|
Originally published In Press as doi:10.1074/jbc.M302041200 on March 18, 2003
J. Biol. Chem., Vol. 278, Issue 20, 18235-18240, May 16, 2003
The Central Domain of Core RAG1 Preferentially Recognizes
Single-stranded Recombination Signal Sequence Heptamer*
Mandy M.
Peak,
Janeen L.
Arbuckle, and
Karla K.
Rodgers
From the Department of Biochemistry and Molecular Biology, The
University of Oklahoma Health Sciences Center,
Oklahoma City, Oklahoma 73190
Received for publication, February 26, 2003
 |
ABSTRACT |
RAG1 and RAG2 initiate V(D)J recombination by
introducing DNA double strand breaks between each selected gene segment
and its bordering recombination signal sequence (RSS) in a two-step mechanism in which the DNA is first nicked, followed by hairpin formation. The RSS consists of a conserved nonamer and heptamer sequence, in which the latter borders the site of DNA cleavage. A region within RAG1, referred to as the central domain
(residues 528-760 of 1040 in the full-length protein), has been shown
previously to bind specifically to the double-stranded (ds) RSS
heptamer, but with both weak specificity and affinity. However,
additional investigations into the RAG1-RSS heptamer interaction are
required because the DNA substrate forms intermediate conformations
during the V(D)J recombination reaction. These include the nicked and hairpin products, as well as likely base unpairing to produce single-stranded (ss) DNA near the cleavage site. Here, it was determined that although the central domain showed substantially higher
binding affinity for ss and nicked versus ds substrate, the
interaction with ss RSS was particularly robust. In addition, the
central domain bound with greater sequence specificity to the ss RSS
heptamer than to the ds form. This study provides important insight into the V(D)J recombination reaction, specifically that significant interaction of the RSS heptamer with RAG1 occurs only after
the induction of conformational changes at the RSS heptamer.
 |
INTRODUCTION |
V(D)J recombination leads to the formation of functional
immunoglobulin and T cell receptor genes in developing B and T cells, respectively. Through DNA rearrangement of the immunoglobulin and T cell receptor genetic loci, the genes are assembled by combining selected gene segments termed variable (V), joining (J), and at some
loci, diversity (D). The variability of the assembly process in each
developing lymphocyte yields an immune system that contains a
repertoire of antigen receptors with an array of binding specificities (1, 2).
The first phase of V(D)J recombination consists of site-specific DNA
cleavage steps adjacent to selected gene segments and requires the
lymphoid-specific recombination activating proteins, RAG1 and RAG2 (1,
2). Together the RAG proteins are directed to potential DNA cleavage
sites by recognition of the recombination signal sequence
(RSS),1 which flanks each
gene segment. The RSS contains a conserved heptamer and nonamer
sequence separated by either 12 (12-RSS) or 23 (23-RSS) base pairs of
poorly conserved DNA. Successful assembly of two gene segments requires
that the segments are adjoined to dissimilar RSSs, a requirement
referred to as the 12/23 rule. The RAG proteins cleave at each selected
RSS to first nick the double-stranded DNA between the RSS heptamer and
the bordering antigen receptor gene segment. The result is a 3'-OH
group that executes a nucleophilic attack on the opposite strand,
generating a covalently closed hairpin at the coding end and a signal
end that is blunt-ended at the 5'-end of the RSS heptamer.
The second phase of the V(D)J recombination reaction consists of
joining the respective coding and signal ends and requires both RAG
proteins along with the non-homologous end-joining proteins DNA-PKcs,
Ku70/80, Artemis, XRCC4, and DNA ligase IV. This phase joins the
12 and 23 signal ends in a precise junction (1). The coding end joint
formation, in contrast to the signal end junction, is variable because
of the addition or deletion of bases. During this phase, studies have
shown that the RAG proteins remain bound to both the coding ends and
signal ends, perhaps to stabilize the joining procedure (3, 4).
The majority of biochemical studies with the RAG proteins have been
accomplished using truncated murine proteins consisting of the core
regions, which are the minimal catalytically active regions required
for in vivo recombination activity. The core regions of RAG1
and RAG2 includes residues 384-1008 of 1040 and residues 1-387 of
527, respectively (2).
Although both RAG proteins are required for DNA cleavage, biochemical
characterizations have revealed that RAG1 contains the sequence-specific DNA binding domains to the RSS. The DNA binding domain with specificity for the RSS nonamer lies within the N-terminal region of core RAG1 (residues 384-454) and was found to contain sequences similar to the homeodomain DNA binding domains (5, 6).
The RSS heptamer binding site has been found to lie within the central
domain of core RAG1, which includes residues 528-760 (7). Along with
its ability to bind to the RSS heptamer, the central domain also
contains the predominant RAG2 binding site (7, 8). In contrast to RAG1,
RAG2 alone does not bind to the RSS. Results from DNA footprinting
formation (9), protein-DNA photo cross-linking (10-12), and RAG2
mutagenesis studies (13-15) indicate that RAG2 enhances the
interaction of RAG1 to the RSS heptamer, perhaps by inducing
conformational changes in RAG1 and/or the DNA.
The RAG protein-RSS heptamer interaction is a critical interaction for
successful DNA cleavage. A survey of the antigen receptor loci has
demonstrated that the heptamer sequence in each RSS is highly
conserved, particularly the three bases at the 5'-end (5'-CAC-3'), whereas the nonamer sequence is more poorly retained (16, 17). Previous
evidence from DNA footprinting studies suggested the structure of the
RSS becomes distorted at the cleavage site upon binding of the RAG
proteins (9). Furthermore, substrates that included single-stranded
(ss) RSS (either entirely ss RSS flanked by a double-stranded (ds)
coding region or RSS with mispaired bases at the coding/heptamer
border) were much more efficiently cleaved compared with an entirely ds
substrate (18, 19). Together these results suggest that a likely loss
of base pairing at the coding/heptamer border occurs upon RAG binding,
which then facilitates subsequent catalytic events.
Although the central domain of RAG1 appeared to recognize the ds RSS
heptamer, the binding affinity was exceptionally weak and the
specificity was low relative to nonsequence-specific DNA (7). Because
the structure of the RSS heptamer may be altered from ds to ss form
upon RAG protein binding and because nicking may lead to altered RAG
interactions, we have characterized the interaction of the central
domain to these variant configurations of the RSS heptamer. Here we
describe the substantial enhancement in binding affinity and sequence
specificity of the RAG1 central domain for certain conformations of the
RSS heptamer versus the ds form. Thus, the RSS heptamer
binding site is located in the RAG1 central domain, but strong complex
formation depends on disruption of the ds DNA helix. The implications
of these results to the V(D)J recombination reaction are discussed.
 |
EXPERIMENTAL PROCEDURES |
Protein Cloning--
Plasmid pAEC5 encodes a gene for maltose
binding protein (MBP) fused to RAG1 residues 528-721, where the fusion
protein is referred to as MBP·R1cd( ZFB). The
RAG1 gene fragment was created by amplification of the
appropriate region from the full-length murine RAG1 gene.
The primers introduced a BamHI site at the 5'-end of the
product and two stop codons and a SalI site at the 3'-end of
the product. The fragment was inserted into the BamHI and
SalI sites of the multiple cloning site of pMAL-c2 (New
England Biolabs).
Protein Expression and Purification--
The plasmids pCJM233
(encoding MBP fused to core RAG1, referred to as MBP·core RAG1), pRS3
(encoding MBP fused to RAG1 residues 528-760, referred to as
MBP·R1cd), and pAEC5 (encoding MBP fused to RAG1 residues 528-721,
referred to as MBP·R1cd( ZFB)) were transformed into
Escherichia coli BL21 cells. The fusion proteins were
expressed and purified as previously described (7), with the following
modification for MBP·R1cd preparations. Size-exclusion chromatography
with a Superdex 200 column of MBP·R1cd yielded ~80 and 20%
monomeric and dimeric protein, respectively. The monomeric and dimeric
fractions of MBP·R1cd were collected and stored separately. GST·core RAG2, expressed by transient transfection in 293T cells, was
purified as previously reported (5).
Oligonucleotide Substrates for Electrophoretic Mobility Shift
Assay--
The 59-base sequence of the top strand of the wild type
(WT) 12-RSS is
d(GATATGGCTCGTCCTACACAGTGATATAGACCTTAACAAAAACCTCCAATCGAGCGGAG). The mutant heptamer (MH) 12-RSS oligonucleotide sequence is identical to the WT 12-RSS except the sequence GAGAAGC replaced the WT heptamer sequence (CACAGTG). The mutant heptamer and mutant nonamer 12-RSS sequence is identical to the WT 12-RSS, except the MH is changed as
described above and the nonamer sequence (ACAAAAACC) has been replaced
by AGGCTCTGA. Oligonucleotides were commercially synthesized and
PAGE-purified (Integrated DNA Technologies). The ss 12-RSS substrates
used corresponded to the top (sense) strand, unless otherwise stated.
The ds 12-RSS substrate used was prepared by annealing complementary
oligonucleotides. The nicked 12-RSS substrates were prepared by
annealing a 16-base oligonucleotide (corresponding to the first 16 bases of the top strand) and a 43-base oligonucleotide (corresponding
to bases 17-59 of the top strand and 5'-labeled with cold ATP) to a
59-base complementary oligonucleotide. Substrates were labeled at the
5'-end of the top (sense) strand with [ -32P]ATP where
indicated, using T4 polynucleotide kinase.
Electrophoretic Mobility Shift Assay--
MBP·R1cd and
MBP·R1cd( ZFB) were incubated with 1 nM
32P-labeled substrates and the complexes resolved on 6%
nondenaturing polyacrylamide gels as previously described (20). The
dimeric fraction of MBP·R1cd was used in the experiments, except
where stated otherwise. MBP·core RAG1 was incubated with 1 nM 32P-labeled substrates and resolved on a
discontinuous 3.5/8% nondenaturing gel. The binding buffer contained
10 mM Tris, pH 8.0, 5 mM MgCl2, 2 mM dithiothreitol, 6% glycerol, and 100 mM
NaCl. The bands were visualized using an Amersham Biosciences SI
PhosphorImager and densitometer and analyzed using ImageQuaNT software.
Protein concentrations in titrations to all ss substrates and WT nicked
RSS ranged up to 1.5 µM. Kd values
were determined as previously reported (20) and are the result of
n = 3 experiments per protein-DNA interaction.
To analyze the effect of RAG2 on the interaction of RSS with the RAG1
proteins, GST·core RAG2 was incubated with either MBP·core RAG1,
MBP·R1cd, or MBP·R1cd( ZFB) for 30 min at 4 °C, followed by
the addition of 1 nM 32P-labeled substrates and
incubation for 30 min at 25 °C, with subsequent resolution on 5%
nondenaturing gels. The binding buffer was the same as listed above,
except for experiments containing both GST·core RAG2 and MBP·core
RAG1, in which 5 mM CaCl2 was substituted for
MgCl2.
 |
RESULTS AND DISCUSSION |
The Central Domain of Core RAG1 Binds with High Affinity to ss
RSS--
The central domain of core RAG1 spans residues 528-760 of
the full-length murine protein (Fig. 1)
and contains two active-site residues (Asp-600 and Asp-708) of the
three that were found by mutagenesis studies to reside in RAG1
(21-23). Further evidence of the importance of this region to
catalytic activity is that point mutations in the central domain lead
to immunodeficiency diseases, which are the result of either completely
defective recombinase activity (i.e.
T B severe combined immunodeficiency)
or significantly reduced activity (i.e. Omenn syndrome)
(24-27). In addition, mutagenesis studies of conserved residues in the
central domain region of intact core RAG1 showed several positions that
severely affected cleavage activity (28, 29).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Domains in core RAG1. Core RAG1 is the
minimal region required for catalysis in in vivo assays.
Within core RAG1, NBR (nonamer binding region) is the region that binds
specifically to the RSS nonamer. ZFB (zinc finger B) is a
C2H2 zinc finger previously identified. The
core is shown as three separate DNA binding regions: the N-terminal
Region, which contains the NBR; the Central Domain, which recognizes
the RSS heptamer; and the C-terminal Domain, which binds DNA in a
sequence-independent manner. The locations of the putative active site
residues (Asp-600, Asp-708, and Glu-962) are shown.
|
|
We have found previously that the central domain demonstrated specific
binding to the ds RSS heptamer. However, the binding affinity was very
weak (with little protein-DNA complex formed even at micromolar
concentrations of protein) and with only 3-fold specificity to the
heptamer over nonsequence-specific DNA (7). Because the conformation of
the RSS heptamer is predicted to gain ss character during the cleavage
reaction and cleavage intermediates occur during the course of the
reaction, we have tested the interaction of the central domain with the
corresponding RSS substrates, including ds, ss, and nicked RSS (Fig.
2A). In these experiments,
increasing concentrations of the RAG1 central domain fused to
maltose-binding protein (referred to as MBP·R1cd) were titrated into
oligonucleotides containing a 12-RSS, with subsequent resolution of the
bound complexes by electrophoretic mobility shift assay (EMSA). In the
binding assays, 12-RSS was used rather than 23-RSS, because the RAG
proteins bind and cleave more efficiently at a 12-RSS (2). It is
evident from Fig. 2A that the binding affinity of MBP·R1cd
is significantly greater for ss and nicked RSS versus the ds
substrate. Quantitation of the binding curves (Fig. 2B)
shows that MBP·R1cd binds with >30-fold preference for ss DNA over
the ds substrate and a >7-fold increase in affinity for nicked RSS
over ds substrate (Table I). The binding
affinity to the ss RSS heptamer corresponding to the bottom strand
sequence (5'-CACTGTG) was within error of that to the top strand (data
not shown), which is not unexpected given the near dyad symmetry of the
ds heptamer sequence. These results clearly demonstrate that the
central domain in core RAG1 has a significantly enhanced capacity to
bind to a ss versus a ds DNA helix. However, it is not clear
what would result in the increased affinity for nicked
versus ds RSS. Perhaps the central domain is capable of
unwinding the DNA helix near the nicked site. Previously, the RAG
proteins were found to form a complex with nicked RSS that had an
apparently slower off rate than with unnicked RSS (30). An increased
affinity of the RAG1 heptamer binding site with newly nicked DNA after
the first cleavage step may account for this behavior.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2.
The interaction of MBP-R1cd with RSS
substrates. A, electrophoretic mobility shift assays of
radiolabeled single-stranded (ss), nicked, and double-stranded (ds)
12-RSS with the RAG1 central domain. The radiolabeled 12-RSS
substrates were titrated with increasing concentrations of MBP·R1cd
ranging from 0.2-0.8 µM (lanes
2-7) using ss and nicked substrates and 4 and 5 µM (lanes 1 and 2) using ds
substrate. The reactions were subjected to electrophoresis on 6%
nondenaturing polyacrylamide gels. To directly compare EMSA results,
protein concentrations up to 0.8 µM only are shown.
B, representative binding curves of ss and nicked 12-RSS
titrated with 0.2-1.5 µM MBP-R1cd. The determination of
Kd values was as described under "Experimental
Procedures." C, electrophoretic mobility shift assay of
radiolabeled single-stranded 12-RSS with monomeric (lane 2)
and dimeric (lane 3) MBP·R1cd samples isolated using
size-exclusion chromatography. Lane 1 contains free ss
12-RSS. Lanes 2 and 3 contain 0.1 and 0.07 µM monomeric and dimeric MBP·R1cd, respectively. The
complexes were subjected to electrophoresis on a 6% nondenaturing
polyacrylamide gel.
|
|
Two distinct protein-DNA complexes are formed in the titration of
MBP·R1cd to the different RSS substrates (Fig. 2A). These complexes may represent monomeric and dimeric forms of the central domain bound to the RSS. Whereas MBP·R1cd eluted from size-exclusion chromatography predominantly in the monomeric form, initial loading concentrations of ~10-20 µM yielded ~20% of the
protein in the dimeric form. To determine whether the two shifted
MBP·R1cd·12-RSS complexes in Fig. 2A were because of a
difference in stoichiometry of MBP·R1cd in the protein-DNA complexes,
we utilized the separate monomeric and dimeric protein fractions from
size-exclusion chromatography. The separate fractions were first
incubated with ss 12-RSS and the resulting protein-DNA complexes
subjected to EMSA (Fig. 2C). At the protein concentrations
used, only a fraction of the DNA was complexed, likely producing the
formation of only sequence-specific protein-DNA complexes.
Significantly, the dimeric fraction yielded two shifted bands, whereas
the monomeric fraction resulted in one shifted band even though the
protein concentration in the latter fraction was slightly higher. The
dimeric fraction of MBP·R1cd was used in the DNA-binding experiments
described here (see "Experimental Procedures" and Table I).
However, the monomeric fraction of protein yielded similar binding
affinities to ss 12-RSS (within error) as the dimeric fraction (data
not shown). In Fig. 2C, the appearance of two complexes with
the dimeric fraction is most likely because of the partial dissociation
of dimer to monomer after completion of size-exclusion chromatography.
This weak self-association of MBP·R1cd also explains why the relative
proportions of dimeric to monomeric MBP·R1cd complexed with 12-RSS
did not change significantly during the course of the titration (Fig.
2A). It is possible though that in the intact RAG1 protein,
the central domain may dimerize more readily, because it is bordered on
each side by domains that have been shown to oligomerize in the absence
of DNA (7, 31).
The Central Domain Demonstrates Specific Binding to the ss RSS
Heptamer--
We have previously shown that the isolated central
domain and intact core RAG1 bind preferentially to the ds RSS heptamer (7). However, the binding specificity was only ~3-fold greater than
to ds nonsequence-specific DNA. This difference is likely not
sufficient to warrant the high conservation of the heptamer in the
endogenous RSSs located in the antigen receptor loci. Because the
central domain demonstrates vastly enhanced binding affinity to ss over
ds DNA, we asked whether the central domain showed greater specificity
if the RSS heptamer were in ss form. To determine the extent of
preferential recognition of the central domain to the RSS heptamer
sequence, we compared the binding affinity to an oligonucleotide in
which the heptamer sequence has been replaced. Comparison of the
results between WT ss 12-RSS (in Fig. 2A) and MH ss 12-RSS
(Fig. 3A) demonstrates that
equivalent protein concentrations yield less complex with the latter
substrate. Mutation of both the heptamer and nonamer sequences did not
significantly further reduce the binding, as expected, because the
nonamer binding site is not located in the central domain. From
analysis of the binding curves, the central domain demonstrates
~10-fold specificity for ss RSS heptamer over nonsequence-specific ss
DNA (Table I). These results demonstrate that the central domain has a
significantly increased specificity for the RSS heptamer in ss
versus ds form and provides further support for the model
that ss DNA is an important structural intermediate in the DNA cleavage
phase of V(D)J recombination.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Interactions of ss DNA with RAG1
proteins. Electrophoretic mobility shift assays of (A)
radiolabeled single-stranded mutant heptamer (MH) 12-RSS
combined with MBP·R1cd and (B) radiolabeled
single-stranded WT 12-RSS with MBP·R1cd( ZFB). In both
panels, increasing concentrations (0.2-0.8 µM) of
protein were titrated into radiolabeled 12-RSS substrate, and the
samples were subjected to electrophoresis on 6% nondenaturing
polyacrylamide gels. To directly compare EMSA results, protein
concentration ranges up to 0.8 µM only are shown.
|
|
In addition, by a similar method, we found that the central domain
demonstrates >7-fold decreased affinity for nicked 12-RSS in
substrates containing mutated heptamer and nonamer sequences (Table I).
Thus, as the RSS is nicked the central domain gains greater affinity
and specificity for the RSS heptamer, likely because of local unwinding
of the ds DNA near the nicked site.
The ZFB Contributes to DNA Binding Affinity of the Central Domain
to the ss RSS Heptamer--
Besides two active site residues, the
central domain also contains a near classic
C2H2 zinc finger motif between residues 722-760, which is referred to as the ZFB (zinc finger B) (31). It has
been previously shown that the ZFB is the predominant binding site to
core RAG2 (8) and also that the isolated central domain is capable of
binding core RAG2 (7). Because zinc fingers are often sequence-specific
DNA binding motifs, we asked whether the ZFB contributes in the
interaction with the RSS heptamer. An MBP fusion protein with the ZFB
deleted from the central domain of RAG1 was constructed and is referred
to as MBP·R1cd( ZFB). Comparison of the titration of
MBP·R1cd( ZFB) (Fig. 3B) versus MBP·R1cd
(Fig. 2A) to ss 12-RSS shows that the truncated central
domain did not form a complex with WT ss 12-RSS as efficiently as the
central domain containing the ZFB. From analysis of the respective
binding curves the difference in affinity is 3- to 4-fold (Table I). These results demonstrate that in the context of the isolated central
domain, the ZFB makes a significant contribution to ss RSS heptamer
binding. However, residues 528-721 within the central domain clearly
make the major sequence-specific contacts with the heptamer, because
the truncated domain still demonstrated an ~3-fold increase in
binding affinity to WT ss 12-RSS over nonsequence-specific ss DNA.
Despite a small fraction (<20%) of MBP·R1cd( ZFB) eluting from
size-exclusion chromatography as a dimer, both the monomeric (Fig.
3B) and dimeric (data not shown) fractions yielded only one
protein-DNA complex, not two as occurred with MBP·R1cd bound to ss
12-RSS. This may indicate that deletion of the ZFB significantly decreases stability of the central domain dimer.
Comparison of the Central Domain to Intact Core RAG1--
Given
the ability of the isolated central domain to preferentially bind ss
over ds RSS, we asked whether intact core RAG1 showed similar DNA
binding properties. Quantitation of binding curves demonstrated that
intact core RAG1 bound with slightly lower affinity to ss
versus ds RSS (Table I). It is not surprising that the
differential effects of the central domain are not observed in the
intact core RAG1 protein because of the presence of additional DNA
binding domains (Fig. 1). Specifically, the N-terminal region of core
RAG1 contains the nonamer binding site, which efficiently recognizes
the ds nonamer sequence (5, 6). Furthermore, a C-terminal domain in
core RAG1 (residues 761-979) was found to bind ds DNA in
nonsequence-specific manner cooperatively and with relatively high
affinity (7). Moreover, it is possible that the heptamer binding site
in the central domain is not as accessible to DNA in the intact core
RAG1 protein, particularly in the absence of RAG2.
RAG2 Inhibits Association of the RAG1 Central Domain with ss
RSS--
Because the central domain of RAG1 demonstrated high affinity
for WT ss 12-RSS, we asked whether this interaction would be affected
upon the addition of RAG2. In these experiments, samples containing
increasing concentrations of GST·core RAG2 were incubated with
MBP·R1cd, followed by the addition of WT ss 12-RSS. After an
additional incubation of the protein complexes with ss 12-RSS, the
resulting protein-DNA complexes were resolved by EMSA. Surprisingly, the results demonstrate that as the concentration of RAG2 increased, the amount of ss 12-RSS complexed with MBP·R1cd decreased (Fig. 4A). The order in which
components were combined had no effect on the results, because
experiments in which RAG2 was added last yielded similar results (data
not shown). However, in the same assay performed with
MBP·R1cd( ZFB), no decrease in DNA binding activity was observed,
indicating that RAG2 does not have substantial interaction with
residues 528-721 of RAG1 (Fig. 4B). Therefore, RAG2
inhibited the association of central domain of RAG1 with the ss 12-RSS,
possibly by binding to the ZFB and blocking access of DNA to the
remaining portion of the central domain.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
The effect of GST·core RAG2 on the
interaction between RAG1 proteins and WT ss 12-RSS. Increasing
concentrations of RAG2 (0.1-0.5 µM) were incubated with
a constant concentration of either MBP·R1cd (at 0.15 µM) (A), MBP·R1cd( ZFB) (at 0.20 µM) (B), or MBP·core RAG1 (at 0.15 µM) (C), followed by the addition of
radiolabeled ss WT 12-RSS to the proteins. The reactions were separated
by electrophoresis on 5% nondenaturing polyacrylamide gels.
cR1 and cR2 represent MBP·core RAG1 and
GST·core RAG2, respectively.
|
|
We also tested the effect of RAG2 on the interaction of intact core
RAG1 with ss 12-RSS, using buffer conditions that prevent DNA cleavage
activity. After utilizing EMSA to resolve the protein-DNA complexes,
supershifted bands due to RAG1·RAG2·12-RSS complexes were detected
(Fig. 4C). As the concentration of GST·core RAG2 increased, the amount of bound DNA increased, indicating that RAG2
enhanced the association of MBP·core RAG1 to the ss 12-RSS. It is
possible that RAG2 alters the conformation of RAG1 to increase the DNA
binding ability of the latter. Core RAG2 has also been found to induce
a similar increase in binding affinity of core RAG1 for ds 12-RSS
(32).
We suggest two possible interpretations for the contrasting influence
of RAG2 on the association to the ss 12-RSS of the isolated central
domain versus intact core RAG1. First, upon binding the ZFB,
RAG2 blocks the DNA binding site in the isolated central domain, but in
intact core RAG1 other regions of the protein (i.e. the N-
or C-terminal core RAG1 domains) prevent this inappropriate orientation
of RAG2. Second, it is possible that prior to V(D)J recombination, RAG2
specifically inhibits the central domain of RAG1 from binding to DNA
until a correct initial complex is formed with an RSS. This latter
possibility would be a means for RAG2 to regulate the binding of the
central domain and, hence, the active site of RAG1 from contacting DNA
until an appropriate protein-DNA complex was formed.
 |
CONCLUSION |
In this study, we have found that the central domain of core RAG1
demonstrated substantially enhanced affinity to putative and known RSS
intermediates, namely ss and nicked substrates as compared with ds RSS.
Binding to the ss RSS substrate was particularly favorable.
Furthermore, the central domain showed a significant increase in
specificity for the RSS heptamer in the ss and nicked forms
versus the ds form. Given these results, we propose the following series of events upon binding of the RAG proteins to a single
RSS. First, the RAG proteins bind to the ds RSS substrate with strong
interactions between the nonamer binding site of RAG1 and the RSS
nonamer but only weakly specific interactions with the RSS heptamer.
DNA helical distortions, which likely include base unpairing, is
induced at the RSS heptamer-coding flank border. In the 12-RSS, the
spacing between the nonamer and heptamer of two helical turns is most
likely optimal for binding of both conserved elements by the RAG
proteins. In the 23-RSS, additional bending of the DNA helix, which may
be facilitated by the high mobility group proteins, HMG1 or HMG2, is
likely required for optimal interaction (33, 34). In either case, the
introduction of ss conformation in the RSS heptamer results in robust
and specific association of the RAG1 central domain with the heptamer
and appropriate proximity of the aspartate active site residues to the
DNA cleavage site for subsequent nicking activity. After nicking
occurs, the RAG1 central domain remains tightly associated with the RSS
heptamer with the active site primed for hairpin formation.
The above model introduces additional constraints on the complete
association of the RAG proteins with the RSS in that optimal interaction of RAG1 with the RSS heptamer requires DNA distortion. This
may reduce the ability of sequences dissimilar to the canonical RSS
heptamer to bind to the RAG1 central domain if they are less prone to
helix distortion or if the ss sequences do not interact with the
central domain in a sequence-specific manner. Additional questions
relevant to the model presented here include how the RAG proteins
distort the DNA helix at the RSS heptamer-coding flank border as well
as the number of base pairs that are affected by this interaction.
Answers to these questions will shed light on the specific events that
occur during protein-DNA interactions in the V(D)J recombination reaction.
 |
ACKNOWLEDGEMENTS |
We thank Timothy Lohman for useful
suggestions and Allison Cowan for technical expertise.
 |
FOOTNOTES |
*
This work was supported by Research Project Grant
RPG-00-032-01-CIM from the American Cancer Society.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 405-271-2227 (ext. 1248); Fax: 405-271-3139; E-mail:
Karla-Rodgers@ouhsc.edu.
Published, JBC Papers in Press, March 18, 2003, DOI 10.1074/jbc.M302041200
 |
ABBREVIATIONS |
The abbreviations used are:
RSS, recombination
signal sequence;
ss, single strand;
ds, double strand;
MBP, maltose
binding protein;
WT, wild type;
MH, mutant heptamer;
EMSA, electrophoretic mobility shift assay;
ZFB, zinc finger B;
R1cd, RAG 1 central domain.
 |
REFERENCES |
| 1.
|
Fugmann, S. D.,
Lee, A. I.,
Shockett, P. E.,
Villey, I. J.,
and Schatz, D. G.
(2000)
Annu. Rev. Immunol.
18,
495-527[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Gellert, M.
(2002)
Annu. Rev. Biochem.
71,
101-132[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Agrawal, A.,
and Schatz, D. G.
(1997)
Cell
89,
43-53[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Hiom, K.,
and Gellert, M.
(1998)
Mol. Cell
1,
1011-1019[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Spanopoulou, E.,
Zaitseva, F.,
Wang, F.-H.,
Santagata, S.,
Baltimore, D.,
and Panayotou, G.
(1996)
Cell
87,
263-276[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Difilippantonio, M. J.,
McMahan, C. J.,
Eastman, Q. M.,
Spanopoulou, E.,
and Schatz, D. G.
(1996)
Cell
87,
253-262[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Arbuckle, J. L.,
Fauss, L. J.,
Simpson, R.,
Ptaszek, L. M.,
and Rodgers, K. K.
(2001)
J. Biol. Chem.
276,
37093-37101[Abstract/Free Full Text]
|
| 8.
|
Aidinis, V.,
Dias, D. C.,
Gomez, C. A.,
Bhattacharyya, D.,
Spanopoulou, E.,
and Santagata, S.
(2000)
J. Immunol.
164,
5826-5832[Abstract/Free Full Text]
|
| 9.
|
Swanson, P. C.,
and Desiderio, S.
(1998)
Immunity
9,
115-125[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Eastman, Q. M.,
Villey, I. J.,
and Schatz, D. G.
(1999)
Mol. Cell. Biol.
19,
3788-3797[Abstract/Free Full Text]
|
| 11.
|
Swanson, P. C.,
and Desiderio, S.
(1999)
Mol. Cell. Biol.
19,
3674-3683[Abstract/Free Full Text]
|
| 12.
|
Mo, X.,
Bailin, T.,
Noggle, S.,
and Sadofsky, M. J.
(2000)
Nucleic Acids Res.
28,
1228-1236[Abstract/Free Full Text]
|
| 13.
|
Gomez, C. A.,
Ptaszek, L. M.,
Villa, A.,
Bozzi, F.,
Sobacchi, C.,
Brooks, E. G.,
Notarangelo, L. D.,
Spanopoulou, E.,
Pan, Z. Q.,
Vezzoni, P.,
Cortes, P.,
and Santagata, S.
(2000)
Mol. Cell. Biol.
20,
5653-5664[Abstract/Free Full Text]
|
| 14.
|
Qiu, J.-X.,
Kale, S. B.,
Yarnal Schultz, H.,
and Roth, D. B.
(2001)
Mol. Cell
7,
77-87[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Fugmann, S. D.,
and Schatz, D. G.
(2001)
Mol. Cell
8,
899-910[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Hesse, J. E.,
Lieber, M. R.,
Mizuuchi, K.,
and Gellert, M.
(1989)
Genes Dev.
3,
1053-1061[Abstract/Free Full Text]
|
| 17.
|
Ramsden, D. A.,
Baetz, K.,
and Wu, G. E.
(1994)
Nucleic Acids Res.
22,
1785-1796[Abstract/Free Full Text]
|
| 18.
|
Ramsden, D. A.,
McBlane, J. F.,
van Gent, D. C.,
and Gellert, M.
(1996)
EMBO J.
15,
3197-3206[Medline]
[Order article via Infotrieve]
|
| 19.
|
Cuomo, C. A.,
Mundy, C. L.,
and Oettinger, M. A.
(1996)
Mol. Cell. Biol.
16,
5683-5690[Abstract]
|
| 20.
|
Rodgers, K. K.,
Villey, I. J.,
Ptaszek, L.,
Corbett, E.,
Schatz, D. G.,
and Coleman, J. E.
(1999)
Nucleic Acids Res.
27,
2938-2946[Abstract/Free Full Text]
|
| 21.
|
Kim, D. R.,
Dai, Y.,
Mundy, C. L.,
Yang, W.,
and Oettinger, M. A.
(1999)
Genes Dev.
13,
3070-3080[Abstract/Free Full Text]
|
| 22.
|
Landree, M. A.,
Wibbenmeyer, J. A.,
and Roth, D. B.
(1999)
Genes Dev.
13,
3059-3069[Abstract/Free Full Text]
|
| 23.
|
Fugmann, S. D.,
Villey, I. J.,
Ptaszek, L. M.,
and Schatz, D. G.
(2000)
Mol. Cell
5,
97-107[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Santagata, S.,
Villa, A.,
Sobacchi, C.,
Cortes, P.,
and Vezzoni, P.
(2000)
Immunol. Rev.
178,
64-74[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Villa, A.,
Santagata, S.,
Bozzi, F.,
Giliani, S.,
Frattini, A.,
Imberti, L.,
Gatta, L. B.,
Ochs, H. D.,
Schwarz, K.,
Notarangelo, L. D.,
Vezzoni, P.,
and Spanopoulou, E.
(1998)
Cell
93,
885-896[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Corneo, B.,
Moshous, D.,
Gungor, T.,
Wulffraat, N.,
Philippet, P.,
Le Deist, F.,
Fischer, A.,
and de Villartay, J. P.
(2001)
Blood
97,
2772-2776[Abstract/Free Full Text]
|
| 27.
|
Villa, A.,
Sobacchi, C.,
Notarangelo, L. D.,
Bozzi, F.,
Abinun, M.,
Abrahamsen, T. G.,
Arkwright, P. D.,
Baniyash, M.,
Brooks, E. G.,
Conley, M. E.,
Cortes, P.,
Duse, M.,
Fasth, A.,
Filipovich, A. M.,
Infante, A. J.,
Jones, A.,
Mazzolari, E.,
Muller, S. M.,
Pasic, S.,
Rechavi, G.,
Sacco, M. G.,
Santagata, S.,
Schroeder, M. L.,
Seger, R.,
Strina, D.,
Ugazio, A.,
Valiaho, J.,
Vihinen, M.,
Vogler, L. B.,
Ochs, H.,
Vezzoni, P.,
Friedrich, W.,
and Schwarz, K.
(2001)
Blood
97,
81-88[Abstract/Free Full Text]
|
| 28.
|
Huye, L. E.,
Purugganan, M. M.,
Jiang, M. M.,
and Roth, D. B.
(2002)
Mol. Cell. Biol.
22,
3460-3473[Abstract/Free Full Text]
|
| 29.
|
Tsai, C.-L.,
Drejer, A. H.,
and Schatz, D. G.
(2002)
Genes Dev.
16,
1934-1949[Abstract/Free Full Text]
|
| 30.
|
Grawunder, U.,
and Lieber, M. R.
(1997)
Nucleic Acids Res.
25,
1375-1382[Abstract/Free Full Text]
|
| 31.
|
Rodgers, K. K.,
Bu, Z.,
Fleming, K. G.,
Schatz, D. G.,
Engelman, D. M.,
and Coleman, J. E.
(1996)
J. Mol. Biol.
260,
70-84[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Godderz, L. J.,
Rahman, N. S.,
Risinger, G. M.,
Arbuckle, J. L.,
and Rodgers, K. K.
(2003)
Nucleic Acids Res.
31,
2014-2023[Abstract/Free Full Text]
|
| 33.
|
Aidinis, V.,
Bonaldi, T.,
Beltrame, M.,
Santagata, S.,
Bianchi, M. E.,
and Spanopoulou, E.
(1999)
Mol. Cell. Biol.
19,
6532-6542[Abstract/Free Full Text]
|
| 34.
|
Swanson, P. C.
(2002)
Mol. Cell. Biol.
22,
1340-1351[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Nishihara, F. Nagawa, T. Imai, and H. Sakano
RAG-Heptamer Interaction in the Synaptic Complex Is a Crucial Biochemical Checkpoint for the 12/23 Recombination Rule
J. Biol. Chem.,
February 22, 2008;
283(8):
4877 - 4885.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. S. Rahman, L. J. Godderz, S. J. Stray, J. D. Capra, and K. K. Rodgers
DNA Cleavage of a Cryptic Recombination Signal Sequence by RAG1 and RAG2: IMPLICATIONS FOR PARTIAL VH GENE REPLACEMENT
J. Biol. Chem.,
May 5, 2006;
281(18):
12370 - 12380.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Fugmann, C. Messier, L. A. Novack, R. A. Cameron, and J. P. Rast
An ancient evolutionary origin of the Rag1/2 gene locus
PNAS,
March 7, 2006;
103(10):
3728 - 3733.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ciubotaru and D. G. Schatz
Synapsis of Recombination Signal Sequences Located in cis and DNA Underwinding in V(D)J Recombination
Mol. Cell. Biol.,
October 1, 2004;
24(19):
8727 - 8744.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. De, M. M. Peak, and K. K. Rodgers
DNA Cleavage Activity of the V(D)J Recombination Protein RAG1 Is Autoregulated
Mol. Cell. Biol.,
August 1, 2004;
24(15):
6850 - 6860.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|