|
Originally published In Press as doi:10.1074/jbc.M302152200 on March 17, 2003
J. Biol. Chem., Vol. 278, Issue 20, 18146-18153, May 16, 2003
Reconstitution of Membrane Proteolysis by FtsH*
Yoshinori
Akiyama and
Koreaki
Ito
From the Institute for Virus Research, Kyoto University,
Kyoto 606-8507, Japan
Received for publication, March 3, 2003
 |
ABSTRACT |
Escherichia coli FtsH is a
membrane-bound and ATP-dependent protease responsible for
degradation of several membrane proteins. The FtsH action is processive
and presumably involves dislocation of the substrate from the membrane
to the cytosol. Although elucidation of its molecular mechanism
requires an in vitro reaction system, in vitro
activities of this enzyme against membrane protein substrates have only
been assayed using detergent-solubilized components. Here we report on
the construction of in vitro reaction systems for
FtsH-catalyzed membrane protein degradation. A combination of two
inverted membrane vesicles or of two proteoliposomes, one bearing the
enzyme and the other bearing a substrate, was fused by polyethylene
glycol 3350 treatment. Addition of ATP then resulted in degradation of
the substrate. It was shown that FtsH can function in the process of
membrane proteins degradation without aid from any other cellular factors.
 |
INTRODUCTION |
Cells respond to accumulation of abnormal proteins not only in the
cytosol but also in membranes. Thus, a certain class of abnormal
membrane proteins must be degraded rapidly. Despite the importance of
membrane protein degradation, our knowledge about these processes is
limited because of difficulty arising from the membrane localization of
both substrates and enzymes. For instance, a question of how a peptide
bond that is embedded within the lipid bilayer can receive efficient
hydrolysis must be answered.
Among the ATP-dependent proteases, ClpPX, ClpAX, HslUV,
Lon, and FtsH, of Escherichia coli, FtsH is unique in that
it is membrane-integrated and that its substrates include integral
membrane proteins (1, 2). The membrane localization of FtsH is crucial
for its ability to degrade membrane proteins (3). Intriguingly, the
proteolytic activity of FtsH is stimulated by the proton motive force
(PMF)1 across the membrane
(4). Three membrane proteins have been identified as native substrates
of this enzyme. Two of them, the SecY subunit of protein translocase
(5, 6) and subunit a of F1F0-ATPase
(Foa) (7), are degraded rapidly in unassembled states. YccA,
a multispanning membrane protein of unknown function, may be
constitutively degraded, although it is not known whether this protein
forms any complex (8). In addition, FtsH is known to degrade several
soluble proteins (1, 2).
FtsH contains two transmembrane segments located N-terminally
and a large cytoplasmic domain, which consists of two subdomains, an
AAA ATPase domain and a protease domain with a zinc metalloprotease motif (HEXXH) (9). FtsH forms a homo-oligomer, and this
feature is essential for the ATPase and the protease activities (3, 10,
11). FtsH is also known to interact with a pair of membrane proteins,
HflK and HflC, that forms a complex (HflKC) (12). HflKC may have a
regulatory role in the proteolytic functions of FtsH (8, 13). In
vivo, FtsH exists exclusively as a large complex (estimated
molecular mass of more than 1000 kDa) with HflKC in the cytoplasmic
membrane.2
We proposed that FtsH exerts proteolysis against the entire molecule of
a membrane-integrated substrate by dislocating it to the cytosolic side
of the membrane (3, 14). This was based on our in vivo
analyses using model membrane proteins. A YccA derivative,
YccA-(P3)-PhoA-His6-Myc, was one of them. It was a chimeric
protein having a PhoA (alkaline phosphatase mature part) sequence
inserted within the third periplasmic region of this protein, which
also contains C-terminally attached His6 and Myc tags. The
folding state of the PhoA domain can be manipulated as its tight
folding depends on the formation of the intramolecular disulfide bonds.
Degradation of this fusion protein by FtsH only occurred when it had an
intact N-terminal cytoplasmic tail. Although the degradation went to
completion when the PhoA moiety was unfolded, it stopped before the
PhoA domain when it was folded, leaving a degradation product
(I60) that contained the PhoA and its C-terminal regions up
to the His6-Myc tag. These degradation processes were dependent on FtsH and took place only as continuation of proteolysis initiated at the N-terminal region of the substrate. Thus, the reaction
must have been processive, which is aborted before a tightly folded
domain, a probable obstacle for the dislocation process.
It was shown further that the degradation initiation requires
cytoplasmic exposure of some 20 amino acids or longer N-terminal tail
(15). FtsH is also able to recognize a C-terminal tail for initiation
of membrane protein degradation (16). For our further understanding of
the molecular mechanisms of polypeptide extraction from the membrane
and presentation to the proteolytic active site, it is essential to
develop an in vitro system, in which membrane protein
degradation by FtsH can be studied using membrane-integrated enzyme and substrates.
Here we report on the use of polyethylene glycol 3350 (PEG3350) to
induce fusion of vesicles bearing the enzyme and a substrate, and
thereby to reproduce subsequent degradation of the substrate upon
addition of ATP. We were thus able to reconstitute
ATP-dependent proteolysis of lipid bilayer-integrated
substrates using purified components. Our results indicate that the
dislocation-accompanied proteolytic event can occur without involving
other cellular factors such as the Sec translocation channel.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains and Media--
E. coli K12 strains
used were as follows. TYE024
(ompT::kan/F'lacIq)
(10) and AD1434 ( ftsH sfhC21
unc/F'lacIq) (4) were derivatives of
CU141 [araD139 (argF-lac)U169 rpsL150 relA1 flbB5301 deoC1 ptsF25
rbsR/F'lacIqZ+Y+
pro+] (17). AR5090 ( ftsH sfhC21
degP5087/F'lacIq) (3, 18) was a derivative of
JM103 [ (lac-pro) endA sbcB15 hsdR thi rpsL
supE/F'lacIq traD36
proAB+ lacZ M15] (19). For
construction of AD1680 (CU141, sfhC21
zhd-220::Tn10 ftsH3::kan
prc::cat), the
prc::cat maker was first introduced into AB1157 (20) carrying pKM201(Ptac-red-gam) (a gift of K. Murphy) by linear transformation using a DNA fragment amplified from
the chromosomal DNA of AK2168 (21) with a pair of primers (GAGGCCGGGCCAGGCATGAACATGTTTTTTAGGCTTACCGTATCTTCCTGGCATCTTCCAG and
GCTTCGCCAGATCGAGTGCGATATTCACCGTCTCATCCAGCATCTGTATTAACGAAGCGC). Then the prc::cat maker was
P1-transduced into AD1672 (CU141, sfhC21
zhd-220::Tn10
ftsH3::kan) (22) that had been constructed by
successive transductions of sfhC21 (23) and
ftsH3::kan (17) into CU141. AD1680 was
used for purification of YccA-HA-His6-Myc and
YccA11-HA-His6-Myc as the Prc (Tsp) protease was found to cleave the C-terminal periplasmic tails of these proteins in
vivo (data not shown).
L (24) and Terrific (25) media were supplemented with ampicillin (50 µg/ml), chloramphenicol (20 µg/ml), tetracycline (25 µg/ml),
kanamycin (25 µg/ml), and/or rifampicin (1 µg/ml), as required, for
selection and screening of transductants and transformants as well as
for cultivation of plasmid-bearing cells.
Plasmids--
pSTD113 (encoding FtsH-His6-Myc) (10),
pKH303 (YccA-His6-Myc) (8), and pKH412
[YccA-(P3)-PhoA-His6-Myc] (14) were described previously. pSTD537 (YccA-HA-His6-Myc) and pSTD562
(YccA11-HA-His6-Myc) were constructed in the following way.
pKH379 (14), which had been constructed from pKH330
(YccA-His6-Myc) (8) by inserting the SpeI
recognition sequence (ACTAGT) between G896 and
C897 corresponding to the third periplasmic domain of YccA
(14), was mutagenized using mutagenic primers
(GCGTTAGTGTTCTTCGCCGCCTCTGCATATGTGCTG and
CAGCACATATGCAGAGGCGGCGAAGAACACTAACGC) to replace Cys-119 and Cys-120 by alanine. The resulting plasmid was further mutagenized to
insert a sequence encoding a hemagglutinin (HA) tag into the YccA-His6 boundary (primer,
GGCTTCGCTAGCCGCGATTATCCGTATGATGTGCCGGATTATGCGGGATCCGAATTCATCGAAGGCCG) and then to attach two cysteine residues at the C terminus (primer, GCAAACGTTGCTGCTAAGGTACCG), yielding pSTD537. pSTD538 was constructed by
introducing the yccA11 mutation into pSTD537 by
site-directed mutagenesis (primer,
AAACAGCTATGGATCGTATTTCACTGCTTAGCACCCATAAG). Proteins encoded by
pSTD357 and pSTD358 are called simply YccA-HA-His6-Myc and
YccA11-HA-His6-Myc, respectively, in this paper, as the Cys to Ala changes and the addition of two cysteines to the C terminus of
YccA were not relevant to this work. pKH425 (Foa) carried an HindIII-VspI blunt-ended atpB fragment
from pBWU113 (26) cloned into the SmaI site of pSTV29
(Takara Shuzo). pKH379 and pKH425 were gifts from A. Kihara.
Preparation of IMVs--
Cells of AD1434/pSTD113, AD1434/pKH425,
AD1434/pKH412, and AR5090 were precultured at 30 °C in 100 ml of
Terrific broth containing 0.1% glucose. They were inoculated into 1 liter of L medium and grown at 37 °C for 3 h. To induce the
plasmid-encoded proteins, 1 mM
isopropyl-1-thio- -D-galactopyranoside and 1 mM cAMP were included in L media. IMVs were prepared
essentially as described previously (4).
Purification of the FtsH-His6-Myc Protein and the
YccA Derivative Proteins--
Cells of TYE024/pSTD113, AR5090/pKH303,
AD1680/pSTD537, and AD1680/pSTD562 were precultured as above,
inoculated into 1 liter of L medium containing 1 mM
isopropyl-1-thio- -D-galactopyranoside and 1 mM cAMP, and grown at 37 °C for 3 h. Cells were
disrupted by a French press, and total membranes were prepared by
ultracentrifugation. Membrane proteins were solubilized with 0.5%
Nonidet P-40, and hexahistidine-tagged proteins were purified by a
nickel-nitrilotriacetic acid-agarose column chromatography with elution
with linear imidazole gradient, as described previously (6), except
that the concentration of Nonidet P-40 was 0.1% for buffers used for
nickel-nitrilotriacetic acid affinity chromatography. Peak fractions of
a protein were combined, dialyzed extensively against dialysis buffer
(10 mM Tris-HCl (pH 8.1), 10% glycerol, 10 mM 2-mercaptoethanol, 0.1% Nonidet P-40), and loaded onto
a mini Q column. After washing the column with 2 column volumes of wash
buffer (10 mM Tris-HCl (pH 8.1), 10% glycerol, 1 mM dithiothreitol (DTT), 0.1% Nonidet P-40), bound
proteins were eluted with 20 column volumes of 0 to 0.5 M
NaCl linear gradient in wash buffer. Peak fractions of a protein, as
detected by SDS-PAGE and Coomassie Brilliant Blue R-250 staining, were
dialyzed extensively against the dialysis buffer and stored at
80 °C.
Preparation of Proteoliposomes--
Typically, 13.22 µl of the
purified sample of FtsH-His6-Myc (8 µg) or one of the
YccA derivatives (0.44 µg) was mixed with a 3-µl suspension of 50 mg/ml E. coli phospholipids in 50 mM Tris-HCl (pH 8.1), 1 mM DTT, 1 µl of 1 M KCl, 1 µl
of 1 M Tris-HCl (pH 8.1), 1.28 µl of 12.5%
O-n-octyl -D-glucopyranoside, and 0.5 µl of
40 mM DTT for incubation at 0 °C for 20 min. The mixture (20 µl) was then diluted with 1 ml of dilution buffer (50 mM Tris-HCl (pH 8.1), 50 mM KCl, 1 mM DTT, 5 mM ADP) and kept at 0 °C for 10 min. ADP was found to facilitate reconstitution of
FtsH.3 After removal of large
aggregates by centrifugation at 10,000 rpm for 5 min using a
microcentrifuge, proteoliposomes were recovered by ultracentrifugation
and suspended in 20 µl of dilution buffer without ADP.
PEG3350-induced Fusion of IMVs and Proteoliposome
Vesicles--
IMV or reconstituted liposomes were incubated in the
presence of 50 mM MOPS (pH 7.0), 0.5 M KCl, and
12.5% PEG3350 at 37 °C for 5 min. That this procedure indeed
induced the vesicle fusion was shown by FRET cancellation and dynamic
light scattering measurements. For fluorospectrometry (27),
liposomes were prepared as described above except that
N-(7-nitro-2,1,3-benzoxadiazol-4-yl)-dioleoylphosphatidylethanolamine (NBD-PE) and N-(lissamine rhodamine B
sulfonyl)- dioleoylphosphatidylethanolamine (Rh-PE) were added to
occupy 0.8% (w/w) of the phospholipids. The fluorescent liposomes were
then mixed with 4-fold weight excess of non-labeled proteoliposomes and
treated with 12.5% PEG3350 at 0 or 37 °C. The extent of liposome
fusion was assessed from the NBD emission intensity, from which that of
PEG-untreated and 0 °C incubated sample was subtracted and that of
0.5% Triton X-100-treated sample (after correction of the quenching by
the detergent) was set as 100%. To quench NBD fluorescence in the
outer leaflet of the liposome, NBD- and Rh-labeled liposomes were
preincubated with 20 mM sodium dithionite at 0 °C for 30 min, followed by removal of excess sodium dithionite by microspin S-400
HR column chromatography. Size distribution profiles of IMVs were
determined by dynamic light scattering measurements using FPAR-1000
fiber optics particle analyzer (Photal Otsuka Electronics) and the
CONTIN program according to the manufacturer's instructions.
Membrane Protein Degradation Reactions--
PEG3350-fused IMVs,
which contained FtsH and a substrate membrane protein, were treated
with or without 250 mM DTT at 37 °C for 10 min. They
were diluted 10-fold with degradation assay buffer containing 50 mM Tris-HCl (pH 8.1), 5 mM MgCl2,
25 µM zinc acetate, 10 mM 2-mercaptoethanol,
and 5 mM sodium succinate and incubated at 37 °C in the
presence or absence of either 5 mM ATP or 5 mM ADP. YccA degradation reactions with PEG3350-fused liposomes were carried out similarly without a prior DTT treatment. At each time point
of reactions, a portion was withdrawn and mixed with more than 30-fold
volumes of 5% trichloroacetic acid. Protein precipitates were
collected by centrifugation, washed with acetone, and dissolved in SDS sample buffer. Proteins were then analyzed by SDS-PAGE and
immunoblotting, essentially as described previously (3).
 |
RESULTS |
Membrane Vesicle Fusion Can be Induced by PEG3350--
In
vitro reaction systems using detergent-solubilized enzyme and
substrates are unsuitable for characterizing the activities of FtsH to
degrade membrane-integrated substrates, because such important features
as the dislocation and the PMF stimulation cannot be addressed. Because
it is difficult to prepare membrane vesicles carrying both FtsH and its
degradation substrate, we attempted to prepare separate membrane
vesicles, one carrying the enzyme and the other carrying a substrate.
These membrane vesicles should then be fused to enable the
enzyme-substrate interaction. Our initial trials of several conditions
that had been reported to induce membrane fusion indicated that
treatment of the enzyme vesicles and the substrate vesicles with
PEG3350 resulted in an ATP-dependent degradation of the
latter (see below).
We verified the PEG-induced fusion of membrane vesicles by two
independent methods (Fig. 1). First,
dynamic light scattering measurements (Fig. 1A) indicated
that incubation of a mixture of inverted membrane vesicles with PEG3350
at 37 °C for 5 min resulted in a marked shift in the mean vesicle
sizes, from 185 (± S.D. of 52.7) to 1322.9 nm (± 261.6) with no
appreciable overlapping or shouldering of the two curves. Similar
PEG3350-dependent size shift was observed with
reconstituted proteoliposomes (22).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
Membrane fusion is induced by PEG3350
treatment. A, size distribution of membrane vesicles.
IMVs were prepared from cells of AD1434 ( ftsH)/pSTD425
(Foa) and from cells of AD1434 ( ftsH)/pSTD113
(FtsH-His6-Myc). They were mixed and incubated with
(filled circles) or without (open circles) 12.5%
PEG3350. The samples were diluted with 10 mM Tris-HCl (pH
8.1) and subjected to dynamic light scattering measurements. Results
are shown as calculated vesicle sizes. B, effects on FRET
between two fluorophores attached to phosphatidylethanolamine.
Liposomes were prepared from E. coli phospholipids to which
0.8 weight % NBD-PE and Rh-PE were added. They were then mixed with
4-fold excess weight of non-labeled liposomes and treated with 12.5%
PEG3350 at 0 or 37 °C for the indicated times. The NBD fluorescence
intensity was measured and expressed as % fusion as described under
"Experimental Procedures." C, lipid mixing in the inner
leaflet of liposomes. NBD-PE- and Rh-PE-containing liposomes were
incubated with or without dithionite and subsequently fused by PEG3350
treatment. Relative NBD fluorescence intensities of
dithionite-treated and untreated vesicles (right) as
well as estimated extents of vesicle fusion with these vesicles
(left) are shown.
|
|
Second, fluorescence resonance energy transfer (FRET) experiments (Fig.
1, B and C) provided evidence for PEG-induced
mixing of phospholipids. Liposomes were prepared in the presence of
NBD-PE and Rh-PE. These liposomes contained sufficiently high
concentrations of NBD-PE and Rh-PE such that NBD fluorescence was
quenched by Rh-PE due to FRET. Liposome solubilization with Triton
X-100 resulted in the elimination of the FRET and a marked increase in
NBD fluorescence (data not shown). Liposomes doubly labeled with NBD-PE
and Rh-PE were mixed with 4-fold excess amount of unlabeled liposomes.
The mixture was incubated in the presence or absence of 12.5% PEG3350 (Fig. 1B). After 1 min of incubation at 0 °C, about 13%
of the maximum fluorescence observed in the presence of Triton X-100 was observed with the PEG-treated sample. This value increased to more
than 50% after prolonged incubation at 37 °C (for 10-30 min).
PEG-untreated samples showed only negligible increase in fluorescence.
We then examined whether PEG-induced lipid mixing occurred not only for
the outer leaflet but also for the inner leaflet of the liposomes (Fig.
1C). The fluor-labeled liposomes were treated with a
membrane-impermeable bleach, dithionite, prior to the PEG3350 treatment. Dithionite treatment decreased the initial NBD fluorescence by 45%, indicating that the outer leaflet was mostly bleached. Essentially, the remaining fluorescence should have come from the inner
leaflet. Upon PEG3350 treatment, the dithionite-treated liposomes
exhibited similar levels of NBD fluorescence dequenching as the
untreated liposomes. Thus, PEG3350-induced lipid mixing occurs for both
leaflets, indicating a complete fusion of the vesicles. Taken together,
we have established an effective procedure for membrane vesicle fusion
in vitro.
FtsH-dependent Degradation of Foa in IMVs upon PEG3350
Treatment--
We applied this simple membrane fusion technique using
PEG3350 to our FtsH studies. Inverted membrane vesicles were prepared from two E. coli strains, one overproducing FtsH and the
other overproducing Foa, an FtsH substrate. These IMVs were
mixed and incubated in the presence of 12.5% PEG3350 at 37 °C for 5 min. Subsequently, they were incubated further in the presence (Fig. 2, lanes 5-8) or absence
(lanes 1-4) of ATP. Foa, as detected by
anti-Foa immunoblotting, was degraded with time in the
presence of ATP but not in its absence. When IMVs from FtsH-deleted
cells were used instead of the FtsH-containing IMVs (lanes
9-12), no degradation of Foa was observed. Also,
omission of the pretreatment with PEG3350 (lanes 13 and
14) resulted in no appreciable degradation of the substrate
even after 4 h of incubation. YccA, another membrane-integrated substrate of FtsH, was also degraded in an ATP- and
FtsH-dependent manner in PEG3350-treated IMV (data not
shown). These results indicate that PEG3350 treatment induces membrane
fusion, allowing FtsH to ATP-dependently hydrolyze
membrane-integrated substrates in the fused vesicles.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
FtsH degradation of Foa in
the PEG3350-treated IMVs. The IMVs prepared from cells of AD1434
( ftsH)/pSTD425 (Foa) were mixed with those
from cells of AD1434 ( ftsH)/pSTD113
(FtsH-His6-Myc) (lanes 1-8, 13, and
14) or from cells of AR5090 ( ftsH)
(lanes 9-12). The mixtures were treated with (lanes
1-12) or without (lanes 13 and 14) 12.5%
PEG3350 at 37 °C for 5 min. They were diluted and incubated further
at 37 °C in the presence (lanes 5-14) or absence
(lanes 1-4) of 5 mM ATP. Samples were withdrawn
at the indicated time points and analyzed by 15% acrylamide, 0.12%
N,N'-methylenebisacrylamide gel electrophoresis
and anti-Foa immunoblotting.
|
|
Degradation of YccA-(P3)-PhoA in Vitro--
The PhoA portion of
the YccA-(P3)-PhoA-His6-Myc fusion protein can be either
folded tightly or unfolded depending on the presence or absence of the
intramolecular disulfide bonds (28, 29). We characterized IMVs carrying
YccA-(P3)-PhoA-His6-Myc.
YccA-(P3)-PhoA-His6-Myc was expressed in AD1434
( ftsH) cells, and IMVs were prepared. They were treated
with or without 250 mM DTT at 37 °C for 10 min and then
digested with trypsin (Fig. 3). Whether
or not the DTT pretreatment was included,
YccA-(P3)-PhoA-His6-Myc was converted by trypsin to a
slightly smaller species that remained stable up to 120 min of
incubation (lanes 1-12). Because YccA has the cytosolic N
terminus and the periplasmic C terminus, trypsin must have removed the
N-terminal tail of this chimeric protein in IMV. On the other hand,
when the IMV was solubilized with Triton X-100 before trypsin
digestion, a smaller degradation product corresponding to PhoA was
produced (lanes 13-15 and 19-21). This PhoA
product was further degraded almost completely for the DTT-pretreated sample (lanes 16-18); no degradation occurred without DTT
(lanes 22-24). These results indicate that the PhoA portion
of YccA-(P3)-PhoA-His6-Myc can be reduced and unfolded by
DTT treatment. It was also shown that this fusion protein assumes the
expected orientation in the IMV. The integrity of the IMVs was also
confirmed. Essentially the same results were obtained after
PEG3350-induced fusion of the IMVs (data not shown). Although these
results suggest that DTT treatment disrupted the intramolecular
disulfide bonds in the PhoA domain, neither DTT nor PEG3350 affected
the integrity of the membrane vesicles.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 3.
Characterization of
YccA-(P3)-PhoA-His6-Myc in IMVs. IMVs were prepared
from cells of AD1434 ( ftsH)/pKH412
[YccA-(P3)-PhoA-His6-Myc] and pre-treated with
(lanes 1-6 and 13-18) or without (lanes
7-12 and 19-24) 250 mM DTT at 37 °C
for 10 min. They were then treated with 50 µg/ml trypsin at 0 °C
in the presence (lanes 13-24) or absence (lanes
1-12) of 1% Triton X-100. At each time point, a portion was
withdrawn and mixed with 5% trichloroacetic acid. Proteins were
analyzed by 10% SDS-PAGE and anti-PhoA immunoblotting. P3 and PhoA'
indicate the intact YccA-(P3)-PhoA-His6-Myc protein and the
trypsin-generated PhoA-sized fragment, respectively. Lane M
is for molecular size markers (81.8, 68.4, 55.0, and 41.6 kDa from
top to bottom).
|
|
IMVs from FtsH-overproducing cells and those from
YccA-(P3)-PhoA-His6-Myc-overproducing cells were subjected
to PEG3350-mediated fusion. The fused vesicles were treated with or
without DTT and incubated in the presence or absence of ATP (Fig.
4). Intensity of the intact band of
YccA-(P3)-PhoA-His6-Myc decreased with time only in the
presence of ATP (Fig. 4A, upper panel,
lanes 4-6 and 10-12; lower
panel, circles). Without DTT treatment, this
degradation was accompanied by the generation of a fragment of an
identical electrophoretic mobility as I60 (Fig.
4A, upper panel, lanes 4-6; lower panel, open squares). This 60-kDa fragment
contained both the PhoA and the Myc epitopes (Fig. 4B,
lanes 1-9), indicating that it corresponded to the in
vivo observed I60 product (14). In the DTT-treated
sample, little accumulation of I60 was observed (Fig.
4A, upper panel, lanes 7-12;
lower panel, solid squares). These results
completely agree with the in vivo observations. It is thus
concluded that our in vitro system can reproduce the in vivo mode of membrane protein degradation catalyzed by
FtsH. Probably the dislocation mechanism is also taking place in
vitro. This point was supported by the following experiments (Fig.
5).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
In vitro degradation of
YccA-(P3)-PhoA-His6-Myc stops before the folded PhoA
domain. A, degradation of
YccA-(P3)-PhoA-His6-Myc in DTT-treated and untreated
vesicles. IMV were prepared from cells of AD1434
( ftsH)/pSTD113 (FtsH-His6-Myc) and from cells
of AD1434 ( ftsH)/pKH412
[YccA-(P3)-PhoA-His6-Myc]. They were fused by PEG3350
treatment and treated with (lanes 1-6) or without
(lanes 7-12) 250 mM DTT, followed by incubation
at 37 °C in the presence (lanes 4-6 and
10-12) or absence (lanes 1-3 and
7-9) of 5 mM ATP as indicated. Proteins were
analyzed by 10% SDS-PAGE and anti-PhoA immunoblotting. I60
indicates a fragment of YccA-(P3)-PhoA-His6-Myc comprising
a region from the PhoA moiety to the C-terminal His6-Myc
tag. The band intensities of the intact
YccA-(P3)-PhoA-His6-Myc protein at time 0 were set as
100%, and the relative values of YccA-(P3)-PhoA-His6-Myc
in the absence of ATP (triangles) and those of
YccA-(P3)-PhoA-His6-Myc (circles) and
I60 (squares) in the presence of ATP were
plotted in the graph. Filled and open symbols are
for the DTT-treated and untreated samples, respectively. B,
degradation of YccA-(P3)-PhoA-His6-Myc after detergent
solubilization. IMVs were prepared from cells of AD1434
( ftsH)/pSTD113 (FtsH-His6-Myc) and from cells
of AD1434 ( ftsH)/pKH412
[YccA-(P3)-PhoA-His6-Myc]. They were fused by PEG3350
treatment and incubated at 37 °C with (lanes 4-9 and
13-18) or without (lanes 1-3 and
10-12) 5 mM ATP in the presence (lanes
10-18) or absence (lanes 1-9) of 1% Nonidet P-40.
Proteins were analyzed by 10% SDS-PAGE and anti-PhoA or anti-Myc
immunoblotting as indicated.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5.
Continued processivity of degradation into
I60 as revealed by DTT-induced unfolding of the PhoA
moiety. IMVs were prepared from cells of AD1434
( ftsH)/pSTD113 (FtsH-His6-Myc) and from cells
of AD1434 ( ftsH)/pKH412
[YccA-(P3)-PhoA-His6-Myc]. They were fused by PEG3350
treatment and incubated at 37 °C for 90 min in the presence of 5 mM ATP. Subsequently, sample was treated with (filled
symbols) or without (open symbols) 250 mM
DTT at 37 °C for 10 min and then incubated further in the presence
of 5 mM ATP (triangles) or of AMP-PNP
(squares). The intensity of the I60 band at the
90-min incubation point is set as 100%, and relative values are
plotted. The arrow indicates the point of DTT
treatment.
|
|
The PEG3350-fused membranes were first incubated in the presence of ATP
to accumulate I60. They were then treated with or without
DTT, followed by the second incubation in the presence of ATP or
AMP-PNP. Further incubation of the DTT-treated sample with ATP resulted
in a gradual decrease in the I60 intensity (Fig. 5,
filled triangles). Such a decrease did not occur when
AMP-PMP was used instead of ATP (filled squares). Without
DTT treatment, I60 accumulation continued (open
triangles). These results suggest that I60 was not in
a dead-end state but was competent to receive further degradation by
FtsH, which might resume proteolysis of the PhoA moiety after its
unfolding. Thus, processivity continues over the chronological gap,
when the steric obstacle has been removed.
When the fused membranes were solubilized with Triton X-100 and
incubated with ATP, a new fragment of about 57 kDa, termed I57, was produced (Fig. 4B, lanes
10-18). Like I60, I57 cross-reacted with
anti-PhoA and anti-Myc (lanes 13-18), suggesting that it was an N-terminally shortened version of I60. Degradation
by FtsH might have been halted by the membrane at an earlier position than the position of steric hindrance by the folded PhoA domain itself.
Even in the presence of Nonidet P-40 some I60-like fragment was also observed. It might be possible that detergent micelles that
are bound to the transmembrane regions acted like the membrane to
partially arrest the processive degradation process.
Reconstitution of Membrane Protein Degradation from Purified
Components--
We then attempted to establish a more defined in
vitro system that reconstitutes the FtsH-catalyzed membrane
protein degradation. We constructed a model substrate,
YccA-HA-His6-Myc, having an HA tag sequence inserted
between YccA and the His6-Myc tag, as well as its
derivative (YccA11-HA-His6-Myc) having the
yccA11 internal deletion of 8 amino acids in the N-terminal
cytoplasmic region. The YccA11 alteration renders this protein
resistant to FtsH in vivo. These YccA derivatives as well as
FtsH were purified from membranes after their overproduction (Fig.
6).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 6.
Purified preparations of the
FtsH-His6-Myc protein and the YccA-related proteins.
Purified samples of FtsH-His6-Myc (lane 1; 0.6 µg), YccA-His6-Myc (lane 2; 0.33 µg),
YccA-HA-His6-Myc (lane 3; 0.33 µg), and
YccA11-HA-His6-Myc (lane 4; 0.41 µg) were
subjected to 12.5% SDS-PAGE, and the gel was stained with Coomassie
Brilliant Blue. Positions of molecular size markers are indicated on
the left. The C-terminally self-processed form of FtsH (34)
is indicated by circle.
|
|
Each of these preparations was mixed with E. coli
phospholipids and diluted to lower detergent concentration to
reconstitute proteoliposomes. Integral association of each protein with
the liposomes was demonstrated by their resistance to extraction with 0.2 N NaOH or 1 M NaCl (data not shown).
Protein orientation in the proteoliposomes was examined by proteinase K
digestion. Reconstituted FtsH was mostly accessible by proteinase K
(Fig. 7A), indicating that its
ATPase and protease domains were exposed outside the vesicles.
Proteinase K digestion of the reconstituted YccA derivatives removed
the N-terminal segment (Fig. 7, B-D), and this digestion pattern was similar to the proteinase K digestion pattern of
YccA-HA-His6-Myc in IMVs (Fig. 7F). The
proteoliposome-associated YccA was completely degraded upon membrane
solubilization with Triton X-100 (Fig. 7, B-D), as was
YccA-His6-Myc in IMV (Fig. 7F).
Proteoliposome-reconstituted YccA11-HA-His6-Myc behaved
similarly to the "wild-type" counterpart, but the proteinase
K-removed part was smaller (Fig. 7, C and D), consistent with the shortening of the N-terminal tail by the
yccA11 deletion mutation. It was thus indicated that each of
the reconstituted FtsH proteins and the reconstituted YccA proteins had
the same topology as in IMV.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Trypsin digestion determination of the
topology of the proteins reconstituted into liposomes.
A-D, each of purified preparations of
FtsH-His6-Myc (A), YccA-His6-Myc
(B), YccA-HA-His6-Myc (C), and
YccA11-HA-His6-Myc (D) was reconstituted
separately with E. coli phospholipids into proteoliposomes.
E, FtsH-His6-Myc and YccA-His6-Myc
were first mixed and then reconstituted simultaneously into
proteoliposomes. F, IMVs containing
YccA-HA-His6-Myc were prepared from cells of AD1680/pSTD537
(YccA-HA-His6-Myc). The proteoliposomes and the IMV were
treated with 0.5 mg/ml proteinase K at 0 °C for the indicated time
in the presence or absence of 1% Triton X-100. Proteins were
visualized by anti-Myc immunoblotting.
|
|
One might argue that a simpler procedure would be to mix the enzyme and
a substrate at low temperature and then to subject the mixture to
reconstitution, making the vesicle fusion step unnecessary. To test
this possibility, we carried out mixed reconstitution using
YccA-HA-His6-Myc and FtsH. However,
YccA-HA-His6-Myc in the resulting proteoliposomes was now
completely digested by proteinase K even in the absence of a detergent
(Fig. 7E). FtsH might have bound to
YccA-HA-His6-Myc in solution and prevented its correct integration into the liposomes. Thus, simultaneous reconstitution with
the enzyme is not appropriate at least for this substrate.
The FtsH proteoliposomes and the YccA proteoliposomes were subjected to
PEG3350-mediated fusion. The fused proteoliposomes were incubated at
37 °C in the presence of ATP or ADP, and
YccA-HA-His6-Myc was analyzed by anti-Myc (Fig.
8) and anti-HA (data not shown) immunoblotting. ADP was included in the control samples, because purified FtsH tended to aggregate when incubated at 37 °C without any nucleotide (data not shown). YccA-His6-Myc (Fig. 8,
A and F) and YccA-HA-His6-Myc (Fig.
8, B and F) were degraded with time in an
ATP-dependent manner. Without prior PEG3350 treatment,
YccA-HA-His6-Myc was not measurably degraded (Fig. 8,
C and F). Also, no YccA-HA-His6-Myc degradation was observed when YccA-HA-His6-Myc
proteoliposomes were fused with liposomes without any protein (data not
shown).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 8.
Degradation of the YccA derivatives in
reconstituted proteoliposomes after fusion with FtsH-bearing
proteoliposomes. A-D, 10 µl of the
FtsH-His6-Myc proteoliposomes were mixed with 3 µl of
those containing YccA-His6-Myc (A),
YccA-HA-His6-Myc (B and C), or
YccA11-HA-His6-Myc (D). The mixtures were
treated with (A, B, and D) or without
(C) PEG3350 and then incubated at 37 °C in the presence
or absence of 5 mM ATP. E, 1.2 µg of
FtsH-His6-Myc and 0.14 µg of
YccA11-HA-His6-Myc was incubated at 37 °C with 5 mM ATP or ADP in the presence of 0.5% Nonidet P-40.
Samples were withdrawn at the indicated time points and analyzed by
12.8% Tricine gel electrophoresis and anti-Myc immunoblotting.
F, quantitation of the results in B-D. The band
intensity of each protein at time 0 was set at 100%, and the relative
values are plotted.
|
|
YccA11-HA-His6-Myc was not degraded in the fused
proteoliposomes even in the presence of an excess amount of FtsH (Fig.
8, D and F). On the other hand, it received
significant proteolysis by excess FtsH under detergent-solubilized
conditions (Fig. 8E). Although our previous results
indicated that YccA11 was less susceptible to degradation by FtsH even
in detergent extracts (8), the YccA11 effect was clearly seen in the
lipid bilayer-integrated assay system. These results support the notion
that proteolysis in the reconstituted system was initiated from the
N-terminal region.
If FtsH had not been able to dislocate YccA-HA-His6-Myc in
this system, the degradation product lacking only the N-terminal cytosolic tail should have been produced; even if some internal degradation initiation occurred, a C-terminal
TM7-HA-His6-Myc fragment (~7 kDa) should have been
produced. However, no degradation products was detected by 12.8%
Tricine/SDS-PAGE that can resolve down to ~3-kDa polypeptides.
Assuming that the FtsH-active sites remain cytosolic during the
reaction, the above results suggest that the degradation reaction in
the reconstituted liposomes was accompanied by substrate dislocation.
FtsH can catalyze this mode of membrane protein degradation without any
aid from any other protein factors.
 |
DISCUSSION |
In this study, we succeeded in reproducing the FtsH-catalyzed
membrane protein degradation in vitro, using the enzyme and substrates, both of which were integrated into the lipid bilayer of
either IMVs or reconstituted proteoliposomes. Recently, much attention
has been directed to the importance of proteolytic reactions that occur
in the vicinity of a membrane. Such reactions not only serve as a
quality control device to eliminate unwanted membrane proteins but also
as a regulatory mechanism, in which a membrane protein is cleaved to
liberate and activate a regulatory domain (30). However, biochemical
and molecular characterization has only insufficiently been conducted
for membrane-integrated proteases. Although their enzymatic reactions
in solution can be studied in vitro in the presence of a
detergent and such reactions will provide some important information on
the reaction parameters of the protease, many pertinent questions can
only be answered by examination of reactions in which both the enzyme
and substrates are engaged in their membrane-integrated states.
We have shown here that PEG3350 treatment is a simple and effective
method to induce fusion of membrane vesicles, and thereby to initiate
interaction between a membrane-bound enzyme and a membrane-bound
substrate. The size measurement results indicated that the PEG3350
treatment induces fusion of an average of ~50 vesicles. As this
method proved effective for both native IMVs and artificial
proteoliposomes, it can probably be used for membrane vesicles of
diverse biological sources. However, for in vitro analysis
to be possible, membrane vesicles should be in such an orientation, in
which enzymatic active site of the protease faces the external milieu,
whose composition can easily be manipulated. The substrate should also
assume the compatible orientation in the membrane vesicles.
Fortunately, in our present case, the availability of inverted membrane
vesicles and the asymmetric reconstitution of both FtsH and YccA
allowed the strategy described above.
The mode of YccA-(P3)-PhoA-His6-Myc degradation in the
fused IMVs was very similar to that observed in vivo,
including the degradation arrest in front of the folded PhoA domain.
Unfolding of the PhoA domain allowed the degradation to continue beyond the PhoA moiety over the entire molecule. Furthermore, FtsH degraded YccA in reconstituted proteoliposomes without leaving a distinct degradation product. Because the YccA11 mutant protein with the shortened N-terminal tail did not receive degradation in the
reconstituted liposomes, the proteolysis in this reconstituted system
could only be initiated at the N-terminal region of the fusion protein. Thus, if degradation cannot continue beyond a transmembrane region, an
end product lacking only the N-terminal tail should have been detected
for the YccA-HA-His6-Myc protein. The lack of such product, together with the fact that this system consisted of purified components, strongly suggests that FtsH can continue degradation of
YccA-HA-His6-Myc beyond the first transmembrane segment
into the periplasmic and the following transmembrane regions. These results provide strong evidence for the dislocation mechanism of the
FtsH-catalyzed membrane protein degradation.
Our results showed that the folded PhoA moiety of
YccA-(P3)-PhoA-His6-Myc could at least partially be
unfolded by treatment with a high concentration (250 mM) of
DTT that should have reduced the intramolecular disulfide bonds in
PhoA. Although the wild-type PhoA protein exhibits significant
resistance to a reducing agent (31), the PhoA portion of the
YccA-(P3)-PhoA-His6-Myc fusion protein may be distorted to
some extent (14) and more susceptible to reduction, making the
post-translational unfolding possible. In contrast to our previous
in vivo experiments, in which the formation of the
intramolecular disulfide bonds in PhoA was prevented in the first place
by the host dsbA mutation or mutational absence of the
responsible cysteine residues in PhoA (3, 14), the DTT treatment
disrupts the structure once established. Our results thus indicate that
post-translationally unfolded periplasmic domain can be dislocated and
degraded by FtsH. It may be generalized that FtsH has the ability to
degrade a periplasmic domain of a membrane protein when it was unfolded
post-translationally by environmental stresses. However, for this event
to happen, the cytosolic region of such a membrane protein should also
be affected to be recognized by FtsH for degradation initiation. During
the dislocation-unfolding events, FtsH appears to remain bound to the
substrate protein, and this should provide a basis for the processive
nature of the proteolysis. Indeed, the I60 intermediate was
degraded when the PhoA moiety on the trans side was unfolded in our in vitro system. The PhoA domain within the
YccA-(P3)-PhoA-His6-Myc fusion protein may not be
completely unfolded by DTT as it exhibited some degree of trypsin
resistance. The presumed ATP hydrolysis-coupled dislocation activity of
FtsH may unfold further such a loose structure.
Our previous studies (4) showed that the in vivo proteolytic
functions of FtsH against different substrate proteins were stimulated
by PMF. This stimulation of degradation was observed both for soluble
and membrane-integrated substrate proteins, the latter including YccA
and Foa. Our in vitro attempts to reproduce the
PMF-stimulation of membrane protein degradation has so far failed.3 Although direct comparison with the in
vivo activity is difficult, the reaction efficiency in our system
appears rather low. The same reaction mixture exhibited more rapid
degradation of the substrates after solubilization of every component
by a non-ionic detergent (data not shown). Although the inefficiency of
the in vitro reaction could suggest that some stimulatory
component is missing in the reaction system, the apparent degradation
speeds were similar between the IMV-based and the proteoliposome-based reactions. Thus, slow reaction might be an inherent nature of the lipid
bilayer-integrated reaction components in vitro. The slow
reaction could be due either to a slow enzyme-substrate encountering, slow initiation of proteolysis, slow dislocation, slow catalysis, or a
combination of these.
Whereas our results suggest that FtsH does not need any aid from other
proteins for its ability to degrade membrane-integrated substrates,
more efficient and physiological reactions could still require some
additional factor(s). In the case of the endoplasmic reticulum-associated degradation in eukaryotic cells, the translocon (the Sec61 complex)-mediated dislocation has been suggested. It remains
possible that the E. coli translocon (the SecYEG complex) plays a similar role for the FtsH-catalyzed membrane protein
degradation to occur rapidly. However, it must be stressed at this
point that our results point to the ability of the FtsH protein itself
to mediate the dislocation/degradation events, even if inefficiently.
We feel that involvement of the SecYEG channel is unlikely for the
following reasons. First, our preparations of FtsH and YccA contained
undetectable levels of SecE and only minute amounts (less than 1.5%
weight ratio) of SecY (data not shown). Second, IMVs from
SecYEG-overproducing cells did not exhibit any enhanced activity of
YccA degradation.2 Third, examination of several
secY mutants revealed none, in which in vivo
degradation of YccA was retarded
significantly.4 In addition,
the m-AAA protease, a mitochondrial counterpart of
FtsH, is also believed to dislocate substrate membrane proteins for
degradation (32), whereas the mitochondrial inner membrane does not
contain a Sec61/SecY homolog (33).
Whereas FtsH-catalyzed proteolysis of membrane proteins does not
require the SecYEG translocon channel as an essential component, participation of some stimulatory factor is not excluded. It should be
noted also that FtsH in wild-type cells exists exclusively as a
complex, termed FtsH holoenzyme, with the HflKC complex.2
The roles played by the HflKC complex should also be elucidated for our
understanding of regulation of the FtsH function in its proteolytic
functions against membrane-integrated and soluble protein substrates.
Our experimental approaches described in this paper can be extended
further to address these important questions in membrane protein
quality control.
 |
ACKNOWLEDGEMENTS |
We thank H. Mori for stimulating discussion,
A. Kihara and K. Murphy for plasmids, Photal Otsuka
Electronics for generous support in the dynamic light scattering
experiments, and K. Mochizuki, M. Sano, and Y. Yoshioka for
technical support.
 |
FOOTNOTES |
*
This work was supported by grants from the Ministry of
Education, Culture, Sports, Science and Technology, Japan, and from CREST, Japan Science and Technology Corp.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Institute for Virus
Research, Kyoto University, Kyoto 606-8507, Japan. Tel.:
81-75-751-4040; Fax: 81-75-771-5699; E-mail:
yakiyama@virus.kyoto-u.ac.jp.
Published, JBC Papers in Press, March 17, 2003, DOI 10.1074/jbc.M302152200
2
N. Saikawa, Y. Akiyama, and K. Ito,
submitted for publication.
3
Y. Akiyama, unpublished results.
4
N. Shimohata, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
PMF, proton motive
force;
DTT, dithiothreitol;
Foa, subunit a of
F1F0-ATPase;
FRET, fluorescence resonance
energy transfer;
HA, hemagglutinin;
IMVs, inverted membrane vesicles;
NBD-PE, N-(7-nitro-2,1,3-benzoxadiazol-4-yl)-dioleoylphosphatidylethanolamine;
PEG3350, polyethylene glycol 3350;
PhoA, alkaline phosphatase mature
part;
Rh-PE, N-(lissamine rhodamine B sulfonyl)
dioleoylphosphatidylethanolamine;
MOPS, 4-morpholinepropanesulfonic acid;
Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine;
AMP-PNP, adenosine 5'-( , -imino)triphosphate.
 |
REFERENCES |
| 1.
|
Akiyama, Y.,
and Ito, K.
(1998)
in
Handbook of Proteolytic Enzymes
(Barret, A. J.
, Rawlings, N. D.
, and Woessner, J. F., eds)
, pp. 1502-1504, Academic Press, London
|
| 2.
|
Gottesman, S.
(1999)
Curr. Opin. Microbiol.
2,
142-147[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Akiyama, Y.,
and Ito, K.
(2000)
EMBO J.
19,
3888-3895[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Akiyama, Y.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
8066-8071[Abstract/Free Full Text]
|
| 5.
|
Kihara, A.,
Akiyama, Y.,
and Ito, K.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
4532-4536[Abstract/Free Full Text]
|
| 6.
|
Akiyama, Y.,
Kihara, A.,
Tokuda, H.,
and Ito, K.
(1996)
J. Biol. Chem.
271,
31196-31201[Abstract/Free Full Text]
|
| 7.
|
Akiyama, Y.,
Kihara, A.,
and Ito, K.
(1996)
FEBS Lett.
399,
26-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Kihara, A.,
Akiyama, Y.,
and Ito, K.
(1998)
J. Mol. Biol.
279,
175-188[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Tomoyasu, T.,
Yamanaka, K.,
Murata, K.,
Suzaki, T.,
Bouloc, P.,
Kato, A.,
Niki, H.,
Hiraga, S.,
and Ogura, T.
(1993)
J. Bacteriol.
175,
1352-1357[Abstract/Free Full Text]
|
| 10.
|
Akiyama, Y.,
Yoshihisa, T.,
and Ito, K.
(1995)
J. Biol. Chem.
270,
23485-43490[Abstract/Free Full Text]
|
| 11.
|
Akiyama, Y.,
and Ito, K.
(2001)
Biochemistry
40,
7687-7693[Medline]
[Order article via Infotrieve]
|
| 12.
|
Kihara, A.,
Akiyama, Y.,
and Ito, K.
(1996)
EMBO J.
15,
6122-6131[Medline]
[Order article via Infotrieve]
|
| 13.
|
Akiyama, Y.,
Kihara, A.,
Mori, H.,
Ogura, T.,
and Ito, K.
(1998)
J. Biol. Chem.
273,
22326-22333[Abstract/Free Full Text]
|
| 14.
|
Kihara, A.,
Akiyama, Y.,
and Ito, K.
(1999)
EMBO J.
18,
2970-2981[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Chiba, S.,
Akiyama, Y.,
Mori, H.,
Matsuo, E.,
and Ito, K.
(2000)
EMBO Rep.
1,
47-52[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Chiba, S.,
Akiyama, Y.,
and Ito, K.
(2002)
J. Bacteriol.
184,
4775-4782[Abstract/Free Full Text]
|
| 17.
|
Akiyama, Y.,
Ogura, T.,
and Ito, K.
(1994)
J. Biol. Chem.
269,
5218-5224[Abstract/Free Full Text]
|
| 18.
|
Shimohata, N.,
Chiba, S.,
Saikawa, N.,
Ito, K.,
and Akiyama, Y.
(2002)
Genes Cells
7,
653-662[Abstract]
|
| 19.
|
Messing, J.,
Crea, R.,
and Seeburg, P. H.
(1981)
Nucleic Acids Res.
9,
309-321[Abstract/Free Full Text]
|
| 20.
|
Murphy, K. C.
(1998)
J. Bacteriol.
180,
2063-2071[Abstract/Free Full Text]
|
| 21.
|
Inaba, K.,
and Ito, K.
(2002)
EMBO J.
21,
2646-2654[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
| Mori, H., Tsukazaki, T., Masui, R., Kuramitsu, S., Yokoyama, S.,
Johnson, A. E., Kimura, Y., Akiyama, Y., and Ito, K. (2003) J. Biol. Chem. 278, in press
|
| 23.
|
Ogura, T.,
Inoue, K.,
Tatsuta, T.,
Suzaki, T.,
Karata, K.,
Young, K.,
Su, L.-H.,
Fierke, C. A.,
Jackman, J. E.,
Raetz, C. R. H.,
Coleman, J.,
Tomoyasu, T.,
and Matsuzawa, H.
(1999)
Mol. Microbiol.
31,
833-844[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Davis, R. W.,
Botstein, D.,
and Roth, J. R.
(1980)
Advanced Bacterial Genetics
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 25.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 26.
|
Moriyama, Y.,
Iwamoto, A.,
Hanada, H.,
Maeda, M.,
and Futai, M.
(1991)
J. Biol. Chem.
266,
22141-22146[Abstract/Free Full Text]
|
| 27.
|
Langosch, D.,
Crane, J. M.,
Brosig, B.,
Hellwig, A.,
Tamm, L. K.,
and Reed, J.
(2001)
J. Mol. Biol.
311,
709-721[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Derman, A. I.,
and Beckwith, J.
(1991)
J. Bacteriol.
173,
7719-7722[Abstract/Free Full Text]
|
| 29.
|
Akiyama, Y.,
Kamitani, S.,
Kusukawa, N.,
and Ito, K.
(1992)
J. Biol. Chem.
267,
22440-22445[Abstract/Free Full Text]
|
| 30.
|
Weihofen, A.,
and Martoglio, B.
(2003)
Trends Cell Biol.
13,
71-78[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Akiyama, Y.,
and Ito, K.
(1993)
J. Biol. Chem.
268,
8146-8150[Abstract/Free Full Text]
|
| 32.
|
Leonhard, K.,
Guiard, B.,
Pellecchia, G.,
Tzagoloff, A.,
Neupert, W.,
and Langer, T.
(2000)
Mol. Cell
5,
629-638[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Glick, B. S.,
and von Heijne, G.
(1996)
Protein Sci.
5,
2651-2652[Medline]
[Order article via Infotrieve]
|
| 34.
|
Akiyama, Y.
(1999)
Biochemistry
38,
11693-11699[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Sakoh, K. Ito, and Y. Akiyama
Proteolytic Activity of HtpX, a Membrane-bound and Stress-controlled Protease from Escherichia coli
J. Biol. Chem.,
September 30, 2005;
280(39):
33305 - 33310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Nixon, M. Barker, M. Boehm, R. de Vries, and J. Komenda
FtsH-mediated repair of the photosystem II complex in response to light stress
J. Exp. Bot.,
January 1, 2005;
56(411):
357 - 363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Anilkumar, R. Srinivasan, and P. Ajitkumar
Genomic organization and in vivo characterization of proteolytic activity of FtsH of Mycobacterium smegmatis SN2
Microbiology,
August 1, 2004;
150(8):
2629 - 2639.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Nagamori, I. N. Smirnova, and H. R. Kaback
Role of YidC in folding of polytopic membrane proteins
J. Cell Biol.,
April 12, 2004;
165(1):
53 - 62.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Silva, E. Thompson, S. Bailey, O. Kruse, C. W. Mullineaux, C. Robinson, N. H. Mann, and P. J. Nixon
FtsH Is Involved in the Early Stages of Repair of Photosystem II in Synechocystis sp PCC 6803
PLANT CELL,
September 1, 2003;
15(9):
2152 - 2164.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|