![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 20, 18117-18123, May 16, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Medicinal Chemistry and Department of Chemistry, University of Michigan, Ann Arbor, Michigan 48109-1065
Received for publication, February 25, 2003, and in revised form, March 14, 2003
| |
ABSTRACT |
|---|
|
|
|---|
3-Deoxy-D-manno-octulosonate
8-phosphate (KDO 8-P) phosphatase, which catalyzes the hydrolysis of
KDO 8-P to KDO and inorganic phosphate, is the last enzyme in the KDO
biosynthetic pathway for which the gene has not been identified.
Wild-type KDO 8-P phosphatase was purified from Escherichia
coli B, and the N-terminal amino acid sequence matched a
hypothetical protein encoded by the E. coli open reading
frame, yrbI. The yrbI gene, which encodes for a
protein of 188 amino acids, was cloned, and the gene product was
overexpressed in E. coli. The recombinant enzyme is a
tetramer and requires a divalent metal cofactor for activity. Optimal
enzymatic activity is observed at pH 5.5. The enzyme is highly specific for KDO 8-P with an apparent Km of 75 µM and a kcat of 175 s 3-Deoxy-D-manno-octulosonate
(KDO)1 is an 8-carbon sugar
that links the lipid A and polysaccharide moieties of the
lipopolysaccharide region in Gram-negative bacteria (1, 2). It
has been demonstrated that an interruption in the biosynthesis of KDO
leads to the accumulation of lipid A precursors and subsequent arrest
in cell growth (3-5). Thus, enzymes involved in KDO biosynthesis
and/or its incorporation into lipid A are considered attractive targets
for the design of novel antibiotics.
The biosynthesis and utilization of KDO involves five
sequential enzymatic reactions that are catalyzed by
D-arabinose 5-phosphate isomerase,
3-deoxy-D-manno-octulosonate 8-phosphate (KDO
8-P) synthase, KDO 8-P phosphatase, cytidine 5'-monophosphate-KDO
synthetase, and KDO transferase (Fig. 1)
(2). During the past two decades, the genes responsible for the
expression of KDO 8-P synthase (6-9), cytidine 5'-monophosphate-KDO
synthetase (10-12), and KDO transferase (13, 14) have been identified,
and their respective enzymes have been studied extensively. More
recently, the gene encoding the D-arabinose 5-phosphate
isomerase (KpsF) from Neisseria meningitides was identified
by Tzeng et al. (15). KDO 8-P phosphatase, therefore, remains the last enzyme in the lipid A-KDO pathway for which a gene has
not been assigned.
1 in the presence of 1 mM Mg2+.
Amino acid sequence analysis indicates that KDO 8-P phosphatase is a
member of the haloacid dehalogenase hydrolase superfamily.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (11K):
[in a new window]
Fig. 1.
The biosynthesis of lipid A-KDO. The
enzymes that catalyze these reactions are: (1),
D-arabinose 5-phosphate isomerase (KpsF); (2),
KDO 8-P synthase (KdsA); (3), KDO 8-P phosphatase;
(4), cytidine 5'-monophosphate-KDO synthetase (KdsB); and
(5), KDO transferase (WaaA).
KDO 8-P phosphatase catalyzes the hydrolysis of KDO 8-P to KDO and inorganic phosphate. Gahlambor and Heath (16) first suggested the existence of a phosphatase for KDO 8-P in 1966. In 1975, Berger and Hammerschmid (17) reported the isolation of a specific phosphatase fraction from a DEAE-cellulose column that would hydrolyze KDO 8-P but not D-arabinose 5-phosphate or p-nitrophenylphosphate. Ray and Benedict (18) first purified and characterized the KDO 8-P phosphatase from Escherichia coli in 1980 but did not identify the encoding gene.
In the present work, for the first time, the gene for KDO 8-P
phosphatase is identified and cloned into an overexpression vector. A
wild-type phosphatase that specifically hydrolyzes KDO 8-P to KDO and
inorganic phosphate was isolated and N-terminally sequenced. A BLAST
search of the E. coli K12 genome data base at the National
Center for Biotechnology Information web site with this N-terminal
sequence revealed a hypothetical protein encoded by the open reading
frame (orf) yrbI. The yrbI gene was cloned, and
the gene product was overexpressed in E. coli. The recombinant protein was purified to homogeneity, and its
characteristics were consistent with those properties reported
for the wild-type KDO 8-P phosphatase.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
The E. coli B cells, grown in glucose
minimal medium supplemented with inorganic phosphate, were purchased
from Grain Processing Inc. (Muscatine, IA) as a frozen cell paste and
stored at
80 °C. Genomic E. coli BL21 DNA was a
generous gift from Dr. George A. Garcia (University of Michigan). The
Promega Wizard DNA purification kit was utilized for plasmid isolation
and purification. E. coli XL1-Blue chemically competent
cells were obtained from Stratagene Cloning System. E. coli
BL21(DE3) chemically competent cells were obtained from Novagen. The
pCR®T7 TOPO®TA expression kit was purchased from Invitrogen.
Restriction enzymes and T4 DNA ligase were purchased from
New England Biolabs. Thermal cycling was performed using a MJ Research
PTC-200 Peltier Thermal Cycler. DNA sequencing, N-terminal amino acid
sequencing, two-dimensional gel electrophoresis, and DNA primer
syntheses were performed by the University of Michigan Biomedical
Resources Core Facility. Tris and HEPES were purchased from Research
Organics. Glycylglycine, phosphoenolpyruvate mono(cyclohexylammonium) salt, p-nitrophenylphosphate di(cyclohexylammonium) salt,
D-ribose 5-phosphate disodium salt, D-arabinose
5-phosphate disodium salt, D-glucose 6-phosphate monosodium
salt, D-mannose 6-phosphate monosodium salt, reagent grade
CuCl2, CaCl2, ultra pure Trizma base, and Q-Sepharose resin were purchased from Sigma. The puratronic grade MgCl2, CoCl2, MnCl2,
CdCl2, ZnSO4, and HCl (99.999%, metal basis) were purchased from Alfa Aesar. EDTA disodium salt and mercuric acetate
were obtained from Mallinckrodt. The Mes was obtained from the United
States Biochemical Corporation. High grade Spectra/Por® 7 dialysis
tubing (10,000 molecular weight cut-off and metal-free) was obtained
from VWR Scientific. The Centriprep YM-10 Concentrators were purchased
from Millipore. AG-MPI and P2 resin were purchased from Bio-Rad. Mono Q
(HR 5/5), phenyl Superose (HR 10/10), and Superose 12 (HR 10/30)
chromatography columns were purchased from Amersham Biosciences.
KDO 8-P Phosphatase Activity Assay-- The KDO 8-P phosphatase activity was determined by either a discontinuous colorimetric assay or a continuous spectrophotometric assay. One unit of enzyme activity is defined as the production of 1 µmol of inorganic phosphate/min at 37 °C.
The standard discontinuous colorimetric assay was measured in a 50-µl reaction mixture containing 1 mM KDO 8-P, 1 mM Mg2+, and 100 mM HEPES (pH 7.0) at 37 °C. The reaction was initiated by the addition of enzyme and quenched by the addition of 50 µl of 10% (w/v) ice-cold trichloroacetic acid. The amount of inorganic phosphate produced was quantitated by the malachite green assay (19) using KH2PO4 as the standard.
The continuous spectrophotometric assay was based on the purine nucleoside phosphorylase (PNPase)-coupled phosphate assay first reported by Webb (20) and later modified by Rieger and co-workers (21). The assay was performed in a 70-µl reaction mixture containing 1 mM KDO 8-P, 1 mM Mg2+, 100 mM HEPES (pH 7.0), 200 µM 7-methylinosine, 2 µM recombinant bacterial PNPase, and 2 nM KDO 8-P phosphatase. The reaction mixture, including PNPase but excluding KDO 8-P phosphatase, was incubated at 37 °C for 5 min to allow the PNPase coupling system to remove any inorganic phosphate potentially present as a contaminant in the substrates. The reaction was initiated by the addition of KDO 8-P phosphatase. In the coupled assays, the concentration of KDO 8-P phosphatase and PNPase was adjusted to ensure that the phosphatase activity was rate-limiting.
Enzymatic Synthesis of KDO 8-P-- KDO 8-P was synthesized enzymatically (22) using KDO 8-P synthase purified as previously described (23). The E. coli KDO 8-P synthase (4 mg) was incubated with phosphoenolpyruvate mono(cyclohexylammonium) salt (24 mg) and D-arabinose 5-phosphate disodium salt (26 mg) in 100 mM Tris-HCl (pH 7.5) in a final volume of 4 ml at 37 °C for 2 h. The reaction mixture was quenched by the addition of 0.45 ml 50% (w/v) trichloroacetic acid and centrifuged to remove precipitated protein. The pH of the supernatant was adjusted to 7.0 by 1 N sodium hydroxide. The resulting solution was loaded onto an AG-MPI anion exchange column (chloride form, 2.5 × 30 cm) pre-equilibrated with water. The column was first washed with 100 ml of water at a flow rate of 1 ml/min and then eluted with a linear gradient of 0 to 0.4 M potassium chloride (60 min at 1 ml/min). The fractions containing KDO 8-P were pooled and lyophilized. The lyophilizate was dissolved in 2 ml of water and then desalted on a P2 column (2.0 × 60 cm) using water as the eluent.
Isolation and Purification of Wild-type KDO 8-P Phosphatase from E. coli B-- KDO 8-P phosphatase was isolated and purified from E. coli B using a modification of the protocol originally described by Ray and Benedict (18). The frozen E. coli B cells (46 g) were thawed at 23 °C in 100 mM Tris-HCl (pH 7.4) in a final volume of 60 ml. The cell suspension was subjected to sonication at 4 °C (ice water bath, 45-s pulses with a 2-min rest between pulses, four times), and the unbroken cells and cell debris were removed by centrifugation (40,000 × g, 30 min, 4 °C). The supernatant was saved. The pellet was suspended in 50 ml of 100 mM Tris-HCl (pH 7.4), sonicated, and centrifuged as above. The two supernatants were combined. To remove nucleic acids, a 2.2% (w/v) protamine sulfate solution (pH 7.0) was slowly added at 4 °C with gentle stirring to the supernatant to yield a final concentration of 0.267% (w/v) protamine sulfate. After continuous stirring for 15 min at 4 °C, the precipitated material was removed by centrifugation (40,000 × g, 30 min, 4 °C).
The pH of the above supernatant was adjusted to 5.2 (pH measured at 4 °C) by dropwise addition of cold 1 N acetic acid. After continuously stirring the solution for 10 min at 4 °C, the precipitated protein was removed by centrifugation (29,000 × g, 20 min, 4 °C), and solid (NH4)2SO4 was then slowly added to the supernatant. The protein fraction precipitating between 10 and 34% (w/v) (NH4)2SO4 was collected by centrifugation (29,000 × g, 30 min, 4 °C) and dissolved in buffer A (20 mM Tris-HCl, pH 7.4). The sample was dialyzed against two liters of the same buffer overnight, and the resulting protein solution was applied to a Q-Sepharose column (1.2 × 21 cm) pre-equilibrated with buffer A. The column was eluted at a flow rate of 2.0 ml/min using a linear gradient of 0-0.5 M potassium chloride in buffer A over a 60-min period. The fractions containing KDO 8-P phosphatase activity were pooled.
Solid (NH4)2SO4 was slowly added to
the pooled fractions to a final concentration of 20% (w/v). The sample
was filtered (0.22 µm) and loaded onto a Phenyl Superose column (HR
10/10) pre-equilibrated with 20%
(NH4)2SO4 in buffer A. A reverse
gradient from 20 to 0% (NH4)2SO4
in buffer A was applied at a flow rate of 1.0 ml/min over a 60-min
period. The fractions containing KDO 8-P phosphatase activity were
pooled, dialyzed against 1 liter of buffer A overnight, and applied to
a Mono Q (HR 5/5) column pre-equilibrated with buffer A. The column was
eluted at a flow rate of 0.5 ml/min using a linear gradient of 0-0.3
M potassium chloride in buffer A over 30 min. The fractions
containing KDO 8-P phosphatase activity were pooled and dialyzed
against 500 ml of buffer A overnight. The final preparation was
concentrated by ultrafiltration to 0.6 mg/ml (Centriprep YM-10
concentrator), and the resulting solution was stored at
80 °C. The
purification process of wild-type KDO 8-P phosphatase is summarized in
Table I.
Two-dimensional Gel Electrophoresis and N-terminal Amino Acid Sequencing-- The two-dimensional gel electrophoresis and N-terminal amino acid sequencing was performed by the University of Michigan Biomedical Resources Core Facility. The wild-type phosphatase preparation was subjected to electrophoresis in the first dimension on a 7-cm immobilized pH gradient strip (pH 3-10) using the Amersham Biosciences Multiphor II system. In the second dimension, SDS-PAGE was carried out on a NuPAGE Novex 4-12% Bis-Tris ZOOM Gel (Invitrogen) using the Invitrogen Xcell Surelock Mini-Cell system. The gel was electroblotted onto a polyvinylidene difluoride membrane (Applied Biosystems Mini ProBlott membrane) using the Bio-Rad Transblot Semi-Dry blotter system. The blotted protein was visualized by Coomassie Blue R-250. The N-terminal sequencing of the blotted proteins were performed on a Procise Protein Sequencing System.
Sequence Analysis-- Data base searching was performed using the BLAST program (24) at the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov/BLAST). Multiple sequence alignments were performed using the program ClustalW (www.ebi.ac.uk/clustalw) (25).
Cloning, Overexpression, and Purification of KDO 8-P Phosphatase-- The yrbI gene (gi:16131088) was amplified from E. coli BL21 genomic DNA by standard polymerase chain reaction methodologies using Taq DNA polymerase as recommended by the manufacturer. The forward primer was CATATGAGCAAAGCAGGTGCGTCGC, and the reverse primer was GATTCTGAATTCGGATCCTCAATTCACCTTCACCCCC. The amplification product was isolated and ligated directly into the vector pCR®T7/CT-TOPO®. The ligation mixture was used to transform chemically competent E. coli TOP10F' cells. Plasmid DNA isolated from several transformants and identified by restriction analysis to contain the PCR product were subjected to DNA sequencing to confirm the sequence of the desired gene. One plasmid with the correct sequence, pT7CT-yrbI, was digested with the restriction endonucleases NdeI and BamHI (underlined above). The restriction-digested product was ligated into the similarly restriction-digested expression vector, pT7-7, which had been treated with calf intestinal alkaline phosphatase. The ligation mixture was used to transform chemically competent E. coli XL1-Blue cells. The plasmid (pT7-yrbI) isolated from these transformants was first sequenced and then used to transform chemically competent E. coli BL21(DE3) cells.
The E. coli BL21(DE3) cells harboring the pT7-yrbI were
grown in 2× YT medium containing ampicillin (100 mg/liter) at 37 °C with shaking (220 rpm). Isopropyl-
-D-thiogalactoside was
added to a final concentration of 0.4 mM when the culture
reached an A600 of 1.5. The cells were
harvested by centrifugation (29,000 × g, 20 min,
4 °C) 4 h post-induction. The pellet was suspended in buffer A
(20 mM Tris-HCl, pH 7.5) and subjected to sonication at
4 °C (ice water bath, 30-s pulses with a 2-min rest between pulses,
five times). The crude extract was centrifuged to remove cell debris
(40,000 × g, 30 min, 4 °C).
The pH of the above supernatant (90 ml; 1880 mg of total protein from a
1.0-liter culture) was adjusted to 5.0 by slowly adding cold 1.0 N acetic acid, and the solution was stirred for another 10 min at 4 °C and centrifuged to remove the precipitated protein (29,000 × g, 20 min, 4 °C). The supernatant (80 ml;
480 mg total protein) was dialyzed against two liters of buffer A
overnight and applied to a Q-Sepharose column (1.2 × 21 cm)
pre-equilibrated with buffer A. The column was eluted at a flow rate of
2.0 ml/min using a linear gradient from 0 to 0.5 M
potassium chloride in the same buffer over 70 min. After the fractions
containing KDO 8-P phosphatase activity were pooled (37 ml; 230 mg of
total protein), they were dialyzed against two liters of 10 mM HEPES buffer (pH 7.0) overnight. The final preparation
was homogeneous as determined by SDS-PAGE. The total yield of
homogeneous protein was 220 mg/liter of cell culture. The purified
enzyme (6 mg/ml) was aliquoted, frozen in ethanol-dry ice, and stored
at
80 °C.
Molecular Weight (MW) Determinations-- The subunit MW of KDO 8-P phosphatase was determined by electrospray ionization mass spectrometry utilizing a Finnigan LCQ mass spectrometer. The native MW of KDO 8-P phosphatase was determined by gel filtration utilizing a Superose 12 column (HR10/30) according to the manufacturer's instructions (Sigma). The elution volume was determined in triplicate for all samples and standards.
Kinetic Studies-- The reactions were carried out at 37 °C using the continuous spectrophotometric assay protocol as described above. Initial rates were determined in triplicate using the linear region (~30 s) of the reaction progress curve for six concentrations of KDO 8-P (between 0.1 and 10 × Km). The values for Km and kcat were determined by fitting the reaction rate versus the substrate concentration to the Michaelis-Menten equation using KaleidaGraph software.
Metal Requirements-- Recombinant KDO 8-P phosphatase was treated with EDTA to remove bound metal ions. The enzyme as isolated (6 mg/ml) was treated with 10 mM EDTA in 20 mM Tris-HCl (pH 7.0) for 2 h at 25 °C and dialyzed against 1 liter of metal-free 20 mM Tris-HCl (pH 7.0) for 24 h at 4 °C with two buffer changes. The metal-free Tris-HCl buffer was prepared directly using metal-free water (PURELAB plus system), ultra pure Trizma base, and metal-free HCl. The divalent metals (1 mM, prepared in metal-free water) were added to the assay mixture to assess their effects on EDTA-treated (apo) KDO 8-P phosphatase activity.
pH Dependence of KDO 8-P Phosphatase-- The enzymatic activity was measured between pH 4.0 and 9.0 at 37 °C by the discontinuous assay described above using sodium acetate (pH 4.0-5.0), Mes (pH 5.5-6.5), HEPES (pH 7.0-8.0), or glycylglycine (pH 8.5-9.0) at a concentration of 100 mM each. The pH of each reaction mixture was measured at 23 °C.
Electrophoresis-- SDS-PAGE was performed under reducing conditions on a 12% polyacrylamide gel with a Mini-PROTEAN II electrophoresis unit (Bio-Rad). The gel was visualized with 0.25% Coomassie Brilliant Blue R-250 stain. Isoelectric focusing of protein, under native state, was performed on a 5.5% (w/v) polyacrylamide gel containing Carrier Ampholytes pH 3-10 (Bio-Rad) with a model 111 mini Isoelectric Focusing cell according to the manufacturer's instructions (Bio-Rad).
Miscellaneous Methods--
Protein concentrations were
determined using the Bio-Rad protein assay reagent with bovine serum
albumin (Sigma) serving as the standard. Optical spectroscopy was
performed using a HP 8453 UV-visible spectrophotometer.
| |
RESULTS |
|---|
|
|
|---|
Purification of Wild-type KDO 8-P Phosphatase from E. coli B-- A specific KDO 8-P phosphatase was purified from E. coli B cells grown in glucose minimal medium containing phosphate by monitoring the enzymatic hydrolysis of the phosphate group of KDO 8-P. The purification included ammonium sulfate fractionation as well as a combination of chromatographic separations utilizing Q-Sepharose, phenyl Superose, and finally Mono Q chromatography. The purified wild-type enzyme preparation, which was purified ~850-fold (Table I), exhibited a specific activity of 34 units/mg in the presence of 1 mM Mg2+ (16 units/mg in the absence of added Mg2+). Under the discontinuous colorimetric assay conditions, neither D-ribose 5-phosphate nor D-glucose 6-phosphate served as a substrate. Thus, the substrate specificity and magnesium requirements of the present wild-type enzyme are identical to those originally reported by Ray and Benedict (18) for their wild-type KDO 8-P phosphatase. The examination of the "purified" wild-type KDO 8-P phosphatase from the present study by two-dimensional gel electrophoresis revealed three protein spots that were further analyzed by N-terminal amino acid sequencing (Fig. 2). Utilizing these N-terminal sequences, the E. coli K12 genome data base at the National Center for Biotechnology Information web site was searched using the "search for short nearly exact matches" search algorithm. Based on these analyses, spot 1 was identified as 2-ketogluconate reductase (MWobs = 39 kDa, MWcal = 35,396), spot 2 as fructose-bisphosphate aldolase (MWobs = 42 kDa, MWcal = 39,147, excluding the initial methionine), and spot 3 as YrbI (MWobs = 52 kDa, MWcal = 19,866, excluding the initial methionine), a hypothetical protein of 188 amino acids (GenBankTM accession number NP_417665). A BLASTP search of the National Center for Biotechnology Information data bases with the YrbI sequence found that most matches were annotated as hypothetical proteins from Gram-negative bacteria (Table II). Because the lipopolysaccharide pathway exists primarily in Gram-negative bacteria, and YrbI was the only E. coli protein that matched the N-terminal sequence of spot 3, the yrbI orf was considered to be the candidate gene encoding KDO 8-P phosphatase.
|
|
|
Cloning, Overexpression, and Purification of KDO 8-P
Phosphatase--
The yrbI orf, the putative KDO 8-P
phosphatase coding region, is located in the yrb operon.
This operon is comprised of 10 genes to which no biological function
has been assigned. To achieve true homologous expression in this study,
the yrbI gene from E. coli BL21 was cloned into
the expression plasmid pT7-7, and the protein was overexpressed in
E. coli BL21(DE3). Crude extracts from cells harboring the
recombinant plasmid showed KDO 8-P phosphatase activity of 38 units/mg
protein in the presence of 1 mM Mg2+, which was
380-fold higher than that of the crude extracts from plasmid-free
E. coli BL21(DE3) cells. The recombinant enzyme was purified
by acid precipitation followed by anion exchange chromatography on a
Q-Sepharose column. The purified recombinant enzyme exhibited a
specific activity of 460 units/mg in the presence of 1 mM
Mg2+. A single protein band observed on the SDS-PAGE gel
demonstrated homogeneity (Fig. 3). The
typical yield of purified protein was 220 mg/liter of cell culture.
|
Physical Properties of the Recombinant KDO 8-P Phosphatase-- The MW of the recombinant enzyme was 19,881 as determined by mass spectrometry. This value is in agreement with the calculated MW of 19,866. The results from SDS-PAGE suggested a subunit MW of 23 kDa (Fig. 3). The native MW of the recombinant enzyme was 89 kDa (analytical gel filtration chromatography). Because the native MW is about four times that of the denatured MW determined, the recombinant KDO 8-P phosphatase is predicted to have a tetrameric structure. The pI of the recombinant enzyme was 4.7 as determined by isoelectric focusing.
Catalytic Properties of the Recombinant KDO 8-P
Phosphatase--
In the presence of 1 mM Mg2+,
the recombinant enzyme exhibited a pH optimum around 5.5; however, a
broad peak with high catalytic activity (90% of maximum) was observed
between pH 5.5 and 7.0 (Fig. 4). Based on
these results, the reported increased stability of enzyme activity at
pH 7.0 in 100 mM HEPES (18), and to allow comparison of the
present results with those previously reported (18), all subsequent
assays were performed in HEPES buffer (100 mM, pH 7.0).
|
To compare with previous reports, the substrate specificity of the
recombinant KDO 8-P phosphatase was determined by the discontinuous colorimetric assay in the presence of 1 mM Co2+
(18). As shown in Table III, of the seven
potential substrates tested, only KDO 8-P was hydrolyzed at a
detectable rate. The kinetic constants of recombinant KDO 8-P
phosphatase were determined for KDO 8-P using the continuous coupled
assay in the presence of 1 mM Mg2+ at 37 °C.
The enzyme exhibited Michaelis-Menten kinetics with an apparent
Km of 75 ± 5 µM and a
kcat of 175 ± 7 s
1.
|
Requirement for Divalent Metals--
During the purification of
wild-type KDO 8-P phosphatase, it was observed that the presence of a
divalent metal increased phosphatase activity. To investigate the
divalent metal requirements for the recombinant enzyme, the enzyme as
isolated was first treated with 10 mM EDTA, and the mixture
was extensively dialyzed against metal-free buffer to prepare the
apoenzyme. The effect of divalent metal on apoenzyme was assessed by
adding the divalent metals to the assay mixture to a final
concentration of 1 mM (Fig.
5). The phosphatase activity was
stimulated by Co2+ and Mg2+ about 9-fold
versus apoenzyme, whereas Ba2+,
Zn2+, and Mn2+ were less effective stimulators
and Ca2+, Cd2+, Hg2+, and
Cu2+ had inhibitory effects on activity. The phosphate
hydrolyzing activity of apo-KDO 8-P phosphatase increased with
increasing Mg2+ concentrations up to 1 mM (Fig.
5, inset). The apoenzyme exhibited a high affinity for
Mg2+.
|
| |
DISCUSSION |
|---|
|
|
|---|
KDO is an essential component of the lipopolysaccharide that is
present in Gram-negative bacteria but absent in Gram-positive microorganisms. KDO 8-P phosphatase is the only enzyme in the KDO
biosynthetic pathway for which the gene responsible for expression has
not been identified. The YrbI protein from E. coli has been defined as KDO 8-P phosphatase based on the following findings: (i) the
N-terminal sequence of the wild-type KDO 8-P phosphatase isolated in
the present work corresponds to the yrbI orf to which no
biological function had been previously assigned, (ii) a BLASTP search
of the National Center for Biotechnology Information genomic data bases
using the YrbI sequence identified matches to only hypothetical
proteins from Gram-negative bacteria (there were no matches to any
proteins from Gram-positive microorganisms), (iii) the recombinant gene
product of yrbI has a low apparent Km of
75 µM for KDO 8-P and a high kcat
of 175 s
1 for KDO 8-P hydrolysis, and (iv) no other
phosphorylated monosaccharide or compound tested in the present study
served as an alternate substrate.
The substrate specificity, kinetic constants, divalent metal requirement, as well as the relatively low pH activity optimum of the recombinant KDO 8-P phosphatase (Table IV) are virtually identical to those reported for the wild-type KDO 8-P phosphatase (18). The pI values and the native MWs of recombinant KDO 8-P phosphatase and the previously reported wild-type KDO 8-P phosphatase (18) are identical. A discrepancy in the denatured MWs was observed, however, between the wild-type and the recombinant protein. The calculated MW of YrbI (188 amino acids) is 19,866. The MW of the recombinant enzyme is 23 kDa as determined by SDS-PAGE and 19,881 by mass spectrometry. The apparent MW of the wild-type enzyme isolated in this report was 52 kDa as determined from two-dimensional gel, as opposed to 40-43 kDa as determined by Ray and Benedict from SDS-PAGE (18). There are several possible explanations for this discrepancy. One possibility could be that wild-type and recombinant KDO 8-P phosphatase differ in their intersubunit interactions because one is highly overexpressed while the other is expressed at physiological levels. These differences in quaternary structure between the wild-type enzyme and the recombinant enzyme may account for the variation seen in the denaturation states under the conditions used for SDS-PAGE analysis. Another possibility could be that the wild-type and recombinant KDO 8-P phosphatases actually differ in their amino acid sequence length/composition. The recombinant enzyme encoded by yrbI may simply comprise only the N-terminal segment of the wild-type KDO 8-P phosphatase.
|
A close examination of the yrb operon reveals that the
termination codon of the yrbI orf overlaps the initiation
codon of the downstream yrbK orf
(ATGA). The yrbK orf
encodes a 21-kDa protein (191 amino acids). The yrbI stop
codon, TGA, has long been recognized as a dual signal for either
termination or frame shifting (26, 27). Translational frame shifting
has been observed in retroviruses, retrotransposons, bacterial
insertion sequences, bacterial cellular genes, and eukaryotic genes
(26, 28). Frame shifting events at some recoding sites yield two protein products from one orf or one fusion protein in which the N- and
C-terminal regions are encoded by two overlapping orfs, respectively.
In some instances, this process serves as a control mechanism for the
expression of specific genes (27-29). It is therefore attractive to
postulate that the wild-type KDO 8-P phosphatase is the product of a
1 translational frame shifting event that occurred at the overlapping
sites of yrbI and yrbK. If this were the case,
the cell might express three protein products in varying concentrations: the yrbI product (20 kDa), the
yrbK product (21 kDa), and the yrbI-yrbK
transframe fusion protein (41 kDa). This frame shifting event, which
would occur under certain physiological circumstances, could be a
regulatory mechanism for the production and/or transport of KDO and,
therefore, would serve as a control point in the biosynthesis of the
lipopolysaccharide region of Gram-negative bacteria. It should
be noted that the E. coli cells used for isolating the
wild-type KDO 8-P phosphatases in both the present study and Ray and
Benedict's study were grown in a glucose minimal medium supplemented
with high levels of inorganic phosphate to repress the synthesis of
alkaline phosphatase. This phosphate-rich growth condition may have
induced the production of the putative high MW yrbI-yrbK
transframe protein. Further studies are under way to distinguish
between these two possible explanations as well as other possible
scenarios for the observed discrepancies in the denatured MWs.
Based on the biochemical characteristics presented here, KDO 8-P
phosphatase can be classified as a specific, low molecular weight acid
phosphatase. Amino acid sequence homology analysis has also been
utilized to classify phosphatase families (30, 31). Such analysis
places KDO 8-P phosphatase into the haloacid dehalogenase (HAD)
superfamily of hydrolases. This family is comprised of haloacid
dehalogenases, epoxide hydrolases, ATPases, phosphomutases, and a
variety of phosphatases, including phosphoserine phosphatase, phosphoglycolate phosphatase, sucrose-6F-phosphate
phosphohydrolase, and trehalose-6-phosphatase (32-35). KDO 8-P
phosphatase, the translated YrbI orf, shares the three highly conserved motifs generally observed in this superfamily of
enzymes (32, 34, 36): motif I, DXDX(T/V); motif
II, (S/T)XX; and motif III, K(G/S)(D/S)XXX(D/N)
(Fig. 6). Although the overall sequence
similarity between members of the HAD superfamily is generally low, a
comparison of the structures of several members of the family
demonstrates a conserved fold and suggests that enzymes in this
superfamily most likely evolved from a common ancestor (37). An
additional signature sequence motif (GGXGAXRE), unique to the KDO 8-P phosphatase-like sequences identified in the gene
data bank, is located in the C-terminal region (Fig. 6). Whether this
signature sequence plays a role in structure and function unique to KDO
8-P phosphatases remains to be determined.
|
During the completion of this study, Parsons et al. (38)
published the crystal structure of the YrbI protein from
Haemophilus influenzae (HI1679, MWcal = 19,432)
solved to 1.67-Å resolution. The H. influenzae YrbI was
tetrameric, and the monomer subunits exhibited an
/
-hydrolase
fold. The active site of each monomer was located at the subunit
interface. The active site was formed mainly by the three conserved
motifs characteristic of the HAD superfamily to which KDO 8-P
phosphatase belongs. A cobalt ion, used for crystallization, was
coordinated at each of the four active sites. Based on structural and
sequence analysis as well as enzymatic assays, the authors tentatively
assigned the function of the protein to be that of a small molecule
phosphatase. Although the true physiological substrate of their
phosphatase was not identified, the authors correctly predicted YrbI to
be the sugar phosphatase. The H. influenzae and E. coli YrbI are 39% identical; thus, the present study not only
confirms their prediction that the H. influenzae YrbI is a
phosphatase but also suggests the substrate for their enzyme.
In summary, the E. coli yrbI orf encodes for the
protein KDO 8-P phosphatase. This is the first characterized gene in
the yrb operon in E. coli and may help provide a
clue to the function of other gene products in this operon. Further
studies on this enzyme may provide useful information in the study of
the evolution and structure/function of the entire HAD superfamily of
enzymes. Additional experiments are in progress to better understand
the discrepancies between the MWs of the recombinant and wild-type KDO
8-P phosphatases. Based on the importance of KDO in the
lipopolysaccharide biosynthetic pathway, inhibition of KDO 8-P
phosphatase will present an attractive target for the design of new
generation antibiotics. The determination of the three-dimensional
structure of the E. coli KDO 8-P phosphatase, now in
progress, as well as the structure of various site-directed mutants, in
the presence of substrate and/or substrate analogues, will further
assist in the elucidation of the mechanism of KDO 8-P phosphatase
catalysis, which will prove invaluable in the design of inhibitors.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. George A. Garcia for kindly providing E. coli BL21 genomic DNA, Dr. Michael Bly for performing two-dimensional gel electrophoresis, and Sherry Williams for performing N-terminal amino acid sequencing. We also thank other members of the Woodard group for helpful discussions.
| |
Note Added in Proof |
|---|
After this paper appeared on the JBC website, Dr. Osnat Herzberg was kind enough to provide us with a sample of recombinant yrbI protein (HI1679) from H. influenzae. Similar to yrbI from E. coli, HI1679 catalyzes the hydrolysis of KDO 8-P to KDO and inorganic phosphate with a specific activity of approximately 420 units/mg in the presence of 1 mM Mg2+. Thus, their original prediction that yrbI from H. influenzae is a sugar phosphatase is correct. The observed MW of recombinant HI1679 (MWcal = 19, 432) as determined by SDS-PAGE was 24 kDa, this is in agreement with our observation that the SDS-PAGE MW observed for the E. coli yrbI is higher than that its calculated MW.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant GM 53069 (to R. W. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: College of
Pharmacy, 428 Church St., Ann Arbor, MI 48109-1065. Tel.:
734-764-7366; Fax: 734-763-2022; E-mail: rww@umich.edu.
Published, JBC Papers in Press, March 14, 2003, DOI 10.1074/jbc.M301983200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: KDO, 3-deoxy-D-manno-octulosonate; KDO 8-P, 3-deoxy-D-manno-octulosonate 8-phosphate; PNPase, purine nucleoside phosphorylase; orf, open reading frame; MW, molecular weight; HAD, haloacid dehalogenase; Mes, 2-(N-morpholino)ethanesulfonic acid.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Raetz, C. R., and Whitfield, C. (2002) Annu. Rev. Biochem. 71, 635-700[CrossRef][Medline] [Order article via Infotrieve] |
| 2. | Raetz, C. R. (1990) Annu. Rev. Biochem. 59, 129-170[CrossRef][Medline] [Order article via Infotrieve] |
| 3. |
Rick, P. D.,
and Osborn, M. J.
(1972)
Proc. Natl. Acad. Sci. U. S. A.
69,
3756-3760 |
| 4. |
Rick, P. D.,
and Osborn, M. J.
(1977)
J. Biol. Chem.
252,
4895-4903 |
| 5. |
Rick, P. D.,
and Young, D. A.
(1982)
J. Bacteriol.
150,
447-455 |
| 6. |
Radaev, S.,
Dastidar, P.,
Patel, M.,
Woodard, R. W.,
and Gatti, D. L.
(2000)
J. Biol. Chem.
275,
9476-9484 |
| 7. | Radaev, S., Dastidar, P., Patel, M., Woodard, R. W., and Gatti, D. L. (2000) Acta Crystallogr. Sect. D Biol. Crystallogr. 56, 516-519[CrossRef][Medline] [Order article via Infotrieve] |
| 8. | Woisetschlager, M., and Hogenauer, G. (1987) Mol. Gen. Genet. 207, 369-373[CrossRef][Medline] [Order article via Infotrieve] |
| 9. |
Woisetschlager, M.,
Hodl-Neuhofer, A.,
and Hogenauer, G.
(1988)
J. Bacteriol.
170,
5382-5384 |
| 10. |
Goldman, R. C.,
Bolling, T. J.,
Kohlbrenner, W. E.,
Kim, Y.,
and Fox, J. L.
(1986)
J. Biol. Chem.
261,
15831-15835 |
| 11. |
Goldman, R. C.,
and Kohlbrenner, W. E.
(1985)
J. Bacteriol.
163,
256-261 |
| 12. | Jelakovic, S., Jann, K., and Schulz, G. E. (1996) FEBS Lett. 391, 157-161[CrossRef][Medline] [Order article via Infotrieve] |
| 13. |
Clementz, T.,
and Raetz, C. R.
(1991)
J. Biol. Chem.
266,
9687-9696 |
| 14. |
Belunis, C. J.,
Clementz, T.,
Carty, S. M.,
and Raetz, C. R.
(1995)
J. Biol. Chem.
270,
27646-27652 |
| 15. |
Tzeng, Y. L.,
Datta, A.,
Strole, C.,
Kolli, V. S.,
Birck, M. R.,
Taylor, W. P.,
Carlson, R. W.,
Woodard, R. W.,
and Stephens, D. S.
(2002)
J. Biol. Chem.
277,
24103-24113 |
| 16. |
Ghalambor, M. A.,
and Heath, E. C.
(1966)
J. Biol. Chem.
241,
3222-3227 |
| 17. | Berger, H., and Hammerschmid, F. (1975) Biochem. Soc. Trans. 3, 1096-1097 |
| 18. |
Ray, P. H.,
and Benedict, C. D.
(1980)
J. Bacteriol.
142,
60-68 |
| 19. | Lanzetta, P. A., Alvarez, L. J., Reinach, P. S., and Candia, O. A. (1979) Anal. Biochem. 100, 95-97[CrossRef][Medline] [Order article via Infotrieve] |
| 20. |
Webb, M. R.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4884-4887 |
| 21. | Rieger, C. E., Lee, J., and Turnbull, J. L. (1997) Anal. Biochem. 246, 86-95[CrossRef][Medline] [Order article via Infotrieve] |
| 22. | Sheflyan, G. Y., Howe, D. L., Wilson, T. L., and Woodard, R. W. (1998) J. Am. Chem. Soc. 120, 11027-11032[CrossRef] |
| 23. |
Dotson, G. D.,
Dua, R. K.,
Clemens, J. C.,
Wooten, E. W.,
and Woodard, R. W.
(1995)
J. Biol. Chem.
270,
13698-13705 |
| 24. |
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402 |
| 25. |
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680 |
| 26. |
Baranov, P. V.,
Gurvich, O. L.,
Fayet, O.,
Prere, M. F.,
Miller, W. A.,
Gesteland, R. F.,
Atkins, J. F.,
and Giddings, M. C.
(2001)
Nucleic Acids Res.
29,
264-267 |
| 27. | Tate, W. P., Mansell, J. B., Mannering, S. A., Irvine, J. H., Major, L. L., and Wilson, D. N. (1999) Biochemistry 64, 1342-1353[Medline] [Order article via Infotrieve] |
| 28. | Engelberg-Kulka, H., and Schoulaker-Schwarz, R. (1994) Mol. Microbiol. 11, 3-8[Medline] [Order article via Infotrieve] |
| 29. | Sekine, Y., Eisaki, N., and Ohtsubo, E. (1994) J. Mol. Biol. 235, 1406-1420[CrossRef][Medline] [Order article via Infotrieve] |
| 30. | Stukey, J., and Carman, G. M. (1997) Protein Sci. 6, 469-472[Abstract] |
| 31. | Thaller, M. C., Schippa, S., and Rossolini, G. M. (1998) Protein Sci. 7, 1647-1652[Abstract] |
| 32. | Aravind, L., Galperin, M. Y., and Koonin, E. V. (1998) Trends Biochem. Sci. 23, 127-129[CrossRef][Medline] [Order article via Infotrieve] |
| 33. | Koonin, E. V., and Tatusov, R. L. (1994) J. Mol. Biol. 244, 125-132[CrossRef][Medline] [Order article via Infotrieve] |
| 34. | Ridder, I. S., and Dijkstra, B. W. (1999) Biochem. J. 339, 223-226 |
| 35. |
Lunn, J. E.,
Ashton, A. R.,
Hatch, M. D.,
and Heldt, H. W.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
12914-12919 |
| 36. | Wang, W., Kim, R., Jancarik, J., Yokota, H., and Kim, S. H. (2001) Structure 9, 65-71[Medline] [Order article via Infotrieve] |
| 37. | Selengut, J. D. (2001) Biochemistry 40, 12704-12711[CrossRef][Medline] [Order article via Infotrieve] |
| 38. | Parsons, J. F., Lim, K., Tempczyk, A., Krajewski, W., Eisenstein, E., and Herzberg, O. (2002) Proteins 46, 393-404[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
A. L. Davidson, E. Dassa, C. Orelle, and J. Chen Structure, Function, and Evolution of Bacterial ATP-Binding Cassette Systems Microbiol. Mol. Biol. Rev., June 1, 2008; 72(2): 317 - 364. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kuznetsova, M. Proudfoot, C. F. Gonzalez, G. Brown, M. V. Omelchenko, I. Borozan, L. Carmel, Y. I. Wolf, H. Mori, A. V. Savchenko, et al. Genome-wide Analysis of Substrate Specificities of the Escherichia coli Haloacid Dehalogenase-like Phosphatase Family J. Biol. Chem., November 24, 2006; 281(47): 36149 - 36161. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Meredith and R. W. Woodard Identification of GutQ from Escherichia coli as a D-Arabinose 5-Phosphate Isomerase J. Bacteriol., October 15, 2005; 187(20): 6936 - 6942. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Proudfoot, E. Kuznetsova, G. Brown, N. N. Rao, M. Kitagawa, H. Mori, A. Savchenko, and A. F. Yakunin General Enzymatic Screens Identify Three New Nucleotidases in Escherichia coli: BIOCHEMICAL CHARACTERIZATION OF SurE, YfbR, AND YjjG J. Biol. Chem., December 24, 2004; 279(52): 54687 - 54694. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Vimr, K. A. Kalivoda, E. L. Deszo, and S. M. Steenbergen Diversity of Microbial Sialic Acid Metabolism Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 132 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Meredith and R. W. Woodard Escherichia coli YrbH Is a D-Arabinose 5-Phosphate Isomerase J. Biol. Chem., August 29, 2003; 278(35): 32771 - 32777. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||