|
Originally published In Press as doi:10.1074/jbc.M300968200 on March 7, 2003
J. Biol. Chem., Vol. 278, Issue 20, 18506-18513, May 16, 2003
Inhibition of Epithelial Ductal Branching in the
Prostate by Sonic Hedgehog Is Indirectly Mediated by Stromal Cells*
Bu-er
Wang §,
Jianyong
Shou §¶,
Sarajane
Ross ,
Hartmut
Koeppen ,
Frederic J.
de Sauvage**, and
Wei-Qiang
Gao 
From the Departments of Molecular Oncology,
Pathology, and ** Molecular Biology, Genentech,
Inc., South San Francisco, California 94080
Received for publication, January 29, 2003, and in revised form, March 5, 2003
 |
ABSTRACT |
Sonic hedgehog (Shh), a vertebrate
homologue of the Drosophila segment-polarity gene hedgehog,
has been reported to play an important role during normal development
of various tissues. Abnormal activities of Shh signaling pathway have
been implicated in tumorigenesis such as basal cell carcinomas and
medulloblastomas. Here we show that Shh signaling negatively regulates
prostatic epithelial ductal morphogenesis. In organotypic cultures of
developing rat prostates, Shh inhibited cell proliferation and promoted
differentiation of luminal epithelial cells. The expression pattern of
Shh and its receptors suggests a paracrine mechanism of action. The Shh receptors Ptc1
(Patched1)
and Ptc2 were found to be expressed in prostatic stromal cells adjacent
to the epithelium, where Shh itself was produced. This paracrine
model was confirmed by co-culturing the developing prostate in the
presence of stromal cells transfected with a vector expressing a
constitutively active form of Smoothened, the real effector
of the Shh signaling pathway. Furthermore, expression of activin A and
TGF- 1 that were shown previously to inhibit prostatic epithelial
branching was up-regulated following Shh treatment in the organotypic
cultures. Taken together, these results suggest that Shh
negatively regulates prostatic ductal branching indirectly by acting on
the surrounding stromal cells, at least partly via up-regulating
expression of activin A and TGF- 1.
 |
INTRODUCTION |
The prostate is derived from the embryonic urogenital
sinus under the influence of testosterone levels and interactions
between the mesenchyme and epithelial cells during embryogenesis (1, 2). The initial prostatic primodium is formed around birth in the
rodent. The prostatic epithelial buds continue to undergo extensive
ductal outgrowth and branching into the surrounding mesenchyme during
the first 3 weeks after birth (3, 4). In the mature prostate, there are
essentially two major types of epithelial cells within the prostatic
epithelium: the luminal and basal cells. They can be distinguished
based on their location, morphology, function, and expression profile
of specific cytokeratins (5). The luminal cells located in the apical
region of the epithelium are generally believed to be terminally
differentiated cells that are androgen-dependent and
produce secretory proteins (5). The basal cells residing between the
luminal cells and the underlying basement membrane express cytokeratin
14 or p63 (6) and are thought to serve as progenitor cells (7).
Currently, the molecular mechanisms that control prostatic ductal
morphogenesis and luminal epithelial cell differentiation are still
poorly understood.
Among several molecules that might be involved in regulation of
prostatic ductal branching (reviewed in Ref. 8), sonic hedgehog
(Shh)1 is a good candidate.
Originally identified as a homologue of the segment-polarity gene
hedgehog of the Drosophila (9), Shh has been reported to be
expressed at numerous sites of epithelial and mesenchymal cell lineages
during development (10, 11). It serves as a morphogen to exert its
biological functions (12), including dorsoventral patterning of body
axis, specification of neuronal and oligodendrocytes cell fates, cell
proliferation, cell differentiation, axonal outgrowth, and cell
survival (13, 14). Both Drosophila and mouse genetics show
that the seven transmembrane protein, Smo
(Smoothened) is required for Shh
signaling (15-17). Ptc
(Patched)
appears to negatively regulate Smo in the absence of Shh (18-20). Even though it is widely accepted that Shh binds to Ptc (21, 22) with high
affinity, it is unclear how Shh binding results in the activation of
its downstream target Smo, as well as the subsequent signaling pathway.
The original model suggested that Ptc binds directly to Smo and
represses its activity in the absence of Shh. Upon Shh binding the
normal inhibition by Ptc is released, and Smo initiates signaling.
However, recent studies in Drosophila have suggested that
Ptc may not repress Smo activity through a direct interaction but
rather that Ptc inhibits Smo activity from a distance (23-27),
possibly through the regulation of vesicular trafficking. The main
target of Shh activity is a family of zinc finger transcription factors
known as Gli or Ci in the fly. In vertebrates there are three Ci
orthologues: Gli1, Gli2, and Gli3 (9). Disruption or mutation of the
Shh pathway results in developmental disorders (28-30) and are highly
associated with several human diseases including basal cell carcinoma
(31-33) and medulloblastomas (34). Plant alkaloid cyclopamine, an
antagonist on Shh signaling by blocking the activity of Smo (35, 36),
has shown promises in pre-clinical models of medulloblastomas (34) and
could be proven useful in the treatment of Shh-associated tumors.
Although a recent study suggested that Shh signaling might be involved
in the initial morphogenesis of the prostate during embryogenesis (37),
prostatic development and maturation mainly occurs during the postnatal
period (3-5). Regulation of epithelial ductal branching and
differentiation of luminal epithelial cells by Shh after the prostatic
primodium is formed around birth is not clearly addressed. In the
present experiments, we focused on a possible role of Shh during
postnatal prostatic ductal morphogenesis and luminal epithelial cell
differentiation. We determined the cellular expression pattern of Shh
and its receptors, Ptc1 and Ptc2, and studied functions of Shh during
postnatal prostatic development by comparing Shh with testosterone and
cyclopamine in postnatal prostate organ cultures. We found that Shh
inhibited epithelial ductal branching of the prostate. Shh appeared to
act indirectly through stromal cells, because Ptc1 and Ptc2 were
selectively expressed in the stromal cells. More importantly,
co-culturing developing prostate with stromal cells overexpressing a
constitutively active form of Smo (SmoM2) (33) mimicked the effects of
Shh on prostatic branching morphogenesis. This effect led to an
up-regulation of activin A and TGF- 1, which are shown previously
(38-40) to be expressed in the stromal cells and inhibit prostatic
epithelial branching. Therefore, we propose that Shh regulates
prostatic branching morphogenesis indirectly via the stroma by at least in part up-regulating expression of activin A and TGF- 1.
 |
MATERIALS AND METHODS |
Organotypic Cultures, Cell Transfection, and RNA
Preparation--
The ventral prostate whole mounts were dissected from
postnatal day 2 (P2) rats and plated on cell culture inserts (8-µm
pore size; BD Biosciences) individually in serum-free medium.
Serum-free medium was made of Dulbecco's modified Eagle's medium/F-12
plus serum-free supplement (I-1884; Sigma), 1% bovine serum
albumin, 2 mM glutamine, 5 mg/ml glucose, 25 ng/ml
fungizone, and 100 units/ml penicillin and 100 mg/ml streptomycin,
modified as described previously (41). Shh (400 nM;
Genentech), cyclopamine (5 µM; kind gift of Dr. W. Gaffield at Western Regional Research Center, United States Department
of Agriculture, Albany, CA), and testosterone (10-8 M;
Sigma) was added to the medium at the beginning of the cultures. The
medium was changed every other day. For some cultures, BrdUrd
was introduced into the medium for 17 h before the cultures were
fixed on the fourth day. In some experiments, individual P2 rat
prostate was cut into 16 pieces, mixed with stromal cells transfected
either with a control vector or a vector expressing a constitutively
active form of Smo (SmoM2) or Gli1 when they were plated together in
the cell culture inserts. Stromal cells were isolated from E17 rat
urogenital sinus by tearing away urogenital epithelium following
incubation in 0.2 M EDTA in Hanks'-buffered saline as
described previously (42). Cell transfection was done 1 day before the
co-culture. The cultures were fixed at various time points in 4%
paraformaldehyde in phosphate buffer (0.1 M, pH 7.4) for 30 min at room temperature before they were processed for
immunocytochemistry (43). Cell transfection was performed using
GenePorter, essentially in a similar manner as described previously
(44, 45). Total RNA was isolated from four cultures of each of the
experimental groups 2 days after treatment with Shh using RNeasy
columns (Qiagen), treated with DNase I (Roche Molecular
Biochemicals) for 15 min at room temperature, and cleaned using RNeasy
columns as described (44).
Immunocytochemistry, Image Acquisition, Cell Counts, and Data
Analysis--
For BrdUrd and cytokeratin 14 double
immunocytochemistry, fixed cultures were treated with 2 N
HCl for 30 min at room temperature. After washes, the preparations were
then incubated with a mixture of anti-BrdUrd antibody (1:40; BD
Biosciences) and anti-cytokeratin 14 (1:10,000; Berkeley Antibody
Company) in phosphate-buffered saline containing 3% normal donkey
serum and 0.2% Triton overnight at 4 °C. Positive staining was
visualized by incubation with FITC-conjugated donkey anti-mouse and
Texas red-conjugated donkey anti-rabbit secondary antibodies as
described previously (44). Some of the cultures were labeled with
anti-Shh monoclonal antibody (5E1, 1:1000; Developmental Studies
Hybridoma Bank) or double stained with anti-p63 antibody (1:200
dilution; Santa Cruz Biotechnology) mediated via FITC-conjugated
secondary antibody and 7AAD (Molecular Probes). Cultures were mounted
in Fluoromount-G (Southern Biotechnology) containing counter staining
dye 4',6-diamidino-2-phenylindole (Sigma) and viewed using a
Zeiss Axiophot epifluorescent microscope. Images were captured with
Compix imaging systems using a cooled RGB CCD camera and
analyzed using Adobe PhotoShop 4.0. Sections labeled with anti-p63
antibody (Santa Cruz Biotechnology) and 7AAD (Molecular Probes) were
viewed using a Bio-Rad MRC-600 confocal microscope.
Cell counts were performed on the digital images captured from the
sections of the cultures. For BrdUrd labeling index, BrdUrd-labeled cells versus the total number of epithelial cells in given
epithelial ducts (cytokeratin 14 highlighted region) or a given area of
stromal area were counted against DAPI counter-stained nuclei.
Approximately 1,500 cells were counted from randomly selected 15-20
sections from each of the experimental groups. Data were then
normalized to the control cultures and are expressed as mean ± S.D. For luminal cell differentiation analysis, p63 negative cells and
total epithelial cells (7AAD-positive) in randomly selected epithelial
ducts were counted from five to six sections from each of the
experimental groups, normalized to the control group, and expressed as
mean ± S.D. Two-way, unpaired t test was used for
statistical analysis.
Gene Expression Analysis by in Situ Hybridization and
PCR--
[33P]UTP-labeled sense and antisense riboprobes
were generated from PCR products cloned into transcription vectors
(46). The murine Ptc1 and Ptc2 cDNA, cloned in pBluescript,
(Stratagene, La Jolla, CA) spanned from nucleotides 3518 to 4289 of
MMU46155 (for Ptc1) and from nucleotides 883 to 1309 of AJ133485 (for Ptc2), respectively. Formalin-fixed, paraffin-embedded, dissected mouse
prostatic tissue (postnatal days 7 and 16 and adult) was sectioned and
deparaffinized. The in situ hybridization was performed as
described previously (44). Tissue pre-treatments consisted of a
proteinase K digestion (4 µg/ml) for 30 min at 37 °C, a 0.5× SSC
wash for 10 min at room temperature, and dehydration prior to
application of the pre-hybridization solution. Slides were processed
for autoradiography and exposed for 4 weeks before developing. Sense
control probes revealed no hybridization above background (not shown).
TaqMan real-time quantitative PCR (RT-PCR) analysis was
performed as described (43, 44). The following specific probes and
primers were used for Ptc1 (probe, TGCCTCCTGGTCACACGAACAATGG; forward primer, CTCCAAGTGTCGTCCGGTTT; reverse primer,
TGTACTCCGAGTCGGAATC), Ptc2 (probe, CCCAACGCGCCCTCTTTGATCTG; forward
primer, TGGCTTTGACTACGCCCAC; reverse primer, GGGAGCTGAAGCGCTGG),
activin A (probe TGTGAACAGTGCCAGGAGAGCGGT; forward primer,
CCTGGATGTGCGGATTGC; reverse primer, TGCCCAGGAGCACTAGGC), TGF- 1
(probe, CATCTCGATTTTTATCCCGGTGGCATACTG; forward primer, TGGGTCCCAGAGAGCGC; reverse primer, GGAGTCGCGGTGACGC), BMP4 (probe, AGAGCGCCGTCATCCCGGATTACAT; forward primer, CGTCCGCAGCCGAGC; reverse primer, TGGAGCCGGTAAAGATCCC), and BMP7 (probe,
TGAGGATGGCCAGTGTGGCAGAAAA; forward primer, GCCAAAGAACCAAGAGGCC;
reverse primer, TGCCTCTGGTCACTGCTGC). Probes and primers for
the control housekeeping gene Gapdh were the same as
reported (44). Expression levels of genes of interest were normalized
to gapdh (43). Initial RT-PCR amplifications were also
examined by agarose gel electrophoresis to ensure that bands were only
visible at the expected molecular weights. Data were collected from
four cultures from each of experimental groups and are expressed as
mean ± S.D.
 |
RESULTS |
Shh Inhibits Prostatic Epithelial Ductal Branching and
Growth--
When whole mount ventral prostate organs were isolated
from postnatal day 2 rats and maintained in serum-free medium (see "Materials and Methods"), epithelial ductal branching and expansion continued (Fig. 1A), although
at a slower pace than in the cultures where testosterone was included
(Fig. 1D). These observations are in agreement with previous
work by Cunha and co-workers (47). However, a significant inhibition of
branching morphogenesis was observed in cultures treated with 400 nM Shh (Fig. 1B). Lower concentrations of Shh
(200 nM) also led to clear, though less profound, growth
inhibition (data not shown). In contrast, cultures grown in the
presence of an Shh pathway antagonist, cyclopamine at 2.5 or 5 µM, showed enhanced epithelial growth (Fig.
1C). This inhibition was further confirmed by
immunocytochemistry of cultures with an anti-cytokeratin 14 antibody
that highlights the epithelial area in the ductal units (5). As shown
in Fig. 1F, the number of epithelial ductal tips was much
lower in cultures where Shh was present than in control cultures (Fig.
1E). On the other hand, the tips of the epithelial ducts in
the cultures containing cyclopamine were enlarged (Fig. 1G).
Similar growth-inhibiting effects were also observed when the tissues
were cultured in the presence of both testosterone and Shh (data not
shown), suggesting that Shh can override the stimulating effects of
testosterone on epithelial cell growth. In addition, when both Shh and
cyclopamine were added together to the culture, the growth pattern was
the same as in cultures treated with cyclopamine alone (not shown),
indicating that the concentration of cyclopamine used (5 µM) is sufficient to block both exogenous and endogenous
Shh activity.

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 1.
Shh inhibits epithelial branching
morphogenesis and growth in organotypic cultures of P2 rat ventral
prostates. Whole mount ventral prostate organs were maintained for
7 days in serum-free medium (A and E), in the
presence of 400 nM Shh (B and F), 5 µM cyclopamine (C and G), or 10-8
M testosterone (D and H). The
cultures were immunostained with anti-cytokeratin 14 antibody
(E-H). Note the much reduced number of
epithelial ductal units in Shh-treated cultures (B and
F) and enlarged ductal tips in cyclopamine-treated cultures
(C and G), as compared with control cultures
(A and E). Ctrl, control culture;
Shh, Shh-treated culture; Cyc,
cyclopamine-treated culture; Tes, testosteronetreated
culture. Scale bar, 400 µm for A-D,
100 µm for E-H.
|
|
The concentrations of Shh used in the present experiments (200 and 400 nM) are similar to previous studies on induction of midbrain dopaminergic neurons (48). To further rule out the possibility
that the growth-inhibiting effects of Shh we observed might be because
of any potential general toxicity of Shh, we did cell death analysis by
performing TUNEL staining on the sections of the cultures from
all four experimental groups. Only negligible number of TUNEL-positive
cells were observed in any of the cultures grown in the presence or
absence of Shh at 400 nM, cyclopamine at 5 µM, or testosterone at 10-8 M. However, a
dramatic elevation in the number of TUNEL-positive cells was seen
(92.0 ± 60.9, n = 4) in sections of the cultures
grown in the presence of 10 µM cyclopamine, suggesting
that at higher concentrations, cyclopamine might be toxic.
Shh Inhibits Cell Proliferation in the Prostate--
To examine
whether Shh influences prostatic morphogenesis by affecting cell
proliferation, we performed BrdUrd immunocytochemistry with all four
groups of cultures. We found that BrdUrd labeling index was greatly
reduced in both epithelial and stromal areas of the Shh-treated
cultures (Fig. 2, C and
D versus A and B). In
contrast, BrdUrd labeling index was elevated in the cultures treated
with cyclopamine (Fig. 2, E and F). Testosterone,
a potent mitogen used as a positive control, showed the highest BrdUrd labeling index (Fig. 2, G and H). Cell counts of
the number of BrdUrd-labeled cells versus total number of
epithelial cells in a given ductal unit or total stromal cells in a
given stromal area provided quantitative support to our observations.
The BrdUrd labeling index in the epithelium is as follows: control,
80.3 ± 21.4; Shh-treated, 48.6 ± 18.6;
cyclopamine-treated, 93.1 ± 11.8; testosterone-treated,
111.44 ± 16.8 (p < 0.01, between Shh-treated and
control or between testosterone-treated and control; p < 0.05 between cyclopamime-treated and control). Data were normalized to the control group and are plotted in Fig.
3.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 2.
Shh inhibits cell proliferation in both
epithelial and stromal areas of the cultured developing prostates.
Shown are BrdUrd (green; A, C,
E, and G) and cytokeratin 14 (red)
double immunocytochemistry (B, D, F,
and H) of the P2 rat ventral prostate organ cultures in
serum-free medium (A and B), in the presence of
400 nM Shh (C and D), 5 µM cyclopamine (E and F), or 10-8
M testosterone (G and H). Scale
bar, 60 µm.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Quantitation of BrdUrd labeling index in the
cultured developing prostates. Data were normalized to the control
group before being plotted. Note that the number of BrdUrd-positive
cells are reduced in Shh-treated cultures but increased in
cyclopamine-treated cultures in both the epithelium (A) and
the stroma (B). Testosterone showed an increased number of
BrdUrd-positive cells in both the epithelium (A) and the
stroma (B).
|
|
Shh Promotes Terminal Differentiation of Luminal Epithelial
Cells--
By postnatal day 5 of normal development, some of the basal
cells that are normally cytokeratin 14/p63-positive start to become postmitotic and differentiate into cytokeratin 14/p63-negative luminal
cells (5). To determine whether luminal cell differentiation is also
affected by Shh, cultures were maintained for 7 days in serum-free
medium and were double-labeled with anti-p63 antibody that highlights
basal epithelial cells and 7AAD that stains nuclei of all cells. We
found that the proportion of luminal cells among the total epithelial
cell population within an individual ductal unit was significantly
higher in the Shh-treated cultures (Fig. 4B) as compared with control
cultures (Fig. 4A). Consistent with this observation, the
proportion of luminal cells in ductal units was significantly lower in
the cultures treated with cyclopamine (Fig. 4C).
Testosterone showed the highest percentage as it is expected to promote
luminal cell differentiation in addition to cell proliferation (47).
The ratio of luminal to total epithelial cells from all four types of
cultures are shown in Fig. 4E (p < 0.05, between Shh-treated and control; p < 0.01 between
control and cyclopamine or testosterone-treated). These observations
suggest that Shh appears to regulate prostatic morphogenesis not only by inhibiting proliferation of progenitor cells but also by promoting terminal differentiation of luminal cells. Cell counts of luminal cells
per ductal unit revealed an absolute increase in luminal cells
(control, 9.2 ± 1.1; Shh-treated, 15.2 ± 1.9; mean ± S.E., n = 35, p < 0.01) and provided
further support for this model. Therefore, Shh pushes the progenitor
cells out of cell cycle earlier than scheduled and induces a precocious
differentiation into luminal epithelial cells.

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 4.
Shh promotes differentiation of prostatic
luminal epithelial cells. Shown are Anti-p63 antibody
(green) and 7AAD (red) double labeling of the P2
rat ventral prostate organ cultures maintained for 7 days in serum-free
medium (A), in the presence of 400 nM Shh
(B), 5 µM cyclopamine (C), or 10-8
M testosterone (D). E, ratio of the
luminal cells versus the total epithelial cells. Note that
the percentage of luminal cells increases significantly in Shh-treated
cultures but decreases in cyclopamine-treated cultures. Testosterone
treatment leads to an increased percentage of luminal cells as
expected. Non-nuclear p63 immunostaining in the stromal area
(B) represents nonspecific, background labeling, which was
also observed at this developing stage in all other three types of
cultures (not shown). Scale bar, 30 µm for
A-D.
|
|
Cellular Expression Patterns of Shh Receptor and Shh--
Previous
studies (22, 50) have demonstrated that Shh exerts its biological
function through its receptors Ptc1 and Ptc2. Ptc genes also constitute
good reporters for Shh pathway activation as they are both up-regulated
upon Shh signaling. Therefore, determination of the expression patterns
of Ptc1 and Ptc2 in the prostatic tissue would help us to understand
the mechanism of action by Shh and in particular the cell type targeted
by Shh activity. We carried out in situ hybridization on
tissue sections prepared from mouse prostates at different
developmental stages. Although the sense probes did not show any
specific labeling (data not shown), signals for Ptc1 and Ptc2 were
specifically detected in stromal cells that are adjacent to the
epithelium at P7 (Fig. 5,
A-D). Expression of Ptc1 and Ptc2 became much
lower in P16 prostates, and no detectable signal was seen in adult
prostate (data not shown), suggesting a down-regulation of the two
receptors as the prostate matures.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 5.
Cellular expression of Ptc1, Ptc2, and Shh in
the prostate. In situ hybridization of murine Ptc1
(A and B) and Ptc2 (C and
D) in P7 mouse prostates. Shown are hematoxylin-eosin
brightfield (A and C) and corresponding darkfield
(B and D) for each image. Strong expression of
Ptc1 is detected in the stroma (arrows) adjacent to
epithelial buds of the developing prostate. The epithelium is negative
(arrowheads). The expression pattern of Ptc2 is similar to
that of Ptc1, although the expression intensity of Ptc2 appears weaker.
Ptc2 is also detected in the stroma (arrows) whereas the
associated epithelium (arrowhead) is negative. E,
Shh immunocytochemistry of a section from a P2 rat ventral prostate
maintained in culture for 4 days indicates that Shh immunoreactivity is
seen in the epithelium (epi) but not in the stroma
(str). Scale bar, 100 µm.
|
|
To find out where Shh is produced, we performed immunocytochemistry of
the P2 prostate cultures using an anti-Shh antibody. As shown in Fig.
5E, immunoreactivity was seen confined to the epithelium of
the prostate. These results indicate that Shh is produced by epithelial
cells whereas its receptors are expressed by the stromal cells.
Co-culturing Stromal Cells Transfected with a Constitutively Active
Form of Smo Leads to a Growth Inhibition in the Developing Prostatic
Epithelium--
The expression patterns of Ptc1 and Ptc2 in stromal
cells and the presence of Shh in the epithelium of the prostate suggest a paracrine mechanism by which Shh might act on stromal cells that then
influence epithelial ductal branching and growth. To provide further
experimental evidence for this model, we cultured developing prostates
that were minced into pieces together with stromal cells that expressed
a constitutively active form of Smo (SmoM2) (33) or a control vector.
In the control cultures, prostatic glandular ductal structures were
well formed resembling intact prostate tissue (Fig.
6A). However, cultures
maintained in the presence of SmoM2-transfected stromal cells showed an
inhibition of epithelial branching similar to what we observed in
Shh-treated cultures (see Fig. 6B and Fig. 1B).
Activation of the Shh signaling pathway by transfecting the stromal
cells with a downstream effector gene, Gli1, which up-regulated
expression of Ptc1 (data not shown), led to similar results (Fig.
6C). To visualize more clearly the epithelial buds of these
cultures, we immunostained them with an anti-cytokeratin 14 antibody.
As shown in Fig. 6, D-F, the number of
epithelial buds was greatly reduced in the cultures in which stromal
cells were transfected with SmoM2 or Gli1. These findings support the
notion that Shh inhibits prostatic epithelial branching by acting on
the stromal cells. Consistent with this notion, we observed that Shh
inhibited proliferation of purified human or rodent stromal cells but
not that of human LNCaP and PC3 prostatic cancer cell
lines.2

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 6.
Activation of Shh signaling in stromal cells
mimics the effects of Shh. Shown are co-cultures of individual P2
rat ventral prostate that are minced into 16 pieces before they are
mixed with stromal cells transfected with a control vector
(A and D), SmoM2 (B and E),
or Gli1 (C and F). A-C and
D-F are phase-contrast and
cytokeratin 14 immunofluorescence images, respectively. Note that
although prostatic glandular structure is well formed in the control
culture, activation of Shh signaling either using SmoM2 or Gli1 leads
to an inhibition of the epithelial ductal branching and budding.
Epi, epithelial buds; Str, stromal cells.
Scale bar, 500 µm for A-C, 450 µm
for D-F.
|
|
Ptc1 and Ptc2 Expression Was Up-regulated in Developing Mouse
Prostates Treated with Shh--
Ptc1 and Ptc2 are known downstream
targets of the Shh pathways whose expression is up-regulated upon Shh
signaling. To confirm that the biological effects we observed in these
cultures were elicited by Shh action on stromal cells, we examined the
expression levels of Ptc1 and Ptc2 in the cultures following Shh
treatment by quantitative RT-PCR. As shown in Fig.
7, the expression levels of Ptc1 and Ptc2
were elevated significantly after Shh treatment (p < 0.01, n = 4 for each group).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
Shh elicits an up-regulation of Ptc1 and Ptc2
expression. TaqMan RT-PCR analysis indicates that addition of Shh
into the culture results in an up-regulation of the receptors of Shh,
Ptc1, and Ptc2. This experiment confirms that the biological effects of
Shh we observed in the cultures are indeed attributable to the
activation of Shh signaling. RNAs were extracted from the cultures 2 days following treatment with Shh, cyclopamine, or testosterone.
|
|
Sonic Hedgehog Up-regulates Expression of Activin A and
TGF- 1--
As an attempt to understand how Shh exerts its
inhibitory effects on epithelial branching morphogenesis via stromal
cells, we focused our attention on TGF- superfamily members
including activin A, TGF- 1, BMP4, and BMP7 as these molecules
are potential candidates that mediate the effects of Shh in other
tissue types (for reviews see Refs. 9 and 51). Furthermore they are
reported to be expressed by prostatic stromal cells and are capable of inhibiting prostatic epithelial cell growth (38-40, 52, 53). We
performed TaqMan RT-PCR analysis to determine whether Shh treatment alters expression of these TGF- superfamily molecules in the cultures. As shown in Fig. 8, cultures
treated with Shh significantly up-regulated expression of activin A and
TGF- 1 as compared with the control cultures (p < 0.01, n = 4 for each group; see Fig. 8). In contrast,
expression of BMP4 and BMP7 remained essentially unchanged following
Shh treatment (p > 0.05).

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 8.
Shh increases expression of activin A and
TGF- 1 in prostatic organ cultures. TaqMan
RT-PCR analysis indicates that addition of Shh into the culture results
in an up-regulation of activin A and TGF- 1 but not BMP4 and BMP7.
RNAs were extracted from the cultures 3 days following treatment of the
cultures with Shh. The probe and primers for activin A were designed
based on the sequence of the gene encoding inhibin A chain as
activin A is a homodimer with two A chains. Other activin molecules
and inhibin contain one of the other B, C, E, or subunits.
After normalization to Gapdh, the data were further normalized
to the cultures without Shh (Untreated). The values
represent -fold increases for each of the genes examined in Shh-treated
cultures.
|
|
 |
DISCUSSION |
In the present study, we demonstrated that Shh regulates prostatic
morphogenesis by inhibiting epithelial ductal branching. Such
inhibition was achieved by negative regulation of cell proliferation of
both epithelial cells and underlying stromal cells and by promotion of
terminal differentiation of the luminal epithelial cells. We also
showed that the stromal cells, but not the epithelial cells, express
the receptors for Shh, Ptc1, and Ptc2. More importantly, co-culturing
the developing prostate with stromal cells transfected with SmoM2
mimicked the growth-inhibitory effects of Shh. These two lines of
evidence strongly suggest that Shh acts on stromal cells to indirectly
regulate the proliferation and differentiation of prostatic epithelial cells.
Activation of Shh signaling can have a variety of biological effects
that depend upon the tissue types. In the skin (31-33), cerebellum
(34, 54, 55), and kidney (56), Shh appears to stimulate cell
proliferation and to inhibit cell differentiation. However, in some
other tissues, Shh inhibits cell proliferation and induces terminal
differentiation of specific cell types. Our findings in the prostate
seem to be consistent with studies on gastric gland cells, pancreatic
cells, midbrain dopaminergic neurons, and spinal cord
motoneurons. For example, activation of Shh signaling inhibits
gastric gland cell proliferation and morphogenesis (57). Shh has also
been shown to indirectly inhibit expansion of pancreas mass by
suppressing within the endoderm the expression of PDX-1, a
transcription factor that is necessary for the formation of the
pancreas (58-60). In the developing nervous system, Shh acts as a
morphogen and induces the differentiation of dopaminergic neurons (48),
serotonergic (61), and motor neurons (62). However, our observations
are different from what was reported recently by Bushman and co-workers
(37) in the prostate. Their results suggest that Shh enhances
epithelial cell proliferation and facilitates the initial ductal
budding based on experiments using Shh neutralizing antibody. There
could be several explanations for the discrepancy. One difference is
that we studied prostate development at a postnatal stage when major
prostatic ductal branching and cell differentiation occur whereas
Bushman and co-workers (37) focused on the initial prostatic budding
process from the embryonic urogenital sinus before birth. They combined
the beads pre-absorbed with Shh neutralizing antibody with E15
urogenital sinus tissue, which is the primodium that will give rise to
the prostate before they grafted the tissue-bead mixture under the renal capsule, and they observed an impairment of prostatic ductal morphogenesis 7-10 days post-grafting (37). It is possible that the tissue responsiveness to Shh may change as development proceeds. Such stage-specific responsiveness of Shh has been described during normal development of avian skin (63). Alternatively, localized expression of Shh in the distal aspect of the epithelial bud (64) may
yield different outcomes as compared with ubiquitous administration of
Shh. Ubiquitous overexpression of Shh in the lung epithelium leads to
an increase in mesenchyme versus epithelium (65, 66). Such
increased mesenchymal cell mass results in defects in the branching
morphogenesis (66, 67) as epithelial outgrowth is inhibited everywhere
along the bud. On the other hand, loss of Shh signaling can also cause
defects in epithelial branching (66) in the form of enlarged epithelial
buds as epithelial outgrowth is initiated ubiquitously. Despite the
difference in the effects of Shh at various developmental stages,
activation of Shh signaling occurs in mesenchymal/stromal cells in both
cases. While we demonstrated by in situ hybridization that
Shh receptors are expressed in the stromal cells, Lamm et
al. (64) looked at another downstream target of the pathway, Gli1,
and found it up-regulated by RT-PCR in mesenchymal cells. In addition,
our tissue recombination experiments using SmoM2- or Gli1-transfected
stromal cells demonstrated that activation of the Shh signaling pathway
in stromal cells show similar growth-inhibiting effects on epithelial
cells as soluble Shh. Similar paracrine action mechanism of epithelial
cell-derived Shh has been observed in the developing mouse kidney and
Xenopus small intestine (68). During development of the
metanephric kidney, Shh is expressed in the ureteric epithelium, and
its receptor Ptc1 is expressed in the surrounding mesenchymal cells
(56). During organogenesis of the Xenopus midgut, the
effectors of hedgehog signaling are localized to the gut mesoderm
whereas hedgehog is produced in the endoderm (68). Activation of
hedgehog signaling leads to an inhibition on the transition of midgut
endoderm into intestinal epithelium (68).
Stromal influence on prostatic epithelial cell proliferation and
differentiation during embryogenesis and tumorigenesis has been
demonstrated previously (69). Tissue recombination studies show that
urogenital sinus mesenchymal cells can induce epithelial cells from
non-prostatic tissues to become prostatic epithelial cells (42, 70),
and such induction is determined by the amount of mesenchymal tissue
present (71, 72). Stroma-epithelial cell co-culture experiments also
indicate that although carcinoma-associated stromal cells enhances
prostatic carcinogenesis (72, 73), normal stromal cells are capable of
inhibiting prostatic carcinogenesis by inducing differentiation and
inhibiting the proliferation of the epithelium (52, 74, 75). Consistent
with this notion, a reduction in the number of normal stromal smooth
muscle cells is closely associated with progression of prostatic
carcinogenesis (76). Although the molecular mechanisms through which
stroma modulates the epithelial cell phenotype are still unknown, a few well characterized signaling pathways, such as steroid hormones and
specific growth factors, may contribute to the paracrine regulation of
epithelial cell growth and differentiation by stromal cells. For
example, experiments using androgen-insensitive urothelium, prepared
from the testicular feminized (Tfm/y) mice, elegantly demonstrate that
androgens exerts their effects by acting through androgen receptors in
the urogenital sinus mesenchymal cells to stimulate epithelial
proliferation, prostatic ductal branching morphogenesis, and columnar
cytodifferentiation (5, 77). There is also evidence of a link between
elevated serum levels of insulin-like growth factor-I (IGF-I) and an
increased risk of prostate cancer (78). In normal prostate IGFs are
produced only by stromal cells whereas normal epithelial cells express the IGF receptors and synthesize specific IGF-binding proteins that
modulate effects of IGFs (79).
Although the exact mechanism by which Shh signaling inhibits prostatic
epithelial cell growth is not yet fully understood, our quantitative
PCR analysis suggests that Shh action on the stromal cells enhances the
expression of the inhibitory growth factors activin A and TGF- 1,
which may, in turn, act on epithelial cells. Consistent with this
notion, conditioned media collected from primary stromal cell cultures
inhibit prostatic epithelial cell proliferation (52). Activin A (38,
39) and TGF- 1 (40) have been shown to exert inhibitory effects on
epithelial cell growth and branching morphogenesis and are found to be
expressed in the prostatic stromal cells. In this regard, members of
the TGF- superfamily have been demonstrated to mediate the effects of Shh in several developmental systems (for reviews, see Refs. 9 and
51). For example, TGF- 2, a very close TGF- 1 family member, has
been shown to mediate the effects of Shh on hypertrophic differentiation and parathyroid hormone-related peptide expression in
the perichondrium of embryonic mouse metatarsal bones grown in organ
cultures (80). Loss of responsiveness of prostatic epithelial cancer
cells to Shh might be attributable to the facts that expression of
TGF- receptors is dramatically down-regulated in these cancer cells
(49, 81) and that stromal cells are absent in the prostatic cancer cell
cultures. On other hand, it should be noted that BMP4, a vertebrate
homolog of Drosophila Decapentaplegic, which
acts as a downstream target of Shh in other tissue types (for reviews,
see Refs. 9 and 51), is found to be expressed in the prostate and shown
to inhibit prostatic epithelial branching (53), but its expression is
not regulated by Shh based on our RT-PCT analysis (Fig. 8). Considered
together, these data suggest that Shh might influence epithelial
branching morphogenesis by at least in part up-regulating expression of activin A and TGF- 1. As demonstrated in the developing lung (65, 66)
and midgut (68), our findings support the notion that appropriate
regulation of Shh signaling in the stroma plays a critical role in
stromal-epithelial cell interactions that determines proper epithelial
ductal branching and differentiation in the prostate.
 |
ACKNOWLEDGEMENTS |
We thank Susan Palmieri for confocal
microscopy and Allison Bruce for assistance with preparation of the figures.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this work.
¶
Present address: Functional Genomics, DC 0444, Lilly Research
Laboratories, Indianapolis, IN 46285.

To whom correspondence should be addressed: Dept. of
Molecular Oncology, MS #72, Genentech, Inc., 1 DNA Way, South San
Francisco, CA 94080. Tel.: 650-225-8101; Fax: 650-225-6240; E-mail:
gao@gene.com.
Published, JBC Papers in Press, March 7, 2003, DOI 10.1074/jbc.M300968200
2
B. Wang, J. Shou, and W.-Q. Gao,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
Shh, sonic hedgehog;
Ptc, Patched;
Smo, Smoothened;
TGF, transforming growth factor;
FITC, fluorescein isothiocyanate;
RT, real-time;
BMP, bone morphogenic
factor;
IGF, insulin-like growth factor;
TUNEL, terminal
deoxynucleotidyltransferase-mediated dUTP nick end labeling.
 |
REFERENCES |
| 1.
|
Cunha, G. R.,
Donjacour, A. A.,
Cooke, P. S.,
Mee, S.,
Bigsby, R. M.,
Higgins, S. J.,
and Sugimura, Y.
(1987)
Endocr. Rev.
8,
338-362[Abstract/Free Full Text]
|
| 2.
|
Cunha, G. R.,
and Donjacour, A. A.
(1989)
Cancer Treat. Res.
46,
159-175[Medline]
[Order article via Infotrieve]
|
| 3.
|
Sugimura, Y.,
Cunha, G. R.,
and Donjacour, A. A.
(1986)
Biol. Reprod.
34,
961-971[Abstract]
|
| 4.
|
Timms, B.,
Mohs, T.,
and Didio, L.
(1994)
J. Urol.
151,
1427-1432[Medline]
[Order article via Infotrieve]
|
| 5.
|
Hayward, S. W.,
Baskin, L. S.,
Haughney, P. C.,
Cunha, A. R.,
Foster, B. A.,
Dahiya, R.,
Prins, G. S.,
and Cunha, G. R.
(1996)
Acta Anatomica
155,
81-93[Medline]
[Order article via Infotrieve]
|
| 6.
|
Signoretti, S.,
Waltregny, D.,
Dilks, J.,
Isaac, B.,
Lin, D.,
Garraway, L.,
Yang, A.,
Montironi, R.,
McKeon, F.,
and Loda, M.
(2000)
Am. J. Pathol.
157,
1769-1775[Abstract/Free Full Text]
|
| 7.
|
Robinson, E.,
Neal, D.,
and Collins, A.
(1998)
Prostate
37,
149-160[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Abate-Shen, C.,
and Shen, M.
(2000)
Genes Dev.
14,
2410-2443[Free Full Text]
|
| 9.
|
Ingham, P. W.,
and McMahon, A. P.
(2001)
Genes Dev.
15,
3059-3087[Free Full Text]
|
| 10.
|
Marti, E.,
Bumcrot, D. A.,
Takada, R.,
and McMahon, A. P.
(1995)
Nature
375,
322-325[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Roberts, D. J.,
Johnson, R. L.,
Burke, A. C.,
Nelson, C. E.,
Morgan, B. A.,
and Tabin, C.
(1995)
Development (Camb.)
121,
3163-3174[Abstract]
|
| 12.
|
Hammerschmidt, M.,
Brook, A.,
and McMahon, A. P.
(1997)
Trends Genet.
13,
14-21[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Marti, E.,
and Bovolenta, P.
(2002)
Trends Neurosci.
25,
89-96[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Machold, R.,
and Fishell, G.
(2002)
Trends Neurosci.
25,
10-11[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Alcedo, J.,
Ayzenzon, M.,
Von Ohlen, T.,
Noll, M.,
and Hooper, J. E.
(1996)
Cell
86,
221-232[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
van den Heuvel, M.,
and Ingham, P. W.
(1996)
Nature
382,
547-551[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Kalderon, D.
(2000)
Cell
103,
371-374[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Goodrich, L.,
Milenkovic, K.,
Higgins, L.,
and Scoot, M.
(1991)
Science
277,
1109-1113
|
| 19.
|
Ingham, P. W.,
Taylor, A. M.,
and Nakano, Y.
(1991)
Nature
353,
184-187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Chen, Y.,
and Struhl, G.
(1998)
Development
125,
4943-4948[Abstract]
|
| 21.
|
Marigo, V.,
Davey, R. A.,
Zuo, Y.,
Cunningham, J. M.,
and Tabin, C. J.
(1996)
Nature
384,
176-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Stone, D. M.,
Hynes, M.,
Armanini, M.,
Swanson, T. A.,
Gu, Q. M.,
Johnson, R. L.,
Scott, M. P.,
Pennica, D.,
Goddard, A.,
Phillips, H.,
Noll, M.,
Hooper, J. E.,
De Sauvage, F.,
and Rosenthal, A.
(1996)
Nature
384,
129-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Chen, Y.,
and Struhl, G.
(1996)
Cell
87,
553-563[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Johnson, R. L.,
Milenkovic, L.,
and Scott, M. P.
(2000)
Mol. Cell
6,
467-478[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Denef, N.,
Neubuser, D.,
Perez, L.,
and Cohen, S. M.
(2000)
Cell
102,
521-531[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Ingham, P. W.,
Nystedt, S.,
Nakano, Y.,
Brown, W.,
Stark, D.,
van den Heuvel, M.,
and Taylor, A. M.
(2000)
Curr. Biol.
10,
1315-1318[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Alcedo, J.,
Zou, Y.,
and Noll, M.
(2000)
Mol. Cell
6,
457-465[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Ruiz, I.,
and Altaba, A.
(1999)
Development (Camb.)
126,
3205-3216[Abstract]
|
| 29.
|
Villavicencio, E. H.,
Walterhouse, D. O.,
and Iannaccone, P. M.
(2000)
Am. J. Hum. Genet.
67,
1047-1054[Medline]
[Order article via Infotrieve]
|
| 30.
|
Ramalho-Santos, M.,
Melton, D. A.,
and McMahon, A. P.
(2000)
Development (Camb.)
127,
2763-2772[Abstract]
|
| 31.
|
Hahn, H.,
Wicking, C.,
Zaphiropoulos, P. G.,
Gailani, M. R.,
Shanley, S.,
Chidambaram, A.,
Vorechovsky, I.,
Holmberg, E.,
Unden, A. B.,
Gillies, S.,
Negus, K.,
Smyth, I.,
Pressman, C.,
Leffell, D. J.,
Gerrard, B.,
Goldstein, A. M.,
Dean, M.,
Toftgard, R.,
Chenevix-Trench, G.,
Wainwright, B.,
and Bale, A. E.
(1996)
Cell
85,
841-851[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Johnson, R. L.,
Rothman, A. L.,
Xie, J.,
Goodrich, L. V.,
Bare, J. W.,
Bonifas, J. M.,
Quinn, A. G.,
Myers, R. M.,
Cox, D. R.,
Epstein, E. H., Jr.,
and Scott, M. P.
(1996)
Science
272,
1668-1671[Abstract]
|
| 33.
|
Xie, J.,
Murone, M.,
Luoh, S. M.,
Ryan, A.,
Gu, Q.,
Zhang, C.,
Bonifas, J. M.,
Lam, C. W.,
Hynes, M.,
Goddard, A.,
Rosenthal, A.,
Epstein, E. H., Jr.,
and de Sauvage, F. J.
(1998)
Nature
391,
90-92[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Berman, D. M.,
Karhadkar, S. S.,
Hallahan, A. R.,
Pritchard, J. I.,
Eberhart, C. G.,
Watkins, D. N.,
Chen, J. K.,
Cooper, M. K.,
Taipale, J.,
Olson, J. M.,
and Beachy, P. A.
(2002)
Science
297,
1559-1561[Abstract/Free Full Text]
|
| 35.
|
Cooper, M.,
Porter, J.,
Young, K.,
and Beachy, P.
(1998)
Science
280,
1603-1607[Abstract/Free Full Text]
|
| 36.
|
Taipale, J.,
Chen, J. K.,
Cooper, M. K.,
Wang, B.,
Mann, R. K.,
Milenkovic, L.,
Scott, M. P.,
and Beachy, P. A.
(2000)
Nature
406,
1005-1009[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Podlasek, C.,
Barnett, D.,
Clemens, J.,
Bak, P.,
and Bushman, W.
(1999)
Dev. Biol.
209,
28-39[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Cancilla, B.,
Jarred, R. A.,
Wang, H.,
Mellor, S. L.,
Cunha, G. R.,
and Risbridger, G. P.
(2001)
Dev. Biol.
237,
145-158[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Ball, E. M.,
and Risbridger, G. P.
(2001)
Dev. Biol.
238,
1-12[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Zhao, H.,
Patra, A.,
Tanaka, Y.,
Li, L. C.,
and Dahiya, R.
(2002)
Biochem. Biophys. Res. Commun.
294,
464-469[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Zheng, J.,
and Gao, W.-Q.
(2000)
Nat. Neurosci.
3,
580-586[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Chung, L. W.,
and Cunha, G. R.
(1983)
Prostate
4,
503-511[Medline]
[Order article via Infotrieve]
|
| 43.
|
Zheng, J.,
Shou, J.,
Guillemot, F.,
Kageyama, R.,
and Gao, W.-Q.
(2000)
Development
127,
4551-4560[Abstract]
|
| 44.
|
Shou, J.,
Ross, S.,
Koeppen, H.,
de Sauvage, FJ.,
and Gao, W.-Q.
(2001)
Cancer Res.
61,
7291-7297[Abstract/Free Full Text]
|
| 45.
|
Shou, J.,
Soriano, R.,
Hayward, S.,
Cunha, G.,
Williams, P.,
and Gao, W.-Q.
(2002)
Proc. Natl. Acad. Sci. (U. S. A.)
99,
2830-2835[Abstract/Free Full Text]
|
| 46.
|
Lu, L. H.,
and Gillett, N. A.
(1994)
Cell Vision
1,
169-176
|
| 47.
|
Lipschutz, J. H.,
Foster, B. A.,
and Cunha, G. R.
(1997)
Prostate
32,
35-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Hynes, M.,
Porter, J.,
Chiang, C.,
Chang, D.,
Tessier-Lavigne, M.,
Beachy, P.,
and Rosenthal, A.
(1995)
Neuron
15,
35-44[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Williams, R.,
Stapleton, A.,
Yang, G.,
Truong, L.,
Rogers, E.,
Timme, T.,
Wheeler, T.,
Scardino, P.,
and Thompson, T.
(1996)
Clin. Cancer Res.
2,
635-640[Abstract]
|
| 50.
|
Carpenter, D.,
Stone, D. M.,
Brush, J.,
Ryan, A.,
Armanini, M.,
Frantz, G.,
Rosenthal, A.,
and de Sauvage, F. J.
(1998)
Proc. Natl. Acad. Sci. (U. S. A.)
95,
13630-13634[Abstract/Free Full Text]
|
| 51.
|
McMahon, A.,
Ingham, P.,
and Tabin, C.
(2003)
Curr. Top. Dev. Biol.
53,
1-114[Medline]
[Order article via Infotrieve]
|
| 52.
|
Kooistra, A.,
Konig, J.,
Keizer, D.,
Romijn, J.,
and Schroder, F.
(1995)
Prostate
26,
123-132[Medline]
[Order article via Infotrieve]
|
| 53.
|
Lamm, M. L.,
Podlasek, C. A.,
Barnett, D. H.,
Lee, J.,
Clemens, J. Q.,
Hebner, C. M.,
and Bushman, W.
(2001)
Dev. Biol.
232,
301-314[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Wallace, V.
(1999)
Curr. Biol.
9,
445-448[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Wechsler-Reya, R.,
and Scott, M.
(1999)
Neuron
22,
103-114[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Yu, J.,
Carroll, T.,
and McMahon, A.
(2002)
Development
129,
5301-5312[Abstract/Free Full Text]
|
| 57.
|
van den Brink, G.,
Hardwick, J.,
Tytgat, G.,
Brink, M.,
Ten Kate, F.,
Van Deventer, S.,
and Peppelenbosch, M.
(2001)
Gastroenterology
121,
317-328[CrossRef][Medline]
[Order article via Infotrieve]
|
| 58.
|
Hebrok, M.,
Kim, S. K.,
and Melton, D. A.
(1998)
Genes Dev.
12,
1705-1713[Abstract/Free Full Text]
|
| 59.
|
Hebrok, M.,
Kim, S.,
St Jacques, B.,
McMahon, A.,
and Melton, D.
(2000)
Development
127,
4905-4913[Abstract]
|
| 60.
|
Grapin-Botton, A.,
Majithia, A.,
and Melton, D.
(2001)
Genes Dev.
15,
444-454[Abstract/Free Full Text]
|
| 61.
|
Hynes, M.,
Stone, D.,
Dowd, M.,
Pitts-Meek, S.,
Goddard, A.,
Gurney, A.,
and Rosenthal, A.
(1995)
Neuron
19,
15-26
|
| 62.
|
Roelink, H.,
Augsburger, A.,
Heemskerk, J.,
Korzh, V.,
Norlin, S.,
Ruiz i Altaba, A.,
Tanabe, Y.,
Placzek, M.,
Edlund, T.,
Jessell, T. M.,
and Dodd, J.
(1994)
Cell
76,
761-775[CrossRef][Medline]
[Order article via Infotrieve]
|
| 63.
|
Morgan, B.,
Orkin, R.,
Noramly, S.,
and Perez, A.
(1998)
Dev. Biol.
201,
1-12[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
Lamm, M.,
Catbagan, W.,
Laciak, R.,
Barnett, D.,
Hebner, C.,
Gaffield, W.,
Walterhouse, D.,
Iannaccone, P.,
and Bushman, W.
(2002)
Dev. Biol.
249,
349-366[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
Bellusci, S.,
Furuta, Y.,
Rush, M.,
Henderson, R.,
Winnier, G.,
and Hogan, B.
(1997)
Development
124,
53-63[Abstract]
|
| 66.
|
Pepicelli, C.,
Lewis, P.,
and McMahon, A.
(1998)
Curr. Biol.
8,
1083-1086[CrossRef][Medline]
[Order article via Infotrieve]
|
| 67.
|
Zhou, L.,
Dey, C.,
Wert, S.,
and Whitsett, J.
(1996)
Dev. Biol.
175,
227-238[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Zhang, J.,
Rosenthal, A.,
de Sauvage, F.,
and Shivdasani, R.
(2001)
Dev. Biol.
229,
188-202[CrossRef][Medline]
[Order article via Infotrieve]
|
| 69.
|
Sung, S.,
and Chung, L.
(2002)
Differentiation
70,
506-521[CrossRef][Medline]
[Order article via Infotrieve]
|
| 70.
|
Cunha, G. R.,
Chung, L. W.,
Shannon, J. M.,
and Reese, B. A.
(1980)
Biol. Reprod.
22,
19-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 71.
|
Chung, L. W.
(1995)
Cancer Surv.
23,
33-42[Medline]
[Order article via Infotrieve]
|
| 72.
|
Olumi, A. F.,
Grossfeld, G. D.,
Hayward, S. W.,
Carroll, P. R.,
Tlsty, T. D.,
and Cunha, G. R.
(1999)
Cancer Res.
59,
5002-5011[Abstract/Free Full Text]
|
| 73.
|
Hayward, S. W.,
Wang, Y.,
Cao, M.,
Hom, Y. K.,
Zhang, B.,
Grossfeld, G. D.,
Sudilovsky, D.,
and Cunha, G. R.
(2001)
Cancer Res.
61,
8135-8142[Abstract/Free Full Text]
|
| 74.
|
Hayward, S. W.,
Cunha, G. R.,
and Dahiya, R.
(1996)
Ann. N. Y. Acad. Sci.
784,
50-62[Medline]
[Order article via Infotrieve]
|
| 75.
|
Hayward, S. W.,
Rosen, M. A.,
and Cunha, G. R.
(1997)
Br. J. Urol.
79,
18-26
|
| 76.
|
Wong, Y.,
and Tam, N.
(2002)
Differentiation
70,
633-645[CrossRef][Medline]
[Order article via Infotrieve]
|
| 77.
|
Shannon, J. M.,
and Cunha, G. R.
(1984)
Biol. Reprod.
31,
175-183[Abstract]
|
| 78.
|
Wolk, A.,
Mantzoros, C. S.,
Andersson, S. O.,
Bergstrom, R.,
Signorello, L. B.,
Lagiou, P.,
Adami, H. O.,
and Trichopoulos, D.
(1998)
J. Natl. Cancer Inst.
90,
911-915[Abstract/Free Full Text]
|
| 79.
|
Khandwala, H. M.,
McCutcheon, I. E.,
Flyvbjerg, A.,
and Friend, K. E.
(2000)
Endocr. Rev.
21,
215-244[Abstract/Free Full Text]
|
| 80.
|
Alvarez, J.,
Sohn, P.,
Zeng, X.,
Doetschman, T.,
Robbins, D.,
and Serra, R.
(2002)
Development
129,
1913-1924[Abstract/Free Full Text]
|
| 81.
|
Kim, I.,
Ahn, H.,
Zelner, D.,
Shaw, J.,
Lang, S.,
Kato, M.,
Oefelein, M.,
Miyazono, K.,
Nemeth, J.,
Kozlowski, J.,
and Lee, C.
(1996)
Clin. Cancer Res.
2,
1255-1261[Abstract]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Yu, J. Gipp, J. W. Yoon, P. Iannaccone, D. Walterhouse, and W. Bushman
Sonic Hedgehog-responsive Genes in the Fetal Prostate
J. Biol. Chem.,
February 27, 2009;
284(9):
5620 - 5629.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Zhu, K. Fukada, H. Zhu, and N. Kyprianou
Prohibitin and Cofilin Are Intracellular Effectors of Transforming Growth Factor {beta} Signaling in Human Prostate Cancer Cells.
Cancer Res.,
September 1, 2006;
66(17):
8640 - 8647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Gao, K. Ishii, J. Mirosevich, S. Kuwajima, S. R. Oppenheimer, R. L. Roberts, M. Jiang, X. Yu, S. B. Shappell, R. M. Caprioli, et al.
Forkhead box A1 regulates prostate ductal morphogenesis and promotes epithelial cell maturation
Development,
August 1, 2005;
132(15):
3431 - 3443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gutierrez-Frias, R. Sacedon, C. Hernandez-Lopez, T. Cejalvo, T. Crompton, A. G. Zapata, A. Varas, and A. Vicente
Sonic Hedgehog Regulates Early Human Thymocyte Differentiation by Counteracting the IL-7-Induced Development of CD34+ Precursor Cells
J. Immunol.,
October 15, 2004;
173(8):
5046 - 5053.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sanchez, A. M. Hernandez, B. Stecca, A. J. Kahler, A. M. DeGueme, A. Barrett, M. Beyna, M. W. Datta, S. Datta, and A. Ruiz i Altaba
Inhibition of prostate cancer proliferation by interference with SONIC HEDGEHOG-GLI1 signaling
PNAS,
August 24, 2004;
101(34):
12561 - 12566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Saika, Y. Muragaki, Y. Okada, T. Miyamoto, Y. Ohnishi, A. Ooshima, and W. W.-Y. Kao
Sonic Hedgehog Expression and Role in Healing Corneal Epithelium
Invest. Ophthalmol. Vis. Sci.,
August 1, 2004;
45(8):
2577 - 2585.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Fan, C. V. Pepicelli, C. C. Dibble, W. Catbagan, J. L. Zarycki, R. Laciak, J. Gipp, A. Shaw, M. L. G. Lamm, A. Munoz, et al.
Hedgehog Signaling Promotes Prostate Xenograft Tumor Growth
Endocrinology,
August 1, 2004;
145(8):
3961 - 3970.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-D. Wang, J. Shou, P. Wong, D. M. French, and W.-Q. Gao
Notch1-expressing Cells Are Indispensable for Prostatic Branching Morphogenesis during Development and Re-growth Following Castration and Androgen Replacement
J. Biol. Chem.,
June 4, 2004;
279(23):
24733 - 24744.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|