|
Originally published In Press as doi:10.1074/jbc.M211770200 on March 6, 2003
J. Biol. Chem., Vol. 278, Issue 20, 18440-18447, May 16, 2003
Adipose-specific Expression, Phosphorylation of
Ser794 in Insulin Receptor Substrate-1, and Activation in
Diabetic Animals of Salt-inducible Kinase-2*
Nanao
Horikeabc,
Hiroshi
Takemoriab,
Yoshiko
Katohac,
Junko
Doiad,
Li
Mina,
Tomoichiro
Asanoe,
Xiao Jian
Sunf,
Hiroyasu
Yamamotog,
Soji
Kasayamag,
Masaaki
Muraokaah,
Yasuki
Nonakai, and
Mitsuhiro
Okamotoajk
From the a Department of Biochemistry and Molecular Biology
(H-1) and g Department of Molecular Medicine (C-4), Graduate
School of Medicine, and j Laboratories for Biomolecular
Networks, Graduate School of Frontier Biosciences, Osaka University,
2-2 Yamadaoka, Suita, Osaka 565-0871, Japan, the d Department
of Life Science, Kinran College, Suita, Osaka 565-0873, Japan, the
e Department of Internal Medicine, Graduate School of Medicine,
University of Tokyo, Tokyo 113-0033, Japan, and
f Endocrinology Division, College of Medicine, University of
Vermont, Burlington, Vermont 05405, h ProteinExpress Co.,
Ltd., 2-11 Chuo-cho, Choshi, Chiba 288-0041, Japan, and
i College of Nutrition, Koshien University, Takarazuka, Hyogo,
665-0006, Japan
Received for publication, November 19, 2002, and in revised form, February 28, 2003
 |
ABSTRACT |
Salt-inducible kinase (SIK),
first cloned from the adrenal glands of rats fed a high salt diet, is a
serine/threonine protein kinase belonging to an AMP-activated protein
kinase family. Induced in Y1 cells at an early stage of ACTH
stimulation, it regulated the initial steps of steroidogenesis. Here we
report the identification of its isoform SIK2. When a green fluorescent
protein-fused SIK2 was expressed in 3T3-L1 preadipocytes, it was mostly
present in the cytoplasm. When coexpressed in cAMP-responsive
element-reporter assay systems, SIK2 could repress the cAMP-responsive
element-dependent transcription, although the degree of
repression seemed weaker than that by SIK1. SIK2 was specifically
expressed in adipose tissues. When 3T3-L1 cells were treated with the
adipose differentiation mixture, SIK2 mRNA was induced within
1 h, the time of induction almost coinciding with that of c/EBP
mRNA. Coexpressed with human insulin receptor substrate-1 (IRS-1)
in COS cells, SIK2 could phosphorylate Ser794 of human
IRS-1. Adenovirus-mediated overexpression of SIK2 in adipocytes
elevated the level of phosphorylation at Ser789, the mouse
equivalent of human Ser794. Moreover, the activity and
content of SIK2 were elevated in white adipose tissues of
db/db diabetic mice. These results suggest that highly
expressed SIK2 in insulin-stimulated adipocytes phosphorylates Ser794 of IRS-1 and, as a result, might modulate the
efficiency of insulin signal transduction, eventually causing the
insulin resistance in diabetic animals.
 |
INTRODUCTION |
The lipid metabolism in adipose tissues is under the control of
two hormonal signaling pathways; insulin stimulates glucose uptake and
lipogenesis, whereas cAMP, generated by exogenous stimuli like
adrenalin and glucagon, stimulates lipolysis. If the balance between the two signaling systems becomes lost and the adipose tissues
are exposed to hyperinsulinemia for a prolonged time, they gradually
become resistant to insulin stimulation (1, 2). The insulin resistance
occurring in tissues involved in biological fuel metabolism, such as
adipose tissues, liver, and skeletal muscles, would finally cause
disorders in energy metabolism of the whole body, such as obesity and
type 2 diabetes (3, 4). Insulin receptor substrate
(IRS)1 proteins are key
molecules of the insulin-signaling cascade (5); they are phosphorylated
on tyrosine residues by the action of insulin-dependently
activated insulin receptor kinase, and the tyrosine-phosphorylated IRS
proteins trigger further intracellular cascades. Several investigators
recently reported (6, 7) that IRS proteins, under certain
non-physiological conditions, were phosphorylated on serine residues.
The serine phosphorylation of IRS proteins would modulate the
efficiency of the insulin-signaling cascade (8, 9) and eventually
render the animals resistant to insulin stimulation (10, 11). Molecular
identification of several protein kinases responsible for the serine
phosphorylation of IRS proteins has been reported (12-24).
Salt-inducible kinase (SIK) was first cloned from the adrenal glands of
rats fed a high salt diet (25, 26). It is a serine/threonine protein
kinase that belongs to a sucrose-nonfermenting-1 protein kinase/AMP-activated protein kinase (AMPK) family. It was induced in
adrenocortical cells at a very early phase of ACTH stimulation, and its
molecular properties have been investigated in detail (27-29). Its
presence in tissues other than the adrenal cortex was also reported
(27). Examining the genomic data base, we noticed the presence of an
isoform of SIK. A cDNA clone of the isoform was isolated; the newly
identified enzyme was named SIK2, and the previously reported isoform
was renamed SIK1. We demonstrate here that SIK2 was abundantly
expressed in adipose tissues and was induced at a very early stage
during the process of preadipocyte-adipocyte differentiation. When
expressed together with human IRS-1 in COS-7 cells, it phosphorylated
Ser794 of human IRS-1. Moreover, its activity and content
in white adipose tissues of diabetic animals were elevated.
 |
EXPERIMENTAL PROCEDURES |
Experimental Animals--
Male ddY, C57BL/6Cr, and C57BLKs/J
db/db (30) mice (10 weeks old) were purchased
from SLC Co. Ltd. (Shizuoka, Japan) and maintained under standard
conditions of light and temperature. All experiments were carried out
in accordance with guidelines for animal care of Osaka University
Medical School.
Cloning of Mouse SIK2 cDNA--
By searching human genome
data base GenBankTM/EMBL/DDBJ for SIK homolog, we found
that the putative protein kinase KIAA0781 (GenBankTM
accession number AB018324) and SIK1 were rather similar to each other,
although the COOH-terminal half of KIAA0781 seemed completely different
from SIK1. We examined the chromosomal loci of human SIK1
and KIAA0781 genes; the SIK1 gene was found on
chromosome 21 (GenBankTM accession numbers AP001046 and
AP001047), whereas the KIAA0781 gene was found on chromosome
11 (GenBankTM accession number AP000925), indicating that
the two genes were similar but distinct. Because the KIAA0781 protein
predicted from the data base lacked its NH2-terminal part,
we decided to isolate a full-length cDNA of KIAA0781 protein.
However, the available knowledge of expressed human cDNAs was
poorer than that of mouse cDNAs. Therefore, a mouse expression tag
(EST) clone data base was searched for mouse homologs of the two genes.
As the result, a 3' non-coding cDNA fragment of mouse SIK1
(GenBankTM accession number U11494) and that of mouse
KIAA0781 protein (GenBankTM accession number AA880086) were
identified. Based on the cDNA structure, a 3' non-coding region of
mouse SIK1 cDNA was amplified by PCR by using primers,
5'-TTGCTCATGCCTGTGTAGTG and 5'-TTCGCCTGTCTGGAGAGTAA. An EST clone
containing a 3' non-coding region of mouse KIAA0781, IMAGE:1230878, was
purchased from Invitrogen. By using these cDNA fragments as probes,
we found that mouse mRNA for KIAA0781 protein was abundantly
expressed in white adipose tissues. Next, we amplified a full-length
mouse KIAA0781 protein cDNA with reverse transcription-PCR by using
F primer (5'-TTGGATCCATGGTCATGGCGGATGGCCCGAGGCA) and R primer
(5'-CTAGGTCTCCCGGGCTAAGCAGCTCACAACCCCATTGTGTTGTGGGTCCACAGC). (The
F primer was designed by taking account of the sequence of an EST clone
(GenBankTM accession number AV146436), similar to human
KIAA0781 protein and having about 300 bp corresponding to the
NH2-terminal peptide. In addition, a BamHI site
was added to the 5' terminus of the F primer to make the cloning of
cDNA into several expression vectors easier. Based on the
termination codon of IMAGE:1230878, we could expect the presence of a
BamHI site near the 3' terminus. So the R primer was
designed to have a mutation at the BamHI site without amino
acid substitution.) The PCR products were directly cloned into pTarget
vector (Promega, Madison, WI), providing five clones that were
sequenced. All clones had the same nucleotide sequence and were 88.8 and 54.7% identical to the coding regions of human KIAA0781 protein
and rat SIK1, respectively. We named the protein encoded by this
cDNA "mouse SIK2" and used it for further study. The amino acid
sequence of mouse SIK2 was 91.5% identical to that of human KIAA0781
protein and was 33.5% to that of rat SIK1.
Plasmids--
To construct vectors for green fluorescence
protein (GFP)-tagged SIK2 and glutathione S-transferase
(GST)-tagged SIK2, BamHI-NotI fragments of mouse
SIK2 cDNA were cloned into the BamHI-NotI
sites of pGFPC (29) and pEBG (kindly given by Dr. Lee A. Witters, Dartmouth Medical School, Hanover, NH (31)), respectively.
Site-directed mutagenesis kits, GeneEditor (Promega), were used with
the mutagenic primers, 5'-CGGAGGTGGCTATCATGATAATAGACAAGTCACAGC
and 5'-GAAGGCCGCAGAGCTGCAGATACGTCCCTTAC, to produce mutated
SIK2s, SIK2(K49M) and SIK2(S587A), respectively.
Escherichia coli expression vectors for GST-fused rat IRS-1
peptide (784-793 residues) and a mutated peptide, IRS-1(S789A), were
prepared by introducing oligonucleotides into the
BamHI/EcoRI site of pGEX-6P3 (Amersham
Biosciences). Nucleotide sequences of oligonucleotides used are as
follows: for wild-type IRS-1, 5'-GATCCCTTCGTCTCTCTTCAAGCTCTGGACGCCTTG and
5'-AATTCAAGGCGTCCAGAGCTTGAAGAGAGACGAAGG; for IRS-1(S789A),
5'-GATCCCTTCGTCTCTCTTCAGCCTCTGGACGCCTTG and 5'-AATTCAAGGCGTCCAGAGGCTGAAGAGAGACGAAGG. To prepare a mammalian expression vector for human IRS-1, pEBG-hIRS-1, SpeI
and NotI sites were created by site-directed mutagenesis in
human IRS-1 cDNA at the 5' and the 3' termini (13). The resultant
full-length human IRS-1 cDNA was isolated by SpeI and
NotI digestion and ligated into the
SpeI/NotI site of pEBG vector. A vector for
mutated human IRS-1(S794A) was similarly prepared by site-directed
mutagenesis by using an oligonucleotide,
5'-CAGCACCTCCGCCTTTCCACTGCTAGCGGTCGCCTTCTCTATGC.
cDNA fragments for mouse SREBP-1 and aP2 were amplified by reverse
transcription-PCR from mouse adipose RNAs by using the following
primers: for SREBP-1, forward (5'-TGGCCCTGTGTGTACTGGTC) and reverse
(5'-GCAGCTGCCACGTAGATCTC); and for aP2, forward
(5'-CCCCATTGGTCACTCCTACA) and reverse (5'-ATTTCCATCCAGGCCTCTTC). The
amplified fragments were cloned into pT7-Blue vector (Novagen, Madison,
WI). cDNA probes for c/EBPs and PPAR were were described
previously (32, 33).
Antibodies--
A specific antibody to SIK2 was raised against a
peptide at the COOH-terminal side (346- 931 residues) in rabbits as
described (34). To produce the antigen, a cDNA fragment encoding
the above peptide was amplified by PCR with primers,
5'-AAGGATCCGTGGAGCAGAGACTTGATG and
5'-TGCGGCCGCTAGGTCTCCCGGGCTAAG, digested by
BamHI/NotI, and cloned into a
BamHI/NotI site of pET28a (Novagen). An antibody against phospho-Ser789 of rat IRS-1 was described before
(35).
Immunoprecipitation--
Mouse tissues (0.3-0.5 g) were
homogenized in 2 ml of lysis buffer (29). The homogenates were
preincubated with 100 µl of protein-G-Sepharose at 4 °C for 30 min
to remove nonspecifically bound proteins. The mixture was centrifuged
at 15,000 rpm for 15 min, and the resulting infranatant was recovered,
and the protein concentration was determined with Protein Assay
(Bio-Rad). The protein solutions, 3 mg obtained from white
adipose, 3 mg from brown adipose, 18 mg from liver, or 18 mg from
skeletal muscles, were incubated with 10 µl of anti-SIK2-specific
antiserum and 50 µl of protein-G-Sepharose at 4 °C for 3 h.
The SIK2-IgG-protein-G-Sepharose complex was precipitated by
centrifugation at 3000 × g for 5 s, washed three
times with 1 ml of lysis buffer, and washed once with 1 ml of
SIK-reaction buffer (27). The final precipitate was suspended in the
SIK-reaction buffer with a final volume of 50 µl. Two aliquots of the
SIK2-IgG suspension were used for the immunoblot analysis and in
vitro kinase assay.
To prepare the samples from cultured cells, fully differentiated 3T3-L1
adipocytes were lysed in 1 ml of lysis buffer, and aliquots of the
lysate were incubated with anti-IRS-1 antibody (5 µl),
anti-phospho-Ser789 IRS-1 antiserum (10 µl), or anti-SIK2
antiserum (10 µl) in the presence of 50 µl of protein-A-Sepharose
for 3 h.
Cells--
3T3L-1 cells, obtained from Japan Health Sciences
Foundation, were maintained in Dulbecco's modified Eagle's medium
(DMEM, Sigma) containing 10% fetal calf serum and antibiotics, at
37 °C under an atmosphere of 5% CO2, 95% air. After
reaching confluence, the cells were treated with a differentiation
mixture (36), MIX (0.5 mM 3-methyl-1-isobutylxanthine, 1 µg/ml insulin, and 1 µM dexamethasone), in DMEM
containing high concentration of glucose (2.5 g/liter). After the 2 days of treatment, the cells were transferred into DMEM containing high
glucose, and the medium was changed every 2nd day. COS-7 cells were
also maintained in DMEM. For transfection of expression vectors,
LipofectAMINE 2000 (Invitrogen) was used in this study.
Phosphorylation of Human IRS-1--
The phosphorylation of
Ser794 in human IRS-1 by SIK2 in COS-7 cells was performed
by a method described previously (29) with some modification. COS-7
cells, after having been transformed with pTarget-SIK2 and pEBG-hIRS-1,
were incubated with 32PO4 (0.05 mCi, 1.85 MBq)
for 12 h in phosphate/serum-free medium. GST-human IRS-1 expressed
in the cells was purified using a glutathione-conjugated column
(MicroSpinTM GST Purification Module, Amersham Biosciences)
and subjected to SDS-PAGE followed by autoradiography.
Adenovirus-mediated Expression of SIK2--
To overexpress SIK2
protein in 3T3-L1 adipocytes, ViraPowerTM adenoviral
expression system (Invitrogen) was used. cDNA fragments of
wild-type SIK2, SIK2(S587A), and SIK2(K49M) were prepared by BamHI/NotI digestion and ligated into the
BamHI/NotI site of pENTR-1A vector (Invitrogen).
pAd/CMV/V5-DEST vector and the Gateway system were used to construct
adenovirus DNAs. About 1 × 108 plaque-forming units
of virus were used for infection of 3T3-L1 adipocytes in 6-cm dishes.
Other Procedures--
Expression of GST-tagged proteins in
E. coli and COS-7 cells and their purification was described
before (27, 29). Procedures for Northern blot analysis, in
vitro kinase assays, and reporter assays were described in Ref.
27.
 |
RESULTS |
Primary Structure of SIK2--
Mouse SIK2 is a 931-amino
acid protein, with a molecular mass about 120 kDa. Fig.
1A shows the sequence
similarity between mouse SIK2 and rat SIK1, highlighting three highly
conserved domains. Domain 1, a serine/threonine protein kinase domain,
was found near the NH2 terminus of SIK2, at the region
20-271 residues. Amino acid residues in the SIK2 and SIK1 kinase
domains were 78% identical to each other. Domain 2, a 54-amino acids
stretch, with 70% residues identical between SIK2 and SIK1, was found
in the central part of the protein. A computer-assisted data base
search (www.sanger.ac.uk/Software/Pfam/) revealed that this domain
contained a ubiquitin-associate motif, a motif found in several
proteins having connections with ubiquitin-dependent
intracellular protein degradation. Whether domain 2 plays a role for
the intracellular turnover of SIK protein remains to be explored.
Domain 3, present one-third from the COOH terminus, contained a protein
kinase A-dependently phosphorylatable Ser587, a
SIK2 equivalent for Ser577 of SIK1.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison between rat SIK1 and mouse
SIK2. A, primary structures of rat SIK1
(GenBankTM accession number AB020480) and mouse SIK2
(GenBankTM accession number AB067780). Highly similar three
regions, Domains 1-3, are highlighted by boxes (the degree
of identity is indicated by %). The amino acid residues essential for
kinase activity, Lys56 and Lys49, and those
sensitive for PKA-dependent phosphorylation,
Ser577 and Ser587, are indicated by red
letters. B, in vitro kinase assay of GST-tagged
SIKs. COS-7 cells, having been plated in a 10-cm dish, were transformed
with 3 µg of GST-SIKs expression vectors (pEBG). After 48 h of
incubation, the cells were lysed in 0.7 ml of lysis buffer, and the
GST-SIKs were purified by glutathione columns (CP, column
purification) followed by Western blot (WB) using anti-GST
antibody (left panel) and in vitro kinase assay
(right panel). Purified SIKs were incubated with 5 µg of
GST-Syntide2 in the presence 0.5 µCi (18.5 kBq) of
[ -32P]ATP at 30 C° for 30 min. The kinase reaction
was stopped by adding 3× SDS sample buffer and heating at 100 °C
for 5 min. The aliquots were subjected to 15% SDS-PAGE, and
phosphorylated peptides were visualized by autoradiogram.
C, intracellular distribution of GFP-tagged SIKs.
3T3-L1 cells, having been plated on 18-mm coverslips, were transformed
with 0.5 µg of expression vectors (pGFP-SIK1 and -SIK2) for
GFP-tagged SIKs (wild-type (WT) and PKA-resistant (S577A/S587A)). After
16 h of incubation, the cells were treated with (+) or without
( ) adipocyte differentiation MIX for 12 h and then fixed.
D, SIKs repress PKA-induced CRE activity in 3T3-L1
cells. 3T3-L1 cells, cultured at 1 × 105/well in
12-well plates for 12 h, were transformed with 0.20 µg of
pTAL-CRE reporter or pTAL, SIK1 (upper panel) (pIRES-SIK1,
pIRES-SIK1 (S577A), pIRES-SIK1 (K56M), or empty vector pIRES) or SIK2
(lower panel) (pTarget-SIK2, pTarget-SIK2 (S587A),
pIRES-SIK2 (K49M), or empty vector pTarget) expression vectors 0.20 µg, and pRL-SV40 internal control 0.03 µg, using 1.8 µl of
LipofectAMINE 2000. After 16 h forskolin (20 µM) was
added to the cells, and they were incubated for 6 h and harvested
for luciferase activities in the dual-luciferase reporter assay system.
Transformation efficiencies were corrected by Renilla
luciferase activities. The specific transcriptional activities derived
from the CRE were expressed as fold expression of the reporter activity
of the empty vector pTAL. Means of four experiments are shown.
|
|
Serine Kinase Activity of SIK--
Full-length SIK2 and SIK1 were
expressed as GST-fused proteins in COS-7 cells and purified by using a
glutathione-Sepharose column. The purified GST-SIKs were subjected to
SDS-PAGE followed by immunoblot analyses using the anti-GST antibody.
The expressed GST-SIK2 had an apparent molecular mass of about 150 kDa,
the sum of GST and SIK2 (left panel in Fig. 1B).
The purified GST-SIK2 was next incubated with GST-Syntide 2 in the
presence of 32P-labeled ATP, and the reaction mixture was
subjected to SDS-PAGE followed by autoradiography (right
panel in Fig. 1B). Two radioactive bands appeared on an
x-ray film, and the band with the lower molecular weight was that of
the phosphorylated Syntide 2, whereas that with the higher molecular
weight was that of the autophosphorylated SIK2. Lys49 of
SIK2, present in the ATP-binding loop (shown in Fig. 1A), is
an SIK2 equivalent to Lys56 of SIK1 that was essential for
the kinase activity. A mutant SIK2 having Met-49 instead of Lys was
assayed for the kinase activity, with the expected results of the
mutant being inactive. The similar experiments performed with SIK1
provided the results completely consistent with those reported previously.
Intracellular Distribution and CRE-repressing Activity of
SIK2--
Our previous study of SIK1 demonstrated that it was present
in both nuclear and cytoplasmic compartments of resting Y1 cell, with
the higher content in the nucleus (29). Also shown was that when the
cells were stimulated with ACTH, Ser577 was protein kinase
A-dependently phosphorylated, and the phosphorylated SIK1
was translocated to the cytoplasm. We examined the subcellular distribution of SIK1 and SIK2 by expressing GFP-fused SIKs in 3T3-L1
cells (Fig. 1C). GFP-SIK1, expressed in 3T3-L1 cells, like that expressed in Y1 cells, was mostly present in the nucleus, and the
protein was translocated to the cytoplasm after the cells were
stimulated with a differentiation mixture (MIX). In contrast, GFP-SIK2
seemed to exist mostly in the cytoplasmic compartment of both resting
and stimulated cells, although weak green fluorescence signal could be
detected in the nucleus as well. That SIK2 was in fact present in the
nucleus was more clearly shown in the cells expressing GFP-SIK2(S587A),
whose phosphorylatable Ser587 had been replaced with Ala.
SIK1, when coexpressed with CRE-reporter gene in Y1 cells, could
repress the PKA-dependently activated reporter activity
(28). We examined the effect of SIKs on
CRE-dependent transcription efficiency in 3T3-L1 cells by
using CRE-reporter cotransfection assays. The extent of SIK2-mediated
inhibition of the forskolin-dependent activation of
CRE-reporter was about 40% weaker (lower panel in Fig.
1D), compared with about 80% obtained by SIK1 (upper
panel in Fig. 1D). As expected, SIK2(S587A), whose
PKA-dependent phosphorylation site had been abolished,
could repress the CRE activity more prominently than the wild-type
SIK2. The SIK kinase activity was indispensable for this repressive
effect, because the enzymatically inactive SIK2(K49M) did not seem to
be repressive.
Tissue Distribution of SIK2--
The tissue distribution of SIK2
was examined by Northern blot analyses of various tissues taken from
10-week-old ddY mice (Fig.
2A). Large amounts of SIK2
transcripts were found in both white adipose and brown adipose tissues,
and a little was found in the testis. Two SIK2 mRNA bands, 4 and 6 kb long, were consistently detected; this seemed to result from an
alternative splicing. As reported before (27), SIK1 mRNA was
present mainly in adrenal gland and in smaller amounts in ovary, brain,
testis, and skeletal muscle in the diminishing order.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 2.
Adipose-specific expression of SIK2.
A, total RNAs (10 µg), each prepared from the
indicated organs from male (except for the case of ovary) ddY mice (10 weeks old), were electrophoresed in 1% agarose gel and subjected to
Northern blot analysis. cDNA fragments of mouse SIK2 (top
panel), mouse SIK1 (2nd panel), and
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) (3rd
panel) were used as probes (see "Experimental Procedures").
Ethidium bromide staining of ribosomal RNA was shown in the 4th
panel. WAT, epididymal white adipose tissues;
BAT, brown adipose tissues; Sk Muscle,
skeletal muscles. B, SIK2 is induced during adipocyte
differentiation of 3T3-L1 cells. 3T3-L1 cells, having been cultured in
10-cm dishes, were harvested for RNA extraction before
(Growth) or after (Confluent) confluency or
during the adipocyte differentiation (Day 1 to Day
7). To induce adipocyte differentiation, cells were incubated with
the differentiation MIX in the DMEM containing high glucose (2.5 g/liter) for 2 days. After incubation, medium was changed to fresh
medium with high glucose every 2nd day. The cells harvested at the
indicated days were subjected to Northern blot analyses by using
cDNA probes indicated. C, 3T3-L1 cells that reached
confluency were treated with the differentiation mixture for short
periods. Dibutyryl cAMP (1 mM) instead of
methylisobutylxanthine was used as a component of the differentiation
mixture. D, each of the three hormones in the
differentiation mixture was added alone, or as the mixture, to 3T3-L1
cells for 2 h. The vertical bar denotes "without
hormone." Autoradiographs shown in A-D are the
representative data from triplicate experiments. B-D,
the filters were exposed to x-ray films for 16 h to visualize SIK2
mRNA, and for 3 days to visualize SIK1 mRNA. DX,
dexamethasone.
|
|
SIK2 Is Expressed during Differentiation of Adipocytes--
The
high expression of sik2 genes in adipose tissues prompted us
to examine the level of SIK2 mRNA during the process of
preadipocyte-adipocyte differentiation. Thus, 3T3-L1 fibroblasts were
cultured for 4 days in DMEM to attain confluence. Then they were
treated with the differentiation mixture to initiate the
differentiation. At several time points after the treatment, the cells
were harvested to examine mRNA levels of SIK2 and several other
adipocyte differentiation markers. As shown in Fig. 2B, SIK2
mRNA was prominently expressed after the first 24-h incubation, and
the level remained high until day 7, when the preadipocytes were mostly
differentiated into mature adipocytes (judged by oil Red-O staining;
data not shown). On the other hand, the level of SIK1 mRNA,
although quite lower compared with that of SIK2 (see the difference in
film exposure times given in the legend), seemed to rise a little
during the first 24 h and remained at the elevated level until day
7. The level of Pref-1 mRNA, a marker of preadipocytes (37), began to decline after the day 2. The mRNA levels of c/EBP and
c/EBP , transcription factors known to appear early in the adipocyte
differentiation (36), rose during the first 24 h in a manner
similar to that of SIK2. The mRNA levels of known late response
genes of adipogenesis, such as SREBP-1, c/EBP , PPAR , and aP2 (38,
39), began to rise after day 2 or day 4. We further examined the
expression of mRNAs during the first 12 h after the
stimulation (Fig. 2C). The SIK2 mRNA level rose within
1 h after the stimulation, and the elevation almost coincided with
that of c/EBP mRNA. The elevation of c/EBP mRNA level
occurred within 1 h as well, but the level gradually declined
after a few hours.
In order to examine which agent in the mixture of three hormones,
insulin, cAMP, and dexamethasone, was required to stimulate the
transcription of sik2 gene, the preadipocytes were incubated for 2 h with a single hormone or a mixture of the three, and the mRNA levels were examined (Fig. 2D). The transcription
of sik2 gene seemed to be activated by dexamethasone alone
to the similar degree as by the mixture, although even insulin alone
could also substantially activate the transcription.
SIK2 Phosphorylates Ser794 of Human IRS-1--
The
above findings strongly suggest that SIK2 may be involved in the signal
transduction pathways in adipose tissues. But nothing more could be
added to this issue until we could identify the intracellular target
molecule(s) of SIK2 action. In our attempt to search for the target
molecule, we noticed that several serine/threonine kinases, including
AMPK, to whose family SIK2 belongs, mitogen-activated protein kinase,
and c-Jun NH2-terminal kinase, are known to play important
roles in modulating the insulin-dependent stimulus-response coupling (6, 7). Therefore, we surmised that the target molecules(s) of
SIK2 might be found somewhere in the insulin-stimulated signaling
pathways of adipose tissues. Our in vitro kinase assays using various synthetic peptide substrates suggest that the canonical phosphorylation motif of SIK is (Hy)((B)X or
X(B))XX(S/T)XXX(Hy), where
S/T is the phosphorylatable Ser or Thr, and (Hy) and (B) are
hydrophobic and basic residues,
respectively.2 Because a
peptide stretch,
Leu-Arg-Leu-Ser-Thr-Ser794-Ser-Gly-Arg-Leu, in human
IRS-1 seemed consistent with the canonical motif, we first tested
whether or not several synthetic peptides having sequences similar to
this stretch could serve as substrates of E. coli-expressed
SIK2. As shown in Fig. 3A, a
rat IRS-1-derived peptide (784-793 residues),
Leu784-Arg-Leu-Ser-Ser-Ser789-Ser-Gly-Arg-Leu793,
was strongly phosphorylated, and the Ser789-disrupted
mutant peptide was weakly phosphorylated by SIK2. Because the rat IRS-1
peptide contained four successive serine residues, we
surmised that one, or several, of the neighboring three residues, Ser787, Ser788, or Ser790, in the
Ser789-disrupted peptide(S789A) might be weakly
phosphorylated by SIK2. In any case, this result clearly indicated that
Ser789 in rat IRS-1, an equivalent for Ser794
in human IRS-1, was a possible candidate for phosphorylation by SIK2
in vitro.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 3.
SIK phosphorylates IRS-1 in vivo
and in vitro. A, peptide (5 µg) of rat IRS-1, 784-793 residues, and its mutant (S789A) were
expressed as GST fusion proteins in E. coli expression
systems, purified, and used for substrates of GST-liked SIK2 produced
in COS-7 cells in the in vitro kinase assays. Upper
panel shows the incorporation of 32P into the
synthetic substrates, and the lower panel shows the
Coomassie Brilliant Blue (CBB) staining of the substrates.
GST-Syntide2 was used for positive control. B, COS-7
cells, cotransformed with mammalian GST-expression vectors (pEBG, 1.5 µg) for GST-human IRS-1 (full-length and its mutant S794A) and SIK2
and its kinase-defective mutant, K49M, (pTarget; 1.5 µg), were
incubated with 32PO4 (0.05 mCi, 1.85 MBq) for
12 h in phosphate/serum-free medium and lysed in 700 µl of lysis
buffer. The GST-human IRS-1s were purified by glutathione columns
(CP, column purification) and subjected to SDS-PAGE (10%),
and the levels of phosphorylation were visualized by autoradiography
(upper panel). Similar experiments were done without isotope
labeling and subjected to Western blot (WB) analyses using
anti-phospho-Ser789 of rat IRS-1 (middle panel)
and anti-IRS-1 antibodies (lower panel). C,
adenovirus-mediated overexpression of SIK2 in 3T3-L1 adipocytes. 3T3-L1
adipocytes, fully differentiated after 10 days, were infected with
adenovirus that could express lacZ (control), wild-type SIK2
(WT), SIK2(S587A), and SIK2(K49M). After 48 h of
incubation, cells were lysed in 1 ml of lysis buffer, and IRS-1,
phospho-IRS-1, and SIK2 proteins were purified by immunoprecipitation
(IP) followed by Western blotting with respective antibodies
as described under "Experimental Procedures." D,
IRS-1 was phosphorylated at Ser794 in preadipocytes, but
the SIK2-dependent CRE suppression overwhelmed the
phosphorylated IRS-1-mediated up-regulation of CRE activity. Wild-type
IRS-1 up-regulates forskolin-induced CRE activity in 3T3-L1
preadipocytes. The procedure for reporter assay is given in Fig. 1
legend. In addition to plasmids denoted in Fig. 1D, 0.2 µg
of pEBG, pEBG-hIRS-1, and pEBG-IRS-1(S794A) were transformed into the
cells.
|
|
Next, GST-linked full-length human IRS-1 or its
Ser794-disrupted derivative was coexpressed with SIK2 or
Lys49-disrupted inactive SIK2 in
H332PO4-preincubated COS-7 cells.
As seen in the upper panel of Fig. 3B, the
wild-type IRS-1 was prominently phosphorylated in the wild-type
SIK2-expressed cells, although a weakly phosphorylated IRS-1 was found
in the inactive SIK2(K49M)-expressed cells, indicating that IRS-1 could
also be phosphorylated in COS-7 cells by a protein kinase(s) other than
SIK2. In contrast, the Ser794-disrupted IRS-1 could only
weakly, if at all, be phosphorylated in either the wild-type SIK2- or
the inactive SIK2-expressed cells. This result suggests that
Ser794 in human IRS-1 could be phosphorylated by SIK2 in
the cells.
To confirm that the phosphorylated residue in human IRS-1 was indeed
Ser794, we analyzed the cell homogenates by using a
specific antibody raised against the phosphorylated Ser789
of rat IRS-1 (middle panel of Fig. 3B). The
phosphorylated Ser794 was clearly seen in the
homogenates prepared from the wild-type IRS-1- and the enzymatically
active SIK2-transfected cells. A very faint immunoreactive product was
seen in the lane of the homogenate prepared from the wild-type IRS-1-
and the inactive SIK2-transfected cells; this occurred probably because
the cells contained a serine kinase(s) other than SIK2 that could
phosphorylate Ser794. As expected, the antibody could not
detect the phosphorylation product in the homogenate prepared from the
Ser794-disrupted IRS-1- and SIK2-transfected cells.
Whether or not SIK2 phosphorylates the Ser789 in mouse
adipose cells could be determined by overexpressing SIK2 in 3T3-L1
cells. But in order to do so, the phosphorylation must be determined by
using the samples taken from the fully differentiated adipocytes rather
than preadipocytes, because the level of IRS-1 protein in the latter is
rather low. On the other hand, the efficient transformation of
adipocytes by naked plasmids would be rather difficult. To overcome
these difficulties, we attempted to employ an adenovirus-mediated
transformation system for the SIK2 expression in adipocytes. When
adenoviruses containing various kinds of constructs for SIK2 were used
to infect the fully differentiated 3T3-L1 cells (Fig.
3C), signals for anti-SIK2-immunoreactive proteins increased by 5-10-fold the control, shown in the lane labeled lacZ in
the lower panel. The total amount of IRS-1
present in the cell homogenates was not changed by SIK2 overexpression
(middle panel in Fig. 3C). When the immunoblot
analyses were carried out by using anti-phospho-Ser789
antibody (upper panel in Fig. 3C), weak, but
significant, immunoreactive bands having the molecular weight of IRS-1
appeared in the samples prepared from the wild-type-SIK2- or
PKA-resistant SIK2(S587A)-overexpressing adipocytes but not in those
prepared from the lacZ-infected control cells or the
inactive SIK2(K49M)- expressing cells.
The finding that either the wild-type SIK2 or the PKA-resistant
SIK2(S587A) could phosphorylate Ser789 of IRS-1 led us to
examine whether the Ser-phosphorylated IRS-1 could influence the
forskolin-dependent CRE activation and the SIK2-dependent suppression of CRE activity. Thus, the human
IRS-1 or its phosphorylation site-disrupted mutant IRS-1(S794A) was coexpressed in the CRE reporter assay system (Fig. 3D). The
forskolin-dependently activated CRE activity was further
elevated in the presence of wild-type human IRS-1. However, this
elevation seemed not to occur in the presence of IRS-1(S794A),
suggesting that IRS-1 was indeed phosphorylated at Ser794
in the PKA-stimulated adipocytes, and the phosphorylated IRS-1 could
up-regulate the forskolin-induced CRE activation. Whether or not a
kinase capable of this phosphorylation was the endogenously expressed
SIK2 was unclear in this experiment. When the PKA-resistant SIK2(S587A)
was overexpressed in this IRS-1/CRE system, the
forskolin-dependently activated CRE activity was completely
abolished either in the presence or the absence of IRS-1, suggesting
that the ability of SIK2 to repress the CRE-reporter transcription
might overwhelm the Ser-phosphorylated up-regulation capability of
IRS-1.
SIK2 Is Activated in White Adipose Tissues of Diabetic
Mice--
The phosphorylation of Ser789 in rat IRS-1 by
AMPK has been reported to occur in C2C12 myotubes in response to
5-aminoimidazole-4-carboxamide riboside (20). More recently, Qiao
et al. (35) reported that the Ser789 could be
phosphorylated in the liver of diabetic rats by a serine kinase that
was different from AMPK. These reports prompted us to measure the level
of SIK2 in tissues of genetically diabetic mice. Thus, white adipose
tissue, brown adipose tissue, liver, and skeletal muscle were taken
from db/db mice (30) or the wild-type lean mice and
homogenized. Northern blot analyses (Fig.
4A) indicated that SIK2
mRNA was present in the white as well as brown adipose tissues of
both diabetic and wild-type animals at the similar levels. As expected,
the SIK2 mRNA contents in liver and skeletal muscles were quite
lower compared with those in the adipose tissues. Again, there seemed
to be no difference in the mRNA contents in these tissues between
diabetic and wild-type animals. However, to our surprise, the levels of
SIK1 mRNA in brown adipose tissue, liver, and skeletal muscle of
diabetic mice were significantly elevated compared with those of
wild-type mice.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4.
Expression of SIK1 and SIK2 in diabetic and
wild-type animals. A, total RNAs were extracted
from 10-week-old male mice of C57BL/6Cr (used as wild-type
(WT)) and C57BLKs/J db/db (diabetic
animal (db)). To estimate the amounts of SIK1 and SIK2
mRNAs in various tissues under the similarly visualized conditions,
5 µg of RNAs each from WAT and BAT and 30 µg of RNAs each from
liver and skeletal muscle (Sk M) were subjected to Northern
blot analyses. B, SIK2 proteins were purified by
immunoprecipitation from lysates containing 3 mg of proteins each from
WAT and BAT and 18 mg of proteins each from liver and skeletal muscle,
and subjected to Western blot analyses. C,
immunopurified SIK2 from various tissues was subjected to in
vitro kinase assay using GST-Syntide2 as the substrate. The
results shown are the representative data from triplicate
experiments.
|
|
Cytosolic fractions of the respective tissues were subjected to
immunoprecipitation using an antibody raised against the COOH-terminal peptide of SIK2. The immunoprecipitates were then subjected to SDS-PAGE
followed by the immunoblot analyses using the anti-SIK2 antibody (Fig.
4B). The results clearly showed that the content of SIK2
protein in white adipose tissue of diabetic animals was higher than
that of wild-type animals. The SIK2 content in brown adipose tissue of
diabetic animals, on the other hand, was lower than that of wild-type
animals. Because the SIK2 contents in liver and skeletal muscle were
low, the immunoreactive bands were scarcely detected in these tissues,
showing no or little difference between the diabetic and wild-type animals.
The respective immunoprecipitate was next assayed for protein kinase
activity using Syntide-2 as a substrate. As shown in Fig.
4C, the precipitate of white adipose tissue of diabetic mice had distinctly higher SIK2 kinase activity than that of the wild-type animals. In contrast, the precipitate prepared from brown adipose tissue of diabetic mice had lower SIK2 kinase activity than that of
wild-type animals. These results seemed consistent with the difference
in SIK2 protein content between the two animals (Fig. 4B).
The liver homogenate had substantial SIK2 activity and that from
diabetic animals had a little lower activity than that from the
wild-type animals. The homogenate of skeletal muscle taken from
diabetic animals showed barely discernible SIK2 activity, whereas that
from wild-type animals showed no activity.
Together, these results strongly suggest that SIK2 protein as well as
its activity were elevated in the white adipose tissue of diabetic mice.
 |
DISCUSSION |
We herein for the first time described the enzymatic properties of
SIK2. In general, they are similar to those of SIK1. However, several
properties different between the two kinases should be noted. Although
SIK1 was found in the nuclear compartment of resting cells, SIK2, as
visualized by green fluorescence signal of the expressed GFP-fused
protein, was mostly present in the cytoplasm of 3T3-L1 cells. However,
the possible presence of a small amount of endogenous SIK2 in the
nucleus could not be excluded, because the fluorocytochemical technique
could only detect the intracellular localization of the expressed
protein. The precise subcellular distribution of SIK2, therefore, must
be established in the future by immunocytochemical methods using a
highly purified antibody raised against SIK2. That SIK2 could
substantially repress the forskolin-dependent transcriptional
activation of CRE-reporter gene may indicate the intranuclear presence
of SIK2. Almost complete repression obtained by the PKA-resistant
SIK2(S587A) clearly demonstrated that SIK2 could act as a
repressor for the CRE-mediated gene transcription, as was the case with
SIK1 (29).
The marked expression of sik2 gene in the adipose tissues
and its involvement in the insulin-mediated adipogenic signal
transduction must be emphasized here. SIK2 appeared to be one of the
very early response genes during preadipocyte-adipocyte
differentiation. The time-dependent elevation of SIK2
mRNA level almost coincided with that of the adipocyte-specific
transcription factors, such as c/EBP and c/EBP . The role played
by SIK2 during the initial stage of adipocyte differentiation has yet
to be clarified. However, it should be noted that the overexpression of
SIK2 could repress the CRE-reporter activity. Besides, based on our
previous investigation on SIK1 (40), SIK2 is likely to repress the
transcriptional activity of both constitutive active and dominant
negative CREBs. On the other hand, the activation of CREB/CRE signaling
has been reported (41, 42) to be an essential step of adipocyte
differentiation. When the CRE activation was disturbed by dominant
negative CREB or by addition of TNF- , the adipogenesis of 3T3-L1
cells was inhibited (41). The overexpression of constitutive active
CREB in 3T3-L1 cells rescued the apoptotic action of TNF- (43) and induced the adipogenesis (44). These considerations may suggest that
SIK2 might be involved in the regulation of the CRE-mediated transcription of genes essential for the initiation of adipogenesis. However, a possibility that SIK2 may also act in the cytoplasm by
regulating the signal transduction occurring in the early stage of
adipogenesis must be considered as well.
Numerous recent investigations suggest the regulatory roles played by
serine/threonine kinase(s) in the insulin signaling (6, 7). Several
serine kinases, including mitogen-activated protein kinase,
glycogen-synthase kinase 3 (14), casein kinase (12),
phosphatidylinositol 3-kinase (23), mTOR (16, 19, 22), c-Jun
NH2-terminal kinase (21, 45), Akt (16), and AMPK (20), are
known to phosphorylate IRS-1. The activation of AMPK in mouse C2C12
myotubes resulted in phosphorylation of Ser789 in IRS-1
(20). The Ser789-phosphorylated IRS-1 was also shown to be
tyrosine-phosphorylated. The resulting IRS-1 had a high affinity to
p85/p110 and thus activated the downstream signaling, such as
phosphatidylinositol 3-kinase (20). In general, the tyrosine
phosphorylation of IRS-1 and the up-regulation of the downstream
signaling are thought to enhance the insulin sensitivity and the
resistance to a high plasma level of glucose (3). However, in the liver
of high salt-induced type 2 diabetic rats, the similar up-regulation of
insulin signaling through IRS-1 occurred, and in this case, the serine
phosphorylation of IRS-1 was thought to eventually generate the insulin
resistance (46, 47). Recently, Qiao et al. (35) reported the
presence in the hepatic cytosols of a genetically diabetic rat of a
kinase responsible for the Ser789 phosphorylation of IRS-1,
which was distinct from AMPK. In viewing these reports, we hypothesized
that SIK2 might be involved in the serine phosphorylation of
insulin-signaling molecule(s) and regulate the signaling pathway in
adipose tissues. We found that Ser794 in human IRS-1, an
equivalent of Ser789 in rat IRS-1, could be phosphorylated
by SIK2 in the in vitro kinase assays as well as in COS-7
cells or 3T3-L1 adipocytes. Then we tested whether or not SIK2 was
activated in tissues prepared from diabetic animals. SIK2 was indeed
found activated in the white adipose tissue of diabetic mice.
Therefore, SIK2, by phosphorylating Ser789 in IRS-1, might
be involved in regulation of insulin sensitivity of white adipose
tissues of diabetic mice.
The case was different for the liver of diabetic mice, whose SIK2 level
seemed similar to that of wild-type animals. However, the levels of
SIK1 mRNA were found markedly elevated in the brown adipose
tissues, livers, and skeletal muscles of diabetic animals. Because our
anti-SIK1 antibody cross-reacted with SIK2 protein, we could not
determine the content and activity of SIK1 protein in these tissues.
However, a possibility remains that SIK1, which was originally
described as "salt-inducible kinase" (26), might be the kinase
responsible for phosphorylation of Ser789 in IRS-1 in the
livers of diabetic animals. Taken together, we propose here that in the
diabetic animals, SIK2 in white adipose tissues and SIK1 in brown
adipose tissues, livers, and skeletal muscles might be involved in the
disturbance of the insulin signaling occurring in these tissues and
therefore might play important pathogenic roles in the development of
type 2 diabetes.
 |
ACKNOWLEDGEMENT |
We are grateful to Dr. Lee A. Witters
(Dartmouth Medical School, Hanover, NH) for sending us pEBG.
 |
FOOTNOTES |
*
This work was supported in part by grants-in-aid for
Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology, the Ministry of Health, Labor, and Welfare Japan, grants from The Uehara Memorial Foundation, The Salt Science Research Foundation Grant 0238, grants from CREST Project of JPST for
"Endocrine Disruption on Action of Brain Neurosteroids," and by
"21st Century Center of Excellence" grant of Japan (to L. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB067780.
b
Both authors contributed equally to this work.
c
Research fellows of the Japan Society for the Promotion of Science.
k
To whom correspondence should be addressed: Dept. of
Biochemistry and Molecular Biology, Graduate School of Medicine (H-1), Osaka University, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan. Tel.:
81-6-6879-3280; Fax: 81-6-6879-3289; E-mail:
mokamoto@mr-mbio.med.osaka-u.ac.jp.
Published, JBC Papers in Press, March 6, 2003, DOI 10.1074/jbc.M211770200
2
Y. Katoh, H. Takemori, and M. Okamoto,
unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
IRS-1, insulin
receptor substrate-1;
SIK, salt-inducible kinase;
ACTH, adrenocorticotropic hormone;
CRE, cAMP-response element;
c/EBP, CCAAT/enhancer-binding protein;
AMPK, AMP-activated protein kinase;
GFP, green fluorescent protein;
GST, glutathione
S-transferase;
DMEM, Dulbecco's modified Eagle's medium;
PKA, cAMP-dependent protein kinase;
CREB, CRE-binding
protein;
TNF- , tumor necrosis factor- ;
WAT, white adipose tissue;
BAT, brown adipose tissue;
EST, expression tag.
 |
REFERENCES |
| 1.
|
Sul, H. S.,
Smas, C. M.,
Wang, D.,
and Chen, L.
(1998)
Prog. Nucleic Acids Res. Mol. Biol.
60,
317-345[Medline]
[Order article via Infotrieve]
|
| 2.
|
Saltiel, A. R.,
and Kahn, C. R.
(2001)
Nature
414,
799-806[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Zick, Y.
(2001)
Trends Cell Biol.
11,
437-441[Medline]
[Order article via Infotrieve]
|
| 4.
|
Lewis, G. F.,
Carpentier, A.,
Adeli, K.,
and Giacca, A.
(2002)
Endocr. Rev.
23,
201-229[Abstract/Free Full Text]
|
| 5.
|
White, M. F.,
and Yenush, L.
(1998)
Curr. Top. Microbiol. Immunol.
228,
179-208[Medline]
[Order article via Infotrieve]
|
| 6.
|
White, M. F.
(1997)
Diabetologia
40 Suppl. 2,
2-17[CrossRef]
|
| 7.
|
Saltiel, A. R.
(2001)
Cell
104,
517-529[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Xiang, X.,
Yuan, M.,
Song, Y.,
Ruderman, N.,
Wen, R.,
and Luo, Z.
(2002)
Mol. Endocrinol.
16,
552-562[Abstract/Free Full Text]
|
| 9.
|
Greene, M. W.,
and Garofalo, R. S.
(2002)
Biochemistry
41,
7082-7091[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Petersen, K. F.,
and Shulman, G. I.
(2002)
Am. J. Cardiol.
90,
G11-G18[Medline]
[Order article via Infotrieve]
|
| 11.
|
White, M. F.
(2002)
Am. J. Physiol.
283,
E413-E422
|
| 12.
|
Tanasijevic, M. J.,
Myers, M. G., Jr.,
Thoma, R. S.,
Crimmins, D. L.,
White, M. F.,
and Sacks, D. B.
(1993)
J. Biol. Chem.
268,
18157-18166[Abstract/Free Full Text]
|
| 13.
|
Ogihara, T.,
Isobe, T.,
Ichimura, T.,
Taoka, M.,
Funaki, M.,
Sakoda, H.,
Onishi, Y.,
Inukai, K.,
Anai, M.,
Fukushima, Y.,
Kikuchi, M.,
Yazaki, Y.,
Oka, Y.,
and Asano, T.
(1997)
J. Biol. Chem.
272,
25267-25274[Abstract/Free Full Text]
|
| 14.
|
Eldar-Finkelman, H.,
and Krebs, E. G.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9660-9664[Abstract/Free Full Text]
|
| 15.
|
De Fea, K.,
and Roth, R. A.
(1997)
J. Biol. Chem.
272,
31400-31406[Abstract/Free Full Text]
|
| 16.
|
Li, J.,
DeFea, K.,
and Roth, R. A.
(1999)
J. Biol. Chem.
274,
9351-9356[Abstract/Free Full Text]
|
| 17.
|
Paz, K.,
Liu, Y. F.,
Shorer, H.,
Hemi, R.,
LeRoith, D.,
Quan, M.,
Kanety, H.,
Seger, R.,
and Zick, Y.
(1999)
J. Biol. Chem.
274,
28816-28822[Abstract/Free Full Text]
|
| 18.
|
Engelman, J. A.,
Berg, A. H.,
Lewis, R. Y.,
Lisanti, M. P.,
and Scherer, P. E.
(2000)
Mol. Endocrinol.
14,
1557-1569[Abstract/Free Full Text]
|
| 19.
|
Haruta, T.,
Uno, T.,
Kawahara, J.,
Takano, A.,
Egawa, K.,
Sharma, P. M.,
Olefsky, J. M.,
and Kobayashi, M.
(2000)
Mol. Endocrinol.
14,
783-794[Abstract/Free Full Text]
|
| 20.
|
Jakobsen, S. N.,
Hardie, D. G.,
Morrice, N.,
and Tornqvist, H. E.
(2001)
J. Biol. Chem.
276,
46912-46916[Abstract/Free Full Text]
|
| 21.
|
Rui, L.,
Aguirre, V.,
Kim, J. K.,
Shulman, G. I.,
Lee, A.,
Corbould, A.,
Dunaif, A.,
and White, M. F.
(2001)
J. Clin. Invest.
107,
181-189[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Ozes, O. N.,
Akca, H.,
Mayo, L. D.,
Gustin, J. A.,
Maehama, T.,
Dixon, J. E.,
and Donner, D. B.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
4640-4645[Abstract/Free Full Text]
|
| 23.
|
Ravichandran, L. V.,
Esposito, D. L.,
Chen, J.,
and Quon, M. J.
(2001)
J. Biol. Chem.
276,
3543-3549[Abstract/Free Full Text]
|
| 24.
|
Liu, Y. F.,
Paz, K.,
Herschkovitz, A.,
Alt, A.,
Tennenbaum, T.,
Sampson, S. R.,
Ohba, M.,
Kuroki, T.,
LeRoith, D.,
and Zick, Y.
(2001)
J. Biol. Chem.
276,
14459-14465[Abstract/Free Full Text]
|
| 25.
|
Halder, S. K.,
Takemori, H.,
Hatano, O.,
Nonaka, Y.,
Wada, A.,
and Okamoto, M.
(1998)
Endocrinology
139,
3316-3328[Abstract/Free Full Text]
|
| 26.
|
Wang, Z.,
Takemori, H.,
Halder, S. K.,
Nonaka, Y.,
and Okamoto, M.
(1999)
FEBS Lett.
453,
135-139[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Lin, X.,
Takemori, H.,
Katoh, Y.,
Doi, J.,
Horike, N.,
Makino, A.,
Nonaka, Y.,
and Okamoto, M.
(2001)
Mol. Endocrinol.
15,
1264-1276[Abstract/Free Full Text]
|
| 28.
|
Doi, J.,
Takemori, H.,
Lin, X.-Z.,
Horike, N.,
Katoh, Y.,
and Okamoto, M.
(2002)
J. Biol. Chem.
277,
15629-15637[Abstract/Free Full Text]
|
| 29.
|
Takemori, H.,
Katoh, Y.,
Horike, N.,
Doi, J.,
and Okamoto, M.
(2002)
J. Biol. Chem.
277,
42334-42343[Abstract/Free Full Text]
|
| 30.
|
Lee, G. H.,
Proenca, R.,
Montez, J. M.,
Carroll, K. M.,
Darvishzadeh, J. G.,
Lee, J. I.,
and Friedman, J. M.
(1996)
Nature
379,
632-635[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Hamilton, S. R.,
O'Donnell, J. B., Jr.,
Hammet, A.,
Stapleton, D.,
Habinowski, S. A.,
Means, A. R.,
Kemp, B. E.,
and Witters, L. A.
(2002)
Biochem. Biophys. Res. Commun.
293,
892-898[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Kurebayashi, S.,
Sumitani, S.,
Kasayama, S.,
Jetten, A. M.,
and Hirose, T.
(2001)
Endocr. J.
48,
249-253[Medline]
[Order article via Infotrieve]
|
| 33.
|
Yamamoto, H.,
Kurebayashi, S.,
Hirose, T.,
Kouhara, H.,
and Kasayama, S.
(2002)
J. Cell Sci.
115,
3601-3607[Abstract/Free Full Text]
|
| 34.
|
Takemori, H.,
Zolotaryov, F. N.,
Ting, L.,
Urbain, T.,
Komatsubara, T.,
Hatano, O.,
Okamoto, M.,
and Tojo, H.
(1998)
J. Biol. Chem.
273,
2222-2231[Abstract/Free Full Text]
|
| 35.
|
Qiao, L. Y.,
Zhande, R.,
Jetton, T. L.,
Zhou, G.,
and Sun, X. J.
(2002)
J. Biol. Chem.
277,
26530-26539[Abstract/Free Full Text]
|
| 36.
|
Yeh, W. C.,
Cao, Z.,
Classon, M.,
and McKnight, S. L.
(1995)
Genes Dev.
9,
168-181[Abstract/Free Full Text]
|
| 37.
|
Smas, C. M.,
and Sul, H. S.
(1993)
Cell
73,
725-734[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Rosen, E. D.,
and Spiegelman, B. M.
(2001)
J. Biol. Chem.
276,
37731-37734[Free Full Text]
|
| 39.
|
Soukas, A.,
Socci, N. D.,
Saatkamp, B. D.,
Novelli, S.,
and Friedman, J. M.
(2001)
J. Biol. Chem.
276,
34167-34174[Abstract/Free Full Text]
|
| 40.
|
Doi, J.,
Takemori, H.,
Ohta, M.,
Nonaka, Y.,
and Okamoto, M.
(2001)
J. Endocrinol.
168,
87-94[Abstract]
|
| 41.
|
Reusch, J. E.,
Colton, L. A.,
and Klemm, D. J.
(2000)
Mol. Cell. Biol.
20,
1008-1020[Abstract/Free Full Text]
|
| 42.
|
Belmonte, N.,
Phillips, B. W.,
Massiera, F.,
Villageois, P.,
Wdziekonski, B.,
Saint-Marc, P.,
Nichols, J.,
Aubert, J.,
Saeki, K.,
Yuo, A.,
Narumiya, S.,
Ailhaud, G.,
and Dani, C.
(2001)
Mol. Endocrinol.
15,
2037-2049[Abstract/Free Full Text]
|
| 43.
|
Reusch, J. E.,
and Klemm, D. J.
(2002)
J. Biol. Chem.
277,
1426-1432[Abstract/Free Full Text]
|
| 44.
|
Klemm, D. J.,
Leitner, J. W.,
Watson, P.,
Nesterova, A.,
Reusch, J. E.,
Goalstone, M. L.,
and Draznin, B.
(2001)
J. Biol. Chem.
276,
28430-28435[Abstract/Free Full Text]
|
| 45.
|
Aguirre, V.,
Uchida, T.,
Yenush, L.,
Davis, R.,
and White, M. F.
(2000)
J. Biol. Chem.
275,
9047-9054[Abstract/Free Full Text]
|
| 46.
|
Anai, M.,
Funaki, M.,
Ogihara, T.,
Kanda, A.,
Onishi, Y.,
Sakoda, H.,
Inukai, K.,
Nawano, M.,
Fukushima, Y.,
Yazaki, Y.,
Kikuchi, M.,
Oka, Y.,
and Asano, T.
(1999)
Diabetes
48,
158-169[Abstract]
|
| 47.
|
Ogihara, T.,
Asano, T.,
Ando, K.,
Chiba, Y.,
Sekine, N.,
Sakoda, H.,
Anai, M.,
Onishi, Y.,
Fujishiro, M.,
Ono, H.,
Shojima, N.,
Inukai, K.,
Fukushima, Y.,
Kikuchi, M.,
and Fujita, T.
(2001)
Diabetes
50,
573-583[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Muraoka, A. Fukushima, S. Viengchareun, M. Lombes, F. Kishi, A. Miyauchi, M. Kanematsu, J. Doi, J. Kajimura, R. Nakai, et al.
Involvement of SIK2/TORC2 signaling cascade in the regulation of insulin-induced PGC-1{alpha} and UCP-1 gene expression in brown adipocytes
Am J Physiol Endocrinol Metab,
June 1, 2009;
296(6):
E1430 - E1439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Boura-Halfon and Y. Zick
Phosphorylation of IRS proteins, insulin action, and insulin resistance
Am J Physiol Endocrinol Metab,
April 1, 2009;
296(4):
E581 - E591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Weigert, M. Kron, H. Kalbacher, A. K. Pohl, H. Runge, H.-U. Haring, E. Schleicher, and R. Lehmann
Interplay and Effects of Temporal Changes in the Phosphorylation State of Serine-302, -307, and -318 of Insulin Receptor Substrate-1 on Insulin Action in Skeletal Muscle Cells
Mol. Endocrinol.,
December 1, 2008;
22(12):
2729 - 2740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sjostrom, K. Stenstrom, K. Eneling, J. Zwiller, A. I. Katz, H. Takemori, and A. M. Bertorello
SIK1 is part of a cell sodium-sensing network that regulates active sodium transport through a calcium-dependent process
PNAS,
October 23, 2007;
104(43):
16922 - 16927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Tzatsos and P. N. Tsichlis
Energy Depletion Inhibits Phosphatidylinositol 3-Kinase/Akt Signaling and Induces Apoptosis via AMP-activated Protein Kinase-dependent Phosphorylation of IRS-1 at Ser-794
J. Biol. Chem.,
June 22, 2007;
282(25):
18069 - 18082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Morino, K. F. Petersen, and G. I. Shulman
Molecular Mechanisms of Insulin Resistance in Humans and Their Potential Links With Mitochondrial Dysfunction
Diabetes,
December 1, 2006;
55(Supplement_2):
S9 - S15.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Al-Hakim, O. Goransson, M. Deak, R. Toth, D. G. Campbell, N. A. Morrice, A. R. Prescott, and D. R. Alessi
14-3-3 cooperates with LKB1 to regulate the activity and localization of QSK and SIK
J. Cell Sci.,
December 1, 2005;
118(23):
5661 - 5673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Weigert, A. M. Hennige, T. Brischmann, A. Beck, K. Moeschel, M. Schauble, K. Brodbeck, H.-U. Haring, E. D. Schleicher, and R. Lehmann
The Phosphorylation of Ser318 of Insulin Receptor Substrate 1 Is Not per se Inhibitory in Skeletal Muscle Cells but Is Necessary to Trigger the Attenuation of the Insulin-stimulated Signal
J. Biol. Chem.,
November 11, 2005;
280(45):
37393 - 37399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. D. Werner, J. Lee, L. Hansen, M. Yuan, and S. E. Shoelson
Insulin Resistance Due to Phosphorylation of Insulin Receptor Substrate-1 at Serine 302
J. Biol. Chem.,
August 20, 2004;
279(34):
35298 - 35305.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Scavo, M. Karas, M. Murray, and D. Leroith
Insulin-Like Growth Factor-I Stimulates Both Cell Growth and Lipogenesis during Differentiation of Human Mesenchymal Stem Cells into Adipocytes
J. Clin. Endocrinol. Metab.,
July 1, 2004;
89(7):
3543 - 3553.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|