|
Advertisement | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 278, Issue 22, 20006-20012, May 30, 2003
Proteins Homologous to p47phox and p67phox Support Superoxide Production by NAD(P)H Oxidase 1 in Colon Epithelial Cells* ![]() ![]() ||
From the
Received for publication, February 5, 2003 , and in revised form, March 24, 2003.
Superoxide production by phagocytes involves activation of a multi-component NADPH oxidase. Recently, several homologues of the catalytic component of the phagocyte oxidase, gp91phox, were identified in various tissues. Here we describe two proteins, p41 and p51, with significant homology to two cytosolic components of the phagocytic oxidase, p47phox and p67phox. Like p47phox, p41 contains an amino-terminal Phox homology domain, two SH3 domains, and a conserved carboxyl-terminal, proline-rich motif. Similarly, p51 is homologous to p67phox, containing four amino-terminal tetratrico-peptide repeats, a conserved "activation domain" motif, a PB1 domain, and a carboxyl-terminal SH3 domain. The highest levels of p41 transcript are detected in the colon and in other gastrointestinal tissues that express Nox1, the predominant gp91phox homologue in these tissues. In contrast, the p51 transcript showed a more widespread expression pattern, suggesting that it may support other tissue-specific oxidases. Mouse colon in situ hybridization detected both transcripts in the epithelial cells of colon crypts. Heterologous co-expression of p41 and p51 significantly enhances the superoxide-generating activity of Nox1-expressing cells; thus, p41 and p51 appear to be novel regulators of Nox1. These proteins also support the activity of gp91phox, albeit at much lower levels than the cytosolic phox counterparts. Our results suggest colon epithelial cells contain a multi-component NAD(P)H oxidase with a molecular architecture similar to the phagocytic oxidase.
Neutrophils and other circulating phagocytic cells are recognized for their unique capacity for robust reactive oxidant generation. This activity is attributed to a phagocyte-specific NADPH oxidase (phox), which serves as an effective microbicidal system (1). Patients with deficient phox activity suffer from chronic granulomatous disease, an inherited disease characterized by enhanced susceptibility to microbial infections due to the absence of or defects in any one of several essential phagocyte oxidase components (1, 2). The phox system is subject to tight regulation, as it is dormant in resting cells and becomes activated in response to infectious or inflammatory stimuli. This involves the coordinated translocation of several phosphorylated cytosolic phox factors, as well as the activation of the small GTPase Rac2, which assemble in a membrane-bound complex with flavocytochrome b558 (1). Recently, several oxidases have been identified in other tissues, based on their homology to the catalytic core component of the flavocytochrome, gp91phox (3, 4, 5, 6, 7, 8). These novel enzymes are proposed to serve a variety of functions, including oxygen sensing, hormone biosynthesis, and signal transduction affecting vasoregulation, cellular proliferation, senescence, and apoptosis; however, little is known about the factors that influence the oxidative output of these related Nox family oxidases. The thyroid and lymphoid oxidases contain multiple calcium-binding EF-hands, consistent with their apparent activation by calcium signals (5, 6, 8). The renal oxidase, Nox4 or Renox, produces measurable amounts of superoxide and induces cellular senescence when heterologously expressed in transfected NIH-3T3 cells, suggesting that this enzyme may be constitutively active, consistent with its proposed role in oxygen sensing (4, 7). In contrast, the colon-specific oxidase, Nox1, appears to be a low-activity enzyme when ectopically expressed (3). Nox1 exhibits functional similarities to the phagocyte oxidase, as it restores differentiation- and activation-dependent superoxide production when transduced into gp91phox-deficient myeloid cell models, indicative of a capacity to cross talk with other phox components.1 Furthermore, co-expression of two cytosolic phox components, p47phox and p67phox, augments Nox1 activity in an activation-dependent manner. These observations demonstrate a significant level of functional homology (cofactor-dependence and regulated superoxide production) between Nox1 and its closest relative, gp91phox, raising the interesting possibility that Nox1 may function as a multi-component, phox-like oxidase in differentiated colon cells. Based on these findings, we searched for candidate phox-like proteins as potential functional partners of Nox1. Here we identify two novel proteins that have significant structural homology to p47phox and p67phox and that are capable of supporting Nox1 activity.
Sequence AnalysisWe performed initial data base searches in the non-redundant peptide sequence data base of GenBankTM using the protein sequences of p47phox and p67phox as query sequences. The following IMAGE clones were identified and obtained from Research Genetics: the human p41 cDNA (4661469), the mouse p41 cDNA (6399072), the mouse p51 cDNA (4988389), and the human p51 cDNA (5197877). The full coding sequence for human p51 cDNA was amplified from human kidney cDNA using Advantage 2 polymerase (Clontech) and primers designed from IMAGE clone 5197877 (5' primer: ATGGCCTCTCTGGGGGACCT; 3' primer: GCATCATTAGGGCTGATCTCCCTG). We conducted additional nucleotide BLAST searches in the data base of expressed sequence tags (dbEST) to identify other homologous EST entries, verifying the results of direct sequence analysis. Northern Blot and in Situ HybridizationFor the human p41 mRNA detection, human multiple-tissue (2 µg of poly(A)+ RNA) and gastrointestinal tissue (1 µg of poly(A)+ RNA) Northern blot membranes (Clontech) were probed at 65 °C with a randomly radiolabeled p41 cDNA fragment (Amersham Biosciences), following standard hybridization methods. For detection of the mouse p51 mRNA, mouse multiple tissue Northern blot membranes containing 2 µg of poly(A)+ RNA/lane (Clontech) were hybridized with a randomly radiolabeled p51 cDNA fragment. For the analysis of Nox1-transfected fibroblasts, total RNA was prepared from 107 cells (15 µg), electrophoretically separated on a 1% agarose formaldehyde gel, and transferred to nylon membrane. Membranes were probed at 55 °C with a randomly radiolabeled human Nox1 cDNA fragment (Amersham Biosciences) by standard hybridization protocols. For in situ hybridization on mouse colon sections, mouse p41 and p51 cDNAs were used as templates. Single-stranded, [35S]UTP-labeled RNA transcripts (sense or antisense riboprobes) were synthesized by T3, T7, or SP6 RNA polymerases, using linearized vector templates. The probing of mouse colon tissue was performed according to the protocol described at intramural.nimh.nih.gov/lcmr/snge/Protocols/ISHH/ISHH.html. Exposed silver grains from autoradiography were visualized with dark-field optics and were photographed using a red filter to contrast with superimposed Giemsa-stained, bright-field images of the same sections. Cell Culture and Cell Transfection and TransductionFor expression studies, the complete coding sequence of human Nox1, p41, and p51 were subcloned into pcDNA3.1+ (Invitrogen). NIH-3T3 fibroblasts and Caco2 adenocarcinoma cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, penicillin (100 units/ml), streptomycin (100 µg/ml), and sodium pyruvate (1 mM). For establishment of Nox1-expressing NIH-3T3 cell line, fibroblasts were transfected at 6070% confluence, with pcDNA3.1-Nox1 or the empty pcDNA3.1 vector (Invitrogen) using the Geneporter (Gene Therapy Systems) transfection reagent (3 µg plasmid DNA and 20 µl of Geneporter/300,000500,000 cells). Cells were selected with G418 (2 mg/ml) 48 h post-transfection, and individual resistant colonies were isolated 7 days later. In transient expression experiments, Caco2 cells and Nox1-NIH-3T3 fibroblasts were transfected with either pcDNA3.1-p41, pcDNA3.1-p51, or the combination of the two plasmids using the Geneporter transfection reagent. K562 cells expressing gp91phox were established using MFG-S-gp91phox retrovirus, as described (9), and were then transiently transfected with the human pcDNA3.1-p41 and pcDNA3.1-p51 plasmids (30 µg DNA/10 million cells) by electroporation (10). Superoxide production by transfected cells was analyzed 2466 h after transfection. In control experiments, mock transfections using Geneporter alone or control (empty) vector had no significant effect on oxidant release by these cells. Measurement of Superoxide ProductionSuperoxide production by Caco2, NIH-3T3, and K562 cells was measured by chemiluminescence using DIOGENES (National Diagnostics), a superoxide-specific chemiluminescence reagent. Adherent cells were trypsinized and washed twice in 1x Hank's balanced solution with Ca2+ and Mg2+. Measurements were performed in 96-well microtiter chemiluminescence plates (5 x 105 cells/well) at 37 °C over a time course of 1 h using a Luminoskan luminometer (Labsystems). The net integrated light units recorded from these reactions (adjusted to account for the low luminescence observed in mock-transfected cells) were shown to be sensitive to superoxide dismutase.
Using the BLAST search algorithm, we identified a novel protein sequence in the non-redundant protein data base of GenBankTM deposited by the Human Genome Project that showed significant homology to p47phox (BC015917 [GenBank] ). Based on its predicted sequence, we named this protein p41 (calculated molecular mass of 41 kDa). A subsequent BLAST search of the Human Genome Data base, using the p41 nucleotide sequence as a query, indicated that the corresponding gene is located on chromosome 16 (16p13.3). The corresponding IMAGE clone (4661469) was obtained and sequenced; the predicted open reading frame encodes a 370-amino acid protein with 27% sequence identity and 46% sequence similarity to human p47phox (Fig. 1A). A full coding murine sequence homologous to the human cDNA was identified by a Blast search in the data base of expressed sequence tags (BQ935073 [GenBank] ); the predicted mouse protein has 66% identity with the human p41nox sequence. Although the overall homology between p47phox and p41 is relatively low, p41 shares remarkable structural similarities with its phagocytic counterpart (Fig. 1B). It contains an amino-terminal PX-domain, followed by two tandem SH3-domains. The protein also has a carboxyl-terminal proline-rich sequence motif (320-PPPTVPTRPSP-332) that could serve as a SH3 domain-binding sequence. The homologous proline-rich motif near the carboxyl terminus of p47phox was shown to interact with the carboxyl-terminal SH3 domain of p67phox (10, 11). Aside from these remarkable similarities, there are several notable differences between these proteins. For example, p47phox contains several serine residues within a polybasic, carboxyl-terminal region ("auto-inhibitory" domain) that were identified as phosphorylation sites that regulate assembly of the phagocytic NAD(P)H oxidase complex (12). Most of these serine residues and their flanking sequences are absent in p41. The PX domain of p47phox contains a PXXP motif at position 7376 that is conserved in several other PX domain sequences and was proposed to participate in an intra-molecular interaction with the carboxyl-terminal SH3 domain of p47phox (13). The PXXP sequence motif is absent in the p41 PX domain.
In Northern blotting experiments, p41 mRNA was detected as a 1.6-kb signal in the colon and the small intestine (Fig. 2A). In other blotting experiments that probed a human gastrointestinal mRNA panel, the p41 transcript was detected in the ileocecal region, the cecum, and the ascending, transverse, and descending colon. When this RNA panel was re-probed with a Nox1-specific probe, a very similar expression pattern was observed (Fig. 2B). Previous experiments in our laboratory indicated that Nox1 is expressed in the epithelial cells of the mouse colon.1 In situ hybridization experiments with fixed mouse colon sections revealed that p41 mRNA is also abundant within epithelial cells of the colon crypts (Fig. 2C).
To explore the possible interaction between Nox1 and p41, we expressed p41 in a K562 erythroleukemia cell line that was previously transduced for Nox1 expression. The co-expression of p41 and Nox1 did not result in any detectable change in superoxide production in these cells. In other experiments, we co-expressed p41, p67phox, and Nox1 in K562 cells and observed a small detectable increase in superoxide output (data not shown). The relatively low stimulatory effect of p41 on the superoxide-producing activity of Nox1 prompted us to search for proteins homologous to p67phox that could interact with p41. Using the p67phox protein sequence as a query sequence to screen the non-redundant peptide sequence data base in GenbankTM, we identified a sequence homologous to the carboxyl-terminal portion of p67phox that was described as a human colon tumor-specific antigen (NY-CO-31), recognized by autologous antibodies in colon cancer patients (14). Subsequent homology searches with the NY-CO-31 sequence identified larger mouse (BG967340 [GenBank] , IMAGE 4988389) and human EST clones (BI753839 [GenBank] , IMAGE 5197877) with more extended homology with p67phox. The mouse EST clone was obtained and sequenced. The open reading frame translates into a 444-amino acid protein with 27% identity and 40% similarity to p67phox (Fig. 3A). The human EST appears to contain an intronic sequence that was not observed in any other deposited sequence in dbEST. The open reading frame of the human sequence was amplified from kidney cDNA using primers derived from IMAGE clone 5197877. This cDNA matches other EST sequences and translates into a 476-amino acid protein with 38% sequence identity and 56% sequence similarity to human p67phox. The mouse and human p51 protein sequences are only 60% identical. We named this protein p51, based on the calculated molecular mass of the human p67phox homologue. These proteins exhibit the most remarkable structural conservation with domains in p67phox shown to be involved in interactions with other phox components (Fig. 3); this includes four amino-terminal tetratrico-peptide repeats (TPR)2 that interact with Rac, a carboxyl-terminal SH3 domain that interacts with p47phox, and a sequence homologous to the activation domain motif of p67phox (residues 199210) that participates in activation of the phox system (15). Both the human and murine proteins lack sequences homologous to the central SH3 domain of p67phox. Murine p51 lacks additional flanking sequences within central regions of human p51; its PB1 domain also appears to be less conserved, because its homology to the PB1 domain of p67phox was not detected in BLAST searches.
The expression pattern of p51 was first examined by Northern blotting of several mouse tissues. Compared with the expression pattern of p41, the p51 mRNA was more widely detected in various tissues. The p51 transcript was not only detected in mouse colon, uterus, prostate, small intestine, and stomach, tissues where Nox1 expression has been documented (3, 16), but also in lung, thyroid, and salivary glands (Fig. 4A). In situ hybridization experiments on mouse colon sections revealed an expression pattern that is indistinguishable from that of p41, suggesting that the two proteins might act together with Nox1 in colon epithelial cells (Fig. 4B). We also detected the p51 mRNA in the human colon by Northern blot and reverse transcription-PCR, although kidney and liver were also positive for the human p51 mRNA (data not shown). Interestingly, although the human colon expresses high levels of Nox1 and p41 mRNA, the expression level of p51 was comparatively low, suggesting that this gene product may be a limiting factor in activation of the colon oxidase.
To study their possible interactions with Nox1, we transfected p41 and p51 in Caco2 colon epithelial adenocarcinoma cells, which express the endogenous Nox1 mRNA (3).1 As shown in Fig. 5A, neither p41 nor p51 stimulate significant superoxide production when expressed alone; however, we observed a significant increase in superoxide production when both proteins were present in these Nox1-expressing cells. The overall yield of superoxide in these reconstituted cells was not dependent on PMA stimulation. In other experiments, we co-transfected p41 and p51 into NIH-3T3 fibroblasts that were previously transfected with the human Nox1 cDNA (Fig. 5B). The co-expression of p41 and p51 resulted in significantly enhanced superoxide production, similar to that observed in Caco2 cells, although the activity reconstituted in NIH-3T3 cells was remarkably dependent on PMA stimulation. These experiments confirmed that p41 and p51 interact with Nox1 to form a functional NAD(P)H oxidase complex. We also co-expressed p41 and p51 in mixed pairs with their phagocytic counterparts, p47phox and p67phox, to determine whether these homologous proteins could also support Nox1 activity. Significantly lower levels of oxidase activity were reconstituted when the colon isoforms were co-expressed in combination with the phox proteins, or when both cytosolic phox proteins were expressed in place of p41 and p51 (Fig. 5B). These reconstitution experiments, together with the observed expression patterns, clearly indicate that p41 and p51 are natural functional partners of Nox1 in colon epithelial cells that together form an active colon oxidase.
Reciprocal experiments were also conducted to examine whether p41 and p51 could support the activity of gp91phox. For this purpose, p41 and p51 or their phagocytic counterparts were co-transfected in K562 cells that were previously transduced for high gp91phox expression. Fig. 5C shows that co-expression of p47phox and p67phox restored comparatively higher levels of oxidase activity in these cells. In contrast, the activities supported by p41 and p51 together or as mixed pairs with the phox isoforms were significantly lower (<1%) than the "complete" phox system, again indicative of a considerable functional divergence between the human colon and phagocytic oxidase systems. In all cases the reconstituted activity of gp91phox in these cells was dependent on PMA stimulation.
Reactive oxygen species production by phagocytic cells has a well established role in the arsenal of antimicrobial systems of the innate immune system. The multi-component nature of the phox system offers several features for the tight regulation of toxic oxidant production by phagocytes, which is considered essential for the targeted killing of invading microbes. In the past two years, several new homologues of gp91phox, the catalytic core of the phagocytic oxidase, have been described due in part to the rapid growth of nucleic acid sequence databases (3, 4, 5, 6, 7, 8). These homologues, now known as members of the Nox/Duox family of NAD(P)H oxidases, all contain highly conserved structural elements considered necessary for the transport of electrons from the cytosol, through the membrane, to molecular oxygen. These include carboxyl-terminal sequence motifs involved in binding of flavin and NAD(P)H and four conserved histidines that co-ordinate two heme adducts within transmembrane domains (17). These phox homologues are proposed to serve diverse roles, such as hormone biosynthesis, oxygen sensing, growth factor signaling, apoptosis, and fertilization (3, 4, 5, 6, 7, 8). The first homologue to be recognized, Nox1, is a colon-specific oxidase that was implicated in the regulation of cell proliferation (3, 15, 18). The identification of a novel source of reactive oxygen species in the colon epithelium is an important finding, as reactive oxygen species production in this organ could have roles in the pathogenesis of inflammatory bowel disease and colon cancer. Nox1 causes increased cell proliferation when ectopically expressed in NIH-3T3 fibroblasts, and these Nox1-transfected cells induce tumor formation in nude mice (3, 18). The study suggested that Nox1 is a constitutively active enzyme with low-level superoxide output. In contrast, we recently obtained evidence that Nox1 could interact with cytosolic components of the phagocytic oxidase when expressed in gp91phox-deficient PLB-985 cells and K562 cells. Thus, the reconstituted Nox1 can function as a regulated and activated oxidase complex.1 The functional interactions between Nox1, p47phox, and p67phox suggest close similarities between the phagocyte and colon enzymes. This prompted us to search for colon-specific homologues of p47phox and p67phox. In this report, we identified and characterized two proteins, p41 and p51, that have considerable homology to the p47phox and p67phox cytosolic components of the phagocytic oxidase and that appear to support the activity of Nox1. While this manuscript was in preparation, Banfi et al. (19) also described the murine homologues of these proteins, which were designated as NOXO1 (p41) and NOXA1 (p51) for Nox organizer 1 and Nox activator 1, respectively. Although p41 exhibits significant structural similarity to p47phox in terms of size and conserved domain structure, we noted several important differences between the two proteins that could have important functional consequences. The absence of multiple, conserved serine residues in the carboxyl terminus of p41 suggests that direct, protein kinase C-mediated phosphorylation of this protein does not play a role in the regulation of p41 function. Several reports suggest that p47phox exists in an inhibited state under resting conditions (10, 11, 13, 20) and that this conformation is stabilized through intramolecular interactions between the central SH3 domains and proline-containing motifs within the amino-terminal PX-domain and the polybasic, carboxyl-terminal domain. It has been proposed that phosphorylation on the carboxyl-terminal serine residues during phagocyte stimulation releases these intramolecular interactions within p47phox and enables SH3 domain interactions with the proline-rich carboxyl terminus of p22phox (10, 11). Two structural differences between p47phox and p41 suggest that an auto-inhibited conformation involving intramolecular SH3 domain contacts is not assumed by p41: (i) the PXXP motif present in the PX domain of several proteins is absent in p41, and (ii) most of the phosphorylated serine residues in the carboxyl-terminal portion, as well as flanking sequences within the polybasic, auto-inhibitory domain of p47phox (residues 299340) are absent. Interestingly, sequence homologous to p47phox residues 318329 (RLSQDAYRRNRSV), shown to be involved in interactions with p67phox and the flavocytochrome b (21, 22), is retained in the carboxyl-terminal domain of human p41 (residues 293304: LLSGTGFRGGDD). These observations suggest that p41 adopts an "open" conformation under resting conditions and that regulation of p41 is achieved by other mechanisms. When expressed together with p67phox in Nox1-transfected cells, we observed only a moderate stimulatory effect of p41 on superoxide production. This low efficiency observed with proteins combined from the two oxidase systems prompted us to search the nucleic acid databases for colon-specific homologues of p67phox. Using the deposited sequence information about a cloned tumor antigen, we were able to identify both mouse and human homologues of p67phox. Similar to p67phox, p51 contains four amino-terminal TPR repeats and a carboxyl-terminal SH3 domain preceded by a PB1 domain. Both p67phox homologues also contain a short stretch of conserved amino acids immediately following the TPR repeats, which is homologous to the activation domain in p67phox (15, 23) thought to interact with the flavocytochrome b558 complex. p67phox contains another central SH3 domain between amino acids 243 and 298, which is not present in human or murine p51. Previous studies (10, 24, 25) on protein interactions of p67phox allow some speculation about the possible protein partners of p51. For example, the carboxyl-terminal SH3 domain has been shown to interact with the carboxyl-terminal proline-rich motif of p47phox. Because the structural elements necessary for this interaction are well conserved in p51 and p41, it is likely that a similar interaction occurs between these proteins and that the two exist in a complex. Furthermore, the presence of amino-terminal TPR motifs in p51 suggests that this protein interacts with Rac, as in p67phox (26, 27). The presence of PB1 domains in human and mouse p51 suggests that proteins containing the PC motif might be partners of p51. The mouse p51 sequence PB1 domain, however, is less conserved and human p51 lacks sequences homologous to the p67phox lysine residue 355 that was shown to be critical for its interaction with the PC motif of p40phox, suggesting that p40phox is not a regulator of the colon oxidase. Finally, we observed significant structural differences in the C-terminal sequences of human and mouse p51 and p67phox. Neither p51 sequence is entirely hydrophobic; an association of these tail sequences with the membrane, as suggested recently (19), seems unlikely. Both the expression patterns and our transfection studies with the human p41 and p51 suggest that these proteins are uniquely adapted to function in concert with Nox1 in colon epithelial cells. These proteins together reconstituted high levels of "constitutive" (i.e. PMA-independent) activity in Caco2 colon epithelial cells, as was recently demonstrated when the murine forms were heterologously expressed in HEK293 cells (19). In contrast to the murine proteins, however, we demonstrated in some settings (i.e. Nox1-expressing NIH-3T3 cells or gp91phox-expressing cells) that the activity supported by the human proteins is significantly enhanced by PMA stimulation. Future work should explore whether these differences in regulation reflect evolutionary differences in these proteins and whether the environment of differentiated colon epithelial cells renders this oxidase constitutively active. Our studies exploring the effects of co-expression of colon and phagocytic components demonstrated that the human proteins are less capable of functioning as mixed Nox/phox complexes than the murine proteins (19). Because the murine proteins were characterized in a different host system, it is possible that differences in host cell factors may account, in part, for this difference. It is nonetheless tempting to speculate that the significant structural differences in these proteins across species can account for this apparent functional divergence between the phox and Nox1 systems in man. Although both p41 and p51 are expressed in mouse and human colon, we also detected p51 mRNA in several other tissues and suspect that it might support the activity of other oxidases. In this regard, it is particularly intriguing that p51 is expressed in the thyroid gland, the salivary gland, and the lung, where Duox isoforms are present (5, 6, 28),3 and in the human kidney, which is the primary site of Nox4 (Renox) expression (4, 7). The close homology, as well as the functional similarities in the regulation of Nox1 and gp91phox activities by homologous components, raises the possibility that the colon oxidase has similar host defense functions as the phagocytic system. It is well known that the colon is inhabited by a plethora of microorganisms and must, therefore, maintain an effective epithelial barrier against invasion of the host. This proposed role of the colon oxidase in mucosal defense against these microorganisms is an exciting possibility that will require further investigation.
Note Added in ProofA consensus terminology for genes encoding p41 and p51 was recently established among several laboratories in this field: NOXO1(p41), for Nox organizer 1, and NOXA1(p51), for Nox activator 1.
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. || To whom correspondence should be addressed: Bldg. 10, Rm. 11N106, National Institutes of Health, Bethesda, MD 20892. Tel.: 301-402-5120; Fax: 301-402-4369; E-mail: tleto{at}nih.gov.
1 Geiszt, M., Lekstrom, K., Brenner, S., Hewitt, S. M., Dana, R., Malech, H. L. and Leto, T. L. (2003) J. Immunol., in press.
2 The abbreviations used are: TPR, tetratrico-peptide repeats; PMS, phorbol 12-myristate 13-acetate.
3 Geiszt, M., Witta, J., Baffi, J., Lekstrom, K., and Leto, T. L. (2003) FASEB J., in press.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||