-liter culture) was adjusted to 5.0 by slowly adding cold 1.0 N acetic acid, and the solution was stirred for another 10 min at 4 °C and centrifuged to remove the precipitated protein (29,000 × g, 20 min, 4 °C). The supernatant (80 ml; 480 mg total protein) was dialyzed against two liters of buffer A overnight and applied to a Q-Sepharose column (1.2 × 21 cm) pre-equilibrated with buffer A. The column was eluted at a flow rate of 2.0 ml/min using a linear gradient from 0 to 0.5 M potassium chloride in the same buffer over 70 min. After the fractions containing KDO 8-P phosphatase activity were pooled (37 ml; 230 mg of total protein), they were dialyzed against two liters of 10 mM HEPES buffer (pH 7.0) overnight. The final preparation was homogeneous as determined by SDS-PAGE. The total yield of homogeneous protein was 220 mg/liter of cell culture. The purified enzyme (6 mg/ml) was aliquoted, frozen in ethanol-dry ice, and stored at -80 °C.

Molecular Weight (MW) Determinations-- The subunit MW of KDO 8-P phosphatase was determined by electrospray ionization mass spectrometry utilizing a Finnigan LCQ mass spectrometer. The native MW of KDO 8-P phosphatase was determined by gel filtration utilizing a Superose 12 column (HR10/30) according to the manufacturer's instructions (Sigma). The elution volume was determined in triplicate for all samples and standards.

Kinetic Studies-- The reactions were carried out at 37 °C using the continuous spectrophotometric assay protocol as described above. Initial rates were determined in triplicate using the linear region (~30 s) of the reaction progress curve for six concentrations of KDO 8-P (between 0.1 and 10 × Km). The values for Km and kcat were determined by fitting the reaction rate versus the substrate concentration to the Michaelis-Menten equation using KaleidaGraph software.

Metal Requirements-- Recombinant KDO 8-P phosphatase was treated with EDTA to remove bound metal ions. The enzyme as isolated (6 mg/ml) was treated with 10 mM EDTA in 20 mM Tris-HCl (pH 7.0) for 2 h at 25 °C and dialyzed against 1 liter of metal-free 20 mM Tris-HCl (pH 7.0) for 24 h at 4 °C with two buffer changes. The metal-free Tris-HCl buffer was prepared directly using metal-free water (PURELAB plus system), ultra pure Trizma base, and metal-free HCl. The divalent metals (1 mM, prepared in metal-free water) were added to the assay mixture to assess their effects on EDTA-treated (apo) KDO 8-P phosphatase activity.

pH Dependence of KDO 8-P Phosphatase-- The enzymatic activity was measured between pH 4.0 and 9.0 at 37 °C by the discontinuous assay described above using sodium acetate (pH 4.0-5.0), Mes (pH 5.5-6.5), HEPES (pH 7.0-8.0), or glycylglycine (pH 8.5-9.0) at a concentration of 100 mM each. The pH of each reaction mixture was measured at 23 °C.

Electrophoresis-- SDS-PAGE was performed under reducing conditions on a 12% polyacrylamide gel with a Mini-PROTEAN II electrophoresis unit (Bio-Rad). The gel was visualized with 0.25% Coomassie Brilliant Blue R-250 stain. Isoelectric focusing of protein, under native state, was performed on a 5.5% (w/v) polyacrylamide gel containing Carrier Ampholytes pH 3-10 (Bio-Rad) with a model 111 mini Isoelectric Focusing cell according to the manufacturer's instructions (Bio-Rad).

Miscellaneous Methods-- Protein concentrations were determined using the Bio-Rad protein assay reagent with bovine serum albumin (Sigma) serving as the standard. Optical spectroscopy was performed using a HP 8453 UV-visible spectrophotometer.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Purification of Wild-type KDO 8-P Phosphatase from E. coli B-- A specific KDO 8-P phosphatase was purified from E. coli B cells grown in glucose minimal medium containing phosphate by monitoring the enzymatic hydrolysis of the phosphate group of KDO 8-P. The purification included ammonium sulfate fractionation as well as a combination of chromatographic separations utilizing Q-Sepharose, phenyl Superose, and finally Mono Q chromatography. The purified wild-type enzyme preparation, which was purified ~850-fold (Table I), exhibited a specific activity of 34 units/mg in the presence of 1 mM Mg2+ (16 units/mg in the absence of added Mg2+). Under the discontinuous colorimetric assay conditions, neither D-ribose 5-phosphate nor D-glucose 6-phosphate served as a substrate. Thus, the substrate specificity and magnesium requirements of the present wild-type enzyme are identical to those originally reported by Ray and Benedict (18) for their wild-type KDO 8-P phosphatase. The examination of the "purified" wild-type KDO 8-P phosphatase from the present study by two-dimensional gel electrophoresis revealed three protein spots that were further analyzed by N-terminal amino acid sequencing (Fig. 2). Utilizing these N-terminal sequences, the E. coli K12 genome data base at the National Center for Biotechnology Information web site was searched using the "search for short nearly exact matches" search algorithm. Based on these analyses, spot 1 was identified as 2-ketogluconate reductase (MWobs = 39 kDa, MWcal = 35,396), spot 2 as fructose-bisphosphate aldolase (MWobs = 42 kDa, MWcal = 39,147, excluding the initial methionine), and spot 3 as YrbI (MWobs = 52 kDa, MWcal = 19,866, excluding the initial methionine), a hypothetical protein of 188 amino acids (GenBankTM accession number NP_417665). A BLASTP search of the National Center for Biotechnology Information data bases with the YrbI sequence found that most matches were annotated as hypothetical proteins from Gram-negative bacteria (Table II). Because the lipopolysaccharide pathway exists primarily in Gram-negative bacteria, and YrbI was the only E. coli protein that matched the N-terminal sequence of spot 3, the yrbI orf was considered to be the candidate gene encoding KDO 8-P phosphatase.


                              
View this table:
[in this window]
[in a new window]
 
Table I
Purification of wild-type KDO 8-P phosphatase from E. coli B
The E. coli B cells were grown to mid-logarithmic phase in a glucose minimal medium supplemented with inorganic phosphate to repress the synthesis of alkaline phosphatase.


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 2.   The two-dimensional gel electrophoresis of wild-type KDO 8-P phosphatase purified from E. coli B. The protein spots indicated by arrows were identified by N-terminal sequencing. Arrow 1, 2-ketogluconate reductase (TKRA) (N-terminal sequence MKPSVILYKA); arrow 2, fructose-bisphosphate aldolase (fba) (N-terminal sequence SKIFDFVKPG); arrow 3, hypothetical protein (YrbI) (N-terminal sequence SKAGASLAT).


                              
View this table:
[in this window]
[in a new window]
 
Table II
YrbI-like sequences from other sources

Cloning, Overexpression, and Purification of KDO 8-P Phosphatase-- The yrbI orf, the putative KDO 8-P phosphatase coding region, is located in the yrb operon. This operon is comprised of 10 genes to which no biological function has been assigned. To achieve true homologous expression in this study, the yrbI gene from E. coli BL21 was cloned into the expression plasmid pT7-7, and the protein was overexpressed in E. coli BL21(DE3). Crude extracts from cells harboring the recombinant plasmid showed KDO 8-P phosphatase activity of 38 units/mg protein in the presence of 1 mM Mg2+, which was 380-fold higher than that of the crude extracts from plasmid-free E. coli BL21(DE3) cells. The recombinant enzyme was purified by acid precipitation followed by anion exchange chromatography on a Q-Sepharose column. The purified recombinant enzyme exhibited a specific activity of 460 units/mg in the presence of 1 mM Mg2+. A single protein band observed on the SDS-PAGE gel demonstrated homogeneity (Fig. 3). The typical yield of purified protein was 220 mg/liter of cell culture.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   The SDS-PAGE analysis of the purified recombinant KDO 8-P phosphatase. Lane 1, molecular weight standards; lane 2, recombinant phosphatase preparation (10 µg); lane 3, recombinant phosphatase preparation (20 µg). The gel was stained with Coomassie Brilliant Blue R-250.

Physical Properties of the Recombinant KDO 8-P Phosphatase-- The MW of the recombinant enzyme was 19,881 as determined by mass spectrometry. This value is in agreement with the calculated MW of 19,866. The results from SDS-PAGE suggested a subunit MW of 23 kDa (Fig. 3). The native MW of the recombinant enzyme was 89 kDa (analytical gel filtration chromatography). Because the native MW is about four times that of the denatured MW determined, the recombinant KDO 8-P phosphatase is predicted to have a tetrameric structure. The pI of the recombinant enzyme was 4.7 as determined by isoelectric focusing.

Catalytic Properties of the Recombinant KDO 8-P Phosphatase-- In the presence of 1 mM Mg2+, the recombinant enzyme exhibited a pH optimum around 5.5; however, a broad peak with high catalytic activity (90% of maximum) was observed between pH 5.5 and 7.0 (Fig. 4). Based on these results, the reported increased stability of enzyme activity at pH 7.0 in 100 mM HEPES (18), and to allow comparison of the present results with those previously reported (18), all subsequent assays were performed in HEPES buffer (100 mM, pH 7.0).


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4.   The pH optimum of the recombinant KDO 8-P phosphatase. Enzymatic activity was measured in the presence of 1 mM KDO 8-P and 1 mM Mg2+ by the discontinuous assay at different pH values as described under "Experimental Procedures." The results are the averages of triplicate assays.

To compare with previous reports, the substrate specificity of the recombinant KDO 8-P phosphatase was determined by the discontinuous colorimetric assay in the presence of 1 mM Co2+ (18). As shown in Table III, of the seven potential substrates tested, only KDO 8-P was hydrolyzed at a detectable rate. The kinetic constants of recombinant KDO 8-P phosphatase were determined for KDO 8-P using the continuous coupled assay in the presence of 1 mM Mg2+ at 37 °C. The enzyme exhibited Michaelis-Menten kinetics with an apparent Km of 75 ± 5 µM and a kcat of 175 ± 7 s-1.


                              
View this table:
[in this window]
[in a new window]
 
Table III
Substrate specificity of recombinant E. coli KDO 8-P phosphatase
Recombinant KDO 8-P phosphatase (3 ng for KDO 8-P and 6 µg for other compounds) was incubated with each indicated substrate and assayed for phosphatase activity by the discontinuous assay. The 50-µl reaction mixture contained 100 mM HEPES (pH 7.0), 5 mM substrate, and 1 mM CoCl2. The results are the averages of triplicate assays.

Requirement for Divalent Metals-- During the purification of wild-type KDO 8-P phosphatase, it was observed that the presence of a divalent metal increased phosphatase activity. To investigate the divalent metal requirements for the recombinant enzyme, the enzyme as isolated was first treated with 10 mM EDTA, and the mixture was extensively dialyzed against metal-free buffer to prepare the apoenzyme. The effect of divalent metal on apoenzyme was assessed by adding the divalent metals to the assay mixture to a final concentration of 1 mM (Fig. 5). The phosphatase activity was stimulated by Co2+ and Mg2+ about 9-fold versus apoenzyme, whereas Ba2+, Zn2+, and Mn2+ were less effective stimulators and Ca2+, Cd2+, Hg2+, and Cu2+ had inhibitory effects on activity. The phosphate hydrolyzing activity of apo-KDO 8-P phosphatase increased with increasing Mg2+ concentrations up to 1 mM (Fig. 5, inset). The apoenzyme exhibited a high affinity for Mg2+.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   The metal requirement of recombinant KDO 8-P phosphatase. Enzyme activity was measured in the presence of each indicated metal (final concentration, 1 mM) by the discontinuous assay. None, the activity of the apoenzyme was measured in the absence of added metals. Inset, the concentration dependence of apoenzyme activation by Mg2+; enzymatic activity was measured by the continuous assay.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

KDO is an essential component of the lipopolysaccharide that is present in Gram-negative bacteria but absent in Gram-positive microorganisms. KDO 8-P phosphatase is the only enzyme in the KDO biosynthetic pathway for which the gene responsible for expression has not been identified. The YrbI protein from E. coli has been defined as KDO 8-P phosphatase based on the following findings: (i) the N-terminal sequence of the wild-type KDO 8-P phosphatase isolated in the present work corresponds to the yrbI orf to which no biological function had been previously assigned, (ii) a BLASTP search of the National Center for Biotechnology Information genomic data bases using the YrbI sequence identified matches to only hypothetical proteins from Gram-negative bacteria (there were no matches to any proteins from Gram-positive microorganisms), (iii) the recombinant gene product of yrbI has a low apparent Km of 75 µM for KDO 8-P and a high kcat of 175 s-1 for KDO 8-P hydrolysis, and (iv) no other phosphorylated monosaccharide or compound tested in the present study served as an alternate substrate.

The substrate specificity, kinetic constants, divalent metal requirement, as well as the relatively low pH activity optimum of the recombinant KDO 8-P phosphatase (Table IV) are virtually identical to those reported for the wild-type KDO 8-P phosphatase (18). The pI values and the native MWs of recombinant KDO 8-P phosphatase and the previously reported wild-type KDO 8-P phosphatase (18) are identical. A discrepancy in the denatured MWs was observed, however, between the wild-type and the recombinant protein. The calculated MW of YrbI (188 amino acids) is 19,866. The MW of the recombinant enzyme is 23 kDa as determined by SDS-PAGE and 19,881 by mass spectrometry. The apparent MW of the wild-type enzyme isolated in this report was 52 kDa as determined from two-dimensional gel, as opposed to 40-43 kDa as determined by Ray and Benedict from SDS-PAGE (18). There are several possible explanations for this discrepancy. One possibility could be that wild-type and recombinant KDO 8-P phosphatase differ in their intersubunit interactions because one is highly overexpressed while the other is expressed at physiological levels. These differences in quaternary structure between the wild-type enzyme and the recombinant enzyme may account for the variation seen in the denaturation states under the conditions used for SDS-PAGE analysis. Another possibility could be that the wild-type and recombinant KDO 8-P phosphatases actually differ in their amino acid sequence length/composition. The recombinant enzyme encoded by yrbI may simply comprise only the N-terminal segment of the wild-type KDO 8-P phosphatase.


                              
View this table:
[in this window]
[in a new window]
 
Table IV
Comparison of recombinant KDO 8-P phosphatase and wild-type KDO 8-P phosphatase as reported by Ray and Benedict (18)

A close examination of the yrb operon reveals that the termination codon of the yrbI orf overlaps the initiation codon of the downstream yrbK orf (ATGA). The yrbK orf encodes a 21-kDa protein (191 amino acids). The yrbI stop codon, TGA, has long been recognized as a dual signal for either termination or frame shifting (26, 27). Translational frame shifting has been observed in retroviruses, retrotransposons, bacterial insertion sequences, bacterial cellular genes, and eukaryotic genes (26, 28). Frame shifting events at some recoding sites yield two protein products from one orf or one fusion protein in which the N- and C-terminal regions are encoded by two overlapping orfs, respectively. In some instances, this process serves as a control mechanism for the expression of specific genes (27-29). It is therefore attractive to postulate that the wild-type KDO 8-P phosphatase is the product of a -1 translational frame shifting event that occurred at the overlapping sites of yrbI and yrbK. If this were the case, the cell might express three protein products in varying concentrations: the yrbI product (20 kDa), the yrbK product (21 kDa), and the yrbI-yrbK transframe fusion protein (41 kDa). This frame shifting event, which would occur under certain physiological circumstances, could be a regulatory mechanism for the production and/or transport of KDO and, therefore, would serve as a control point in the biosynthesis of the lipopolysaccharide region of Gram-negative bacteria. It should be noted that the E. coli cells used for isolating the wild-type KDO 8-P phosphatases in both the present study and Ray and Benedict's study were grown in a glucose minimal medium supplemented with high levels of inorganic phosphate to repress the synthesis of alkaline phosphatase. This phosphate-rich growth condition may have induced the production of the putative high MW yrbI-yrbK transframe protein. Further studies are under way to distinguish between these two possible explanations as well as other possible scenarios for the observed discrepancies in the denatured MWs.

Based on the biochemical characteristics presented here, KDO 8-P phosphatase can be classified as a specific, low molecular weight acid phosphatase. Amino acid sequence homology analysis has also been utilized to classify phosphatase families (30, 31). Such analysis places KDO 8-P phosphatase into the haloacid dehalogenase (HAD) superfamily of hydrolases. This family is comprised of haloacid dehalogenases, epoxide hydrolases, ATPases, phosphomutases, and a variety of phosphatases, including phosphoserine phosphatase, phosphoglycolate phosphatase, sucrose-6F-phosphate phosphohydrolase, and trehalose-6-phosphatase (32-35). KDO 8-P phosphatase, the translated YrbI orf, shares the three highly conserved motifs generally observed in this superfamily of enzymes (32, 34, 36): motif I, DXDX(T/V); motif II, (S/T)XX; and motif III, K(G/S)(D/S)XXX(D/N) (Fig. 6). Although the overall sequence similarity between members of the HAD superfamily is generally low, a comparison of the structures of several members of the family demonstrates a conserved fold and suggests that enzymes in this superfamily most likely evolved from a common ancestor (37). An additional signature sequence motif (GGXGAXRE), unique to the KDO 8-P phosphatase-like sequences identified in the gene data bank, is located in the C-terminal region (Fig. 6). Whether this signature sequence plays a role in structure and function unique to KDO 8-P phosphatases remains to be determined.


View larger version (98K):
[in this window]
[in a new window]
 
Fig. 6.   Alignment of KDO 8-P phosphatase-like sequences. The sequences were aligned using ClustalW (25). The GenBankTM accession numbers of the sequences are listed in Table II. Absolute conserved residues are marked with an asterisk. Residues that are homologous to conserved residues in motifs I, II, and III of the HAD superfamily are highlighted in black. Conserved residues in the unique signature sequence of KDO 8-P phosphatase (C-terminal region) are highlighted in gray.

During the completion of this study, Parsons et al. (38) published the crystal structure of the YrbI protein from Haemophilus influenzae (HI1679, MWcal = 19,432) solved to 1.67-Å resolution. The H. influenzae YrbI was tetrameric, and the monomer subunits exhibited an alpha /beta -hydrolase fold. The active site of each monomer was located at the subunit interface. The active site was formed mainly by the three conserved motifs characteristic of the HAD superfamily to which KDO 8-P phosphatase belongs. A cobalt ion, used for crystallization, was coordinated at each of the four active sites. Based on structural and sequence analysis as well as enzymatic assays, the authors tentatively assigned the function of the protein to be that of a small molecule phosphatase. Although the true physiological substrate of their phosphatase was not identified, the authors correctly predicted YrbI to be the sugar phosphatase. The H. influenzae and E. coli YrbI are 39% identical; thus, the present study not only confirms their prediction that the H. influenzae YrbI is a phosphatase but also suggests the substrate for their enzyme.

In summary, the E. coli yrbI orf encodes for the protein KDO 8-P phosphatase. This is the first characterized gene in the yrb operon in E. coli and may help provide a clue to the function of other gene products in this operon. Further studies on this enzyme may provide useful information in the study of the evolution and structure/function of the entire HAD superfamily of enzymes. Additional experiments are in progress to better understand the discrepancies between the MWs of the recombinant and wild-type KDO 8-P phosphatases. Based on the importance of KDO in the lipopolysaccharide biosynthetic pathway, inhibition of KDO 8-P phosphatase will present an attractive target for the design of new generation antibiotics. The determination of the three-dimensional structure of the E. coli KDO 8-P phosphatase, now in progress, as well as the structure of various site-directed mutants, in the presence of substrate and/or substrate analogues, will further assist in the elucidation of the mechanism of KDO 8-P phosphatase catalysis, which will prove invaluable in the design of inhibitors.

    ACKNOWLEDGEMENTS

We thank Dr. George A. Garcia for kindly providing E. coli BL21 genomic DNA, Dr. Michael Bly for performing two-dimensional gel electrophoresis, and Sherry Williams for performing N-terminal amino acid sequencing. We also thank other members of the Woodard group for helpful discussions.

    Note Added in Proof

After this paper appeared on the JBC website, Dr. Osnat Herzberg was kind enough to provide us with a sample of recombinant yrbI protein (HI1679) from H. influenzae. Similar to yrbI from E. coli, HI1679 catalyzes the hydrolysis of KDO 8-P to KDO and inorganic phosphate with a specific activity of approximately 420 units/mg in the presence of 1 mM Mg2+. Thus, their original prediction that yrbI from H. influenzae is a sugar phosphatase is correct. The observed MW of recombinant HI1679 (MWcal = 19, 432) as determined by SDS-PAGE was 24 kDa, this is in agreement with our observation that the SDS-PAGE MW observed for the E. coli yrbI is higher than that its calculated MW.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant GM 53069 (to R. W. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: College of Pharmacy, 428 Church St., Ann Arbor, MI 48109-1065. Tel.: 734-764-7366; Fax: 734-763-2022; E-mail: rww@umich.edu.

Published, JBC Papers in Press, March 14, 2003, DOI 10.1074/jbc.M301983200

    ABBREVIATIONS

The abbreviations used are: KDO, 3-deoxy-D-manno-octulosonate; KDO 8-P, 3-deoxy-D-manno-octulosonate 8-phosphate; PNPase, purine nucleoside phosphorylase; orf, open reading frame; MW, molecular weight; HAD, haloacid dehalogenase; Mes, 2-(N-morpholino)ethanesulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Raetz, C. R., and Whitfield, C. (2002) Annu. Rev. Biochem. 71, 635-700[CrossRef][Medline] [Order article via Infotrieve]
2. Raetz, C. R. (1990) Annu. Rev. Biochem. 59, 129-170[CrossRef][Medline] [Order article via Infotrieve]
3. Rick, P. D., and Osborn, M. J. (1972) Proc. Natl. Acad. Sci. U. S. A. 69, 3756-3760[Abstract/Free Full Text]
4. Rick, P. D., and Osborn, M. J. (1977) J. Biol. Chem. 252, 4895-4903[Free Full Text]
5. Rick, P. D., and Young, D. A. (1982) J. Bacteriol. 150, 447-455[Abstract/Free Full Text]
6. Radaev, S., Dastidar, P., Patel, M., Woodard, R. W., and Gatti, D. L. (2000) J. Biol. Chem. 275, 9476-9484[Abstract/Free Full Text]
7. Radaev, S., Dastidar, P., Patel, M., Woodard, R. W., and Gatti, D. L. (2000) Acta Crystallogr. Sect. D Biol. Crystallogr. 56, 516-519[CrossRef][Medline] [Order article via Infotrieve]
8. Woisetschlager, M., and Hogenauer, G. (1987) Mol. Gen. Genet. 207, 369-373[CrossRef][Medline] [Order article via Infotrieve]
9. Woisetschlager, M., Hodl-Neuhofer, A., and Hogenauer, G. (1988) J. Bacteriol. 170, 5382-5384[Abstract/Free Full Text]
10. Goldman, R. C., Bolling, T. J., Kohlbrenner, W. E., Kim, Y., and Fox, J. L. (1986) J. Biol. Chem. 261, 15831-15835[Abstract/Free Full Text]
11. Goldman, R. C., and Kohlbrenner, W. E. (1985) J. Bacteriol. 163, 256-261[Abstract/Free Full Text]
12. Jelakovic, S., Jann, K., and Schulz, G. E. (1996) FEBS Lett. 391, 157-161[CrossRef][Medline] [Order article via Infotrieve]
13. Clementz, T., and Raetz, C. R. (1991) J. Biol. Chem. 266, 9687-9696[Abstract/Free Full Text]
14. Belunis, C. J., Clementz, T., Carty, S. M., and Raetz, C. R. (1995) J. Biol. Chem. 270, 27646-27652[Abstract/Free Full Text]
15. Tzeng, Y. L., Datta, A., Strole, C., Kolli, V. S., Birck, M. R., Taylor, W. P., Carlson, R. W., Woodard, R. W., and Stephens, D. S. (2002) J. Biol. Chem. 277, 24103-24113[Abstract/Free Full Text]
16. Ghalambor, M. A., and Heath, E. C. (1966) J. Biol. Chem. 241, 3222-3227[Abstract/Free Full Text]
17. Berger, H., and Hammerschmid, F. (1975) Biochem. Soc. Trans. 3, 1096-1097
18. Ray, P. H., and Benedict, C. D. (1980) J. Bacteriol. 142, 60-68[Abstract/Free Full Text]
19. Lanzetta, P. A., Alvarez, L. J., Reinach, P. S., and Candia, O. A. (1979) Anal. Biochem. 100, 95-97[CrossRef][Medline] [Order article via Infotrieve]
20. Webb, M. R. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 4884-4887[Abstract/Free Full Text]
21. Rieger, C. E., Lee, J., and Turnbull, J. L. (1997) Anal. Biochem. 246, 86-95[CrossRef][Medline] [Order article via Infotrieve]
22. Sheflyan, G. Y., Howe, D. L., Wilson, T. L., and Woodard, R. W. (1998) J. Am. Chem. Soc. 120, 11027-11032[CrossRef]
23. Dotson, G. D., Dua, R. K., Clemens, J. C., Wooten, E. W., and Woodard, R. W. (1995) J. Biol. Chem. 270, 13698-13705[Abstract/Free Full Text]
24. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
25. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]
26. Baranov, P. V., Gurvich, O. L., Fayet, O., Prere, M. F., Miller, W. A., Gesteland, R. F., Atkins, J. F., and Giddings, M. C. (2001) Nucleic Acids Res. 29, 264-267[Abstract/Free Full Text]
27. Tate, W. P., Mansell, J. B., Mannering, S. A., Irvine, J. H., Major, L. L., and Wilson, D. N. (1999) Biochemistry 64, 1342-1353[Medline] [Order article via Infotrieve]
28. Engelberg-Kulka, H., and Schoulaker-Schwarz, R. (1994) Mol. Microbiol. 11, 3-8[Medline] [Order article via Infotrieve]
29. Sekine, Y., Eisaki, N., and Ohtsubo, E. (1994) J. Mol. Biol. 235, 1406-1420[CrossRef][Medline] [Order article via Infotrieve]
30. Stukey, J., and Carman, G. M. (1997) Protein Sci. 6, 469-472[Abstract]
31. Thaller, M. C., Schippa, S., and Rossolini, G. M. (1998) Protein Sci. 7, 1647-1652[Abstract]
32. Aravind, L., Galperin, M. Y., and Koonin, E. V. (1998) Trends Biochem. Sci. 23, 127-129[CrossRef][Medline] [Order article via Infotrieve]
33. Koonin, E. V., and Tatusov, R. L. (1994) J. Mol. Biol. 244, 125-132[CrossRef][Medline] [Order article via Infotrieve]
34. Ridder, I. S., and Dijkstra, B. W. (1999) Biochem. J. 339, 223-226
35. Lunn, J. E., Ashton, A. R., Hatch, M. D., and Heldt, H. W. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 12914-12919[Abstract/Free Full Text]
36. Wang, W., Kim, R., Jancarik, J., Yokota, H., and Kim, S. H. (2001) Structure 9, 65-71[Medline] [Order article via Infotrieve]
37. Selengut, J. D. (2001) Biochemistry 40, 12704-12711[CrossRef][Medline] [Order article via Infotrieve]
38. Parsons, J. F., Lim, K., Tempczyk, A., Krajewski, W., Eisenstein, E., and Herzberg, O. (2002) Proteins 46, 393-404[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
A. L. Davidson, E. Dassa, C. Orelle, and J. Chen
Structure, Function, and Evolution of Bacterial ATP-Binding Cassette Systems
Microbiol. Mol. Biol. Rev., June 1, 2008; 72(2): 317 - 364.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Kuznetsova, M. Proudfoot, C. F. Gonzalez, G. Brown, M. V. Omelchenko, I. Borozan, L. Carmel, Y. I. Wolf, H. Mori, A. V. Savchenko, et al.
Genome-wide Analysis of Substrate Specificities of the Escherichia coli Haloacid Dehalogenase-like Phosphatase Family
J. Biol. Chem., November 24, 2006; 281(47): 36149 - 36161.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
T. C. Meredith and R. W. Woodard
Identification of GutQ from Escherichia coli as a D-Arabinose 5-Phosphate Isomerase
J. Bacteriol., October 15, 2005; 187(20): 6936 - 6942.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Proudfoot, E. Kuznetsova, G. Brown, N. N. Rao, M. Kitagawa, H. Mori, A. Savchenko, and A. F. Yakunin
General Enzymatic Screens Identify Three New Nucleotidases in Escherichia coli: BIOCHEMICAL CHARACTERIZATION OF SurE, YfbR, AND YjjG
J. Biol. Chem., December 24, 2004; 279(52): 54687 - 54694.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
E. R. Vimr, K. A. Kalivoda, E. L. Deszo, and S. M. Steenbergen
Diversity of Microbial Sialic Acid Metabolism
Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 132 - 153.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. C. Meredith and R. W. Woodard
Escherichia coli YrbH Is a D-Arabinose 5-Phosphate Isomerase
J. Biol. Chem., August 29, 2003; 278(35): 32771 - 32777.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/20/18117    most recent
M301983200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend